WO2008154482A2 - Sirna compositions and methods of use in treatment of ocular diseases - Google Patents

Sirna compositions and methods of use in treatment of ocular diseases Download PDF

Info

Publication number
WO2008154482A2
WO2008154482A2 PCT/US2008/066298 US2008066298W WO2008154482A2 WO 2008154482 A2 WO2008154482 A2 WO 2008154482A2 US 2008066298 W US2008066298 W US 2008066298W WO 2008154482 A2 WO2008154482 A2 WO 2008154482A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sirna
sirna molecule
molecule comprises
sense strand
Prior art date
Application number
PCT/US2008/066298
Other languages
French (fr)
Other versions
WO2008154482A3 (en
Inventor
Patrick Y. Lu
Xiao-Ling Liang
Original Assignee
Sirnaomics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sirnaomics, Inc. filed Critical Sirnaomics, Inc.
Publication of WO2008154482A2 publication Critical patent/WO2008154482A2/en
Publication of WO2008154482A3 publication Critical patent/WO2008154482A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention provides compositions and methods for treatment of various ocular diseases using small interfering RNA (siRNA) mixtures containing a plurality of sequences targeting multiple disease causing genes.
  • siRNA small interfering RNA
  • the invention provides siRNA sequences targeting 1) viral genes expressed in ocular infections; 2) genes whose expression causes inflammation; and 3) genes whose expression promotes pro-angiogenesis activity.
  • ocular diseases There are variety of ocular diseases having unmet medical needs. Those diseases are ranging from infections, allergenic disorder, cardiovascular disorder and age related conditions. Many diverse ocular diseases are the result of excessive neovascularization (NV), an abnormal proliferation and growth of blood vessels within the eye.
  • NV neovascularization
  • the development of ocular NV itself has adverse consequences for vision but also is an early pathological step in many serious eye diseases; despite introduction of new therapeutic agents it remains the most common cause of permanent blindness in United States and Europe.
  • Several major eye diseases promote an abnormal neovascularization, which leads to further damage to the eyes causing loss of vision. Unfortunately, few treatment options exist for patients with any of these ocular NV diseases.
  • the most commonly used approved therapy is a photodynamic treatment, Visudyne, that uses light to activate a photosensitizer in the vicinity of the neovascularization to destroy unwanted blood vessels. It is not effective in many patients and cannot prevent recurrence even when it is effective.
  • a recently approved agent, Macugen provides some benefit but also is ineffective in most patients.
  • the intraocular administration of Macugen leads to irritation and risk of infection, both of which are adverse since they exacerbate the neovascularization pathology.
  • the ocular neovascularization diseases can be divided into diseases affecting the anterior, or front, of the eye and those affecting the posterior, or retinal, part of the eye. Development of NV at these different regions may have different origins, but the biochemical and physiological nature of the NV process appears to be virtually identical, regardless of eye region. Consequently, an effective means to intervene in the biochemical nature of ocular NV offers the prospect for providing an effective treatment for any ocular disease that involves ocular NV as the major pathology or as the underlying pathology, regardless of whether the disease afflicts the anterior or posterior of the eye. Nonetheless, the anterior and posterior ocular tissues differ considerably and these differences can have a dramatic influence on the most effective means to administer therapeutic treatments so that the tissue and cells are reached by the therapeutic agent.
  • ROP Retinopathy of prematurity
  • ROP is a potentially blinding eye disorder that primarily affects premature infants weighing about 2% pounds (1250 grams) or less that are born before 31 weeks of gestation (a full-term pregnancy has a gestation of 38-42 weeks).
  • This disorder which usually develops in both eyes — is one of the most common causes of visual loss in childhood and can lead to lifelong vision impairment and blindness.
  • ROP The most effective proven treatments for ROP are laser therapy or cryotherapy.
  • Laser therapy "burns away" the periphery of the retina, which has no normal blood vessels.
  • cryotherapy physicians use an instrument that generates freezing temperatures to briefly touch spots on the surface of the eye that overlie the periphery of the retina.
  • Both laser treatment and cryotherapy destroy the peripheral areas of the retina, slowing or reversing the abnormal growth of blood vessels.
  • the treatments also destroy some side vision. This is done to save the most important part of our sight — the sharp, central vision we need for "straight ahead" activities such as reading, sewing, and driving.
  • Both laser treatments and cryotherapy are performed only on infants with advanced ROP.
  • ROP treatment decreases the chances for vision loss, it does not always prevent it. Not all babies respond to ROP treatment, and the disease may get worse. If treatment for ROP does not work, a retinal detachment may develop. If the center of the retina or the entire retina detaches, central vision is threatened, and surgery may be recommended to reattach the retina.
  • the current methods of treatment of ROP are invasive surgeries, not able to prevent the disease getting worse and have potential long-term side effects.
  • PDR Proliferate Diabetic Retinopathy
  • PDR occurs when the tiny blood vessels providing oxygen to the retina become damaged. The damage allows blood and fluid to escape into the retina, and also results in new blood vessel growth. These new vessels are more fragile and frequently bleed into the vitreous region of the eye, interfering in vision. Patients with the most serious form of DR are at a substantial risk for severe visual loss without treatment.
  • neovascularization is a central pathology of the disease.
  • Diabetic retinopathy is the most common diabetic eye disease and a leading cause of blindness in American adults. In some people with diabetic retinopathy, blood vessels may swell and leak fluid. In other people, abnormal new blood vessels grow on the surface of the retina. The retina is the light-sensitive tissue at the back of the eye.
  • Scatter laser treatment helps to shrink the abnormal blood vessels. Physician places 1,000 to 2,000 laser burns in the areas of the retina away from the macula, causing the abnormal blood vessels to shrink. Because a high number of laser burns are necessary, two or more sessions usually are required to complete treatment. This treatment may cause some loss of the side vision, but can save the rest of sight. Scatter laser treatment may slightly reduce color vision and night vision. As we can see, the scatter laser treatment is still not ideal.
  • Age related macular degeneration (AMD):
  • AMD is the leading cause of blindness in people over 60 years and each year the problem becomes more acute. In AMD central vision is lost making it impossible to appreciate fine detail. Given the magnitude of the burden of AMD on individuals and society as a whole, it is perhaps surprising that more is not known of the causes of the disease and how it develops. It is clear, however, that the retinal pigment epithelium (RPE) plays a pivotal role. Abnormal waste material builds up beneath and within the RPE and RPE cells eventually die. The rods and cones in the retina depend for their survival upon normal functioning RPE and this RPE failure leads to progressive loss of vision. The disease provokes a scarring process at the back of the eye inducing formation of new blood vessels, neovascularization.
  • RPE retinal pigment epithelium
  • Rubeosis is a term that describes abnormal blood vessel growth on the iris and the structures in the front of the eye. Normally there are no visible blood vessels in these areas. When the retina has been deprived of oxygen, or is ischemic, as with diabetic retinopathy or vein occlusion, abnormal vessels form to supply oxygen to the eye. Unfortunately, the formation of these vessels obstructs the drainage of aqueous fluid from the front of the eye, causing the eye pressure to become elevated. This usually leads to neovascular glaucoma.
  • Uveitis is a broad group of diseases originating from inflammation of tissues on the inside of the eye. This disease is most commonly classified anatomically as anterior, intermediate, posterior or diffuse. Ocular complications of uveitis may produce profound and irreversible loss of vision, especially when unrecognized or treated improperly. The most frequent complications include cataract; glaucoma; retinal detachment; neovascularization of the retina, optic nerve, or iris and the like.
  • a related group of ocular diseases are the consequence of eye infections, including Conjunctivitis, Keratitis, Blepharitis, Sty, Chalazion and Iritis, again all major causes of ocular neovascularization that leads to vision loss.
  • Recurrent HSV infection is the most common infectious cause of corneal blindness in the U.S. This viral infection causes blinding lesions called stromal keratitis (SK). Corneal NV is an early step in vision loss from herpetic SK.
  • ocular tissues are in a continuous state of maintenance which often entails neovascularization.
  • ocular neovascularization becomes the major symptom and this abnormal physiological change is the key pathology required treatment.
  • This ocular neovascularization results in excessive growth of damaging new blood vessels, and it appears to be virtually identical regardless of the region of the eye and disease, although the originating cause of the pathology as well as the role in vision loss differs widely.
  • the commonality of the pathological process offers means to provide therapeutic interventions that are effective in these diverse diseases of the eye.
  • Herpes Simplex Virus type-1 infection can cause Herpetic Stromal Keratitis (HSK) which induces corneal neovascularization.
  • HSV Herpes Simplex Virus type-1 infection
  • the angiogenic factor production occurs initially from virus-infected corneal epithelial, non-inflammatory, cells followed by expression in a clinical phase from inflammatory cells (PMNs and macrophages) in the stroma.
  • PMNs and macrophages inflammatory cells
  • a mouse model of HSV induced corneal NV was developed by implantation of purified HSV viral DNA fragments (HSV DNA, rich in CpG motifs) or synthetic CpG oligonucleotides (CpG ODN).
  • HSV-I Hypoxia inducible factor- 1
  • HIF-I Hypoxia inducible factor- 1
  • HIF-I transactivates multiple genes whose products play key roles in oxygen homeostasis, including vascular endothelial growth factor (VEGF).
  • VEGF vascular endothelial growth factor
  • VEGF-mediated neovascularization and angiogenesis is one of the common pathological pathways of many ocular neovascularization diseases.
  • the VEGF-mediated angiogenesis pathway plays a central role in angiogenesis of all these NV-related eye diseases.
  • the VEGF family is composed of five structurally related growth factors: VEGF-A, Placenta Growth factor (PIGF), VEGF-B, VEGF-C, and VEGF-D.
  • VEGFR-I FIt-I
  • VEGFR-2 KDR or FIk-I
  • VEGFR-3 VEGFR-3
  • VEGF-A binds VEGFR-I and VEGFR-2 and is known to induce neovascularization and angiogenesis, as well as vascular permeability.
  • VEGFR- 1 and VEGFR-2 are both up-regulated in proliferating endothelium that may be a direct response to VEGF-A or hypoxia.
  • VEGFR-I has higher affinity to VEGF-A than VEGFR-2.
  • VEGFR-2 is responsible for angiogenic signals for blood vessel growth, but the function of VEGFR-I is poorly understood. Some studies suggested a direct role in transducing angiogenic signals, and roles in motility and permeability. This understanding of key players in the VEGF pathway of angiogenesis has led to studies with inhibitors of VEGF-A as candidate therapeutic agents, including Macugen® (an aptamer oligonucleotide inhibiting VEGF binding to its receptor) and Lucentis® (a monoclonal antibody against VEGF). While these studies in ocular angiogenesis, as well as in other angiogenesis diseases such as tumor growth, have validated the value of the VEGF pathway for clinical effect, the experimental agents are far from effective for many patients. It is clear that better inhibitors of the VEGF pathway are needed if we are to develop treatments for these major eye diseases.
  • Matrix metalloproteinases are a family of extracellular matrix-degrading enzymes associated with neovascularization. Matrix metalloproteinases (MMP)-2 and -9 play an important role in the pathogenesis of choroidal neovascularization (CNV).
  • CNV choroidal neovascularization
  • RPE Retinal pigment epithelial cells
  • MMP-2 secretion was also increased by stimulation with VEGF, but not bFGF.
  • MMP-2 activity compromises retinal pericyte survival possibly through MMP-2 action on ECM proteins and/or direct association of MMP-2 with integrins, which promotes apoptosis/anoikis by loss of cell contact with an appropriate ECM.
  • pshRNA shRNA
  • two plasmids were generated encoding shRNA (pshRNA) targeted against two distinct MMP-9 gene sequences. Transfection of these pshMMP-9s have shown specific inhibition of MMP-9 expression both in vivo and in vitro. In vivo delivery of pshMMP- 9 subconjunctivally was also effective at inhibiting MMP-9 protein expression in the mouse cornea. Delivery of the pshMMP-9 stopped angiogenesis and decreased the severity of herpetic stromal keratitis. Therefore, we strongly believe that MMP-2 and MMP-9 should be another set of targets for anti-angiogenesis treatment.
  • alpha v beta 3 and alpha v beta 5 in the ocular angiogenic process.
  • PDR proliferative diabetic retinopathy
  • Fibroblast growth factors such as FGF-2 are potent mitogens for endothelial cells and induce their assembly into vascular-like structures in culture and in in vivo assays.
  • a study on FGF-2 functions during physiological vascularization are poorly documented has indicated that the major functions of FGF-2 at different early stages of physiological vascularization. Both the failure in hyaloid regression and the intense angiogenic invasion of endothelial cells into the retina may serve as a model for some related human ocular pathologies.
  • Expression of FGF-2 interestingly, resulted in beneficial therapeutic effect on herpetic SK progression via its role in wound healing.
  • EGF epithelial growth factor
  • PDGFR platelet-derived growth factor receptor alpha and beta
  • PIGF placenta growth factor
  • Inflammation is a process that involves many cells and biochemical factors, but despite its complexity the process is highly conserved across tissues.
  • One of the early events in inflammation is secretion of activating factors as a result of tissue hypoxia, damage, or other insults. These factors activate cells and induce recruitment of inflammatory cells into the tissue, which secrete additional activating factors.
  • One common biochemical pathway for induction of inflammation is secretion of TNF alpha and IL-lbeta, as well as up regulation of cyclooxygenase (COX)-2.
  • COX cyclooxygenase
  • RNA interference RNA interference
  • siRNA Small Interfering RNA
  • RNA interference is a sequence-specific RNA degradation process that provides a relatively easy and direct way to knockdown, or silence, theoretically any gene (11).
  • RNA interference a double stranded RNA is cleaved by an RNase IIMielicase protein, Dicer, into small interfering RNA (siRNA) molecules, a dsRNA of 19-23 nucleotides (nt) with 2-nt overhangs at the 3' ends.
  • siRNA small interfering RNA
  • RISC RNA-induced-silencing-complex
  • siRNA-directed endonuclease digests the RNA, thereby inactivating it.
  • Recent studies have revealed that the use of chemically synthesized 21-25-nt siRNAs exhibit RNAi effects in mammalian cells 20, and the thermodynamic stability of siRNA hybridization (at terminals or in the middle) plays a central role in determining the molecule's function.
  • target designate an siRNA molecule which is specifically complementary to a sequence on a target RNA molecule, and inactivates the target RNA molecule. While not wishing to bound by theory, the inactivation is thought to proceed through the RNAi mechanism described in this paragraph.
  • RNAi in mammalian cells in laboratory or potentially, in therapeutic applications, uses either chemically synthesized siRNAs or endogenously expressed molecules (24).
  • the endogenous siRNA is first expressed as a small hairpin RNAs (shRNAs) by an expression vector (plasmid or virus vector), and then processed by Dicer into siRNAs. It is thought that siRNAs hold great promise to be therapeutics for human diseases especially that caused by viral infections (27-30).
  • siRNA polynucleotide that is, with certainty, capable of specifically altering the expression of a given mRNA.
  • the present invention provides siRNA compositions directed toward RNA targets implicated in various diseases and pathologies of the eye. These include both virally induced diseases and a variety of spontaneous afflictions that affect mammalian eyes, especially the human eye.
  • the invention is also directed to methods of treatment of such diseases and pathologies using the compositions disclosed herein.
  • a mixture in a first aspect includes a plurality of small interfering RNA (siRNA) oligonucleotides and a pharmaceutical carrier, wherein each of the siRNA molecules targets an RNA molecule encoding a gene product whose activity promotes at least one of inflammation, neovascularization and angiogenesis in the eye arising in an ocular disease.
  • siRNA small interfering RNA
  • the ocular disease is selected from the group consisting of herpetic stromal keratitis, uveitis, rubeosis, conjunctivitis, keratitis, blepharitis, sty, chalazion, crizis, age-related macular degeneration, proliferate diabetic retinopathy and retinopathy of prematurity.
  • a targeted RNA molecule encodes a gene selected from the group consisting of herpesvirus essential genes, pro-inflammatory pathway genes, pro-angiogenesis pathway genes, pro-cell proliferation pathway genes, and viral infectious agent genome RNA, and viral infectious agent genes.
  • a component siRNA molecule targets an mRNA molecule, whereas in alternative embodiments a component siRNA molecule targets a viral RNA molecule.
  • the same siRNA targets mRNA molecules that encode orthologous human and mouse genes.
  • the mixture includes at least three siRNA molecules targeting a herpes virus UL5 gene, a herpes virus UL29 gene, and human and mouse matrix metalloproteinase (MMP) 9 gene (Table 23).
  • a mixture includes at least three siRNA molecules targeting human and mouse tumor necrosis factor alpha, interleukin- 1 beta, and cyclooxygenase-2 genes (Table 18).
  • a mixture includes at least three siRNA molecules targeting human and mouse vascular endothelial growth factor (VEGF)-A, VEGF receptor 1 and VEGF receptor 2 genes (Table 19).
  • VEGF vascular endothelial growth factor
  • a mixture includes at least three siRNA molecules targeting human and mouse VEGF receptor 2, VEGF A, and VEGF receptor 1 genes (Table 20). In yet an additional embodiment a mixture includes at least three siRNA molecules targeting human and mouse MMP-2, VEGF A, and VEGF receptor 1 genes (Table 22).
  • various mixtures include combinations of alternative choices of at least three siRNA molecules targeting human and mouse placenta growth factor (PIGF), VEGF A, and VEGF receptor 1 genes (Table 25).
  • PIGF human and mouse placenta growth factor
  • VEGF A vascular endothelial growth factor
  • VEGF receptor 1 genes Table 25.
  • a mixture includes at least four siRNA molecules targeting human and mouse PIGF, VEGF A, VEGF receptor 1, and basic fibroblast growth factor (b- FGF) genes (Table 25).
  • a mixture includes at least four siRNA molecules targeting human and mouse A-RAF, mTOR, hypoxia inducible factor- 1 (HIF-I) alpha, and integrin alpha V genes (Table 24).
  • a mixture includes at least three siRNA molecules targeting human and mouse A-RAF, mTOR, and HIF-I alpha genes (Table 24).
  • a mixture includes at least three siRNA molecules targeting human and mouse A-RAF, m TOR, and integrin receptor alpha V genes (Table 24).
  • a mixture includes at least four siRNA molecules targeting human and mouse PIGF 5 VEGF A, VEGF receptor 1, and VEGF receptor 2 genes (Table 25).
  • a mixture includes at least four siRNA molecules targeting human and mouse PIGF, VEGF A, VEGF B, and b-FGF genes (Table 25).
  • a mixture includes at least four siRNA molecules targeting human and mouse MMP-9, VEGF A, herpes virus UL5, and herpes virus UL29 genes (Table 23).
  • a targeted mRNA molecule includes a VEGF pathway gene, an FGF pathway gene, a protein kinase gene, a pro-angiogenesis gene, a proinflammatory gene, an endothelial cell proliferation gene, or a herpes simplex virus gene.
  • the pharmaceutical carrier of the mixture is selected from the group of a saline solution, sugars, polymer, lipid, or micelle solutions, and in more particular embodiments the carrier is selected from among a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, and a ligand functionalized-hydrophilic polymer grafted polymer.
  • the carrier includes a histidine-lysine copolymer which forms a nanoparticle with an siRNA molecule.
  • an siRNA molecule contains naturally occurring nucleotides, and in other embodiments an siRNA molecule includes one or more chemically modified nucleotides.
  • a method for treating ocular disease in a subject, wherein the disease is characterized at least in part by inflammation, neovascularization, and/or angiogenesis.
  • the method includes administering to the subject a mixture that includes a plurality of small interfering RNA (siRNA) oligonucleotides and a pharmaceutical carrier, wherein each of the siRNA molecules targets an RNA molecule encoding a gene product whose activity promotes at least one of inflammation, neovascularization and angiogenesis in the eye arising in an ocular disease of said subject.
  • siRNA small interfering RNA
  • the mixture is administered at a site distal to the eye wherein said site is selected from the group consisting of a subconjunctival site, an intravenous site, an intraocular site, and a subcutaneous site, and in certain other embodiments the mixture is administered topically to the eye.
  • the method is directed against an ocular disease selected from the group consisting of herpetic stromal keratitis, uveitis, rubeosis, conjunctivitis, keratitis, blepharitis, sty, chalazion, crizis, age-related macular degeneration, proliferate diabetic retinopathy and retinopathy of prematurity.
  • the mixture inhibits expression of at least one gene selected from among herpesvirus essential genes, pro-inflammatory pathway genes, pro- angiogenesis pathway genes, pro-cell proliferation pathway genes, and viral infectious agent genome RNA, and viral infectious agent genes.
  • the mixture includes siRNA molecules that target sequences selected from among the following sets of sequences: SEQ ID NOS: 61-158; or SEQ ID NOS:1-60 and SEQ ID NOS:486-536; or SEQ ID NOS:189-218 and SEQ ID NOS:279-365; or SEQ ID NOS: 159-218 and SEQ ID NOS:279-335; or SEQ ID NOS: 189- 218, SEQ ID NOS:279-335 and SEQ ID NOS:456-485; or SEQ ID NOS: 189-218, and SEQ ID NOS:249-335; or SEQ ID NOS: 189-218, SEQ ID NOS:279-335, and SEQ ID NOS:426- 455; or SEQ ID NOS:159-188 and SEQ ID NOS:396-455; or SEQ ID NOS:159-188, SEQ ID NOS:396-455, and SEQ ID NOS:537-566; or a mixture that inhibit
  • the carrier is selected from among a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, and a ligand functionalized-hydrophilic polymer grafted polymer.
  • composition in an additional aspect includes one or more siRNA oligonucleotides and a pharmaceutical carrier, wherein the one or more siRNA molecules targets an RNA molecule encoding a gene product whose activity promotes at least one of inflammation, neovascularization and angiogenesis in the eye arising in an ocular disease.
  • HKP-siRNA nanoparticle enhances siRNA delivery into the rabbit ocular tissue.
  • Each of the 250 ⁇ g of siRNA labeled with detection signal was intravitreously injected into the rabbit eye balls. Four eyes were measured from each test group.
  • Fig. 2 Polymer-siRNA nanoparticles.
  • siRNA designs targeting mVEGF (Accession: M95200), mVEGRl (Accession: D88689) and mVEGFR2 (Accession: X70842) with two siRNA oligos for each gene
  • mVEGF mVEGF
  • mVEGFRl mVEGFR2
  • mVEGFR2 mVEGFR2
  • the total RNA samples were collected from the cell culture experiments after transfection of simVEab, simRlab and simR2ab (Table 26). Two dosages of the siRNA oligos were used against the same dosage of control siRNA oligos.
  • HKP-siRNA particles can be formed when HKP aqueous solution is mixed with siRNA solution, and likewise for RPP-siRNA particles, (d) siRNA oligos were delivered through both local and systemic administration routes.
  • siRNA oligos were delivered through both local and systemic administration routes.
  • HKP-siRNA particles were mainly for local delivery through either subconjunctival (SCJ) or intravitreous (IVT) routes.
  • RPP- siRNA particles were applied for systemic deliveries through either intraperitoneal (IP) or intravenous (IV) routes, respectively, reaching to the blood stream first and then to ocular neo vasculature,
  • IP intraperitoneal
  • IV intravenous
  • H3K4b ocular neo vasculature
  • siRNA oligos were locally and systemically delivered into the ocular NV tissues, (al) FITC-labeled siClab was observed in angiogenic corneal cryosection 24 hr after SCJ administration, compared to the cryosection from the group (a2) treated with naked FITC-labeled siClab through the same route of delivery, (bl) FITC-labeled siClab was observed in angiogenic corneal cryosection 24 hr after IV injection of RPP-siClab, compared to the cryosection from the group (b2) treated with naked FITC-labeled siClab through the same systemic delivery, (c) ELISA analysis identified mVEGF protein down regulation.
  • Fig. 4 Anti-angiogenesis efficacy on CpG induced ocular NV.
  • (b) Images from mouse eyes representing each treated group marked with the same pattern as (a)
  • SCJ locally
  • HSK-simVmix and systemically
  • IV delivered RPP-simVmix demonstrated potent anti-angiogenesis efficacy.
  • (d) Images of mouse eyes from both treated and control groups, indicated by the same marks as (c).
  • Fig. 5 Inhibition of Corneal NV with locally administration of siRNA duplexes in HSK model.
  • the siRNA duplexes targeting only one gene were able to inhibit corneal NV compared to control siRNA (a) in the eyes of HSK models.
  • Locally delivered simVmix demonstrated stronger inhibition for corneal NV (b) compared to the siRNA targeting only a single gene. The pictures were taken at P4.
  • Fig. 6 Pharmacodynamics of the simVmix in mouse HSK model, (a) the HSK disease scores were measured at P6, 10, 14 and 22, after either local (SCJ) or systemic (IV) administrations of HKP-simVmix (see page 51) and RPP-simVmix at Pl and P3. Significant inhibition was observed for systemic (IV) delivered RPP-simVmix compared to RPP-siClab (* P ⁇ 0.05), at P14 and P22. The potency is comparable to the locally delivered HKP- simVmix . (b) Therapeutic efficacy of simVmix in the HSK model.
  • the HKP- simVmix (stripe) and the RPP-simVmix (dot) treated groups exhibit healthy eyes compared to HKP-siClab (black) and RPP-siClab (grey) treated groups, which show severer HSK disease symptom, deformed and bloody corneal surfaces.
  • Fig. 7 Inhibition of Corneal NV with systemic administration of siRNA duplexes in HSK model.
  • the siRNA duplexes targeting only one gene were able to inhibit corneal NV compared to control siRNA (a) in the eyes of HSK models.
  • Systemically delivered simVmix demonstrated stronger inhibition for corneal NV (b) compared to the siRNA targeting only a single gene. The pictures were taken at P4.
  • Fig. 9 Fluorescein-labeled retinal whole mount changes. The changes were examined in ischemic retinopathy mice with siRNA duplexes treated though subconjuctival, intravitreal or intraperitoneal injection, (al, 2) Normal retinal vasculature in a normal (control) mouse at P 17.
  • Fig. 10 Histological changes in ischemic retinopathy mice. The histological changes were examined with siRNA treated though subconjuctival, intravitreal or intraperitoneal injection, (al, 2) Normal retinal vasculature in a normal (control) mouse at P17.
  • Fig. 11 SiRNA cocktail significantly silenced expression of VEGF, VEGFRl and VEGFR2.
  • VEGF vascular endothelial growth factor
  • VEGFRl vascular endothelial growth factor
  • a Q-RT-PCR analyses of mRNA levels.
  • Fig. 12 RT-PCR analysis of VEGF, VEGFRl, VEGFR2 mRNA levels.
  • the mRNA levels in the retina tissues at P14 and P17 were examined after intravitreal and intraperitoneal injection of simVmix (see page 51).
  • IPN and IVT represent intraperitoneal or intravitreal administration respectively
  • Fig. 13 Suppression of expression of human VEGF in human cells.
  • Fig. 14 Comparison of siRNA effectiveness in suppressing VEGF in human and mouse cells.
  • Fig. 15. Comparison of effectiveness of five 25 mer VEGF-Rl specific siRNA duplexes in suppressing gene expression.
  • Fig. 16 Comparison of effectiveness of three 25 mer MMP-9 specific siRNA duplexes in suppressing gene expression.
  • Fig. 17 Comparison of effectiveness of three 25 mer PDGF specific siRNA duplexes in suppressing gene expression.
  • the present invention provides novel siRNA targeting sequences. There are three important characteristics that distinguish the instant siRNA molecules and their targets:
  • siRNA duplexes are identical in the human and mouse sequences of the same, or orthologous, gene. That means each of the siRNA duplexes will be able to suppress the expression of the same gene target in both human and mouse cells, which is advantageous in drug development. For example, a potent siRNA specific to VEGF gene will be able to knockdown both human VEGF in human cells and mouse VEGF gene expression in mouse cells.
  • the sequences generally have three different lengths: 21 nucleotides (nt), 23 nt and 25 nt.
  • 21 nucleotides (nt) 21 nucleotides (nt)
  • 23 nt and 25 nt 25 nucleotides
  • siRNAs that are 23 nt or 25 nt in length are usually more potent than 21 nt siRNAs, but on the other hand 25 nt siRNAs may induce unwanted interferon response more than shorter length oligonucleotides. Therefore, siRNA duplexes at various lengths will provide the best chance to identify potent inhibitors with minimal interferon response.
  • the siRNA oligos are provided in either blunt end or sticky end form,.
  • a "blunt” end designates a duplex in which the terminal nucleotide on each strand is paired with a nucleotide on the opposite strand.
  • a "sticky" end or staggered end designates a duplex having a terminus in which one strand extends additional unpaired nucleotides beyond a paired nucleotide on the opposing strand.
  • the additional unpaired nucleotides at a staggered end are termed an "overhang" herein, and such nucleotides are termed overhanging nucleotides.
  • oligonucleotides may be sensitive to degradation while the blunt end may activate the cellular interferon response.
  • oligonucleotides "oligos", and similar terms based on this relate to short oligonucleotides composed of naturally occurring nucleotides as well as to oligonucleotides composed of synthetic or modified nucleotides.
  • siRNAs provided herein may be constituted purely of ribonucleotides, or they may have certain designated positions occupied by deoxynucleotides.
  • oligonucleotides provided in this invention may be constituted entirely of deoxynucleotides which provide siRNA molecules by transcription processes.
  • an oligonucleotide that is an siRNA may have any number of nucleotides between 19 and 35 nucleotides. In many embodiments an siRNA may have any number of nucleotides between 19 and 27 nucleotides. Oligonucleotides may be 19 or more nucleotides in length, or 20, or 21, or 22, or 23, or 24, or 25, or 26, or 27, or more nucleotides in length, including any integral number of nucleotides up to 35 or more in length. siRNA oligonucleotides are generally double stranded and include a sense strand and an antisense strand.
  • siRNA may be single stranded at a certain point in its preparation prior to being paired with a complementary strand to form a duplex. Either of such single stranded oligonucleotides is also included within the use of the term siRNA herein.
  • siRNA molecules are termed "targeting" oligonucleotides or "directed” oligonucleotides herein.
  • the base sequence of the siRNA directs or targets the siRNA to a particular target sequence within an mRNA or viral RNA whose expression is intended to be suppressed.
  • the base sequence within the mRNA so targeted by the siRNA is the "target" sequence as used herein.
  • an siRNA may have two blunt ends, or two sticky ends, or it may have one blunt end and one sticky end.
  • the overhang nucleotides of a sticky end can range from one to four or more.
  • the invention provides siRNA compositions of 21, 23 and 25 base pairs with blunt ends.
  • polynucleotide and “oligonucleotide” are used synonymously herein.
  • a "mixture”, and related words and phrases relates to a composition that contains a plurality of siRNA molecules.
  • a mixture of siRNA molecules may have improved beneficial effects, when used to treat a disease or pathology, than a composition that contains only a single species of siRNA.
  • a mixture may contain two siRNA species, or three siRNA species, or four siRNA species, or even more.
  • a "cocktail" of siRNA molecules and a mixture thereof are synonymous.
  • a composition of the invention may include a single siRNA oligonucleotide, or it may contain a plurality of targeting siRNA molecules.
  • a composition or mixture may further include, in addition to the at least one siRNA molecule, a polymeric and/or a liposome carrier.
  • a polymeric carrier may comprise a cationic polymer that binds to the RNA molecule to form a nanoparticle (between 50-500 nm in diameter).
  • the cationic polymer may be an amino acid copolymer (such as a copolypeptide), containing, for example, histidine and lysine residues.
  • the polymer may additionally comprise a branched polymer.
  • the composition may comprise a targeting synthetic carrier.
  • the synthetic carrier may comprise a cationic polymer, a hydrophilic polymer, and a targeting ligand.
  • the polymer may comprise a polyethyleneimine
  • the hydrophilic polymer may comprise a polyethylene glycol or a polyacetal
  • the targeting ligand may comprise a peptide comprising an RGD sequence, a transferrin targeting ligand, a protamine or a single chain antibody, etc.
  • an electric field may be applied to a tissue substantially contemporaneously with the composition.
  • the composition and method of the invention comprises dsRNA oligonucleotides with a sequence matching an endogenous human gene or a mutated endogenous gene, and at least one mutation in the mutated gene may be in a coding or regulatory region of the gene.
  • the endogenous gene may be selected from the group consisting of angiogenesis related genes including growth factor genes, protein serine/threonine kinase genes, protein tyrosine kinase genes, protein serine/threonine phosphatase genes, protein tyrosine phosphatase genes, receptor genes, and transcription factor genes.
  • RNAi agents utilize an endogenous process active against dsRNA viral infections but can be used to inhibit expression from virtually any mRNA, and with a high degree of selectivity.
  • the invention provides for RNAi agents for inhibiting ocular viral infections as a means to intervene in ocular neovascularization.
  • the RNAi agents of the invention include short dsRNA oligonucleotides, siRNA, with a sequence matching viral gene sequences and lacking sequence specificity for human genes.
  • RNAi agents of the invention inhibit mRNA expressed by either DNA or RNA viral infections and they degrade the genome of dsRNA viral infections.
  • One DNA viral infection inhibited by the RNAi agents of the invention is HSV, which causes herpetic stromal keratitis. This virus has a relative large genome that remains episomal and where expression levels of viral mRNA rise and fall over time. The continuous low levels of HSV viral mRNA expression result in a persistent, albeit quiescent, infection that flairs up from time to time.
  • the RNAi agents of the invention are useful to inhibit rising HSV mRNA expression associated with recurrence of infection. By reducing the ability of the infection to flair up, the RNAi agents protect from induction of ocular neovascularization disease.
  • RNAi agents also are useful to diminish the continuous, low level HSV mRNA expression to even lower levels, which diminishes the ability of the HSV infection to flair up.
  • the RNAi agents are effective to inhibit the DNA and RNA viral infections of ocular tissues that lead to ocular neovascularization.
  • the siRNA sequences were designed targeting respectively to HSV-I and HSV-2 viral UL5 and UL29 genes, with ten 21-mer, ten 23-mer and ten 25-mer in length.
  • the inhibitory siRNA duplexes can be synthesized according to those targeted sequences as one sense single-stranded RNA oligo and one antisense single- stranded RNA oligo first.
  • the double- stranded siRNA duplexes can be annealed as either blunt-ended or overhang (3' end).
  • the sequences of UL5 gene of both HSV- 1 and HSV-2 targeted by designed siRNAs are listed in Table 1.
  • the sequences of UL29 gene of both HSV-I and HSV-2 targeted by designed siRNAs are listed in Table 2.
  • HSV UL5 and UL29 genes are included in the group of genes considered to be herpesvirus essential genes. (Note: the lists of the sequences in this application are the target sequences from cDNA.
  • sequences can easily be transcribed into RNA sequences for preparation of siRNA' s by changing thymidine (t) to uridine (u). Only sense strand sequences are listed in the tables. The antisense sequences can be easily added by the base pairing rules).
  • Table 1 The targeted sequences ofUL5 gene of both HSV-I and HSV- ⁇ >
  • Inflammation is a process that involves many cells and biochemical factors, but despite its complexity the process is highly conserved across tissues.
  • One of the early events in inflammation is secretion of activating factors as a result of tissue hypoxia, damage, or other insults. These factors activate cells and induce recruitment of inflammatory cells into the tissue, which secrete additional activating factors.
  • One common biochemical pathway for induction of inflammation is secretion of TNF and IL-I. These factors act in a largely parallel manner so that strong inhibition of their activation of an inflammation cascade requires intervening in both simultaneously. Downstream of this point, the inflammatory cascade results in secretion of factors to induce neovascularization.
  • the inflammatory process offers many points for intervention: upstream at secreted factors initiating the cascade; and downstream at factors responsible for activating specific cells in the cascade, such as endothelial cell recruitment of neutrophils from the blood and endothelial cell induction of neovascularization.
  • the invention provides RNAi agents effective for inhibiting factors whose upregulation and role in inflammation depends on gene expression of the factor. While many secreted factors are present in cells and released to initiate inflammation, up regulation of expression of those same factors is important for continued expansion of the inflammation and for persistent of the inflammation.
  • the RNAi agents of the invention provide for inhibition of persistent inflammation, which is a greater contributor to the ocular neovascularization disease.
  • siRNA sequences target Interleukin-1 beta (IL- l ⁇ ) and Tumor Necroses Factor alpha (TNF ⁇ ) genes of both human and mouse.
  • IL- l ⁇ Interleukin-1 beta
  • TNF ⁇ Tumor Necroses Factor alpha
  • the siRNA targeted sequences are 21-mer, 23-mer and 25- mer in length.
  • the inhibitory siRNA duplexes can be synthesized according to those targeted sequences as one sense single- stranded RNA oligo and one antisense single- stranded RNA oligo first.
  • the double-stranded siRNA duplexes can be annealed as either blunt-ended or overhang (3' end).
  • the targeted sequences of IL- l ⁇ gene of both human and mouse are listed in Table 3.
  • the targeted sequences of TNF ⁇ gene of both human and mouse are listed in Table 4.
  • the targeted sequences of cyclooxygenase (COX)-2 gene of both human and mouse are listed in Table 5.
  • hypoxia inducible factor-1 is a transcription factor composed of HIF-lalpha and HIF-lbeta subunits. HIF-I transactivates multiple genes whose products play key roles in oxygen homeostasis, including vascular endothelial growth factor (VEGF).
  • VEGF vascular endothelial growth factor
  • An early step is driven by the VEGF pathway that involves secretion of VEGF growth factors, which bind and activate cells bearing different members of the VEGF family of receptors.
  • the VEGF family is composed of five structurally related growth factors: VEGF-A, Placenta Growth factor Table 3: The targeted sequences of IL-Ip gene ofboth human and mouse.
  • PIGF vascular endothelial growth factor
  • VEGF-B vascular endothelial growth factor
  • VEGF-C vascular endothelial growth factor-B
  • VEGF-C vascular endothelial growth factor-D
  • VEGF-D vascular endothelial growth factor-B
  • VEGF-C vascular endothelial growth factor-B
  • VEGF-C vascular endothelial growth factor receptor
  • VEGF-D vascular endothelial growth factor receptors
  • Tables 4, 10 16, and 35 include sequences that target only the human ortholog of the gene, some of which include a -dtdt overhang at the 3' end.
  • Table 4 The targeted sequences of TNF ⁇ gene of both human and mouse.
  • s Sense strand
  • a Antisense strand Table 5.
  • COX cyclooxygenase
  • VEGF A gene of both human and mouse are listed in Table 7.
  • Table 7 The targeted sequences of VEGF A gene of both human and mouse.
  • the targeted sequences of VEGF B gene of both human and mouse are listed in Table 8.
  • the targeted sequences of PIGF gene of both human and mouse are listed in Table 9.
  • the targeted sequences of VEGFR-I (FIt-I) gene of both human and mouse are listed in Table 10 and corresponding siRNA sequences are in Table 35.
  • the targeted sequences of VEGFR- 2 gene of both human and mouse are listed in Table 11.
  • Table 8 The targeted sequences of VEGF B gene of both human and mouse.
  • bFGF Another major secreted angiogenic growth factor is bFGF, which actives a separate set of receptors. Both of these pathways activate endothelial cells in nearby vasculature, and stimulate their proliferation and migration to form new vasculature into the region secreting the growth factor stimulants.
  • the VEGF and bFGF pathways act somewhat in parallel up to a point where they become the same.
  • These secreted growth factor pathways of neovascularization represent a very useful point for therapeutic intervention, as provided by the invention, either by inhibiting the growth factors or their Table 9: The targeted sequences of PIGF gene of both human and mouse.
  • the invention also provides for inhibiting both pathways simultaneously, as well as for inhibition of intracellular signaling induced by these pathways such as the induced signal transduction kinases, or in a preferred embodiment the transcription factors.
  • the transcription factors have been established as useful points for therapeutic intervention but have been intractable to conventional therapeutic modalities.
  • the bFGF pathway is one of several FGF pathways.
  • the bFGF factor is a strong stimulator of angiogenesis and thus it and its receptors are an important point for therapeutic intervention.
  • the invention provides siRNA agents specific for inhibition of bFGF and its receptors, and intracellular signal transduction pathway. Table 10: The targeted sequences of VEGFR-I (FIt-I) gene of both human and mouse.
  • VEGFR1 VEGFR-I
  • Table 11 The targeted sequences of VEGFR- 2 gene of both human and mouse.
  • the targeted sequences of bFGF gene of both human and mouse are listed in Table 12.
  • the targeted sequences of A-RAF gene of both human and mouse are listed in Table 13.
  • the targeted sequences of mTOR gene of both human and mouse are listed in Table 14.
  • Table 12 The targeted sequences of bFGF gene of both human and mouse.
  • Table 13 The targeted sequences of A-RAF gene of both human and mouse.
  • gaggtgatccgtatgcaggacccga 398 Table 14 The targeted sequences of mTOR gene of both human and mouse.
  • Matrix metalloproteinases are a family of extracellular matrix-degrading enzymes associated with neovascularization. Matrix metalloproteinases (MMP)-2 and -9 play an important role in the pathogenesis of choroidal neovascularization (CNV). Retinal pigment epithelial cells (RPE) are an important source of MMPs in the outer retinal environment, however little is known about the local factors that modulate MMP secretion in these cells. There are studies showed resting RPE cells secreted MMP-2 but not MMP-9, and stimulation with TNF-alpha induced secretion of MMP-9 and increased the secretion of MMP-2.
  • RPE Retinal pigment epithelial cells
  • MMP- 2 secretion was also increased by stimulation with VEGF, but not bFGF. Therefore, we strongly believe that MMP-2 and MMP-9 should be another set of targets for anti- angiogenesis treatment. There is evidence implicating the integrins alpha v beta 3 and alpha v beta 5 in the ocular angiogenic process.
  • alpha v beta 3 and alpha v beta 5 were present on vascular cells in tissues from patients with PDR.
  • the targeted sequences of MMP-2 gene of both human and mouse are listed in Table 15.
  • the targeted sequences of MMP-9 gene of both human and mouse are listed in Table 16.
  • the targeted sequences of integrins alpha v beta 3 (Integrin ⁇ V ⁇ 3) gene of both human and mouse are listed in Table 17.
  • Table 15 The targeted sequences of MMP-2 gene of both human and mouse.
  • Table 16 The targeted sequences of MMP-9 gene of both human and mouse.
  • Human 25-mer is UGGCACCACCACAACAUCACCUAUU 490 la AAUAGGUGAUGUUGUGGUGGUGCCA 491
  • Table 17 The targeted sequences of Integrin ⁇ V ⁇ 3 gene of both human and mouse.
  • the invention provides the therapeutic siRNA cocktail targeting multiple disease controlling genes in the same treatment.
  • "cocktail" and similar terms and phrases relates to a pharmaceutical composition that includes more than one siRNA molecule.
  • the invention provides for RNAi agents, such as siRNA oligonucleotides, that are chemically similar to the same source of supply and the same manufacturing process, and they are comprised of four types of nucleotides with different sequences.
  • the invention provides the siRNA cocktail drug for treatments of several types of ocular disease, including Uveitis, AMD, PDR and HSK, etc, acting on multiple aspects of the diseases and reducing potential toxicity.
  • the siRNA cocktail should contain at least two siRNA duplexes targeting at least two genes (not two sequences of the same gene) at a ratio of therapeutic requirement.
  • siRNA cocktail design for each combination must follow the understanding of the role of each gene in a background of the system biology network, such as these genes are functioning either in the same pathway or in a different one.
  • the chemical property of each siRNA duplexes in the cocktail must be the same in terms of source of supply, manufacturing process, chemical modification, storage conditions and formulation procedures.
  • Each individual siRNA duplex in the cocktail can be different in their lengths, with either blunt or sticky end, as long as their potencies have been defined.
  • siRNA cocktail Since siRNA cocktail is targeting multiple genes and a single cell type usually dose not express all those factors, the efficacy of a siRNA cocktail must be tested in a relevant disease model, either a multiple cell model, a tissue model or a animal model, after the confirmation of the potency of each individual siRNA duplex in the cell culture.
  • Each validated siRNA cocktail can be used for addressing one or more pathological conditions, for treatment of one or multiple types of diseases, such as, siRNA cocktail for suppressing inflammation, siRNA cocktail for antiangiogenesis activity and siRNA cocktail for autoimmune conditions.
  • siRNA cocktail must be administrated through the same route of delivery in the same formulation, although the regimen of dosing for each cocktail will be defined based on either the experimental design or therapeutic requirement.
  • Each siRNA cocktail can be applied either independently, or in combination with other drug modalities such as small molecule inhibitors, monoclonal antibodies, protein and peptides, and other siRNA cocktail drug(s).
  • Step 1 Defining the pathological condition for the siRNA cocktail design.
  • Inflammation is a process that involves many cells and biochemical factors, but despite its complexity the process is highly conserved across tissues.
  • One of the early events in inflammation is secretion of activating factors as a result of tissue hypoxia, damage, or other insults.
  • One common biochemical pathway for induction of inflammation is secretion of TNF alpha and IL- 1 beta.
  • Cyclooxygenases (COX) are rate-limiting enzymes involved in the conversion of PLA(2)-mobilized arachidonic acid into prostaglandins and thromboxanes.
  • COX-2 is a key mediator of inflammation during both physiologic and pathologic responses to endogenous stimuli and infectious agents.
  • siRNA cocktail may provide a potent anti-inflammatory agent for treatment of the ocular inflammatory disease such as Uveitis.
  • Step 2 Selection of potent siRNA duplexes targeting the selected genes in both mouse and human cell cultures.
  • Nonlimiting examples of highly potent siRNA duplexes are selected to be composed of the siRNA cocktail(s) as shown in Table 18.
  • the lists of the sequences in this application are generally the target sequences from cDNA.
  • the sequences can easily be transcribed into RNA sequences for preparation of siRNA' s by changing thymidine (t) to uridine (u).
  • t thymidine
  • u uridine
  • the combinations listed below are only examples. Therefore by following the same steps, various siRNA duplexes can be combined in various compositions to form a highly potent inhibitory cocktail for down regulation of a particular pathological process, as result, to treat various diseases).
  • siRNA cocktail Three combinations are selected to be tested in the Equine recurrent uveitis (ERU) model for autoimmune diseases, since it develops frequently and occurs spontaneously and has a similar pathogenic mechanism was assumed to exist in Uveitis.
  • ERU Equine recurrent uveitis
  • Step 4 When the potency of the siRNA cocktail is confirmed, it can be repeatedly tested in other autoimmune and inflammatory disease models in mouse. Since the sequences have homology to the same gene from both mouse and human, the siRNA cocktail can be directly developed for human therapeutic application. Using these procedures, many siRNA cocktail combinations deemed to be highly potent for various preclinical test and future therapeutics use have been identified, as described following: Table 19. siRNA cocktails targeting VEGF pathway. siRNA Cocktail Combinations (targeted sequences)
  • siRNA cocktails targeting VEGF pathway Table 20. siRNA Cocktail Combinations (targeted sequences)
  • VEGF VEGFR1 Human and Mouse homologues HIF-1 alpha SEQ ID NO:
  • siRNA cocktails targeting VEGF pathway Table 22. siRNA Cocktail Combinations (targeted sequences)
  • siRNA cocktail can be applied as an independent agent for treatment of ocular diseases, or applied with other drug modalities. Since siRNA therapeutics predominantly inhibit the target gene expression which is significantly different from the antagonist drugs such as the
  • siRNA cocktail and antagonist drug small molecule inhibitors and monoclonal antibodies. Therefore, use of the both siRNA cocktail and antagonist drug in the same therapeutic regimen may achieve better therapeutic benefit due to the too inhibitory mechanisms are in action.
  • siRNA cocktails can also be administrated in the same regimen for better clinical outcome.
  • the siRNA duplexes can be made as either the blunt end and sticky end at two ends, or one end is blunt and another is sticky. The ratios of each individual siRNA duplex in the cocktail can be even or different depending the target gene requirement for effective knockdown, to achieve therapeutic effect).
  • the invention provides compositions and methods for administering the therapeutic agents to treat ocular neovascularization diseases, and in particular to treat diseases in the anterior of the eye.
  • the invention also provides compositions and methods for administering the therapeutic agents to treat ocular neovascularization diseases anywhere in the eye including the posterior of the eye.
  • the tissues anywhere in the eye can be treated with neovasculature-targeted delivery of therapeutic agents, according to the invention, by local administration, by topical administration to the eye, and by intravenous administration at a distal site.
  • the tissues in the anterior of the eye can be treated, according to the invention, by local administration into the subconjunctival tissue, by topical administration to the eye, by periocular injection, by intraocular injection, and by intravenous administration at a distal site.
  • the compositions provided by the invention include 1) cationic agents that bind nucleic acids by an electrostatic interaction, including non-natural synthetic polymers, grafted polymers, block copolymers, peptides, lipids and micelles, 2) hydrophilic agents that reduce non-specific binding to tissues and cells, including non-natural synthetic polymers, peptides, and carbohydrates, 3) tissue and cell penetrating agents, including surfactants, peptides, non- natural synthetic polymers, and carbohydrates.
  • a preferred class of peptide is the histidine-lysine copolymer (HKP) that is a basic, cationic, broad class of peptides.
  • HTP histidine-lysine copolymer
  • Another preferred class of peptide is linear polylysine with histidine or imidazole monomers coupled to the epsilon amino moiety of the lysine monomers.
  • Another preferred class of peptide is branched polylysine and branched polylysine with histidine or imidazole monomers coupled to the epsilon amino moiety of the lysine monomers.
  • a preferred composition has a self-assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic peptide with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold.
  • a preferred class of polylysine coupled with histidine or imidazole monomers has 30 to 70% coupling to primary amines of the lysine monomers.
  • Another preferred class of peptide is a polymer with a monomer comprised of the tripeptide histidine-histidine-lysine or the tetrapeptide of histidine-histidine-lysine-lysine, where the polymer is either linear or branched, the branched polymer having monomers coupled to either the alpha or epsilon amino group of another monomer, or both.
  • a preferred molecular weight of the polylysine class of polymers is in the range of 5,000 to 100,000, and a more preferred molecular weight of 10,000 to 30,000.
  • Fig. 1 demonstrates the significant enhancement of siRNA delivery into retina tissue.
  • a preferred class of grafted polymers is a peptide grafted with a hydrophilic polymer, where the hydrophilic polymer includes PEG, polyoxazoline, polyacetal (referred to in some instances as Fleximer), HPMA, and polyglycerol.
  • a preferred composition has a self- assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic grafted polymer with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold.
  • a preferred molecular weight of the hydrophilic polymer is in the range of 2,000 to 10,000.
  • grafted polymers is a peptide grafted with a hydrophilic polymer further comprised of a ligand grafted to the hydrophilic polymer, where the ligand includes peptides, carbohydrates, vitamins, nutrients, and antibodies or their fragments.
  • a preferred class of non-natural synthetic cationic polymer is a polymer with a backbone repeating unit of ethyl-nitrogen ( -C-C-N- ), including polyoxazoline and polyethyleneimine (PEI).
  • a preferred composition has a self-assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic polymer with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold.
  • the invention provides linear polyoxazoline or PEI derivatized with histidine or imidazole monomers.
  • Another preferred class of polymer is branched polyoxazoline or PEI derivatized with histidine or imidazole monomers.
  • a preferred class of polymer coupled with histidine or imidazole monomers has 30 to 70% of the basic moieties being imidazole.
  • a preferred molecular weight of the polymers is in the range of 5,000 to 100,000, and a more preferred molecular weight of 10,000 to 30,000.
  • a preferred class of grafted polymers is a polymer grafted with a hydrophilic polymer, where the hydrophilic polymer includes PEG, polyoxazoline, polyacetal (referred to in some instances as Fleximer), HPMA, and polyglycerol.
  • a preferred composition has a self-assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic grafted polymer with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold.
  • grafted polymers is a polymer grafted with a hydrophilic polymer further comprised of a ligand grafted to the hydrophilic polymer, where the ligand includes peptides, carbohydrates, vitamins, nutrients, and antibodies or their fragments.
  • Another preferred class of cationic polymer is a polymer with a polyacetal backbone.
  • a preferred composition has a self-assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic polyacetal polymer with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold.
  • the invention provides linear polyacetal derivatized with a basic moiety, where the basic moiety class includes mixture of lysine, primary amine, histidine, and imidazole monomers.
  • Another preferred class of polymer is branched polyacetal derivatized with a basic moiety (again including the class of lysine, amine, histidine, and imidazole monomers).
  • a preferred class of polyacetal polymer coupled with lysine, amine, histidine, and imidazole monomers has 30 to 70% if the basic moieties being imidazole.
  • a preferred molecular weight of the polymers is in the range of 5,000 to 100,000, and a more preferred molecular weight of 10,000 to 30,000.
  • a preferred class of grafted polymers is a polymer grafted with a hydrophilic polymer, where the hydrophilic polymer includes PEG, polyoxazoline, polyacetal (referred to in some instances as FleximerTM), HPMA, and polyglycerol.
  • grafted polymers is a polyacetal polymer grafted with a hydrophilic polymer further comprised of a ligand grafted to the hydrophilic polymer, where the ligand includes peptides, carbohydrates, vitamins, nutrients, and antibodies or their fragments.
  • RNAi the double stranded RNA (dsRNA)- induced sequence-specific degradation of messenger RNA (mRNA), often called gene silencing, has been proven to be a powerful tool for gene discovery and it holds great potential in targeted therapeutics.
  • dsRNA double stranded RNA
  • mRNA messenger RNA
  • mVEGF-A the double stranded RNA
  • mVEGF-Rl the double stranded RNA
  • mVEGF-R2 messenger RNA
  • the siRNAs are 21 -nucleotide long double stranded RNAs with 2-nt overhangs at either 3' termini, with the negative strand complementary to the targeted mRNA sequences.
  • siRNA duplexes targeting mVEGF, mVEGFRl and mVEGFR2.
  • Six siRNA duplexes were designed to target each of mVEGF, mVEGFRl and mVEGFR2 using algorithms from the public domain and chemically synthesized by Qiagen (Germantown, MD).
  • siRNAs were 21-nt long double stranded RNA oligos with dTdT overhang at 3' end without further modification (Table 26). After screenings for gene silencing potency in cell cultures, two out of six duplexes were selected for targeting the specified gene and those two were used in an equal molar mixture.
  • siRNA duplexes were used in pairs, the new name for each pairs are as follows: simVEab for mVEGF-siRNAab, simRlab for mVEGFRl-siRNAab, simR2ab for mVEGFR2-siRNAab, siClab for Control 1-siRNAab and siC2ab for Control2-siRNAab.
  • simVEGFmix The siRNA cocktail containing simVEab, simRlab and simR2ab with equal molar ratio was named as simVEGFmix.
  • HKP Optimal branched histidine-lysine polymer
  • HKP was synthesized on a Ranin Voyager synthesizer (PTI, Arlington, AZ) and complexed with siRNA duplexes as described previously (70) for local administration.
  • the HKP was dissolved in aqueous solution and then mixed with siRNA aqueous solution at a ratio of 4:1 by mass, forming nanoparticles of average size of 150-200 nm in diameter.
  • the targeted polymeric siRNA nanoparticles for systemic administration were prepared by chemical synthesis of tripartite polymer conjugate RPP, a PEGylated form of branched polyethyleneimine (PEI) having an RGF peptide at its distal end ( RGD-PEG- PEI) (71).
  • PEI branched polyethyleneimine
  • RGD-PEG- PEI RGD-PEG- PEI
  • RPP- siRNA nanoparticles can be self-assembled in aqueous solution by simply mixing two solutions together with a 2:1 molar ratio.
  • the measurements of particle size (120-150 nm) and ⁇ -potential indicate that the RPP- siRNA particles exhibit colloidal surface properties indicative of an outer steric polymer layer and potentially exposed RGD ligand to mediate cell-binding selectivity.
  • the HKP-siRNA and RPP-siRNA aqueous solutions were semi- transparent without noticeable aggregation of precipitate, and can be stored at 4 C for at least three months.
  • NV corneal neovascularization
  • the HSK model 1 2 was established using BALB/C (H-2 d ) mice 6-8 weeks of age purchased from Harlan Sprague- Dawley (Indianapolis, IN).
  • the NV in corneal stromal in the HSK model were induced through either corneal implantation of CpG-ON or HSV-I infection 1 ' 2 .
  • the CpG-ON induced model requires micropocket being made around 1 mm from the limbus under a stereomicroscope with pellets containing 1 ⁇ g of CpG-ON.
  • Angiogenesis was evaluated at day 4 and 7 post the pellet implantation by comparison of NV areas and the VEGF protein levels 34 .
  • HSV-induced HSK model was established by introducing 2 ⁇ l drop containing 1 x 10 5 plaque-forming units (PFU) of HSV-I RE into the mouse corneas with a 30-gauge needle.
  • PFU plaque-forming units
  • the NV in HSK model was evaluated through comparison of the NV area, angiogenesis score and clinical score, through 22 day period post the infection.
  • the animal studies followed guidelines of the Committee on the Care of Laboratory Animals Resources, Commission of Life Sciences, National Research Council. The animal facilities of the University of Tennessee (Knoxville, TN) are fully accredited by the American Association of Laboratory Animal Care.
  • ROP Mouse Retinopathy of prematurity
  • ROP model was established with C57BL/6 mice purchased from Center of Experimental animal of Guangzhou Medical college, Guangzhou University of traditional Chinese Medicine.
  • the retinal NV in ROP model was induced by hyperoxia 3 ' 4 . Briefly, the pups with the nursing dams were maintained in hyperoxia environment (75% + 2 oxygen) from postnatal days P7 to P12, then returned to room air (normoxia), followed by treatment with Polymeric siRNA nanoparticles via different routes of delivery.
  • the ocular NV in ROP model was evaluated with fluorescein perfusion/ flatmounting, cryosection staining, RT-PCR for mRNA levels and ELISA for protein levels. All investigations followed guidelines of the Committee on the Care of Laboratory Animals Resources, Commission of Life Science, National Research Council, China.
  • HKP-siRNA solution (10 ⁇ g/10 ⁇ l/eye) was delivered subconjunctivally (SCJ) with a 32-gauge Hamilton syringe (Hamilton company, Reno, Nevada) at 6 and 24 h after CpG-ON pellets implantation or day 1 and 3 after virus infection under deep anesthesia induced by Avertin (Pittman Moore, Mundelein, IL).
  • the RPP-siRNA solution (40 ⁇ g siRNA/100 ⁇ l/mice) was delivered intravenously (IV) at 6 and 24 h after CpG-ON pellets implantation or day 1 and 3 after virus infection.
  • simVmix is a mixture of the siRNA duplexes mVEGF-siRNA(a), mVEGF-siRNA(b), mVEGFRl-siRNA(a), mVEGFRl-siRNA(b), mVEGFR2-siRNA(a), and mVEGFR2-siRNA(b) (SEQ ID NOS:568-579; see Table 26).
  • HKP- simVmix solution (4 ⁇ g/2 ⁇ l/eye) was delivered either subconjunctivally (SCJ) or intravitreously (IVT) in the left eye and HKP-siC2ab (4 ⁇ g/2 ⁇ l/eye) in the right eye.
  • the RPP-simVmix solution (15 ⁇ g siRNA/50 ⁇ l/mice) was given intraperitoneally (IP). Both local and systemic administrations were in two regimens: P12, P 14, and P 16; or only on P 12 and P13. Mice were sacrificed followed by evaluations of NV status and the expressions of the targeted genes at P 14 and P 17. Retinal angiography.
  • RNA samples were tested by mRNA-specific PCR (RS-PCR) as described previously.
  • the set of primers for each mRNA include a 47-mer mRNA-specific primer for reverse transcription reaction (RTP), a 5'-end gene specific primer (GP) and a 3'-end universal primer (see Table 27). The lower cases indicated the sequences specific to the targets for reverse transcriptions.
  • the RNA samples were also quantified with GAPDH and ⁇ -actin specific RT-PCR. All PCR products were subjected to the gel electrophoresis analysis and quantification. Table 27.
  • VEGF and VEGFl, VEGFR2 ELISA analyses for VEGF and VEGFl, VEGFR2.
  • Retinas were collected after mice were sacrificed at P 14 and P 17, and homogenized in cell lysis buffer (Mammalian cell lysis Kit, Biotechnology Department Bio Basid Inc, Canada). The supernatants were subjected to ELISA analysis using BCA protein quantitative analysis Kit (Shenery Biocolor Bioscience & Technology Company, China).
  • Levels of VEGF, VEGFRl, and VEGFR2 were determined using the Quantikine M Murine VEGF, sVEGFRl, and sVEGFR2 Immunoassay Kits respectively (R&D Systems Inc., Minneapolis, MN). Six to 12 tissue samples were analyzed for each group and each time point.
  • VEGF vascular endothelial growth factor
  • VEGFRl vascular endothelial growth factor
  • VEGFR2 vascular endothelial growth factor 2
  • X70842 X70842
  • the siRNA duplexes were chemically synthesized by Qiagen (Germantown, MD, USA). Potencies of the siRNA duplexes for silencing the targeted genes were evaluated by in vitro transfection of RAW264.7 gamma NO (-) cells and SVR cells, followed by RT-PCR and ELISA analyses. Two most potent siRNA duplexes for each gene target were selected from the eight candidates (Fig.
  • the simVEab is able to target all three isoforms 38 of murine VEGF including VEGFigs, VEGF 164 and VEGF 12 O • These three pairs of siRNA agents were selected as the payloads of the nanoparticles for in vivo studies with murine ocular NV models.
  • Herpetic stromal keratitis (HSK) model was generated with CpG-ON pellet implant and HSV infection as described previously 34 , which represents a clinically relevant model of corneal neovascularization with typical characteristics of inflammation induced angiogenesis and lymphangiogenesis 40 . Measurements of the angiogenesis areas, HSK disease scores and protein expression levels are the most effective ways to evaluate the siRNA-mediated anti- angiogenesis activities in the anterior section of the eyes.
  • the retinopathy of prematurity (ROP) model reflects the characters of retinal NV with typical pathogenesis of ischemic and degenerative diseases such as PDR and AMD 41 .
  • Measurements of the angiogenesis areas through perfusion/flatmount, cryosection , and mRNA and protein expression levels are useful tools to evaluate anti-angiogenesis activity in the posterior section of the eyes.
  • integrin receptor subtypes ⁇ v ⁇ 3 and ⁇ v ⁇ 5 are selectively expressed in the proliferative endothelium of corneal, retinal and choroidal neovascular membranes 14 ' 15> 16 , which have been indicated as the ideal targets for RGD ligand binding 17> 34> 42 .
  • HK polymers Two polymeric carriers were selected for in vivo delivery of siRNA duplexes through either local or systemic administrations.
  • Optimal branched histidine-lysine (HK) polymers have been applied for siRNA deliveries in vitro 43 and in vivo 44 .
  • a particular species of the HK polymer (PT73, named as HKP) has a lysine backbone with four branches containing multiple repeats of Histidine, Lysine and Asparagine.
  • PT73 histidine-lysine
  • Asparagine Asparagine
  • HKP-siRNA solutions were used for the subconjunctival (SCJ) or intravitreous (IVT) administrations in both HSK and ROP models (Fig. 2c-2d).
  • SCJ subconjunctival
  • IVT intravitreous
  • a more complicated tripartite polymer conjugate, PEGylated branched polyethyleneimine (PEI) having an RGF peptide at its distal end (RGD-PEG-PEI, in short as RPP) 45 was applied in two previous in vivo studies 33> 34 .
  • PEI PEGylated branched polyethyleneimine
  • RPP RGF peptide at its distal end
  • RPP-siRNA nanoparticles can also be self-assembled in aqueous solution with sizes about 80-120 nm in diameter by simply mixing two solutions together with a 2: 1 molar ratio.
  • the RGD ligand directed RPP- siRNA nanoparticles were able to preferentially reach to the CpG-ON induced ocular NV tissue through IV delivery and to knockdown the VEGF expression which is the key factor for activation of the local angiogenesis.
  • SiRNA cocktail exhibited stronger anti-angiogenesis activity
  • VEGF, VEGFRl and VEGFR2 are key players in ocular NV through activation of HA and LA processes activated by CpG-ON induced inflammation 1 ' 2 . Therefore, inhibiting expression of each of these genes with the specific siRNA duplexes should down regulate progression of the ocular NV 35> 36 .
  • Systemically delivered RPP-simVEab, -simRlab and - simR2ab nanoparticles (40 ⁇ g/100 ⁇ l/eye) significantly minimized angiogenesis areas compared to the no treatment and siClab treated groups (Fig. 4a).
  • siRNA cocktail nanoparticles HKP-simVmix (see page 51; 4 ⁇ g/2 ⁇ l/eye) through SJV injection and RPP-simVmix (40 ⁇ g/100 ⁇ l/eye) through IV injection, at 6 and 24 hours after CpG-ON induction of corneal NV in mice (HSK model) as described in the method section.
  • the angiogenesis areas of each treatment groups were measured on day 4 and 7 followed by comparisons between the control and treatment groups (Fig. 5).
  • the siRNA cocktail treatments resulted in stronger anti-angiogenesis activities in the HSK models (Fig. 4c-d) compared to siRNAs targeting single gene (Fig.
  • HSV infection causes severe ocular NV and corneal lesion that usually present between 14 - 22 days after the infection.
  • both locally and systemically delivered siRNA cocktail nanoparticles displayed similar anti-angiogenesis benefits in this HSV induced HSK model.
  • the pharmacodynamics of both locally delivered HKP-simVmix and systemically delivered RPP-simVmix were very similar during the entire course of disease progression.
  • the 40% of disease inhibition at p22 also demonstrated the durable anti- angiogenesis potencies of both formulations.
  • the slightly higher scores for HKP-siClab treated group at P6 and PlO may be due to the physical prying by local injections of the nanoparticles.
  • the siRNA cocktail treatment the HSV infected eyes became highly angiogenic and finally deformed (Fig. 6b).
  • the systemically administrated RPP-simVmix demonstrated stronger inhibition for corneal NV (Fig. 7b) compared to the siRNA targeting only a single gene. (Fig. 7, c-e).
  • SiRNA cocktail displayed a potent anti-angiogenesis activity in ROP model
  • FIG. 8c A selection of the images for perfusion/flatmount analysis (Fig. 9) is demonstrated in Fig. 8c.
  • the HKP-simVmix and RPP-simVmix show marked differences between treatment groups and control groups (Fig. 8c, panels 2, 6, 3,7; see Figure Legend).
  • the similar therapeutic benefit could also be observed in Fig. 8d, where the samples from the groups treated with the siRNA cocktail through either IVT or IP delivery display minimum NV (Fig. 8d, panels 6-7), but the samples from the control groups revealed large fronds of retinal and subretinal NV extending above the internal limiting membrane (Fig. 8d, panels 2- 3).
  • siRNA cocktail (simVmix) exhibited potent anti-angiogenesis efficacy in vivo, delivered via either local or systemic routes, packaged with either HKP or RPP, and examined in either HSK or ROP model, we determined whether those anti-angiogenesis activities really came from silencing all three key angiogenesis factors in the same temporal and spatial locations.
  • Q-RT-PCR quantitative RT-PCR
  • the siRNA cocktail approach divulge a new paradigm that multiple targeted therapeutics are more efficacious than the single targeted therapeutics (Fig. 1 Ic) for treatment of ocular NV diseases.
  • siRNA cocktail simVmix
  • This simVmix is able to simultaneously knockdown genes for both angiogenic cytokine (VEGF) and its receptors (VEGFRl and VEGFR2), by reaching both retinal pigment epithelium cells and retinal vascular membrane endothelium cells through either local or systemic delivery, providing therapeutic benefit demonstrated in the ROP murine model.
  • VEGF angiogenic cytokine
  • VEGFRl and VEGFR2 angiogenic cytokine
  • This indicates that potent anti- angiogenesis efficacy is more likely to accrue from a cocktail approach than from targeting single target such as can be done with monoclonal antibody 10> u or chimerical receptor 7 drugs.
  • HKP and RPP polymeric nanoparticles have clearly demonstrated their capabilities for local and systemic deliveries of siRNA active agents.
  • the cyclic RGD ligand used in this study possesses high affinity to the integrin receptors, ⁇ v ⁇ 3 and ⁇ v ⁇ 5, which are not expressed in the normal and proliferative vitreoretinopathic tissues, but selectively expressed in corneal neovascular membranes 42 , retinal and choroidal neovascular membranes 16 ⁇ 20 .
  • Our data affirm that RPP-simVmix activity is mediated through RGD binding to ⁇ v ⁇ 3 and ⁇ v ⁇ 5 integrins expressed on the cell membrane of neovascular endothelium.
  • the unequivocal identification and quantification of new vessels and measurement of angiogenesis areas employed in the Examples enable objective data collection.
  • the local delivery effect and systemic delivery effect can be clearly distinguished.
  • the HSK model with severe corneal NV and ROP model with serious retinal NV reflect characteristics of almost all kinds of ocular angiogenesis diseases.
  • HSK or RPP carriers with either local or systemic delivery, are applicable for (1) inflammatory corneal NV such as HSK, Uveitis, Scleritis and Iritis; (2) ischemic retinal NV such as PDR, ROP and retinal vein occlusion (RVO); and (3) degenerative choroidal NV, AMD, polypoidal choroidal vasculopathy (PCV) and pathologic myopia, etc.
  • inflammatory corneal NV such as HSK, Uveitis, Scleritis and Iritis
  • ischemic retinal NV such as PDR, ROP and retinal vein occlusion (RVO)
  • degenerative choroidal NV AMD
  • PCV polypoidal choroidal vasculopathy
  • pathologic myopia etc.
  • siRNA cocktail administrated with polymeric nanoparticle, requires us to carefully evaluate the potential toxicity in vivo throughout the entire observation on both HSK and ROP murine models. Except some minor injures in the ocular tissue due to the repeated deliveries of polymeric-siRNA nanoparticles intravitreously into young mice (Table 29), we did not fine any physical, behavioral and appearance change of the treated mice, after repeated systemic administrations of RPP- simVmix nanoparticles, even with less than two week old C57BL/6 mice. This observation indicates that the dosage and regimen we used in those treatments were safe. Therefore, this siRNA cocktail therapeutic approach may possess a wide therapeutic window for the treatment of ocular NV.
  • Murine VEGF Accession: M95200
  • siRNA sequences were selected (forward sequence): SEQ ID NO: simVEa: GCCGUCCUGUGUGCCGCUGdtdt; 541 simVEb: CGAUGAAGCCCUGGAGUGCdtdt; 543 simVE-1: GUGGUCCCAGGCUGCACCCdtdt; 568 simVE-2: GAUCCGCAGACGUGUAAAUdtdt; 569 simVE-3: ACACAGACUCGCGUUGCAAdtdt; 570 simVE-4: CACAGACUCGCGUUGCAAGdtdt; 571 simVE-5: GGCGAGGC AGCUUGAGUUAdtdt; 572 simVE-6: ACGAACGUACUUGCAGAUGdtdt. 573
  • siRNA sequences were selected (forward sequence): simRla: GUUAAAAGUGCCUGAACUGdtdt 545 simRlb: GCAGGCCAGACUCUCUUUCdtdt 547 simRl-1: GGAGAGGACCUGAAACUGUdtdt, 574 simRl-2: GCAAGGAGGGCCUCUGAUGdtdt, 575 simRl-3: GGAGGGCCUCUGAUGGUGAdtdt, 576 simRl-4: CUACCUC AAGAGCAAACGUdtdt, 577 simRl-5: GUGGCCAGAGGCAUGGAGUdtdt, 578 simRl-6: AGUGCAUUCAUCGGGACCUdtdt. 579
  • Murine VEGFR-2 (FLK-I), Accession: X70842
  • siRNA candidates were selected (forward sequence): simR2a: GCUCAGCACACAGAAAGACdtdt 549 simR2b: UGCGGCGGUGGUGACAGUAdtdt 551 simR2-l: CAGAAUUUCCUGGGACAGCdtdt, 580 simR2-2: CUGAAGACAGGCUACUUGUdtdt, 581 simR2-3: GGACUUCCUGACCUUGGAGdtdt, 582 simR2-4: GUGGCUAAGGGCAUGGAGUdtdt, 583 simR2-6: AUGUACCAGACCAUGCUGGdtdt, 584 simR2-8: CAGUAAGCGAAAGAGCCGGdtdt, 585 Table 29. Toxicity responses to the intravitreal administration of simVmix.
  • Human colorectal carcinoma cells, DLD-I and human breast carcinoma cells, MDA-MB-435 American Type Culture Collection (ATCC; Centerville VA) were generally cultured and rinsed twice with 0.25% trypsin, 0.53 mM EDTA solution at room temperature (or at 37C) until the cells detached. Fresh culture medium was added, the cells were aspirated and dispensed into new culture flasks. Cells were transfected with naked siRNA using Lipo2000 (Invitrogen, Carlsbad, CA) according to the protocol provided by the vendor. Either 0.3 and 2.0 ug blunt ended siRNA was transfected in a given experiment.
  • Lipo2000 Invitrogen, Carlsbad, CA
  • the 25 mer siRNA 5'-ccaugccaaguggucccaggcugca-3' targets both human and mouse VEGF.
  • the 21 mer siRNA 5'- aaucgagacccugguggacau-3' targets human VEGF.
  • the mock was treated with buffer alone.
  • the amounts of mRNA were determined by quantitative-RT-PCR analysis using TaqMan® Gene Expression system (ABI, Forest City, CA).
  • Fig. 13 show that the 25 mer siRNA (SEQ ID NO: 596) is more potent for silencing effects tested than the 21 mer siRNA (SEQ ID NO 624).
  • VEGF-A Human embryo kidney cells, 293, and mouse myeloma cells, F3, were cultured and transfected with 8 different siRNA sequences designated VEGF-A through VEGF-H targeting human VEGF.
  • the expression ratio is determined by the changes of mRNA.
  • the amounts of mRNA were determined by quantitative-RT-PCR analysis using TaqMan® Gene Expression system (ABI, Forest City, CA).
  • Fig. 14 The results shown in Fig. 14 indicate that differing targeted sequences within the VEGF have differing susceptibilities for suppression of gene expression.
  • the siRNA designated VEGF-C is most effective in both human and mouse cells.
  • VEGF-Rl specific siRNA duplexes Comparison of effectiveness of five 25 mer VEGF-Rl specific siRNA duplexes in suppressing gene expression.
  • Mouse SVR cells were cultured and transfected with five different siRNA molecules each of which targets orthologous mouse and human genes, or with siRNA targeting green fluorescent protein (GFP), or were transfected with buffer alone. Either 0.3 or 2.0 ug siRNA per experiment was used. Relative expression levels compared to untreated cells were determined. The siRNA sequences used were
  • duplex molecules for use in various mixtures disclosed herein are listed in Table 34. duplex molecules
  • RNAs diced small interfering RNAs (siRNAs) specific to vascular endothelial growth factor (VEGF). Curr Eye Res. 2006; 31(2):171-80.
  • VEGF-A stimulates lymphangiogenesis and hemangiogenesis in inflammatory neovascularization via macrophage recruitment. J Clin Invest. 2004; 113(7): 1040-50.
  • VEGF-D is the strongest angiogenic and lymphangiogenic effector among VEGFs delivered into skeletal muscle via adenoviruses. Circ Res. 2003; 92(10):1098-106.
  • VEGF-TRAP(R 1R2) suppresses choroidal neovascularization and VEGF-induced breakdown of the blood-retinal barrier. J Cell Physiol. 2003; 195(2):241- 8.
  • Campochiaro PA Potential applications for RNAi to probe pathogenesis and develop new treatments for ocular disorders. Gene Ther. 2006; 13(6):559-62.
  • VEGF isoforms and their expression after a single episode of hypoxia or repeated fluctuations between hyperoxia and hypoxia: relevance to clinical ROP. MoI Vis. 2004 JuI 21; 10:512-20.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Endocrinology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides compositions and methods for use of siRNA mixtures with appropriate delivery systems to treat various ocular diseases. The invention includes compositions of siRNA targeted sequences, siRNA duplexes, and siRNA mixtures to inhibit expression of genes causing ocular disease, either from infectious virus or arising spontaneously in the patient. Further, the compositions include carrier polymers for siRNA agents that deliver the agents to eye for effective therapeutic treatment.

Description

SIRNA COMPOSITIONS AND METHODS OF USE IN TREATMENT
OF OCULAR DISEASES
FIELD OF THE INVENTION
The present invention provides compositions and methods for treatment of various ocular diseases using small interfering RNA (siRNA) mixtures containing a plurality of sequences targeting multiple disease causing genes. The invention provides siRNA sequences targeting 1) viral genes expressed in ocular infections; 2) genes whose expression causes inflammation; and 3) genes whose expression promotes pro-angiogenesis activity.
BACKGROUND
There are variety of ocular diseases having unmet medical needs. Those diseases are ranging from infections, allergenic disorder, cardiovascular disorder and age related conditions. Many diverse ocular diseases are the result of excessive neovascularization (NV), an abnormal proliferation and growth of blood vessels within the eye. The development of ocular NV itself has adverse consequences for vision but also is an early pathological step in many serious eye diseases; despite introduction of new therapeutic agents it remains the most common cause of permanent blindness in United States and Europe. Several major eye diseases promote an abnormal neovascularization, which leads to further damage to the eyes causing loss of vision. Unfortunately, few treatment options exist for patients with any of these ocular NV diseases. The most commonly used approved therapy is a photodynamic treatment, Visudyne, that uses light to activate a photosensitizer in the vicinity of the neovascularization to destroy unwanted blood vessels. It is not effective in many patients and cannot prevent recurrence even when it is effective. A recently approved agent, Macugen, provides some benefit but also is ineffective in most patients. In addition, the intraocular administration of Macugen leads to irritation and risk of infection, both of which are adverse since they exacerbate the neovascularization pathology. As a consequence, a large and growing unmet clinical need exists for effective treatments, either inhibiting progression since disease progression tends to be very prolonged or therapeutic to reverse the unwanted The National Eye Institute of NIH has estimated, 400,000 Americans have had some form of ocular herpes, and there are nearly 50,000 new and recurring cases diagnosed each year in the United States, with the more serious stromal keratitis accounting for about 25%. From a larger study, it was found that the recurrence rate of ocular herpes is 10 percent in one year, 23 percent in two years, and 63 percent within 20 years. Although application of available anti-viral drugs could control the HSV infection to certain extent, there is no effective medication available that could treat the HSV-caused stromal keratitis and protect the patients from blindness.
The ocular neovascularization diseases can be divided into diseases affecting the anterior, or front, of the eye and those affecting the posterior, or retinal, part of the eye. Development of NV at these different regions may have different origins, but the biochemical and physiological nature of the NV process appears to be virtually identical, regardless of eye region. Consequently, an effective means to intervene in the biochemical nature of ocular NV offers the prospect for providing an effective treatment for any ocular disease that involves ocular NV as the major pathology or as the underlying pathology, regardless of whether the disease afflicts the anterior or posterior of the eye. Nonetheless, the anterior and posterior ocular tissues differ considerably and these differences can have a dramatic influence on the most effective means to administer therapeutic treatments so that the tissue and cells are reached by the therapeutic agent.
Posterior Ocular NV Disease
Retinopathy of prematurity (ROP):
ROP is a potentially blinding eye disorder that primarily affects premature infants weighing about 2% pounds (1250 grams) or less that are born before 31 weeks of gestation (a full-term pregnancy has a gestation of 38-42 weeks). The smaller a baby is at birth, the more likely that baby is to develop ROP. This disorder — which usually develops in both eyes — is one of the most common causes of visual loss in childhood and can lead to lifelong vision impairment and blindness. Today, with advances in neonatal care, smaller and more premature infants are being saved. These infants are at a much higher risk for ROP. Not all babies who are premature develop ROP. There are approximately 3.9 million infants born in the U.S. each year; of those, about 28,000 weigh 2¥Λ pounds or less. About 14,000-16,000 of these infants are affected by some degree of ROP. The disease improves and leaves no permanent damage in milder cases of ROP. About 90 percent of all infants with ROP are in the milder category and do not need treatment. However, infants with more severe disease can develop impaired vision or even blindness.
The most effective proven treatments for ROP are laser therapy or cryotherapy. Laser therapy "burns away" the periphery of the retina, which has no normal blood vessels. With cryotherapy, physicians use an instrument that generates freezing temperatures to briefly touch spots on the surface of the eye that overlie the periphery of the retina. Both laser treatment and cryotherapy destroy the peripheral areas of the retina, slowing or reversing the abnormal growth of blood vessels. Unfortunately, the treatments also destroy some side vision. This is done to save the most important part of our sight — the sharp, central vision we need for "straight ahead" activities such as reading, sewing, and driving. Both laser treatments and cryotherapy are performed only on infants with advanced ROP. Both treatments are considered invasive surgeries on the eye, and doctors don't know the long-term side effects of each. While ROP treatment decreases the chances for vision loss, it does not always prevent it. Not all babies respond to ROP treatment, and the disease may get worse. If treatment for ROP does not work, a retinal detachment may develop. If the center of the retina or the entire retina detaches, central vision is threatened, and surgery may be recommended to reattach the retina. Clearly, the current methods of treatment of ROP are invasive surgeries, not able to prevent the disease getting worse and have potential long-term side effects.
Proliferate Diabetic Retinopathy (PDR):
PDR occurs when the tiny blood vessels providing oxygen to the retina become damaged. The damage allows blood and fluid to escape into the retina, and also results in new blood vessel growth. These new vessels are more fragile and frequently bleed into the vitreous region of the eye, interfering in vision. Patients with the most serious form of DR are at a substantial risk for severe visual loss without treatment. In this disease, neovascularization is a central pathology of the disease. Diabetic retinopathy is the most common diabetic eye disease and a leading cause of blindness in American adults. In some people with diabetic retinopathy, blood vessels may swell and leak fluid. In other people, abnormal new blood vessels grow on the surface of the retina. The retina is the light-sensitive tissue at the back of the eye. A healthy retina is necessary for good vision. Proliferate Diabetic Retinopathy is currently treated with laser surgery. This procedure is called scatter laser treatment. Scatter laser treatment helps to shrink the abnormal blood vessels. Physician places 1,000 to 2,000 laser burns in the areas of the retina away from the macula, causing the abnormal blood vessels to shrink. Because a high number of laser burns are necessary, two or more sessions usually are required to complete treatment. This treatment may cause some loss of the side vision, but can save the rest of sight. Scatter laser treatment may slightly reduce color vision and night vision. As we can see, the scatter laser treatment is still not ideal.
Age related macular degeneration (AMD):
AMD is the leading cause of blindness in people over 60 years and each year the problem becomes more acute. In AMD central vision is lost making it impossible to appreciate fine detail. Given the magnitude of the burden of AMD on individuals and society as a whole, it is perhaps surprising that more is not known of the causes of the disease and how it develops. It is clear, however, that the retinal pigment epithelium (RPE) plays a pivotal role. Abnormal waste material builds up beneath and within the RPE and RPE cells eventually die. The rods and cones in the retina depend for their survival upon normal functioning RPE and this RPE failure leads to progressive loss of vision. The disease provokes a scarring process at the back of the eye inducing formation of new blood vessels, neovascularization. In a large segment of the patients, those with "wet AMD", an excessive proliferation of leaky neovasculature develops in front of the retina, which also blurs and distorts vision. In this disease, damaging neovascularization develops in later, severe stages of disease in a large segment of the patient population.
Anterior Ocular NV Disease
Rubeosis is a term that describes abnormal blood vessel growth on the iris and the structures in the front of the eye. Normally there are no visible blood vessels in these areas. When the retina has been deprived of oxygen, or is ischemic, as with diabetic retinopathy or vein occlusion, abnormal vessels form to supply oxygen to the eye. Unfortunately, the formation of these vessels obstructs the drainage of aqueous fluid from the front of the eye, causing the eye pressure to become elevated. This usually leads to neovascular glaucoma.
Uveitis is a broad group of diseases originating from inflammation of tissues on the inside of the eye. This disease is most commonly classified anatomically as anterior, intermediate, posterior or diffuse. Ocular complications of uveitis may produce profound and irreversible loss of vision, especially when unrecognized or treated improperly. The most frequent complications include cataract; glaucoma; retinal detachment; neovascularization of the retina, optic nerve, or iris and the like.
A related group of ocular diseases are the consequence of eye infections, including Conjunctivitis, Keratitis, Blepharitis, Sty, Chalazion and Iritis, again all major causes of ocular neovascularization that leads to vision loss. Recurrent HSV infection is the most common infectious cause of corneal blindness in the U.S. This viral infection causes blinding lesions called stromal keratitis (SK). Corneal NV is an early step in vision loss from herpetic SK.
Ocular Disease Physiology and Target Genes
Like other tissues, ocular tissues are in a continuous state of maintenance which often entails neovascularization. At late stage of almost all the ocular diseases described above, ocular neovascularization becomes the major symptom and this abnormal physiological change is the key pathology required treatment. This ocular neovascularization results in excessive growth of damaging new blood vessels, and it appears to be virtually identical regardless of the region of the eye and disease, although the originating cause of the pathology as well as the role in vision loss differs widely. The commonality of the pathological process offers means to provide therapeutic interventions that are effective in these diverse diseases of the eye.
Herpes Simplex Virus type-1 infection can cause Herpetic Stromal Keratitis (HSK) which induces corneal neovascularization. The angiogenic factor production occurs initially from virus-infected corneal epithelial, non-inflammatory, cells followed by expression in a clinical phase from inflammatory cells (PMNs and macrophages) in the stroma. A mouse model of HSV induced corneal NV was developed by implantation of purified HSV viral DNA fragments (HSV DNA, rich in CpG motifs) or synthetic CpG oligonucleotides (CpG ODN). This model is thought to provide a clinically relevant model of corneal NV and herpetic SK disease, and is useful for testing therapeutic modalities for their efficacy in inhibiting ocular NV disease. Clearly, in this case, using siRNA agent to knockdown viral genes should minimize the HSV viral replication and infection, and as a result, inhibit the angiogenesis induction. The UL5 (a component of the helicase-primase complex) and UL29 (a DNA binding protein) of HSV are the essential viral genes responsible for viral replication and infection. Accession Numbers for all genes identified herein are provided in Table 30. Hypoxia inducible factor- 1 (HIF-I) is a transcription factor composed of HIF-I alpha and HIF-lbeta subunits. HIF-I transactivates multiple genes whose products play key roles in oxygen homeostasis, including vascular endothelial growth factor (VEGF). Immunoblots of retinal lysates showed low levels of HIF-I alpha at earlier stage of induction that were markedly increased 4 days post induction, remained high throughout the period of retinal vascular development and then decreased to an intermediate level in adults. HIF-lbeta levels were relatively constant at all time points. In mice with oxygen-induced ischemic retinopathy, HIF-I alpha levels were increased in the retina. The peak of increase occurred at 2 hours, and levels returned to baseline by 24 hours. Immunohistochemistry showed increased staining for HIF-I alpha throughout the hypoxic inner retina, but not in the normoxic outer retina. There was no modulation of HIF-lbeta levels. There was constitutive expression of VEGF mRNA in the inner nuclear layer that was increased 6 hours after the onset of hypoxia and remained elevated for several days. Since HIF-I is a transcription factor and largely presents in the nuclear, it is difficult to be targeted using monoclonal and small molecule drugs. Therefore, siRNA therapeutic will have unique advantage for inhibitory therapeutic agent.
An attractive approach for therapeutic intervention is to inhibit the common pathological condition of these diseases. From many studies, it has become established that VEGF-mediated neovascularization and angiogenesis is one of the common pathological pathways of many ocular neovascularization diseases. The VEGF-mediated angiogenesis pathway plays a central role in angiogenesis of all these NV-related eye diseases. The VEGF family is composed of five structurally related growth factors: VEGF-A, Placenta Growth factor (PIGF), VEGF-B, VEGF-C, and VEGF-D. Known receptors include three structurally homologous tyrosine kinase receptors, VEGFR-I (FIt-I), VEGFR-2 (KDR or FIk-I), and VEGFR-3 (Flt-4), with different affinity or functions related to different VEGF members. While function and regulation of four VEGF members are poorly understood, VEGF-A binds VEGFR-I and VEGFR-2 and is known to induce neovascularization and angiogenesis, as well as vascular permeability. VEGFR- 1 and VEGFR-2 are both up-regulated in proliferating endothelium that may be a direct response to VEGF-A or hypoxia. VEGFR-I has higher affinity to VEGF-A than VEGFR-2. It is thought that VEGFR-2 is responsible for angiogenic signals for blood vessel growth, but the function of VEGFR-I is poorly understood. Some studies suggested a direct role in transducing angiogenic signals, and roles in motility and permeability. This understanding of key players in the VEGF pathway of angiogenesis has led to studies with inhibitors of VEGF-A as candidate therapeutic agents, including Macugen® (an aptamer oligonucleotide inhibiting VEGF binding to its receptor) and Lucentis® (a monoclonal antibody against VEGF). While these studies in ocular angiogenesis, as well as in other angiogenesis diseases such as tumor growth, have validated the value of the VEGF pathway for clinical effect, the experimental agents are far from effective for many patients. It is clear that better inhibitors of the VEGF pathway are needed if we are to develop treatments for these major eye diseases.
Matrix metalloproteinases are a family of extracellular matrix-degrading enzymes associated with neovascularization. Matrix metalloproteinases (MMP)-2 and -9 play an important role in the pathogenesis of choroidal neovascularization (CNV). Retinal pigment epithelial cells (RPE) are an important source of MMPs in the outer retinal environment, however little is known about the local factors that modulate MMP secretion in these cells. There are studies showed resting RPE cells secreted MMP-2 but not MMP-9, and stimulation with TNF-alpha induced secretion of MMP-9 and increased the secretion of MMP-2. MMP-2 secretion was also increased by stimulation with VEGF, but not bFGF. In addition, increased MMP-2 activity compromises retinal pericyte survival possibly through MMP-2 action on ECM proteins and/or direct association of MMP-2 with integrins, which promotes apoptosis/anoikis by loss of cell contact with an appropriate ECM. In a different study, two plasmids were generated encoding shRNA (pshRNA) targeted against two distinct MMP-9 gene sequences. Transfection of these pshMMP-9s have shown specific inhibition of MMP-9 expression both in vivo and in vitro. In vivo delivery of pshMMP- 9 subconjunctivally was also effective at inhibiting MMP-9 protein expression in the mouse cornea. Delivery of the pshMMP-9 stopped angiogenesis and decreased the severity of herpetic stromal keratitis. Therefore, we strongly believe that MMP-2 and MMP-9 should be another set of targets for anti-angiogenesis treatment.
There is evidence implicated the integrins alpha v beta 3 and alpha v beta 5 in the ocular angiogenic process. Examination of the expression of alpha v beta 3 and alpha v beta 5 in neovascular ocular tissue from patients with subretinal neovascularization from age-related macular degeneration or the presumed ocular histoplasmosis syndrome or retinal neovascularization from proliferative diabetic retinopathy (PDR) indicated that only alpha v beta 3 was observed on blood vessels in ocular tissues with active neovascularization from patients with age-related macular degeneration or presumed ocular histoplasmosis, whereas both alpha v beta 3 and alpha v beta 5 were present on vascular cells in tissues from patients with PDR. Since the observation of both integrins on vascular cells from tissues of patients with retinal neovascularization from PDR, using inhibitors or antagonist peptides were able to blocked new blood vessel formation with no effect on established vessels. These results not only reinforce the concept that retinal and subretinal neovascular diseases are distinct pathological processes, but inhibition of alpha v beta 3 and/or alpha v beta 5 may be effective in treating individuals with blinding eye disease associated with angiogenesis.
Fibroblast growth factors such as FGF-2 are potent mitogens for endothelial cells and induce their assembly into vascular-like structures in culture and in in vivo assays. A study on FGF-2 functions during physiological vascularization are poorly documented has indicated that the major functions of FGF-2 at different early stages of physiological vascularization. Both the failure in hyaloid regression and the intense angiogenic invasion of endothelial cells into the retina may serve as a model for some related human ocular pathologies. Expression of FGF-2, interestingly, resulted in beneficial therapeutic effect on herpetic SK progression via its role in wound healing. Epithelial growth factor (EGF) receptors, platelet-derived growth factor receptor (PDGFR) alpha and beta, and placenta growth factor (PIGF) are also the factors considered playing some role in ocular angiogenesis process. Although they may have relatively minor involvement, designing siRNA duplexes against those targets and including those siRNA duplexes in the siRNA cocktail combinations are certainly meaningful approach for treatment of various ocular diseases.
Inflammation is a process that involves many cells and biochemical factors, but despite its complexity the process is highly conserved across tissues. One of the early events in inflammation is secretion of activating factors as a result of tissue hypoxia, damage, or other insults. These factors activate cells and induce recruitment of inflammatory cells into the tissue, which secrete additional activating factors. One common biochemical pathway for induction of inflammation is secretion of TNF alpha and IL-lbeta, as well as up regulation of cyclooxygenase (COX)-2. These factors act in a largely parallel manner so that strong inhibition of their activation of an inflammation cascade requires intervening in both simultaneously. Downstream of this point, the inflammatory cascade results in secretion of factors to induce neovascularization. The inflammatory process offers many points for intervention. Using siRNA inhibitors to knockdown those factors in conjunction with other siRNA inhibitors targeting both HSV essential genes and pro-angiogenesis factors will be an attractive therapeutic approach.
RNA interference (RNAi) and Small Interfering RNA (siRNA)
RNA interference (RNAi) is a sequence-specific RNA degradation process that provides a relatively easy and direct way to knockdown, or silence, theoretically any gene (11). In naturally occurring RNA interference, a double stranded RNA is cleaved by an RNase IIMielicase protein, Dicer, into small interfering RNA (siRNA) molecules, a dsRNA of 19-23 nucleotides (nt) with 2-nt overhangs at the 3' ends. These siRNAs are incorporated into a multicomponent-ribonuclease called RNA-induced-silencing-complex (RISC). One strand of siRNA remains associated with RISC, and guides the complex towards a cognate RNA that has sequence complementary to the guider ss-siRNA in RISC. This siRNA- directed endonuclease digests the RNA, thereby inactivating it. Recent studies have revealed that the use of chemically synthesized 21-25-nt siRNAs exhibit RNAi effects in mammalian cells 20, and the thermodynamic stability of siRNA hybridization (at terminals or in the middle) plays a central role in determining the molecule's function. These and other characteristics of RISC, siRNA molecules and RNAi have been described (23-28). As used herein, the term "target", "targeting", and similar noun and verb forms of this term designate an siRNA molecule which is specifically complementary to a sequence on a target RNA molecule, and inactivates the target RNA molecule. While not wishing to bound by theory, the inactivation is thought to proceed through the RNAi mechanism described in this paragraph.
Application of RNAi in mammalian cells in laboratory or potentially, in therapeutic applications, uses either chemically synthesized siRNAs or endogenously expressed molecules (24). The endogenous siRNA is first expressed as a small hairpin RNAs (shRNAs) by an expression vector (plasmid or virus vector), and then processed by Dicer into siRNAs. It is thought that siRNAs hold great promise to be therapeutics for human diseases especially that caused by viral infections (27-30).
Importantly, it is presently not possible to predict with any degree of confidence which of many possible candidate siRNA sequences potentially targeting a viral genome sequence (e.g., oligonucleotides of about 16-30 base pairs) will in fact exhibit effective siRNA activity. Instead, individual specific candidate siRNA polynucleotide or oligonucleotide sequences must be generated and tested to determine whether the intended interference with expression of a targeted gene has occurred. Accordingly, no routine method exists in the art for designing a siRNA polynucleotide that is, with certainty, capable of specifically altering the expression of a given mRNA.
PCT publication WO/2005/076999, entitled "Compositions and Methods for Combination RNAi Therapeutics", discloses various siRNA compositions and methods of using them for treatment of diseases. SUMMARY OF THE INVENTION
The present invention provides siRNA compositions directed toward RNA targets implicated in various diseases and pathologies of the eye. These include both virally induced diseases and a variety of spontaneous afflictions that affect mammalian eyes, especially the human eye. The invention is also directed to methods of treatment of such diseases and pathologies using the compositions disclosed herein.
In a first aspect a mixture is disclosed that includes a plurality of small interfering RNA (siRNA) oligonucleotides and a pharmaceutical carrier, wherein each of the siRNA molecules targets an RNA molecule encoding a gene product whose activity promotes at least one of inflammation, neovascularization and angiogenesis in the eye arising in an ocular disease. In certain embodiments of a mixture, the ocular disease is selected from the group consisting of herpetic stromal keratitis, uveitis, rubeosis, conjunctivitis, keratitis, blepharitis, sty, chalazion, iritis, age-related macular degeneration, proliferate diabetic retinopathy and retinopathy of prematurity. In additional embodiments a targeted RNA molecule encodes a gene selected from the group consisting of herpesvirus essential genes, pro-inflammatory pathway genes, pro-angiogenesis pathway genes, pro-cell proliferation pathway genes, and viral infectious agent genome RNA, and viral infectious agent genes.
In certain embodiments of a mixture, a component siRNA molecule targets an mRNA molecule, whereas in alternative embodiments a component siRNA molecule targets a viral RNA molecule. In various embodiments, the same siRNA targets mRNA molecules that encode orthologous human and mouse genes. In alternative embodiments an mRNA target molecule of encodes specifically a human gene.
In an embodiment the mixture includes at least three siRNA molecules targeting a herpes virus UL5 gene, a herpes virus UL29 gene, and human and mouse matrix metalloproteinase (MMP) 9 gene (Table 23).
In a further embodiment a mixture includes at least three siRNA molecules targeting human and mouse tumor necrosis factor alpha, interleukin- 1 beta, and cyclooxygenase-2 genes (Table 18).
In yet another embodiment a mixture includes at least three siRNA molecules targeting human and mouse vascular endothelial growth factor (VEGF)-A, VEGF receptor 1 and VEGF receptor 2 genes (Table 19).
In still a further embodiment a mixture includes at least three siRNA molecules targeting human and mouse VEGF receptor 2, VEGF A, and VEGF receptor 1 genes (Table 20). In yet an additional embodiment a mixture includes at least three siRNA molecules targeting human and mouse MMP-2, VEGF A, and VEGF receptor 1 genes (Table 22).
In still several additional embodiments various mixtures include combinations of alternative choices of at least three siRNA molecules targeting human and mouse placenta growth factor (PIGF), VEGF A, and VEGF receptor 1 genes (Table 25).
In yet another embodiment a mixture includes at least four siRNA molecules targeting human and mouse PIGF, VEGF A, VEGF receptor 1, and basic fibroblast growth factor (b- FGF) genes (Table 25).
In yet a further embodiment a mixture includes at least four siRNA molecules targeting human and mouse A-RAF, mTOR, hypoxia inducible factor- 1 (HIF-I) alpha, and integrin alpha V genes (Table 24).
In still another embodiment a mixture includes at least three siRNA molecules targeting human and mouse A-RAF, mTOR, and HIF-I alpha genes (Table 24).
In yet a further embodiment a mixture includes at least three siRNA molecules targeting human and mouse A-RAF, m TOR, and integrin receptor alpha V genes (Table 24).
In still another embodiment a mixture includes at least four siRNA molecules targeting human and mouse PIGF5VEGF A, VEGF receptor 1, and VEGF receptor 2 genes (Table 25).
In yet a further embodiment a mixture includes at least four siRNA molecules targeting human and mouse PIGF, VEGF A, VEGF B, and b-FGF genes (Table 25).
In yet an additional embodiment a mixture includes at least four siRNA molecules targeting human and mouse MMP-9, VEGF A, herpes virus UL5, and herpes virus UL29 genes (Table 23).
In various embodiments of a mixture a targeted mRNA molecule includes a VEGF pathway gene, an FGF pathway gene, a protein kinase gene, a pro-angiogenesis gene, a proinflammatory gene, an endothelial cell proliferation gene, or a herpes simplex virus gene.
In still additional embodiments the pharmaceutical carrier of the mixture is selected from the group of a saline solution, sugars, polymer, lipid, or micelle solutions, and in more particular embodiments the carrier is selected from among a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, and a ligand functionalized-hydrophilic polymer grafted polymer. In a particular embodiment the carrier includes a histidine-lysine copolymer which forms a nanoparticle with an siRNA molecule. In still additional embodiments of a mixture an siRNA molecule contains naturally occurring nucleotides, and in other embodiments an siRNA molecule includes one or more chemically modified nucleotides.
In a second aspect, a method is disclosed for treating ocular disease in a subject, wherein the disease is characterized at least in part by inflammation, neovascularization, and/or angiogenesis. The method includes administering to the subject a mixture that includes a plurality of small interfering RNA (siRNA) oligonucleotides and a pharmaceutical carrier, wherein each of the siRNA molecules targets an RNA molecule encoding a gene product whose activity promotes at least one of inflammation, neovascularization and angiogenesis in the eye arising in an ocular disease of said subject.
In certain embodiments the mixture is administered at a site distal to the eye wherein said site is selected from the group consisting of a subconjunctival site, an intravenous site, an intraocular site, and a subcutaneous site, and in certain other embodiments the mixture is administered topically to the eye. In various embodiments the method is directed against an ocular disease selected from the group consisting of herpetic stromal keratitis, uveitis, rubeosis, conjunctivitis, keratitis, blepharitis, sty, chalazion, iritis, age-related macular degeneration, proliferate diabetic retinopathy and retinopathy of prematurity.
In various embodiments of the method the mixture inhibits expression of at least one gene selected from among herpesvirus essential genes, pro-inflammatory pathway genes, pro- angiogenesis pathway genes, pro-cell proliferation pathway genes, and viral infectious agent genome RNA, and viral infectious agent genes.
In alternative embodiments of the method the mixture includes siRNA molecules that target sequences selected from among the following sets of sequences: SEQ ID NOS: 61-158; or SEQ ID NOS:1-60 and SEQ ID NOS:486-536; or SEQ ID NOS:189-218 and SEQ ID NOS:279-365; or SEQ ID NOS: 159-218 and SEQ ID NOS:279-335; or SEQ ID NOS: 189- 218, SEQ ID NOS:279-335 and SEQ ID NOS:456-485; or SEQ ID NOS: 189-218, and SEQ ID NOS:249-335; or SEQ ID NOS: 189-218, SEQ ID NOS:279-335, and SEQ ID NOS:426- 455; or SEQ ID NOS:159-188 and SEQ ID NOS:396-455; or SEQ ID NOS:159-188, SEQ ID NOS:396-455, and SEQ ID NOS:537-566; or a mixture that inhibits expression of VEGF-A, VEGF-B, VEGF Rl, and b-FGF; or that inhibits expression of VEGF pathway genes, FGF pathway genes, or a combination thereof; or that inhibits expression of a pro-angiogenesis gene, a pro-inflammatory gene, or a combination thereof; or that inhibits expression of a pro- angiogenesis gene, a herpes simplex virus gene, or a combination thereof; or that inhibits expression of a pro-angiogenesis gene, an endothelial cell proliferation gene, or a combination thereof; or that inhibits expression of a pro-inflammation gene, a herpes simplex virus gene, or a combination thereof.
In still an additional embodiment of the method the carrier is selected from among a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, and a ligand functionalized-hydrophilic polymer grafted polymer.
In an additional aspect a composition is disclosed that includes one or more siRNA oligonucleotides and a pharmaceutical carrier, wherein the one or more siRNA molecules targets an RNA molecule encoding a gene product whose activity promotes at least one of inflammation, neovascularization and angiogenesis in the eye arising in an ocular disease.
DESCRIPTION OF THE FIGURES
Fig. 1. HKP-siRNA nanoparticle enhances siRNA delivery into the rabbit ocular tissue. Each of the 250 μg of siRNA labeled with detection signal was intravitreously injected into the rabbit eye balls. Four eyes were measured from each test group.
Fig. 2. Polymer-siRNA nanoparticles. (a) siRNA designs targeting mVEGF (Accession: M95200), mVEGRl (Accession: D88689) and mVEGFR2 (Accession: X70842) with two siRNA oligos for each gene, (b) RT-PCR analyses for mRNA levels of mVEGF, mVEGFRl and mVEGFR2. The total RNA samples were collected from the cell culture experiments after transfection of simVEab, simRlab and simR2ab (Table 26). Two dosages of the siRNA oligos were used against the same dosage of control siRNA oligos. (c) Formation of two different types of polymeric siRNA nanoparticles. HKP-siRNA particles can be formed when HKP aqueous solution is mixed with siRNA solution, and likewise for RPP-siRNA particles, (d) siRNA oligos were delivered through both local and systemic administration routes. Two murine ocular NV models, HSK representing corneal disease and ROP representing retinopathy disease, were used. HKP-siRNA particles were mainly for local delivery through either subconjunctival (SCJ) or intravitreous (IVT) routes. RPP- siRNA particles were applied for systemic deliveries through either intraperitoneal (IP) or intravenous (IV) routes, respectively, reaching to the blood stream first and then to ocular neo vasculature, (e) Schematic structure of histidine-lysine polymer H3K4b. (f) Electron micrograph of an HKP-siRNA nanoparticle assembled as described herein. Fig. 3. The siRNA oligos were locally and systemically delivered into the ocular NV tissues, (al) FITC-labeled siClab was observed in angiogenic corneal cryosection 24 hr after SCJ administration, compared to the cryosection from the group (a2) treated with naked FITC-labeled siClab through the same route of delivery, (bl) FITC-labeled siClab was observed in angiogenic corneal cryosection 24 hr after IV injection of RPP-siClab, compared to the cryosection from the group (b2) treated with naked FITC-labeled siClab through the same systemic delivery, (c) ELISA analysis identified mVEGF protein down regulation. Systemically delivered (IV) RPP-simVEab resulted in significant (* P<0.05, n=8) knock down of VEGF protein (dots) compared to the RPP-siClab group (black), while the naked simVEab group (grey) only has minor down regulation, at both P4 and P7.
Fig. 4. Anti-angiogenesis efficacy on CpG induced ocular NV. (a) Systemic delivery (IV) of RPP-carried simVEab (dotted bar), simRlab (blank) and simR2ab (striped bar) (see Table 26 for the mixtures) significantly minimized angiogenesis areas in mouse eyes at P4 (* P< 0.05, n = 8) compared to RPP-siClab treated group (grey) and no treatment group (black), (b) Images from mouse eyes representing each treated group marked with the same pattern as (a), (c) At both P4 and P7, both locally (SCJ) delivered HSK-simVmix and systemically (IV) delivered RPP-simVmix demonstrated potent anti-angiogenesis efficacy. The angiogenesis areas of the treated groups (dot and stripe) are significantly smaller compared to the HKP-siClab and RPP-siCl treated groups (black and grey), with N = 8, and * represents P < 0.05. (d) Images of mouse eyes from both treated and control groups, indicated by the same marks as (c).
Fig. 5. Inhibition of Corneal NV with locally administration of siRNA duplexes in HSK model. The siRNA duplexes targeting only one gene (c. d. e) were able to inhibit corneal NV compared to control siRNA (a) in the eyes of HSK models. Locally delivered simVmix demonstrated stronger inhibition for corneal NV (b) compared to the siRNA targeting only a single gene. The pictures were taken at P4.
Fig. 6. Pharmacodynamics of the simVmix in mouse HSK model, (a) the HSK disease scores were measured at P6, 10, 14 and 22, after either local (SCJ) or systemic (IV) administrations of HKP-simVmix (see page 51) and RPP-simVmix at Pl and P3. Significant inhibition was observed for systemic (IV) delivered RPP-simVmix compared to RPP-siClab (* P < 0.05), at P14 and P22. The potency is comparable to the locally delivered HKP- simVmix . (b) Therapeutic efficacy of simVmix in the HSK model. At P22, the HKP- simVmix (stripe) and the RPP-simVmix (dot) treated groups exhibit healthy eyes compared to HKP-siClab (black) and RPP-siClab (grey) treated groups, which show severer HSK disease symptom, deformed and bloody corneal surfaces.
Fig. 7. Inhibition of Corneal NV with systemic administration of siRNA duplexes in HSK model. The siRNA duplexes targeting only one gene (c. d. e) were able to inhibit corneal NV compared to control siRNA (a) in the eyes of HSK models. Systemically delivered simVmix demonstrated stronger inhibition for corneal NV (b) compared to the siRNA targeting only a single gene. The pictures were taken at P4.
Fig. 8. Perfusion/Flatmount and cryosection analyses for simVmix efficacy on ROP model, (a) Comparison between routes of administration. IVT delivered HKP-simVmix using either regimen A (on P12 and P13; dots, n = 5) or regimen B (on P12, P14, and P16; stripe, n = 8) exhibited significant anti-angiogenesis efficacy (P < 0.05) compared to HKP- siClab treated groups (black and grey). But SCJ delivered simVmix resulted in no effect. IP delivered RPP-simVmix achieved similar results as that from the HKP-simVmix (P < 0.05) treated groups using either regimen A (n= 4) or regimen B (n=4). (b) Comparison between administration regimens. Since regimen B involved in three repeated injections, the retina samples for cryosection analysis were not achievable due to the retina damage. Samples from the regimen A with only twice IVT deliveries of HKP-simVmix (n = 5), and from IP deliveries of RPP-simVmix using either regiment A ( n = 4) or regimen B ( n = 4), both demonstrated significant anti-angiogenesis efficacy ( P < 0.05). (c) Images for Perfusion/Flatmount analyses, cl. Hypoxia induced ROP; c5. Normal; c2. IVT delivered HKP-siC2ab; c6. IVT delivered HKP-simVmix; c3. IP delivered RPP-siC2ab; c7. IP delivered RPP-simVmix; c4. SCJ delivered HKP-siC2ab and c8. SCJ delivered HKP- simVmix. (d) Images for Cryosection analyses, dl. Hypoxia induced ROP; d5. Normal; d2. IVT delivered HKP-siC2ab; d6. IVT delivered HKP-simVmix; d3. IP delivered RPP-siC2ab; d7. IP delivered RPP-simVmix; d4. SCJ delivered HKP-siC2ab and d8. SCJ delivered HKP- simVmix.
Fig. 9. Fluorescein-labeled retinal whole mount changes. The changes were examined in ischemic retinopathy mice with siRNA duplexes treated though subconjuctival, intravitreal or intraperitoneal injection, (al, 2) Normal retinal vasculature in a normal (control) mouse at P 17. (bl, 2) Extensive high fluorescent area of the retinal NV (arrows), (cl, 2) Many patches of retinal NV after subconjuctival injection of siC2ab (arrows), (dl, 2) Many patches of retinal NV after subconjuctival injection of simVmix (arrows), (el, 2 and gl, 2) Large patches of retinal NV after intravitreous or intraperitoneal injection of siC2ab respectively (arrows), (fl, 2 and hi, 2) Tiny patches of retinal NV after intravitreal or intraperitoneal injection of simVmix respectively (arrows).
Fig. 10. Histological changes in ischemic retinopathy mice. The histological changes were examined with siRNA treated though subconjuctival, intravitreal or intraperitoneal injection, (al, 2) Normal retinal vasculature in a normal (control) mouse at P17. (bl, 2) Extensive GSA positive retinal neovascularization (NV) extending above the internal limiting membrane (arrows), (cl, 2) Large clumps of retinal NV after subconjuctival injection of siC2ab (arrows), (dl, 2) Many clumps of retinal NV after subconjuctival injection of simVmix (arrows), (el, 2 and gl, 2) Large fronds of retinal NV after intravitreal or intraperitoneal injection of siC2ab respectively (arrows), (fl, 2 and hi, 2) Occasional small retinal NV after intravitreal or intraperitoneal injection of simVmix, extending above the internal limiting membrane respectively (arrows).
Fig. 11. SiRNA cocktail significantly silenced expression of VEGF, VEGFRl and VEGFR2. For each gene or protein, there are five bars: no treatment control (black), IVT delivered HKP-siC2ab (white) and HKP-simVmix (stripe), IP delivered RPP-siC2ab (grey) and RPP-simVmix (dot), (a) Q-RT-PCR analyses of mRNA levels. The upper panel shows samples treated with regimen A (on P12 and P13 and collected at P14 having significant knockdowns (P < 0.05, n = 3) for all three genes. The lower panel shows samples treated with regimen B (on P 12, P 14, and P 16) and collected at P 17 exhibiting significant knockdowns (P < 0.05, n = 3) for all three genes, (b) ELISA analyses of protein levels. The upper panel shows samples treated with regimen A and collected at P14 having significant knockdowns (P < 0.05) for all three proteins: VEGF (n = 4), VEGFRl (n = 4) and VEGFR2 (n = 5). The lower panel shows samples treated with regimen B and collected at P17 exhibiting the significant knockdowns (P < 0.05) for all three proteins, (c) Schematic drawing illustrating a proposed model for the activity of the cocktail simVmix simultaneously targeting genes in various parts of the VEGF pathway: VEGF (A, B, C), VEGFRl (FLT-I) and VEGFR2 (FIk- 1/KDR).
Fig. 12. RT-PCR analysis of VEGF, VEGFRl, VEGFR2 mRNA levels. The mRNA levels in the retina tissues at P14 and P17 were examined after intravitreal and intraperitoneal injection of simVmix (see page 51). IPN and IVT represent intraperitoneal or intravitreal administration respectively
Fig. 13. Suppression of expression of human VEGF in human cells.
Fig. 14. Comparison of siRNA effectiveness in suppressing VEGF in human and mouse cells. Fig. 15. Comparison of effectiveness of five 25 mer VEGF-Rl specific siRNA duplexes in suppressing gene expression.
Fig. 16. Comparison of effectiveness of three 25 mer MMP-9 specific siRNA duplexes in suppressing gene expression.
Fig. 17. Comparison of effectiveness of three 25 mer PDGF specific siRNA duplexes in suppressing gene expression.
DETAILED DESCRIPTION siRNA inhibitors
The present invention provides novel siRNA targeting sequences. There are three important characteristics that distinguish the instant siRNA molecules and their targets:
(1) Sequences targeted by siRNA duplexes are identical in the human and mouse sequences of the same, or orthologous, gene. That means each of the siRNA duplexes will be able to suppress the expression of the same gene target in both human and mouse cells, which is advantageous in drug development. For example, a potent siRNA specific to VEGF gene will be able to knockdown both human VEGF in human cells and mouse VEGF gene expression in mouse cells.
(2) The sequences generally have three different lengths: 21 nucleotides (nt), 23 nt and 25 nt. One consideration contributing to this variation in length is that siRNAs that are 23 nt or 25 nt in length are usually more potent than 21 nt siRNAs, but on the other hand 25 nt siRNAs may induce unwanted interferon response more than shorter length oligonucleotides. Therefore, siRNA duplexes at various lengths will provide the best chance to identify potent inhibitors with minimal interferon response.
(3) The siRNA oligos are provided in either blunt end or sticky end form,. A "blunt" end designates a duplex in which the terminal nucleotide on each strand is paired with a nucleotide on the opposite strand. A "sticky" end or staggered end designates a duplex having a terminus in which one strand extends additional unpaired nucleotides beyond a paired nucleotide on the opposing strand. The additional unpaired nucleotides at a staggered end are termed an "overhang" herein, and such nucleotides are termed overhanging nucleotides. Staggered end siRNA oligos may be sensitive to degradation while the blunt end may activate the cellular interferon response. As used herein, "oligonucleotides", "oligos", and similar terms based on this relate to short oligonucleotides composed of naturally occurring nucleotides as well as to oligonucleotides composed of synthetic or modified nucleotides. siRNAs provided herein may be constituted purely of ribonucleotides, or they may have certain designated positions occupied by deoxynucleotides. In addition, oligonucleotides provided in this invention may be constituted entirely of deoxynucleotides which provide siRNA molecules by transcription processes. An oligonucleotide that is an siRNA may have any number of nucleotides between 19 and 35 nucleotides. In many embodiments an siRNA may have any number of nucleotides between 19 and 27 nucleotides. Oligonucleotides may be 19 or more nucleotides in length, or 20, or 21, or 22, or 23, or 24, or 25, or 26, or 27, or more nucleotides in length, including any integral number of nucleotides up to 35 or more in length. siRNA oligonucleotides are generally double stranded and include a sense strand and an antisense strand. Alternatively an siRNA may be single stranded at a certain point in its preparation prior to being paired with a complementary strand to form a duplex. Either of such single stranded oligonucleotides is also included within the use of the term siRNA herein. siRNA molecules are termed "targeting" oligonucleotides or "directed" oligonucleotides herein. The base sequence of the siRNA directs or targets the siRNA to a particular target sequence within an mRNA or viral RNA whose expression is intended to be suppressed. The base sequence within the mRNA so targeted by the siRNA is the "target" sequence as used herein.
In many embodiments, an siRNA may have two blunt ends, or two sticky ends, or it may have one blunt end and one sticky end. The overhang nucleotides of a sticky end can range from one to four or more.
In a preferred embodiment, the invention provides siRNA compositions of 21, 23 and 25 base pairs with blunt ends.
The terms "polynucleotide" and "oligonucleotide" are used synonymously herein.
As used herein, a "mixture", and related words and phrases, relates to a composition that contains a plurality of siRNA molecules. As disclosed herein, a mixture of siRNA molecules may have improved beneficial effects, when used to treat a disease or pathology, than a composition that contains only a single species of siRNA. Commonly, a mixture may contain two siRNA species, or three siRNA species, or four siRNA species, or even more. As used herein, a "cocktail" of siRNA molecules and a mixture thereof are synonymous.
A composition of the invention may include a single siRNA oligonucleotide, or it may contain a plurality of targeting siRNA molecules. A composition or mixture may further include, in addition to the at least one siRNA molecule, a polymeric and/or a liposome carrier. By way of nonlimiting example, a polymeric carrier may comprise a cationic polymer that binds to the RNA molecule to form a nanoparticle (between 50-500 nm in diameter). The cationic polymer may be an amino acid copolymer (such as a copolypeptide), containing, for example, histidine and lysine residues. The polymer may additionally comprise a branched polymer. The composition may comprise a targeting synthetic carrier. The synthetic carrier may comprise a cationic polymer, a hydrophilic polymer, and a targeting ligand. The polymer may comprise a polyethyleneimine, the hydrophilic polymer may comprise a polyethylene glycol or a polyacetal, and the targeting ligand may comprise a peptide comprising an RGD sequence, a transferrin targeting ligand, a protamine or a single chain antibody, etc.
In any of these methods, an electric field may be applied to a tissue substantially contemporaneously with the composition. The composition and method of the invention comprises dsRNA oligonucleotides with a sequence matching an endogenous human gene or a mutated endogenous gene, and at least one mutation in the mutated gene may be in a coding or regulatory region of the gene. In any of these methods, the endogenous gene may be selected from the group consisting of angiogenesis related genes including growth factor genes, protein serine/threonine kinase genes, protein tyrosine kinase genes, protein serine/threonine phosphatase genes, protein tyrosine phosphatase genes, receptor genes, and transcription factor genes.
Inhibition of Viral Infection
One of the well established causes of ocular neovascularization is herpes and other viral infections. A means to intervene in ocular neovascularization derived from viral infections is to inhibit the originating viral infection. The RNAi agents utilize an endogenous process active against dsRNA viral infections but can be used to inhibit expression from virtually any mRNA, and with a high degree of selectivity. The invention provides for RNAi agents for inhibiting ocular viral infections as a means to intervene in ocular neovascularization. The RNAi agents of the invention include short dsRNA oligonucleotides, siRNA, with a sequence matching viral gene sequences and lacking sequence specificity for human genes. The RNAi agents of the invention inhibit mRNA expressed by either DNA or RNA viral infections and they degrade the genome of dsRNA viral infections. One DNA viral infection inhibited by the RNAi agents of the invention is HSV, which causes herpetic stromal keratitis. This virus has a relative large genome that remains episomal and where expression levels of viral mRNA rise and fall over time. The continuous low levels of HSV viral mRNA expression result in a persistent, albeit quiescent, infection that flairs up from time to time. The RNAi agents of the invention are useful to inhibit rising HSV mRNA expression associated with recurrence of infection. By reducing the ability of the infection to flair up, the RNAi agents protect from induction of ocular neovascularization disease. The RNAi agents also are useful to diminish the continuous, low level HSV mRNA expression to even lower levels, which diminishes the ability of the HSV infection to flair up. The RNAi agents are effective to inhibit the DNA and RNA viral infections of ocular tissues that lead to ocular neovascularization. The siRNA sequences were designed targeting respectively to HSV-I and HSV-2 viral UL5 and UL29 genes, with ten 21-mer, ten 23-mer and ten 25-mer in length. The inhibitory siRNA duplexes can be synthesized according to those targeted sequences as one sense single-stranded RNA oligo and one antisense single- stranded RNA oligo first. Depending on the actual design of the duplexes being blunt-ended, 2, 3 or more nt overhang, the double- stranded siRNA duplexes can be annealed as either blunt-ended or overhang (3' end). The sequences of UL5 gene of both HSV- 1 and HSV-2 targeted by designed siRNAs are listed in Table 1. The sequences of UL29 gene of both HSV-I and HSV-2 targeted by designed siRNAs are listed in Table 2. HSV UL5 and UL29 genes are included in the group of genes considered to be herpesvirus essential genes. (Note: the lists of the sequences in this application are the target sequences from cDNA. The sequences can easily be transcribed into RNA sequences for preparation of siRNA' s by changing thymidine (t) to uridine (u). Only sense strand sequences are listed in the tables. The antisense sequences can be easily added by the base pairing rules).
Table 1:. The targeted sequences ofUL5 gene ofboth HSV-I and HSV-^>
Organism Gene Length No. Sense Sequences SEQ ID NO:
HSV1.HSV-2 UL5 21-mer 1 gctgatgccgtagtcggcgtt 1
2 cctgggagcgcgtgatggtca 2
3 ctgcatgtgctcctcggtgat 3
4 ggccgtactccagcaccttca 4
5 cgtactccagcaccttcatga 5
6 ctccagcaccttcatgaggtt 6
7 gcggttgcagatgaggtacgt 7
8 gatgaggtacgtgagcacgtt 8
9 ggtgtggtacagggcgttaat 9
10 cctggacgtgattcccgcgaa 10
23-mer 1 gacatcagccccccgcgcggcga 11
2 cccgcgcggcgagccggtcagca 12
3 gtaggcgtggagcttggccatgt 13
4 gttgcagatgaggtacgtgagca 14
5 gcggttgcagatgaggtacgtga 15
6 ggtgtggtacagggcgttaatca 16
7 gggcgttaatcatccaccagcaa 17
8 gcgttaatcatccaccagcaata 18
9 cgccacgtcccggaaccactgca 19
10 ggcctggacgtgattcccgcgaa 20
25-mer 1 cggacatcagccccccgcgcggcga 21
2 cccccgcgcggcgagccggtcagca 22
3 ggtaggcgtggagcttggccatgta 23
4 cggttgcagatgaggtacgtgagca 24
5 gtgcggttgcagatgaggtacgtga 25
6 gggtgtggtacagggcgttaatcat 26
7 cagggcgttaatcatccaccagcaa 27
8 gcgttaatcatccaccagcaataca 28
9 gccgccacgtcccggaaccactgca 29
10 gggcctggacgtgattcccgcgaaa 30
Figure imgf000023_0001
Inhibition of Inflammatory Cells and Pathways Stimulating Ocular NV
Inflammation is a process that involves many cells and biochemical factors, but despite its complexity the process is highly conserved across tissues. One of the early events in inflammation is secretion of activating factors as a result of tissue hypoxia, damage, or other insults. These factors activate cells and induce recruitment of inflammatory cells into the tissue, which secrete additional activating factors. One common biochemical pathway for induction of inflammation is secretion of TNF and IL-I. These factors act in a largely parallel manner so that strong inhibition of their activation of an inflammation cascade requires intervening in both simultaneously. Downstream of this point, the inflammatory cascade results in secretion of factors to induce neovascularization. The inflammatory process offers many points for intervention: upstream at secreted factors initiating the cascade; and downstream at factors responsible for activating specific cells in the cascade, such as endothelial cell recruitment of neutrophils from the blood and endothelial cell induction of neovascularization. The invention provides RNAi agents effective for inhibiting factors whose upregulation and role in inflammation depends on gene expression of the factor. While many secreted factors are present in cells and released to initiate inflammation, up regulation of expression of those same factors is important for continued expansion of the inflammation and for persistent of the inflammation. The RNAi agents of the invention provide for inhibition of persistent inflammation, which is a greater contributor to the ocular neovascularization disease. Numerous factors are involved in the inflammation pathway and specifically for the persistent ocular inflammation that leads to ocular neovascularization disease, including and importantly endothelial cell activation. In this invention, certain siRNA sequences target Interleukin-1 beta (IL- lβ) and Tumor Necroses Factor alpha (TNF α) genes of both human and mouse. The siRNA targeted sequences are 21-mer, 23-mer and 25- mer in length. The inhibitory siRNA duplexes can be synthesized according to those targeted sequences as one sense single- stranded RNA oligo and one antisense single- stranded RNA oligo first. Depending on the actual design of the duplexes being blunt-ended, or 2, 3 or more nt overhang, the double-stranded siRNA duplexes can be annealed as either blunt-ended or overhang (3' end). The targeted sequences of IL- lβ gene of both human and mouse are listed in Table 3. The targeted sequences of TNFα gene of both human and mouse are listed in Table 4. The targeted sequences of cyclooxygenase (COX)-2 gene of both human and mouse are listed in Table 5.
Inhibition of Factors in Angiogenic Pathways
The angiogenesis process, like inflammation, is complex but highly conserved across tissues. Another similarity is the major role several secreted factors play. Hypoxia inducible factor-1 (HIF-I) is a transcription factor composed of HIF-lalpha and HIF-lbeta subunits. HIF-I transactivates multiple genes whose products play key roles in oxygen homeostasis, including vascular endothelial growth factor (VEGF). An early step is driven by the VEGF pathway that involves secretion of VEGF growth factors, which bind and activate cells bearing different members of the VEGF family of receptors. The VEGF family is composed of five structurally related growth factors: VEGF-A, Placenta Growth factor Table 3: The targeted sequences of IL-Ip gene ofboth human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse IL-1 beta 21-mer 1 ttccttcatctttgaagaaga 61
2 gacaaaatacctgtggccttg 62
3 caaaatacctgtggccttggg 63
4 aatacctgtggccttgggcct 64
5 acctgtggccttgggcctcaa 65
6 tacccaaagaagaagatggaa 66
7 cccaaagaagaagatggaaaa 67
8 caaagaagaagatggaaaagc 68
9 tttgtcttcaacaagatagaa 69
10 ccccaactggtacatcagcac 70
23-mer 1 gacaaaatacctgtggccttggg 71
2 aaaatacctgtggccttgggcct 72
3 atacctgtggccttgggcctcaa 73
4 tacccaaagaagaagatggaaaa 74
5 cccaaagaagaagatggaaaagc 75
6 agttccccaactggtacatcagc 76
7 tccccaactggtacatcagcacc 77
8 ccccaactggtacatcagcacct 78
25-mer 1 gacaaaatacctgtggccttgggcc 79
2 acaaaatacctgtggccttgggcct 80
3 aaatacctgtggccttgggcctcaa 81
4 tacccaaagaagaagatggaaaagc 82
5 agttccccaactggtacatcagcac 83
6 gttccccaactggtacatcagcacc 84
7 tccccaactggtacatcagcacctc 85
(PIGF), VEGF-B, VEGF-C, and VEGF-D. Known receptors include three structurally homologous tyrosine kinase receptors, VEGFR-I (FIt-I), VEGFR-2 (KDR or FIk-I), and VEGFR-3 (Flt-4), with different affinity or functions related to different VEGF members. The targeted sequences of HIF- lα gene of both human and mouse are listed in Table 6.
In addition, Tables 4, 10 16, and 35 include sequences that target only the human ortholog of the gene, some of which include a -dtdt overhang at the 3' end. Table 4. The targeted sequences of TNFα gene of both human and mouse.
Figure imgf000026_0001
s: Sense strand; a: Antisense strand Table 5. The targeted sequences of cyclooxygenase (COX)-2 gene of both human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse COX-2 21-mer 1 caaaagctgggaagccttctc 129
2 gatgtttgcattctttgccca 130
3 cattctttgcccagcacttca 131
4 catcagtttttcaagacagat 132
5 cagtttttcaagacagatcat 133
6 gtttttcaagacagatcataa 134
7 ctgcgccttttcaaggatgga 135
8 gtctttggtctggtgcctggt 136
9 ctttggtctggtgcctggtct 137
10 ggagcaccattctccttgaaa 138
23-mer 1 gatgtttgcattctttgcccagc 139
2 catcagtttttcaagacagatca 140
3 cagtttttcaagacagatcataa 141
4 ctgcgccttttcaaggatggaaa 142
5 gtctttggtctggtgcctggtct 143
6 ctttggtctggtgcctggtctga 144
7 ggtctggtgcctggtctgatgat 145
8 ctggtgcctggtctgatgatgta 146
9 gcctggtctgatgatgtatgcca 147
10 gagcaccattctccttgaaagga 148
25-mer 1 gatgtttgcattctttgcccagcac 149
2 catcagtttttcaagacagatcata 150
3 gtttttcaagacagatcataagcga 151
4 gtctttggtctggtgcctggtctga 152
5 ggtctggtgcctggtctgatgatgt 153
6 gtgcctggtctgatgatgtatgcca 154
7 gagcaccattctccttgaaaggact 155
8 caccattctccttgaaaggacttat 156
9 cctcaattcagtctctcatctgcaa 157
10 caattcagtctctcatctgcaataa 158
Table 6. The targeted sequences of HIF-Iα gene ofboth human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse HIF-1 alpha 21-mer 1 gttctgaacgtcgaaaagaaa 159
2 gaagttttttatgagcttgct 160
3 gagcttgctcatcagttgcca 161
4 cagtacaggatgcttgccaaa 162
5 gctccctatatcccaatggat 163
6 ctggacacagtgtgtttgatt 164
7 cacagtgtgtttgattttact 165
8 gtggattaccacagctgacca 166
9 cagaaacctactgcagggtga 167
10 ggtgaagaattactcagagct 168
23-mer 1 ctgaacgtcgaaaagaaaagtct 169
2 gaagttttttatgagcttgctca 170
3 gagcttgctcatcagttgccact 171
4 gacagtacaggatgcttgccaaa 172
5 gaactaactggacacagtgtgtt 173
6 cacagtgtgtttgattttactca 174
7 gacacagtgtgtttgattttact 175
8 ctcatccatgtgaccatgaggaa 176
9 gaccatgaggaaatgagagaaat 177
10 gagaaatgcttacacacagaaat 178
25-mer 1 gttttttatgagcttgctcatcagt 179
2 gacacagtgtgtttgattttactca 180
3 caggacagtacaggatgcttgccaa 181
4 ctcatccatgtgaccatgaggaaat 182
5 catgtgaccatgaggaaatgagaga 183
6 ccatgaggaaatgagagaaatgctt 184
7 gagagaaatgcttacacacagaaat 185
8 ccgctcaatttatgaatattatcat 186
9 ctcaatttatgaatattatcatgct 187
10 ggatgcttgccaaaagaggtggata 188
The targeted sequences of VEGF A gene of both human and mouse are listed in Table 7.
Table 7: The targeted sequences of VEGF A gene of both human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse VEGFA 21-mer 1 gtgtgcgcagacagtgctcca 189
2 ccaccatgccaagtggtccca 190
3 cctggtggacatcttccagga 191
4 gcacataggagagatgagctt 192
5 caagatccgcagacgtgtaaa 193
6 ggcgaggcagcttgagttaaa 194
7 cttgagttaaacgaacgtact 195
8 ggaaggagcctccctcagggt 196
9 cactttgggtccggagggcga 197
10 cagtattcttggttaatattt 198
23-mer 1 gcctccgaaaccatgaactttct 199
2 ctccaccatgccaagtggtccca 200
3 cctggtggacatcttccaggagt 201
4 cagcacataggagagatgagctt 202
5 gcttgagttaaacgaacgtactt 203
6 gttaaacgaacgtacttgcagat 204
7 ggaaggagcctccctcagggttt 205
8 ctccctcagggtttcgggaacca 206
9 ctaatgttattggtgtcttcact 207
10 gagaaagtgttttatatacggta 208
25-mer 1 cctccgaaaccatgaactttctgct 209
2 ccaccatgccaagtggtcccaggct 210
3 ccctggtggacatcttccaggagta 211
4 gatccgcagacgtgtaaatgttcct 212
5 cgcagacgtgtaaatgttcctgcaa 213
6 gtaaatgttcctgcaaaaacacaga 214
7 cagcttgagttaaacgaacgtactt 215
8 gttaaacgaacgtacttgcagatgt 216
9 ccatgccaagtggtcccaggctgca 217
10 ccctggtggacatcttccaggagta 218
The targeted sequences of VEGF B gene of both human and mouse are listed in Table 8. The targeted sequences of PIGF gene of both human and mouse are listed in Table 9. The targeted sequences of VEGFR-I (FIt-I) gene of both human and mouse are listed in Table 10 and corresponding siRNA sequences are in Table 35. The targeted sequences of VEGFR- 2 gene of both human and mouse are listed in Table 11. Table 8: The targeted sequences of VEGF B gene of both human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse VEGFB 21-mer 1 gactgtgcaggtgactgtgca 219
2 cgctgtggtggctgctgccct 220
3 ggtggctgctgccctgacgat 221
4 ggagatgtccctggaagaaca 222
5 ctgacccccggacctgccgct 223
6 ccaagggcggggcttagagct 224
7 gggcttagagctcaacccaga 225
8 gcttagagctcaacccagaca 226
9 gtccctggaagaacacagcca 227
10 tctgttccgggctgggactct 228
23-mer 1 gactgtgcagcgctgtggtggct 229
2 cgctgtggtggctgctgccctga 230
3 gtggtggctgctgccctgacgat 231
4 ggagatgtccctggaagaacaca 232
5 gagcagtcagctgggggagatgt 233
6 ccctgacccccggacctgccgct 234
7 caagggcggggcttagagctcaa 235
8 cggggcttagagctcaacccaga 236
9 cttagagctcaacccagacacct 237
10 cgccctgacccccggacctgccg 238
25-mer 1 gtgactgtgcagcgctgtggtggct 239
2 gctgtggtggctgctgccctgacga 240
3 ctgtggtggctgctgccctgacgat 241
4 ggggagatgtccctggaagaacaca 242
5 ccgagcagtcagctgggggagatgt 243
6 cgccctgacccccggacctgccgct 244
7 gccaagggcggggcttagagctcaa 245
8 ggcggggcttagagctcaacccaga 246
9 ggcttagagctcaacccagacacct 247
10 ccctgacccccggacctgccgctgc 248
Other Growth Factors Involved in Angio genesis
Another major secreted angiogenic growth factor is bFGF, which actives a separate set of receptors. Both of these pathways activate endothelial cells in nearby vasculature, and stimulate their proliferation and migration to form new vasculature into the region secreting the growth factor stimulants. However, the intracellular kinase signal transduction pathways induced by the VEGF and bFGF pathways merge at a common point related to A-RAF or its downstream target transcription factors such as NFkB. Thus the VEGF and bFGF pathways act somewhat in parallel up to a point where they become the same. These secreted growth factor pathways of neovascularization represent a very useful point for therapeutic intervention, as provided by the invention, either by inhibiting the growth factors or their Table 9: The targeted sequences of PIGF gene of both human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse PIGF 21-mer 1 gtttgttaggaccaaacctca 249
2 taggaccaaacctcaaagcat 250
3 accaaacctcaaagcatggct 251
4 cctattccactggattgggaa 252
5 ctattccactggattgggaaa 253
6 gcgacctttggctacgtggct 254
7 ctttggctacgtggctggcct 255
8 caacatgatgtgattgtagct 256
9 catgatgtgattgtagctttt 257
10 gagagattgtaccttctagtt 258
23-mer 1 gtttgttaggaccaaacctcaaa 259
2 gttaggaccaaacctcaaagcat 260
3 ggaccaaacctcaaagcatggct 261
4 ctattccactggattgggaaaga 262
5 gagcgacctttggctacgtggct 263
6 acctttggctacgtggctggcct 264
7 caacatgatgtgattgtagcttt 265
8 catgatgtgattgtagcttttta 266
9 ctgagagattgtaccttctagtt 267
10 gtaccttctagttgaaataaagt 268
25-mer 1 gttaggaccaaacctcaaagcatgg 269
2 gtttgttaggaccaaacctcaaagc 270
3 taggaccaaacctcaaagcatggct 271
4 cctattccactggattgggaaagac 272
5 cgacctttggctacgtggctggcct 273
6 caacatgatgtgattgtagcttttt 274
7 aacatgatgtgattgtagcttttta 275
8 ctgagagattgtaccttctagttga 276
9 ccctgagagattgtaccttctagtt 277
10 gtaccttctagttgaaataaagtat 278
receptors, or both. The invention also provides for inhibiting both pathways simultaneously, as well as for inhibition of intracellular signaling induced by these pathways such as the induced signal transduction kinases, or in a preferred embodiment the transcription factors. The transcription factors have been established as useful points for therapeutic intervention but have been intractable to conventional therapeutic modalities. The bFGF pathway is one of several FGF pathways. The bFGF factor is a strong stimulator of angiogenesis and thus it and its receptors are an important point for therapeutic intervention. The invention provides siRNA agents specific for inhibition of bFGF and its receptors, and intracellular signal transduction pathway. Table 10: The targeted sequences of VEGFR-I (FIt-I) gene of both human and mouse. VEGFR1
Figure imgf000032_0001
Table 11: The targeted sequences of VEGFR- 2 gene of both human and mouse.
Figure imgf000032_0002
Figure imgf000033_0001
The targeted sequences of bFGF gene of both human and mouse are listed in Table 12. The targeted sequences of A-RAF gene of both human and mouse are listed in Table 13. The targeted sequences of mTOR gene of both human and mouse are listed in Table 14. Table 12: The targeted sequences of bFGF gene of both human and mouse.
Figure imgf000033_0002
Figure imgf000034_0001
Table 13: The targeted sequences of A-RAF gene of both human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse A-RAF 21-mer 1 ggccctgaaggtgcggggtct 369
2 cactgcctgggacacagccat 370
3 ctgaccatgcacaattttgta 371
4 ccatgcacaattttgtacgga 372
5 catgcacaattttgtacggaa 373
6 ctgtgacttctgccttaagtt 374
7 ctgccttaagtttctgttcca 375
8 ggaagtccccacattccaagt 376
9 gaggaagtccccacattccaa 377
10 gatccgtatgcaggacccgaa 378
23-mer 1 gtcactgcctgggacacagccat 379
2 gaccatgcacaattttgtacgga 380
3 catgcacaattttgtacggaaga 381
4 gtggctacaagttccaccagcat 382
5 ctacaagttccaccagcattgtt 383
6 caagttccaccagcattgttcct 384
7 caccagcattgttcctccaaggt 385
8 gaggaagtccccacattccaagt 386
9 cctggggtaccgggactcaggct 387
10 ggtgatccgtatgcaggacccga 388
25-mer 1 ctgaccatgcacaattttgtacgga 389
2 cctgtggctacaagttccaccagca 390
3 ctgaccatgcacaattttgtacgga 391
4 ggctacaagttccaccagcattgtt 392
5 cctgtggctacaagttccaccagca 393
6 gggaggaagtccccacattccaagt 394
7 gtgaagaacctggggtaccgggact 395
8 cagcattgttcctccaaggtcccca 396
9 cctggggtaccgggactcaggctat 397
10 gaggtgatccgtatgcaggacccga 398 Table 14: The targeted sequences of mTOR gene of both human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse mTOR 21-mer 1 gccgaagccgcgcgaacctca 399
2 gccgcgcgaacctcagggcaa 400
3 gaggagtctactcgcttctat 401
4 ggtttccagctcagatgccaa 402
5 gctcagatgccaatgagagga 403
6 cagcatggagggagagcgtct 404
7 ggtgtgccagtgggtgctgaa 405
8 ggtgtcctttgtgaagagcca 406
9 ccagctgtttggcgccaacct 407
10 gccagggatctcttcaatgct 408
23-mer 1 gccgcgcgaacctcagggcaaga 409
2 gaggagtctactcgcttctatga 410
3 gtttccagctcagatgccaatga 411
4 cagctcagatgccaatgagagga 412
5 cagcatggagggagagcgtctga 413
6 caggccatcaccttcatcttcaa 414
7 ggtgtcctttgtgaagagccaca 415
8 cactacaaagaactggagttcca 416
9 gccatgaaacactttggagagct 417
10 gaggttatccagtacaaacttgt 418
25-mer 1 gcgcgaacctcagggcaagatgctt 419
2 gtttccagctcagatgccaatgaga 420
3 cagcatggagggagagcgtctgaga 421
4 caggccatcaccttcatcttcaagt 422
5 ccagctgtttggcgccaacctggat 423
6 cactacaaagaactggagttccaga 424
7 gccatggtttcttgccacatgctgt 425
8 ggtcccttgtggtcagccctcatga 426
9 ctgcgtcatgccagcggggccaaca 427
10 ggtttgattatggtcactggccaga 428
Factors Involved in Neovasculature Formations
Matrix metalloproteinases are a family of extracellular matrix-degrading enzymes associated with neovascularization. Matrix metalloproteinases (MMP)-2 and -9 play an important role in the pathogenesis of choroidal neovascularization (CNV). Retinal pigment epithelial cells (RPE) are an important source of MMPs in the outer retinal environment, however little is known about the local factors that modulate MMP secretion in these cells. There are studies showed resting RPE cells secreted MMP-2 but not MMP-9, and stimulation with TNF-alpha induced secretion of MMP-9 and increased the secretion of MMP-2. MMP- 2 secretion was also increased by stimulation with VEGF, but not bFGF. Therefore, we strongly believe that MMP-2 and MMP-9 should be another set of targets for anti- angiogenesis treatment. There is evidence implicating the integrins alpha v beta 3 and alpha v beta 5 in the ocular angiogenic process. Examination of the expression of alpha v beta 3 and alpha v beta 5 in neovascular ocular tissue from patients with subretinal neovascularization from age-related macular degeneration or the presumed ocular histoplasmosis syndrome or retinal neovascularization from proliferative diabetic retinopathy (PDR) indicated that only alpha v beta 3 was observed on blood vessels in ocular tissues with active neovascularization from patients with age-related macular degeneration or presumed ocular histoplasmosis, whereas both alpha v beta 3 and alpha v beta 5 were present on vascular cells in tissues from patients with PDR. The targeted sequences of MMP-2 gene of both human and mouse are listed in Table 15. The targeted sequences of MMP-9 gene of both human and mouse are listed in Table 16. The targeted sequences of integrins alpha v beta 3 (Integrin αVβ3) gene of both human and mouse are listed in Table 17.
Table 15: The targeted sequences of MMP-2 gene of both human and mouse.
Figure imgf000036_0001
Table 16: The targeted sequences of MMP-9 gene of both human and mouse.
Organism Gene Length No. Sense Sequences SEQ ID NO:
Human, Mouse MMP-9 21-mer 1 catccagtttggtgtcgcgga 459
2 ccagtttggtgtcgcggagca 460
3 gcggagcacggagacgggtat 461
4 cggagacgggtatcccttcga 462
5 gagctgtgcgtcttccccttc 463
23-mer 1 gtcatccagtttggtgtcgcgga 464
2 gcgcggagcacggagacgggtat 465
3 ggagcacggagacgggtatccct 466
25-mer 1 ccagtttggtgtcgcggagcacgga 467
2 cgcgcgcggagcacggagacgggta 468
3 cggagcacggagacgggtatccctt 469
Human | 21-mer Is CCACCACAACAUCACCUAUTT 470
Ia AUAGGUGAUGUUGUGGUGGTT 471
2s GCCAGUUUCCAUUCAUCUUTT 472
2a AAGAUGAAUGGAAACUGGCTT 473
3s GCGCUGGGCUUAGAUCAUUTT 474
3a AAUGAUCUAAGCCCAGCGCTT 475
4s GCAUAAGGACGACGUGAAUTT 476
4a AUUCACGUCGUCCUUAUGCTT 477
5s CCUGCAACGUGAACAUCUUTT 478
5a AAGAUGUUCACGUUGCAGGTT 479
6s GGAACCAGCUGUAUUUGUUTT 480
6a AACAAAUACAGCUGGUUCCTT 481
7s GCCAGUUUGCCGGAUACAATT 482
7a UUGUAUCCGGCAAACUGGCTT 483
8s CCAGUUUGCCGGAUACAAATT 484
8a UUUGUAUCCGGCAAACUGGTT 485
9s GCCGGAUACAAACUGGUAUTT 486
9a AUACCAGUUUGUAUCCGGCTT 487
10s CCGGAUACAAACUGGUAUUTT 488
10a AAUACCAGUUUGUAUCCGGTT 489 Table 16 continued
Human 25-mer is UGGCACCACCACAACAUCACCUAUU 490 la AAUAGGUGAUGUUGUGGUGGUGCCA 491
2s CACAACAUCACCUAUUGGAUCCAAA 492
2a UUUGGAUCCAAUAGGUGAUGUUGUG 493
3s GACGCAGACAUCGUCAUCCAGUUUG 494
3a CAAACUGGAUGACGAUGUCUGCGUC 495
4s GGAAACCCUGCCAGUUUCCAUUCAU 496
4a AUGAAUGGAAACUGGCAGGGUUUCC 497
5s CAUUCAUCUUCCAAGGCCAAUCCUA 498
5a UAGGAUUGGCCUUGGAAGAUGAAUG 499
6s ACGAUGCCUGCAACGUGAACAUCUU 500
6a AAGAUGUUCACGUUGCAGGCAUCGU 501
7s GCGGAGAUUGGGAACCAGCUGUAUU 502
7a AAUACAGCUGGUUCCCAAUCUCCGC 503
8s CGGAGAUUGGGAACCAGCUGUAUUU 504
8a AAAUACAGCUGGUUCCCAAUCUCCG 505
9s CAGUACCGAGAGAAAGCCUAUUUCU 506
9a AGAAAUAGGCUUUCUCUCGGUACUG 507
10s AAGCCUAUUUCUGCCAGGACCGCUU 508
10a AAGCGGUCCUGGCAGAAAUAGGCUU 509 s: Sense strand; a: Antisense strand
Table 17: The targeted sequences of Integrin αVβ3 gene of both human and mouse.
Figure imgf000038_0001
Figure imgf000039_0001
SiRNA cocktail Therapeutics for Ocular Diseases
Human disease is a complicated pathological process showing various severities of disease symptoms. Many human diseases are caused by abnormal over expressions of disease causing or disease control genes from human body itself, or from foreign infectious organisms, or both. The disease progression and development of drug resistance can also circumvent the effect of single drug treatment. One strategy to overcome those hurdles is using combination of multiple drugs. The invention provides the therapeutic siRNA cocktail targeting multiple disease controlling genes in the same treatment. As used herein, "cocktail" and similar terms and phrases relates to a pharmaceutical composition that includes more than one siRNA molecule. The invention provides for RNAi agents, such as siRNA oligonucleotides, that are chemically similar to the same source of supply and the same manufacturing process, and they are comprised of four types of nucleotides with different sequences. The invention provides the siRNA cocktail drug for treatments of several types of ocular disease, including Uveitis, AMD, PDR and HSK, etc, acting on multiple aspects of the diseases and reducing potential toxicity.
This invention defines following important characteristics of an siRNA cocktail and its applications in the experimental and therapeutic settings:
(1) The siRNA cocktail should contain at least two siRNA duplexes targeting at least two genes (not two sequences of the same gene) at a ratio of therapeutic requirement.
(2) The siRNA cocktail design for each combination must follow the understanding of the role of each gene in a background of the system biology network, such as these genes are functioning either in the same pathway or in a different one. (3) The chemical property of each siRNA duplexes in the cocktail must be the same in terms of source of supply, manufacturing process, chemical modification, storage conditions and formulation procedures.
(4) Each individual siRNA duplex in the cocktail can be different in their lengths, with either blunt or sticky end, as long as their potencies have been defined.
(5) Since siRNA cocktail is targeting multiple genes and a single cell type usually dose not express all those factors, the efficacy of a siRNA cocktail must be tested in a relevant disease model, either a multiple cell model, a tissue model or a animal model, after the confirmation of the potency of each individual siRNA duplex in the cell culture.
(6) Each validated siRNA cocktail can be used for addressing one or more pathological conditions, for treatment of one or multiple types of diseases, such as, siRNA cocktail for suppressing inflammation, siRNA cocktail for antiangiogenesis activity and siRNA cocktail for autoimmune conditions.
(7) The siRNA cocktail must be administrated through the same route of delivery in the same formulation, although the regimen of dosing for each cocktail will be defined based on either the experimental design or therapeutic requirement.
(8) Each siRNA cocktail can be applied either independently, or in combination with other drug modalities such as small molecule inhibitors, monoclonal antibodies, protein and peptides, and other siRNA cocktail drug(s).
Examples of siRNA Cocktail Design
Step 1: Defining the pathological condition for the siRNA cocktail design.
Inflammation is a process that involves many cells and biochemical factors, but despite its complexity the process is highly conserved across tissues. One of the early events in inflammation is secretion of activating factors as a result of tissue hypoxia, damage, or other insults. One common biochemical pathway for induction of inflammation is secretion of TNF alpha and IL- 1 beta. Cyclooxygenases (COX) are rate-limiting enzymes involved in the conversion of PLA(2)-mobilized arachidonic acid into prostaglandins and thromboxanes. COX-2 is a key mediator of inflammation during both physiologic and pathologic responses to endogenous stimuli and infectious agents. Clearly, targeting TNF alpha, IL-I beta and COX-2 using siRNA cocktail may provide a potent anti-inflammatory agent for treatment of the ocular inflammatory disease such as Uveitis. Step 2: Selection of potent siRNA duplexes targeting the selected genes in both mouse and human cell cultures.
Take the sequences from Table 3, 4 and 5, and test their potencies in relevant cell cultures with siRNA transfections, total RNA and protein isolations, RT-PCR measurement, and Western Blot for protein measurement. Nonlimiting examples of highly potent siRNA duplexes are selected to be composed of the siRNA cocktail(s) as shown in Table 18. (Note: the lists of the sequences in this application are generally the target sequences from cDNA. The sequences can easily be transcribed into RNA sequences for preparation of siRNA' s by changing thymidine (t) to uridine (u). In most cases only sense strand sequences are listed in the tables to save the space since the antisense sequences can be easily added by the base pairing roles. In addition, the combinations listed below are only examples. Therefore by following the same steps, various siRNA duplexes can be combined in various compositions to form a highly potent inhibitory cocktail for down regulation of a particular pathological process, as result, to treat various diseases).
Table 18: The siRNA cocktail for inhibition of inflammation
siRNA Cocktail Combinations (targeted sequences)
IL-I beta
TNF alpha Human and Mouse homologues
COX-2 SEQ ID NO:
Cocktail 1 IL-1 beta 5 ' -ccccaactggtacatcagcac-3 ' 70
TNF alpha 5 ' -gagtgacaagcctgtagccca-3 ' 87
COX-2 5 ' -cattctttgcccagcacttca-3 ' 131
Cocktail 2 IL-1 beta 5 ' -gttccccaactggtacatcagcacc-3 ' 84
TNF alpha 5 ' -caagccctggtatgagcccatctat-3 ' 540
COX-2 5 ' -ggtctggtgcctggtctgatgatgt-3 ' 153
Step 3. Confirmation of siRNA cocktail potency in relevant animal model(s).
Three combinations are selected to be tested in the Equine recurrent uveitis (ERU) model for autoimmune diseases, since it develops frequently and occurs spontaneously and has a similar pathogenic mechanism was assumed to exist in Uveitis. Step 4. When the potency of the siRNA cocktail is confirmed, it can be repeatedly tested in other autoimmune and inflammatory disease models in mouse. Since the sequences have homology to the same gene from both mouse and human, the siRNA cocktail can be directly developed for human therapeutic application. Using these procedures, many siRNA cocktail combinations deemed to be highly potent for various preclinical test and future therapeutics use have been identified, as described following: Table 19. siRNA cocktails targeting VEGF pathway. siRNA Cocktail Combinations (targeted sequences)
VEGF
VEGFR1 Human and Mouse homologues
MMP-9 SEQ ID NO:
Cocktail 1 VEGF 5 ' -gcacataggagagatgagctt-3 ' 192
VEGFR1 5 ' -ggaatgattgtaccacacaaa-3 ' 284
MMP-9 5 ' -catccagtttggtgtcgcgga-3 ' 486
Cocktail 2 VEGF 5 ' -cuguagacacacccacccacauaca-3 ' 622
VEGFR1 5 ' -cuaccucaagagcaaacgugacuua-3 ' 295*
MMP-9 5 ' -cggagcacggagacggguaucccuu-3 ' 469*
Cocktail 3 VEGF 5 ' -cuguagacacacccacccacauaca-3 ' 622 VEGFR1 5 ' -aactgagtttaaaaggcacccagca-3 ' 623
MMP-9 5 - ' -c _g_ga..g_ca..c_g_ga..g_a.c_g_gguaucccuu-3 ' 469* SEQ ID NO: after all u nucleotides are changed to t.
Table 20. siRNA cocktails targeting VEGF pathway. siRNA Cocktail Combinations (targeted sequences)
VEGF VEGFR1 Human and Mouse homologues HIF-1 alpha SEQ ID NO:
Cocktail 1 VEGF 5 ' -gcacataggagagatgagctt-3 ' 192 VEGFR1 5 ' -ggaatgattgtaccacacaaa-3 ' 284 HIF-1 alpha 5 ' -ctggacacagtgtgtttgatt-3 ' 164
Cocktail 2 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ccaactacctcaagagcaaacgtga-3 ' 294 HIF-1 alpha 5 ' -catgtgaccatgaggaaatgagaga-3 ' 183
Cocktail 3 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ctacctcaagagcaaacgtgactta-3 ' 295 HIF-1 alpha 5 ' -caggacagtacaggatgcttgccaa-3 ' 181
Cocktail 4 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ccaactacctcaagagcaaacgtga-3 ' 294 HIF-1 alpha 5 ' -ggatgcttgccaaaagaggtggata-3 ' 188 Table 21. siRNA cocktails targeting VEGF pathway. siRNA Cocktail Combinations (targeted sequences)
VEGF VEGFR1 Human and Mouse homologues
SEQ ID
PIGF NO:
Cocktail 1 VEGF 5 ' -gcacataggagagatgagctt-3 ' 192 VEGFR1 5 ' -ggaatgattgtaccacacaaa-3 ' 284 PIGF 5 ' -gagagattgtaccttctagtt-3 ' 258
Cocktail 2 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ccaactacctcaagagcaaacgtga-3 ' 294 PIGF 5 ' -cgacctttggctacgtggctggcct-3 ' 273
Table 21 continued
Cocktail 3 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ctacctcaagagcaaacgtgactta-3 ' 295 PIGF 5 ' -ccctgagagattgtaccttctagtt-3 ' 258
Cocktail 4 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ccaactacctcaagagcaaacgtga-3 ' 294 PIGF 5 ' -ctgagagattgtaccttctagttga-3 ' 258
Table 22. siRNA cocktails targeting VEGF pathway. siRNA Cocktail Combinations (targeted sequences)
VEGF VEGFR1 Human and Mouse homologues MMP-2 SEQ ID NO:
Cocktail 1 VEGF 5 ' -gcacataggagagatgagctt-3 ' 192 VEGFR1 5 ' -ggaatgattgtaccacacaaa-3 ' 284 MMP-2 5 ' -caagcccaagtgggacaagaa-3 ' 433
Cocktail 2 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ccaactacctcaagagcaaacgtga-3 ' 294 MMP-2 5 ' -gagttggcagtgcaatacctgaaca-3 ' 451
Cocktail 3 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ctacctcaagagcaaacgtgactta-3 ' 295 MMP-2 5 ' -gcaagcccaagtgggacaagaacca-3 ' 453
Cocktail 4 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217 VEGFR1 5 ' -ccaactacctcaagagcaaacgtga-3 ' 294 MMP-2 5 ' -gagcgtgaagtttggaagcatcaaa-3 ' 457 Table 23. siRNA cocktail targeting VEGF and HSV pathway. siRNA Cocktail Combinations (targeted sequences)
VEGF Human and Mouse homologues
MMP-9
HSV UL5 HSV- 1 and HSV-2 homologues
HSV UL29 SEQ ID NO:
Cocktail 1 VEGF 5 ' -gcacataggagagatgagctt-3 ' 192
MMP-9 5 ' -ccagtttggtgtcgcggagca-3 ' 460
HSV UL5 5 ' -cctgggagcgcgtgatggtca-3 ' 2
HSV UL29 5 ' -ggtcgttgccggccatgccgt-3 ' 36
Cocktail 2 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217
MMP-9 5 ' -cgcgcgcggagcacggagacgggta-3 ' 468
HSV UL5 5 ' -ggtaggcgtggagcttggccatgta-3 ' 23
HSV UL29 5 ' -ggtcgttgccggccatgccgtagta-3 ' 54
Table 23 continued
Cocktail 3 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217
MMP-9 5 ' -cgcgcgcggagcacggagacgggta-3 ' 468
HSV UL5 5 ' -cagggcgttaatcatccaccagcaa-3 ' 27
HSV UL29 5 ' -cagggcgttaatcatccaccagcaa-3 ' 27
Cocktail 4 VEGF 5 ' -ccatgccaagtggtcccaggctgca-3 ' 217
MMP-9 5 ' -cggagcacggagacgggtatccctt-3 ' 469
HSV UL5 5 ' -gggcctggacgtgattcccgcgaaa-3 ' 30
HSV UL29 5 ' -gcgccttggcggcctcggacgcgtt-3 ' 59
Table 24. siRNA cocktail for Antiangiogenesis Activity
siRNA Cocktail Combinations (targeted sequences)
A-RAF Human and Mouse homologues mTOR HIF-1 alpha lntegrin alpha V SEQ ID NO:
Cocktail 1 A-RAF 5 ' -ggccctgaaggtgcggggt ct -3 ' 396 mTOR 5 ' -gaggagt ct act cgctt ct at -3 ' 401
H IF-1 5 ' -ctggacacagtgtgtttgatt -3 ' 164 lntegrin 5 ' -caggagttccaagagcagcaa-3 ' 515
Cocktail 2 A-RAF 5 ' -cctgtggct acaagtt ccaccagca-3 ' 390 mTOR 5 ' -gcgcgaacctcagggcaagatgctt-3 ' 419
H IF-1 5 ' -caggacagt acaggatgcttgccaa-3 ' 181 lntegrin 5 ' -gtggt cctggt agctttt attggca-3 ' 534 Table 24 continued
Cocktail 3 A-RAF 5 ' -cctgtggctacaagttccaccagca-3 ' 390 mTOR 5 ' -gccatggtttcttgccacatgctgt-3 ' 425
HIF-1 5 ' -caggacagtacaggatgcttgccaa-3 ' 181 lntegrin 5 ' -gtggtcctggtagcttttattggca-3 ' 534
Cocktail 4 A-RAF 5 ' -ggctacaagttccaccagcattgtt-3 ' 392 mTOR 5 ' -gcgcgaacct cagggcaagatgctt -3 ' 41 9
H IF-1 5 ' -caggacagt acaggatgcttgccaa-3 ' 181 lntegrin 5 ' -gagtt ccaagagcagcaaggacttt -3 ' 536
Combination of siRNA Cocktail Drug with Other Drug Modalities
The siRNA cocktail can be applied as an independent agent for treatment of ocular diseases, or applied with other drug modalities. Since siRNA therapeutics predominantly inhibit the target gene expression which is significantly different from the antagonist drugs such as the
Table 25. Growth Factor Specific siRNA cocktails for Antiangiogenesis and Antiproliferation Activities
siRNA Cocktail Combinations (targeted sequences)
VEGFA Human and Mouse homologues
VEGFB
PIGF b-FGF SEQ ID NO:
Cocktail 1 VEGFA 5 ' -gcacataggagagatgagctt-3 ' 192
VEGFB 5 ' -ggtggctgctgccctgacgat-3 ' 221
PIGF 5 ' -gcgacctttggctacgtggct-3 ' 254 b-FGF 5 ' -gaagagagaggagttgtgtctatca-3 ' 361
Cocktail 2 VEGFA 5 ' -cgcagacgtgtaaatgttcctgcaa-3 ' 213
VEGFB 5 ' -gtgactgtgcagcgctgtggtggct-3 ' 239
PIGF 5 ' -cgacctttggctacgtggctggcct-3 ' 273 b-FGF 5 ' -gagaggagttgtgtctatcaa-3 ' 344
Cocktail 3 VEGFA 5 ' -cgcagacgtgtaaatgttcctgcaa-3 ' 213
VEGFB 5 ' -gtgactgtgcagcgctgtggtggct-3 ' 239
PIGF 5 ' -ccctgagagattgtaccttctagtt-3 ' 258 b-FGF 5 ' -cagaagagagaggagttgtgtctat-3 ' 362
Cocktail 4 VEGFA 5 ' -cagcttgagttaaacgaacgtactt-3 ' 215
VEGFB 5 ' -ggcttagagctcaacccagacacct-3 ' 247
PIGF 5 ' -ccctgagagattgtaccttctagtt-3 ' 258 b-FGF 5 ' -cagaagagagaggagttgtgtctat-3 ' 362 small molecule inhibitors and monoclonal antibodies. Therefore, use of the both siRNA cocktail and antagonist drug in the same therapeutic regimen may achieve better therapeutic benefit due to the too inhibitory mechanisms are in action. In addition, a couple of siRNA cocktails can also be administrated in the same regimen for better clinical outcome. (Note: The siRNA duplexes can be made as either the blunt end and sticky end at two ends, or one end is blunt and another is sticky. The ratios of each individual siRNA duplex in the cocktail can be even or different depending the target gene requirement for effective knockdown, to achieve therapeutic effect).
Delivery of Therapeutic Agents Including Local, Topical, and Systemic
The invention provides compositions and methods for administering the therapeutic agents to treat ocular neovascularization diseases, and in particular to treat diseases in the anterior of the eye. The invention also provides compositions and methods for administering the therapeutic agents to treat ocular neovascularization diseases anywhere in the eye including the posterior of the eye. The tissues anywhere in the eye can be treated with neovasculature-targeted delivery of therapeutic agents, according to the invention, by local administration, by topical administration to the eye, and by intravenous administration at a distal site. The tissues in the anterior of the eye can be treated, according to the invention, by local administration into the subconjunctival tissue, by topical administration to the eye, by periocular injection, by intraocular injection, and by intravenous administration at a distal site. The compositions provided by the invention include 1) cationic agents that bind nucleic acids by an electrostatic interaction, including non-natural synthetic polymers, grafted polymers, block copolymers, peptides, lipids and micelles, 2) hydrophilic agents that reduce non-specific binding to tissues and cells, including non-natural synthetic polymers, peptides, and carbohydrates, 3) tissue and cell penetrating agents, including surfactants, peptides, non- natural synthetic polymers, and carbohydrates.
A preferred class of peptide is the histidine-lysine copolymer (HKP) that is a basic, cationic, broad class of peptides. Another preferred class of peptide is linear polylysine with histidine or imidazole monomers coupled to the epsilon amino moiety of the lysine monomers. Another preferred class of peptide is branched polylysine and branched polylysine with histidine or imidazole monomers coupled to the epsilon amino moiety of the lysine monomers. A preferred composition has a self-assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic peptide with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold. A preferred class of polylysine coupled with histidine or imidazole monomers has 30 to 70% coupling to primary amines of the lysine monomers. Another preferred class of peptide is a polymer with a monomer comprised of the tripeptide histidine-histidine-lysine or the tetrapeptide of histidine-histidine-lysine-lysine, where the polymer is either linear or branched, the branched polymer having monomers coupled to either the alpha or epsilon amino group of another monomer, or both. A preferred molecular weight of the polylysine class of polymers is in the range of 5,000 to 100,000, and a more preferred molecular weight of 10,000 to 30,000. Fig. 1 demonstrates the significant enhancement of siRNA delivery into retina tissue.
A preferred class of grafted polymers is a peptide grafted with a hydrophilic polymer, where the hydrophilic polymer includes PEG, polyoxazoline, polyacetal (referred to in some instances as Fleximer), HPMA, and polyglycerol. A preferred composition has a self- assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic grafted polymer with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold. A preferred molecular weight of the hydrophilic polymer is in the range of 2,000 to 10,000. Another preferred class of grafted polymers is a peptide grafted with a hydrophilic polymer further comprised of a ligand grafted to the hydrophilic polymer, where the ligand includes peptides, carbohydrates, vitamins, nutrients, and antibodies or their fragments.
A preferred class of non-natural synthetic cationic polymer is a polymer with a backbone repeating unit of ethyl-nitrogen ( -C-C-N- ), including polyoxazoline and polyethyleneimine (PEI). A preferred composition has a self-assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic polymer with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold. In one embodiment, the invention provides linear polyoxazoline or PEI derivatized with histidine or imidazole monomers. Another preferred class of polymer is branched polyoxazoline or PEI derivatized with histidine or imidazole monomers. A preferred class of polymer coupled with histidine or imidazole monomers has 30 to 70% of the basic moieties being imidazole. A preferred molecular weight of the polymers is in the range of 5,000 to 100,000, and a more preferred molecular weight of 10,000 to 30,000.
A preferred class of grafted polymers is a polymer grafted with a hydrophilic polymer, where the hydrophilic polymer includes PEG, polyoxazoline, polyacetal (referred to in some instances as Fleximer), HPMA, and polyglycerol. A preferred composition has a self-assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic grafted polymer with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold. Another preferred class of grafted polymers is a polymer grafted with a hydrophilic polymer further comprised of a ligand grafted to the hydrophilic polymer, where the ligand includes peptides, carbohydrates, vitamins, nutrients, and antibodies or their fragments.
Another preferred class of cationic polymer is a polymer with a polyacetal backbone. A preferred composition has a self-assembled complex of negatively charged therapeutic agent such as a nucleic acid with a cationic polyacetal polymer with an excess of cationic charge of 2 fold to 10 fold and a more preferred cationic charge of 2 fold to 6 fold. In one embodiment, the invention provides linear polyacetal derivatized with a basic moiety, where the basic moiety class includes mixture of lysine, primary amine, histidine, and imidazole monomers. Another preferred class of polymer is branched polyacetal derivatized with a basic moiety (again including the class of lysine, amine, histidine, and imidazole monomers). A preferred class of polyacetal polymer coupled with lysine, amine, histidine, and imidazole monomers has 30 to 70% if the basic moieties being imidazole. A preferred molecular weight of the polymers is in the range of 5,000 to 100,000, and a more preferred molecular weight of 10,000 to 30,000. A preferred class of grafted polymers is a polymer grafted with a hydrophilic polymer, where the hydrophilic polymer includes PEG, polyoxazoline, polyacetal (referred to in some instances as Fleximer™), HPMA, and polyglycerol. Another preferred class of grafted polymers is a polyacetal polymer grafted with a hydrophilic polymer further comprised of a ligand grafted to the hydrophilic polymer, where the ligand includes peptides, carbohydrates, vitamins, nutrients, and antibodies or their fragments.
Example of siRNA Cocktail Targeting VEGF Pathway Factors for Treatment of ROP and HSK
RNAi, the double stranded RNA (dsRNA)- induced sequence-specific degradation of messenger RNA (mRNA), often called gene silencing, has been proven to be a powerful tool for gene discovery and it holds great potential in targeted therapeutics. In our anti-angiogenic RNAi design for the inhibition of eye NV, mVEGF-A, mVEGF-Rl, and mVEGF-R2 are chosen to be the target genes that are key players in the VEGF angiogenic pathway. The siRNAs are 21 -nucleotide long double stranded RNAs with 2-nt overhangs at either 3' termini, with the negative strand complementary to the targeted mRNA sequences. The knockdown of these genes, singly or in combination, has the impact of blocking the angiogenic pathway leading to the inhibition of NV, and thus the relief of the SK symptoms. The same methodology applies to other NV-related ocular diseases, such as ROP model. To date, there is no report about using siRNA cocktail to treat any type of ocular diseases. Our invention is focusing on using siRNA cocktail duplexes targeting various genes involved in the ocular diseases. The following example has demonstrated our unique approach of siRNA cocktail based anti-angiogenesis therapeutics, through either local or systemic route of administration, tested in herpetic stromal keratitis (HSK) model and retinopathy of prematural (ROP) model in mice, achieving significant therapeutic effects without any evident toxicity.
EXAMPLES
METHODS
Design of siRNA duplexes targeting mVEGF, mVEGFRl and mVEGFR2. Six siRNA duplexes were designed to target each of mVEGF, mVEGFRl and mVEGFR2 using algorithms from the public domain and chemically synthesized by Qiagen (Germantown, MD). siRNAs were 21-nt long double stranded RNA oligos with dTdT overhang at 3' end without further modification (Table 26). After screenings for gene silencing potency in cell cultures, two out of six duplexes were selected for targeting the specified gene and those two were used in an equal molar mixture. Since the siRNA duplexes were used in pairs, the new name for each pairs are as follows: simVEab for mVEGF-siRNAab, simRlab for mVEGFRl-siRNAab, simR2ab for mVEGFR2-siRNAab, siClab for Control 1-siRNAab and siC2ab for Control2-siRNAab. The siRNA cocktail containing simVEab, simRlab and simR2ab with equal molar ratio was named as simVEGFmix.
Table 26.
Figure imgf000050_0001
Cell culture screening for potent siRNA duplexes. RAW264.7 gamma NO (-) cells (ATCC, CRL-2278) grown in RPMI with 10% FBS were used for screening potent siRNA duplexes against endogenous murine VEGF. SVR cells (ATCC, CRL-2280) grown in DMEM with 5% FBS were used for screening siRNA duplexes against endogenous murine VEGFRl and VEGFR2. Cells were plated in 6 well plates, transfected with the active and control siRNA duplexes using LipofectAmine (Invitrogen, Carlsbad, CA). Cytoplasmic RNA samples were extracted twenty-four hours or forty-eight hours later for RS-PCR. Preparation of polymer-siRNA nanoparticles. Optimal branched histidine-lysine polymer, HKP, was synthesized on a Ranin Voyager synthesizer (PTI, Tucson, AZ) and complexed with siRNA duplexes as described previously (70) for local administration. The particular species of the HKP was named as PT73 with a structure of (R)K(R)-K(R)-(R)K(X), where R = KHHHKHHHNHHHNHHHN, X =C(O)NH2, K = lysine, H = histidine and N = asparagine. The HKP was dissolved in aqueous solution and then mixed with siRNA aqueous solution at a ratio of 4:1 by mass, forming nanoparticles of average size of 150-200 nm in diameter. The targeted polymeric siRNA nanoparticles for systemic administration were prepared by chemical synthesis of tripartite polymer conjugate RPP, a PEGylated form of branched polyethyleneimine (PEI) having an RGF peptide at its distal end ( RGD-PEG- PEI) (71). The 'cyclic' lOmer RGD peptide with the sequence H-ACRGDMFGCA-OH and >95% purity, was purchased form Advanced ChemTech (Louisville, KY). These RPP- siRNA nanoparticles can be self-assembled in aqueous solution by simply mixing two solutions together with a 2:1 molar ratio. The measurements of particle size (120-150 nm) and ζ-potential indicate that the RPP- siRNA particles exhibit colloidal surface properties indicative of an outer steric polymer layer and potentially exposed RGD ligand to mediate cell-binding selectivity. The HKP-siRNA and RPP-siRNA aqueous solutions were semi- transparent without noticeable aggregation of precipitate, and can be stored at 4 C for at least three months.
Mouse HSK model of corneal neovascularization (NV). The HSK model1 2 was established using BALB/C (H-2d) mice 6-8 weeks of age purchased from Harlan Sprague- Dawley (Indianapolis, IN). The NV in corneal stromal in the HSK model were induced through either corneal implantation of CpG-ON or HSV-I infection1' 2. The CpG-ON induced model requires micropocket being made around 1 mm from the limbus under a stereomicroscope with pellets containing 1 μg of CpG-ON. Angiogenesis was evaluated at day 4 and 7 post the pellet implantation by comparison of NV areas and the VEGF protein levels 34. HSV-induced HSK model was established by introducing 2 μl drop containing 1 x 105 plaque-forming units (PFU) of HSV-I RE into the mouse corneas with a 30-gauge needle. The NV in HSK model was evaluated through comparison of the NV area, angiogenesis score and clinical score, through 22 day period post the infection. The animal studies followed guidelines of the Committee on the Care of Laboratory Animals Resources, Commission of Life Sciences, National Research Council. The animal facilities of the University of Tennessee (Knoxville, TN) are fully accredited by the American Association of Laboratory Animal Care.
Mouse Retinopathy of prematurity (ROP) model of retinal neovascularization.
ROP model was established with C57BL/6 mice purchased from Center of Experimental animal of Guangzhou Medical college, Guangzhou University of traditional Chinese Medicine. The retinal NV in ROP model was induced by hyperoxia3'4. Briefly, the pups with the nursing dams were maintained in hyperoxia environment (75% + 2 oxygen) from postnatal days P7 to P12, then returned to room air (normoxia), followed by treatment with Polymeric siRNA nanoparticles via different routes of delivery. The ocular NV in ROP model was evaluated with fluorescein perfusion/ flatmounting, cryosection staining, RT-PCR for mRNA levels and ELISA for protein levels. All investigations followed guidelines of the Committee on the Care of Laboratory Animals Resources, Commission of Life Science, National Research Council, China.
Administrations of polymeric siRNA nanoparticles locally and systemically. For the HSK mouse model, HKP-siRNA solution (10 μg/10 μl/eye) was delivered subconjunctivally (SCJ) with a 32-gauge Hamilton syringe (Hamilton company, Reno, Nevada) at 6 and 24 h after CpG-ON pellets implantation or day 1 and 3 after virus infection under deep anesthesia induced by Avertin (Pittman Moore, Mundelein, IL). The RPP-siRNA solution (40 μg siRNA/100 μl/mice) was delivered intravenously (IV) at 6 and 24 h after CpG-ON pellets implantation or day 1 and 3 after virus infection. The siRNA mixture used in many of these Examples is termed simVmix. simVmix is a mixture of the siRNA duplexes mVEGF-siRNA(a), mVEGF-siRNA(b), mVEGFRl-siRNA(a), mVEGFRl-siRNA(b), mVEGFR2-siRNA(a), and mVEGFR2-siRNA(b) (SEQ ID NOS:568-579; see Table 26). For the ROP model, HKP- simVmix solution (4 μg/2 μl/eye) was delivered either subconjunctivally (SCJ) or intravitreously (IVT) in the left eye and HKP-siC2ab (4μg/2 μl/eye) in the right eye. The RPP-simVmix solution (15 μg siRNA/50 μl/mice) was given intraperitoneally (IP). Both local and systemic administrations were in two regimens: P12, P 14, and P 16; or only on P 12 and P13. Mice were sacrificed followed by evaluations of NV status and the expressions of the targeted genes at P 14 and P 17. Retinal angiography. Animals were perfused with a solution of 50 mg/ml fluorescein dextran in sodium chloride as described previously 41. Both eyes were enucleated and fixed for 0.5-1 h in 10% buffered formaldehyde at room temperature. The anterior segment was cut off and the neurosensory retina carefully removed. The retina was cut radically and flat mounted in glycerin with the photoreceptors facing downward. A cover slip was placed over the retina and sealed with nail polish. Retinal whole mounts were examined by fluorescence microscopy. The areas of retinal NV were measured by soft Image-Pro Plus (Media Cybernetics,USA).
Cryosection analyses. Eyes were enucleated and frozen in optimal cutting temperature embedding compound (Miles Diagnostics, PA, USA). Ocular frozen sections (lOμm) were histochemically stained with biotinylated GSA. Slides were incubated in methanol/H2O2 for 10 min at 4° C, washed with 0.05 M Tris-buffered saline (TBS), pH 7.6, and incubated for 30 min in 10% normal bovine serum. Slides were incubated with biotinylated GSA, avidin coupled to alkaline phosphatase (Vector Laboratories) and diaminobenzidine, further counterstained with eosin, and mounted with Cytoseal. To perform quantitative assessments, 15 GSA-stained sections were examined with microscope, and images were digitized using digital camera. Image-Pro Plus software (Media Cybernetics, Silver Spring, MD, USA) was used to delineate GSA-stained cells on the surface of the retina and measure the areas. In case of the local delivery, the measurement from each eye was used as a single experimental value. As for systemic delivery, the mean of both eyes of a mouse was considered as a single experimental value.
Detection of mRNA levels in cell culture and ocular tissues by RS-PCR and RT-
PCR. Total RNA from transfected cells was extracted by RNA wiz (Ambion, #9736) and total RNA from retina was extracted using TRIzol reagent (Invitrogen, USA) after mice was sacrificed at P14 and P17. The cytoplasmic RNA samples were tested by mRNA-specific PCR (RS-PCR) as described previously. The set of primers for each mRNA include a 47-mer mRNA-specific primer for reverse transcription reaction (RTP), a 5'-end gene specific primer (GP) and a 3'-end universal primer (see Table 27). The lower cases indicated the sequences specific to the targets for reverse transcriptions. The RNA samples were also quantified with GAPDH and β-actin specific RT-PCR. All PCR products were subjected to the gel electrophoresis analysis and quantification. Table 27.
Figure imgf000054_0001
ELISA analyses for VEGF and VEGFl, VEGFR2. Retinas were collected after mice were sacrificed at P 14 and P 17, and homogenized in cell lysis buffer (Mammalian cell lysis Kit, Biotechnology Department Bio Basid Inc, Canada). The supernatants were subjected to ELISA analysis using BCA protein quantitative analysis Kit (Shenery Biocolor Bioscience & Technology Company, China). Levels of VEGF, VEGFRl, and VEGFR2 were determined using the Quantikine M Murine VEGF, sVEGFRl, and sVEGFR2 Immunoassay Kits respectively (R&D Systems Inc., Minneapolis, MN). Six to 12 tissue samples were analyzed for each group and each time point.
Data analysis and Statistics
Data were expressed as means ± s.e. Significant differences between groups were evaluated by using the Student's r-test. P < 0.05 was regarded as significant difference between two groups.
RESULTS
Selection of potent siRNA duplexes and nanoparticle formulations
Eight candidate 21 nucleotide sequences were identified to target each of the three murine genes, VEGF (Accession: M95200), VEGFRl (Accession: D88689) and VEGFR2 (Accession: X70842), using algorithms from several public domains (Table 28). The siRNA duplexes were chemically synthesized by Qiagen (Germantown, MD, USA). Potencies of the siRNA duplexes for silencing the targeted genes were evaluated by in vitro transfection of RAW264.7 gamma NO (-) cells and SVR cells, followed by RT-PCR and ELISA analyses. Two most potent siRNA duplexes for each gene target were selected from the eight candidates (Fig. 2a) and potencies of each combined siRNA pair were further tested by RT- PCR (Fig. 2b). The siRNA pairs targeting murine VEGF, simVEab, simRlab and simR2ab, all demonstrated potent activity to knock down their targeted genes, compared to the control siRNA duplexes, siClab. The simVEab is able to target all three isoforms 38 of murine VEGF including VEGFigs, VEGF164 and VEGF12O • These three pairs of siRNA agents were selected as the payloads of the nanoparticles for in vivo studies with murine ocular NV models.
Herpetic stromal keratitis (HSK) model was generated with CpG-ON pellet implant and HSV infection as described previously 34, which represents a clinically relevant model of corneal neovascularization with typical characteristics of inflammation induced angiogenesis and lymphangiogenesis 40. Measurements of the angiogenesis areas, HSK disease scores and protein expression levels are the most effective ways to evaluate the siRNA-mediated anti- angiogenesis activities in the anterior section of the eyes. On the other hand, the retinopathy of prematurity (ROP) model reflects the characters of retinal NV with typical pathogenesis of ischemic and degenerative diseases such as PDR and AMD 41. Measurements of the angiogenesis areas through perfusion/flatmount, cryosection , and mRNA and protein expression levels are useful tools to evaluate anti-angiogenesis activity in the posterior section of the eyes. Within the neovasculature tissues of both HSK and ROP models, integrin receptor subtypes αvβ3 and αvβ5 are selectively expressed in the proliferative endothelium of corneal, retinal and choroidal neovascular membranes14' 15> 16, which have been indicated as the ideal targets for RGD ligand binding 17> 34> 42.
Two polymeric carriers were selected for in vivo delivery of siRNA duplexes through either local or systemic administrations. Optimal branched histidine-lysine (HK) polymers have been applied for siRNA deliveries in vitro43 and in vivo44. A particular species of the HK polymer (PT73, named as HKP) has a lysine backbone with four branches containing multiple repeats of Histidine, Lysine and Asparagine. When this HKP aqueous solution was mixed with siRNA aqueous solution at a ratio of 4: 1 by mass, the nanoparticles of average size of 100-200 nm in diameter were self- assembled. The resulting HKP-siRNA solutions were used for the subconjunctival (SCJ) or intravitreous (IVT) administrations in both HSK and ROP models (Fig. 2c-2d). A more complicated tripartite polymer conjugate, PEGylated branched polyethyleneimine (PEI) having an RGF peptide at its distal end (RGD-PEG-PEI, in short as RPP) 45, was applied in two previous in vivo studies 33> 34. These RPP-siRNA nanoparticles can also be self-assembled in aqueous solution with sizes about 80-120 nm in diameter by simply mixing two solutions together with a 2: 1 molar ratio. We decided to test the RPP-siRNA aqueous solution via both intravenous (IV) and intraperitoneal (IP) administrations in HSK and ROP models coordinately (Fig.2c-2d). Both types of the nanoparticles, HKP-siRNA and RPP-siRNA, were characterized for their packaging capacity, ζ-potential and particle sizes.
Efficient delivery of siRNA duplexes into ocular NV tissues
To determine the physical presences of the HKP-siRNA and RPP-siRNA particles at the ocular NV tissues, we packaged FITC-labeled siClab (control) with either the HKP or RPP carrier and then administrated them though either local (SJC) or systemic (IV) administration into the mouse HSK model. The cryosections of the anterior section of the eyes indicated the presence of the HKP-siRNA (Fig. 3a, panel 1) compared to the sample only treated with naked siRNA (Fig. 3a, panel T). FITC-labeled siRNA duplexes were also observed in the cryosection samples from RPP-siRNA treated mouse (Fig. 3b, panel 1) with IV delivery compared to the naked siRNA treated mouse (Fig. 3b, panel T). This result indicated that RPP-siRNA was able to reach the ocular NV tissue through IV administration, presumably due to the ligand-directed nanoparticle trafficking in the blood stream, which did not occur with the naked siRNA . Systemic delivery of RPP-simVEab into the ocular NV tissue significantly inhibited VEGF-A protein expression compared to control. (Fig. 3c). Those mouse ocular protein samples were harvested 4 days (P4) or 7 days (P7) after the CpG- ON induction with two siRNA treatments at 6 and 24 hours after the induction. The RPP- simVEab inhibitory effect was stronger at P7 than P4, while the naked simVEab treatment exhibited only weak inhibition of VEGF expression. Clearly, the RGD ligand directed RPP- siRNA nanoparticles were able to preferentially reach to the CpG-ON induced ocular NV tissue through IV delivery and to knockdown the VEGF expression which is the key factor for activation of the local angiogenesis.
SiRNA cocktail exhibited stronger anti-angiogenesis activity
VEGF, VEGFRl and VEGFR2 are key players in ocular NV through activation of HA and LA processes activated by CpG-ON induced inflammation1' 2. Therefore, inhibiting expression of each of these genes with the specific siRNA duplexes should down regulate progression of the ocular NV 35> 36. Systemically delivered RPP-simVEab, -simRlab and - simR2ab nanoparticles (40 μg/100 μl/eye) significantly minimized angiogenesis areas compared to the no treatment and siClab treated groups (Fig. 4a). As reported previously 34, the individual gene knockdown resulted in similar anti-angiogenesis effects among VEGF, VEGFRl and VEGFR2 in this HSK model (Fig. 4b). These results led to the idea that using a siRNA cocktail targeting VEGF, VEGFRl and VEGFR2 genes at the same time with the same dosage should achieve stronger anti-angiogenesis efficacy. To test this assumption, we delivered siRNA cocktail nanoparticles, HKP-simVmix (see page 51; 4 μg/2μl/eye) through SJV injection and RPP-simVmix (40 μg/100 μl/eye) through IV injection, at 6 and 24 hours after CpG-ON induction of corneal NV in mice (HSK model) as described in the method section. The angiogenesis areas of each treatment groups were measured on day 4 and 7 followed by comparisons between the control and treatment groups (Fig. 5). The siRNA cocktail treatments resulted in stronger anti-angiogenesis activities in the HSK models (Fig. 4c-d) compared to siRNAs targeting single gene (Fig. 4a-b), through either local (HKP) or systemic (RPP) delivery. These results are consistent with our previous observations 34. The anti-angiogenesis potencies of the siRNA cocktail treatments increased gene knockdown from 30% to 50% at P4 and from 30% to 40% at P7.
Systemic delivered siRNA cocktail demonstrated durable activity in HSK model
To further evaluate the therapeutic potential of the siRNA cocktail, we chose a more clinically relevant HSK model with Herpes virus infection. Unlike the CpG-ON induced HSK model, HSV infection causes severe ocular NV and corneal lesion that usually present between 14 - 22 days after the infection. The HKP-simVmix (4 μg/2μl/eye) delivered through SJV injection and RPP-simVmix (40 μg/100 μl/eye) delivered through IV injection, at Pl and P3, resulted in significant therapeutic benefit protecting eyes from severe pathological angiogenesis as well as the HSK disease scores (Fig. 6a; see Fig. 6 legend). As observed in CpG-ON induced HSK model, both locally and systemically delivered siRNA cocktail nanoparticles displayed similar anti-angiogenesis benefits in this HSV induced HSK model. Meanwhile, the pharmacodynamics of both locally delivered HKP-simVmix and systemically delivered RPP-simVmix were very similar during the entire course of disease progression. The 40% of disease inhibition at p22 also demonstrated the durable anti- angiogenesis potencies of both formulations. The slightly higher scores for HKP-siClab treated group at P6 and PlO may be due to the physical prying by local injections of the nanoparticles. Clearly, without the siRNA cocktail treatment, the HSV infected eyes became highly angiogenic and finally deformed (Fig. 6b). Interestingly, the systemically administrated RPP-simVmix demonstrated stronger inhibition for corneal NV (Fig. 7b) compared to the siRNA targeting only a single gene. (Fig. 7, c-e).
SiRNA cocktail displayed a potent anti-angiogenesis activity in ROP model
Since the ROP model reflects a different type of ocular NV with pathogenesis of ischemic and degenerative diseases, we tested the HKP-simVmix and RPP-simVmix (see page 51) nanoparticles through both local and systemic administrations, to reveal the therapeutic potential of these formulations for treatment of PDR and AMD 41. Two routes for local deliveries, SCJ and IVT, were applied for HKP-simVmix formulations, while the systemic delivery was switched from IV to IP due to the size limitation of tail vein of the young mouse pups. Administrations through all three routes were arranged into regimen A with injection twice at P12 and P13, and regimen B with injection three times at P12, P14 and P16. The samples were collected at P14 for the regimen A and collected at P17 for the regimen B, following cardiac perfusion with fluorescein-labeled dextran. Comparisons of the samples from the Perfusion/Flatmount treatments indicated that both regimen A and B worked very well with IVT and IP administrations (Fig. 8a; see Figure Legend); angiogenesis areas were reduced to almost a half. However, the SCJ deliveries with both regimens failed to achieve any significant anti-angiogenesis activity (Fig. 8a). Using the cryosection analysis, retinal NV was assessed histologically by measured the GSA-positive cells anterior to the internal limiting membrane (ILM). We found that IVT administration revealed a weakness that the three repeated injections made the sample collection impossible due to structural damage. In comparison, samples from the IP administration provided significantly reduced angiogenesis areas (about 50%), with both delivery regimens (Fig. 8b; see Figure Legend). A selection of the images for perfusion/flatmount analysis (Fig. 9) is demonstrated in Fig. 8c. The HKP-simVmix and RPP-simVmix show marked differences between treatment groups and control groups (Fig. 8c, panels 2, 6, 3,7; see Figure Legend). The similar therapeutic benefit could also be observed in Fig. 8d, where the samples from the groups treated with the siRNA cocktail through either IVT or IP delivery display minimum NV (Fig. 8d, panels 6-7), but the samples from the control groups revealed large fronds of retinal and subretinal NV extending above the internal limiting membrane (Fig. 8d, panels 2- 3). Although the same dosage of HKP-simVmix was delivered through the SCJ route as the IVT route, the minimum therapeutic benefit indicated that this route had no effect on the retinal angiogenesis activity (Fig. 8c, panels 4, 8 and Fig. 8d, panels 4, 8). This interesting observation on the other hand confirmed a possibility that the IP administration of RPP- simVmix was indeed reaching ocular NV tissue mainly through the blood stream which is the best way to approach the activated vascular endothelium cells. Meanwhile, the SCJ delivered HKP-simVmix was unable to efficiently reach the retinal and choroidal NV even through diffusion within the ocular tissues. Additional cryosection images can be found in Fig. 10 (see Figure Legend).
SiRNA cocktail effectively inhibited VEGF pathway
Since the siRNA cocktail (simVmix) exhibited potent anti-angiogenesis efficacy in vivo, delivered via either local or systemic routes, packaged with either HKP or RPP, and examined in either HSK or ROP model, we determined whether those anti-angiogenesis activities really came from silencing all three key angiogenesis factors in the same temporal and spatial locations. To measure effects, we applied quantitative RT-PCR (Q-RT-PCR) to examine mRNA levels and ELISA to quantify protein levels from all samples treated with HKP-simVmix and RPP-simVmix and collected at two different time points. The Q-RT-PCR results (Fig. l la; see Figure Legend) demonstrated that both HKP-simVmix and RPP- simVmix nanoparticles administrated through either IVT or IP route were potent inhibitors of VEGF, VEGFRl and VEGFR2 expression, through an RNAi mechanism of action. The regimen A provided a better knockdown of the gene expressions than those treated with regimen B. Additional data from Q-RT-PCR analysis can be found in Fig. 12. The ELISA analysis results for protein expression further confirmed the inhibitory effects of these siRNA cocktail in various tissue samples (Fig. 1 Ib; see Figure Legend). Similar to the mRNA levels, both formulations and routes of delivery achieved almost equal activities for protein down regulation, while the samples treated with regimen A showing slightly better activities than those treated with regimen B. These results have led to a further analysis of the impacts of down regulation of the VEGF, VEGFRl and VEGFR2 on the entire VEGF pathway. As all three isoforms of VEGF protein play various key roles in the HA and LA process which cause several types of the ocular NV, siRNA-mediated gene silencing of VEGF undoubtedly represents a major advancement 22 on gene inhibitory targeted therapeutics. The VEGFRl knockdown by siRNA duplexes further confirmed the effectiveness of this type of therapeutic approach to block the signal transduction pathway mediated by VEGFB and PIGF 41. However, those signal gene targeted therapeutic approach can not address issues involved in the entire VEGF pathway. For example, VEGFC and VEGFD mainly binds to VEGFR2 to activate the LA. Therefore, in order to tightly down regulate VEGF pathway and avoid compensatory or alternative signaling transductions, the siRNA cocktail approach divulge a new paradigm that multiple targeted therapeutics are more efficacious than the single targeted therapeutics (Fig. 1 Ic) for treatment of ocular NV diseases.
The results presented in these Examples demonstrate for the first time that the siRNA cocktail, simVmix, is a potent therapeutic agent for treatment of ocular NV, in different murine disease models and using different routes of administrations. This simVmix is able to simultaneously knockdown genes for both angiogenic cytokine (VEGF) and its receptors (VEGFRl and VEGFR2), by reaching both retinal pigment epithelium cells and retinal vascular membrane endothelium cells through either local or systemic delivery, providing therapeutic benefit demonstrated in the ROP murine model. This indicates that potent anti- angiogenesis efficacy is more likely to accrue from a cocktail approach than from targeting single target such as can be done with monoclonal antibody 10> u or chimerical receptor7 drugs.
In addition, the use of HKP and RPP polymeric nanoparticles in the Examples has clearly demonstrated their capabilities for local and systemic deliveries of siRNA active agents. The cyclic RGD ligand used in this study possesses high affinity to the integrin receptors, αvβ3 and αvβ5, which are not expressed in the normal and proliferative vitreoretinopathic tissues, but selectively expressed in corneal neovascular membranes 42, retinal and choroidal neovascular membranes 16~20. Our data affirm that RPP-simVmix activity is mediated through RGD binding to αvβ3 and αvβ5 integrins expressed on the cell membrane of neovascular endothelium. The results presented in the Examples show clearly that the integrin-mediated endocytosis allows siRNA cocktail entering the cytoplasm to silence the VEGF, VEGFRl and VEGFR2 expressions. Therefore, this RPP-simVmix nanoparticle presents a dual targeting property: neovasculature targeting and gene targeting, achieving potent anti-angiogenesis activity by crossing the blood-retinal barrier after IV and IP systemic administrations.
Systemic delivery of anti- VEGF therapy to the eyes with neovascularization conditions has been tested in animal models and clinical studies7' 12> 50. The preliminary efficacy and safety outcome of the clinical studies for neovascular AMD patients with systemic administrations of soluble VEGF receptor, VEGF-Trap12, and VEGF monoclonal antibody50, provide important evidence that systemic therapy for ocular NV conditions is a viable approach, especially for those having neovasculature targeting property.
The unequivocal identification and quantification of new vessels and measurement of angiogenesis areas employed in the Examples enable objective data collection. In addition, as a relatively isolated compartment, the local delivery effect and systemic delivery effect can be clearly distinguished. The HSK model with severe corneal NV and ROP model with serious retinal NV reflect characteristics of almost all kinds of ocular angiogenesis diseases. Therefore, the results achieved in these Examples, using either HSK or RPP carriers, with either local or systemic delivery, are applicable for (1) inflammatory corneal NV such as HSK, Uveitis, Scleritis and Iritis; (2) ischemic retinal NV such as PDR, ROP and retinal vein occlusion (RVO); and (3) degenerative choroidal NV, AMD, polypoidal choroidal vasculopathy (PCV) and pathologic myopia, etc.
The novel approach applied in the study, siRNA cocktail administrated with polymeric nanoparticle, requires us to carefully evaluate the potential toxicity in vivo throughout the entire observation on both HSK and ROP murine models. Except some minor injures in the ocular tissue due to the repeated deliveries of polymeric-siRNA nanoparticles intravitreously into young mice (Table 29), we did not fine any physical, behavioral and appearance change of the treated mice, after repeated systemic administrations of RPP- simVmix nanoparticles, even with less than two week old C57BL/6 mice. This observation indicates that the dosage and regimen we used in those treatments were safe. Therefore, this siRNA cocktail therapeutic approach may possess a wide therapeutic window for the treatment of ocular NV.
Table 28. The siRNA sequences targeting murine VEGF, VEGFRl and VEGFR2 genes.
Murine VEGF, Accession: M95200
Eight siRNA sequences were selected (forward sequence): SEQ ID NO: simVEa: GCCGUCCUGUGUGCCGCUGdtdt; 541 simVEb: CGAUGAAGCCCUGGAGUGCdtdt; 543 simVE-1: GUGGUCCCAGGCUGCACCCdtdt; 568 simVE-2: GAUCCGCAGACGUGUAAAUdtdt; 569 simVE-3: ACACAGACUCGCGUUGCAAdtdt; 570 simVE-4: CACAGACUCGCGUUGCAAGdtdt; 571 simVE-5: GGCGAGGC AGCUUGAGUUAdtdt; 572 simVE-6: ACGAACGUACUUGCAGAUGdtdt. 573
Murine VEGFR-I (FLT-I), Accession: D88689
Eight siRNA sequences were selected (forward sequence): simRla: GUUAAAAGUGCCUGAACUGdtdt 545 simRlb: GCAGGCCAGACUCUCUUUCdtdt 547 simRl-1: GGAGAGGACCUGAAACUGUdtdt, 574 simRl-2: GCAAGGAGGGCCUCUGAUGdtdt, 575 simRl-3: GGAGGGCCUCUGAUGGUGAdtdt, 576 simRl-4: CUACCUC AAGAGCAAACGUdtdt, 577 simRl-5: GUGGCCAGAGGCAUGGAGUdtdt, 578 simRl-6: AGUGCAUUCAUCGGGACCUdtdt. 579
Murine VEGFR-2 (FLK-I), Accession: X70842
Eight siRNA candidates were selected (forward sequence): simR2a: GCUCAGCACACAGAAAGACdtdt 549 simR2b: UGCGGCGGUGGUGACAGUAdtdt 551 simR2-l: CAGAAUUUCCUGGGACAGCdtdt, 580 simR2-2: CUGAAGACAGGCUACUUGUdtdt, 581 simR2-3: GGACUUCCUGACCUUGGAGdtdt, 582 simR2-4: GUGGCUAAGGGCAUGGAGUdtdt, 583 simR2-6: AUGUACCAGACCAUGCUGGdtdt, 584 simR2-8: CAGUAAGCGAAAGAGCCGGdtdt, 585 Table 29. Toxicity responses to the intravitreal administration of simVmix.
Regimens Corneal Anterior chamber liquid Vitreous Retina
HKP-simVmix Opacity (+), Cell(+) Empyemata (+) Retinal P12, P13 KP(+) Flare(+) detachment (+)
HKP-simVmix Opacity (+) Cell (++) Empyemata (++) Retinal KP (+) Flare (++) detachment (+) P12, P14, P16 Hypopyon (+)
simVmix Opacity (+) Cell (+) Empyemata (+) Retinal P12, P13 KP (+) flare (+) detachment(±)
Accession Numbers for the genes identified herein are provided in Table 30. Table 30. Accession Numbers
Figure imgf000063_0001
Suppression of expression of human VEGF. Human colorectal carcinoma cells, DLD-I and human breast carcinoma cells, MDA-MB-435 American Type Culture Collection (ATCC; Centerville VA) were generally cultured and rinsed twice with 0.25% trypsin, 0.53 mM EDTA solution at room temperature (or at 37C) until the cells detached. Fresh culture medium was added, the cells were aspirated and dispensed into new culture flasks. Cells were transfected with naked siRNA using Lipo2000 (Invitrogen, Carlsbad, CA) according to the protocol provided by the vendor. Either 0.3 and 2.0 ug blunt ended siRNA was transfected in a given experiment.
The 25 mer siRNA 5'-ccaugccaaguggucccaggcugca-3' (SEQ ID NO: 596) targets both human and mouse VEGF. The 21 mer siRNA 5'- aaucgagacccugguggacau-3' (SEQ ID NO 624)targets human VEGF. The mock was treated with buffer alone.
The amounts of mRNA were determined by quantitative-RT-PCR analysis using TaqMan® Gene Expression system (ABI, Forest City, CA).
The results (Fig. 13) show that the 25 mer siRNA (SEQ ID NO: 596) is more potent for silencing effects tested than the 21 mer siRNA (SEQ ID NO 624).
Comparison of siRNA effectiveness in suppressing VEGF in human and mouse cells. Human embryo kidney cells, 293, and mouse myeloma cells, F3, were cultured and transfected with 8 different siRNA sequences designated VEGF-A through VEGF-H targeting human VEGF. The expression ratio is determined by the changes of mRNA. The amounts of mRNA were determined by quantitative-RT-PCR analysis using TaqMan® Gene Expression system (ABI, Forest City, CA).
The results shown in Fig. 14 indicate that differing targeted sequences within the VEGF have differing susceptibilities for suppression of gene expression. In these experiments the siRNA designated VEGF-C is most effective in both human and mouse cells.
Comparison of effectiveness of five 25 mer VEGF-Rl specific siRNA duplexes in suppressing gene expression. Mouse SVR cells were cultured and transfected with five different siRNA molecules each of which targets orthologous mouse and human genes, or with siRNA targeting green fluorescent protein (GFP), or were transfected with buffer alone. Either 0.3 or 2.0 ug siRNA per experiment was used. Relative expression levels compared to untreated cells were determined. The siRNA sequences used were
Table 31.
Figure imgf000064_0001
* SEQ ID NO: after all u nucleotides are changed to t. The results are shown in Fig. 15. It is seen that VRl-a is the most potent siRNA silencer.
Comparison of effectiveness of three 25 mer MMP-9 specific siRNA duplexes in suppressing gene expression. Human PC-3 cells (ATCC) were cultured, suspended by trypsin treatment and resuspended in complete growth medium for further culture, at 37C. They were transfected with three different siRNA molecules each of which targets human and mouse orthologs of MMP-9, or with siRNA targeting green fluorescent protein (GFP), or were transfected with buffer alone. Variously. 0.1, 1.0 and 3.0 ug naked siRNA per experiment was added, or a control medium. Relative expression levels compared to untreated cells were determined. The siRNA sense strand sequences are
Table 32.
Figure imgf000065_0001
* SEQ ID NO: after all u nucleotides are changed to t.
The results are shown in Fig. 16. It is seen that all three siRNA molecules are potent inhibitors of MMP-9 gene expression at all concentrations used..
Comparison of effectiveness of three 25 mer PDGF specific siRNA duplexes in suppressing gene expression. Human PC-3 cells (ATCC) were cultured, suspended by trypsin treatment and resuspended in complete growth medium for further culture, at 37C. They were transfected with three different siRNA molecules each of which targets human and mouse orthologs of PDGF or with a control. Variously. 0.5, 1 and 2 ug naked siRNA per experiment was added, or a control medium. Expression was determined by labeling after gel runs. The siRNA sense strand sequences used were
Table 33.
Figure imgf000065_0002
The results are shown in Fig. 17. It is seen that all three siRNA molecules are effective suppressors of PDGF expression. . duplex sequences for use in various mixtures disclosed herein are listed in Table 34. duplex molecules
Figure imgf000066_0001
65
Docket No. Table 35. siRNA sequences targeting VEGFR-I (FIt-I) gene of both human and mouse.
VEGFR1
Figure imgf000067_0001
Figure imgf000068_0001
References
1. Thomas J, Rouse BT: Immunopathogenesis of herpetic ocular disease. Immunol Res. 1997, 16:375-386
2. Zheng M, Deshpande S, Lee S, Ferrara N, Rouse BT: Contribution of vascular endothelial growth factor in the neovascularization process during the pathogenesis of herpetic stromal keratitis. J Virol 2001, 75:9828-9835.
3. Zhang M, Yang Y, Yan M, Zhang J. Down regulation of vascular endothelial growth factor and integrinbeta3 by endostatin in a mouse model of retinal neovascularization. Exp Eye Res. 2006; 82(l):74-80.
4. Economopoulou M, Bdeir K, Cines DB, Fogt F, Bdeir Y, Lubkowski J, Lu W, Preissner KT, Hammes HP, Chavakis T. Inhibition of pathologic retinal neovascularization by alpha-defensins. Blood. 2005; 106(12):3831-8.
5. Yoon KC, Ahn KY, Lee JH, Chun BJ, Park SW, Seo MS, Park YG, Kim KK Lipid- mediated delivery of brain- specific angiogenesis inhibitor 1 gene reduces corneal neovascularization in an in vivo rabbit model. Gene Ther. 2005; 12(7):617-24.
6. Murata M, Takanami T, Shimizu S, Kubota Y, Horiuchi S, Habano W, Ma JX, Sato S. Inhibition of ocular angiogenesis by diced small interfering RNAs (siRNAs) specific to vascular endothelial growth factor (VEGF). Curr Eye Res. 2006; 31(2):171-80.
7. Cursiefen C, Chen L, Borges LP, Jackson D, Cao J, Radziejewski C, D'Amore PA, Dana MR, Wiegand SJ, Streilein JW. VEGF-A stimulates lymphangiogenesis and hemangiogenesis in inflammatory neovascularization via macrophage recruitment. J Clin Invest. 2004; 113(7): 1040-50.
8. Rissanen TT, Markkanen JE, Gruchala M, Heikura T, Puranen A, Kettunen MI, Kholova I, Kauppinen RA, Achen MG, Stacker SA, Alitalo K, Yla-Herttuala S. VEGF-D is the strongest angiogenic and lymphangiogenic effector among VEGFs delivered into skeletal muscle via adenoviruses. Circ Res. 2003; 92(10):1098-106.
9. Cao Y, Linden P, Farnebo J, Cao R, Eriksson A, Kumar V, Qi JH, Claesson-Welsh L, Alitalo K. Vascular endothelial growth factor C induces angiogenesis in vivo. Proc Natl Acad Sci U SA. 1998; 95(24): 14389-94.
10. Ferrara N, Hillan KJ, Novotny W. Bevacizumab (Avastin), a humanized anti-VEGF monoclonal antibody for cancer therapy. Biochem Biophys Res Commun. 2005; 333(2):328-35. 11. Yang JC, Haworth L, Sherry RM, Hwu P, Schwartzentruber DJ, Topalian SL, Steinberg SM, Chen HX, Rosenberg SA. A randomized trial of bevacizumab, an anti- vascular endothelial growth factor antibody, for metastatic renal cancer. N Engl J Med. 2003; 349(5):427-34.
12. Saishin Y, Saishin Y, Takahashi K, Lima e Silva R, Hylton D, Rudge JS, Wiegand SJ, Campochiaro PA. VEGF-TRAP(R 1R2) suppresses choroidal neovascularization and VEGF-induced breakdown of the blood-retinal barrier. J Cell Physiol. 2003; 195(2):241- 8.
13. Campochiaro PA. Potential applications for RNAi to probe pathogenesis and develop new treatments for ocular disorders. Gene Ther. 2006; 13(6):559-62.
14. Dormond O, Ponsonnet L, Hasmim M, Foletti A, Ruegg C. Manganese-induced integrin affinity maturation promotes recruitment of alpha V beta 3 integrin to focal adhesions in endothelial cells: evidence for a role of phosphatidylinositol 3-kinase and Src. Thromb Haemost. 2004; 92(1): 151-61.
15. Graef T, Steidl U, Nedbal W, Rohr U, Fenk R, Haas R, Kronenwett R. Use of RNA interference to inhibit integrin subunit alphaV-mediated angiogenesis. Angio genesis. 2005; 8(4):361-72.
16. Wilkinson-Berka JL, Jones D, Taylor G, Jaworski K, Kelly DJ, Ludbrook SB, Willette RN, Kumar S, Gilbert RE. SB-267268, a nonpeptidic antagonist of alpha(v)beta3 and alpha(v)beta5 integrins, reduces angiogenesis and VEGF expression in a mouse model of retinopathy of prematurity. Invest Ophthalmol Vis Sci. 2006; 47(4): 1600-5.
17. Friedlander M, Theesfeld CL, Sugita M, Fruttiger M, Thomas MA, Chang S, Cheresh DA. Involvement of integrins alpha v beta 3 and alpha v beta 5 in ocular neovascular diseases. Proc Natl Acad Sci U SA. 1996; 93(18):9764-9.
18. Stupack DG, Cheresh DA. Get a ligand, get a life: integrins, signaling and cell survival. J Cell Sci. 2002; 115(Pt 19):3729-38.
19. Anderson SA, Rader RK, Westlin WF, Null C, Jackson D, Lanza GM, Wickline SA, Kotyk JJ. Magnetic resonance contrast enhancement of neovasculature with alpha(v)beta(3)-targeted nanoparticles. Magn Reson Med. 2000; 44(3):433-9.
20. Ye Y, Bloch S, Xu B, Achilefu S. Design, synthesis, and evaluation of near infrared fluorescent multimeric RGD peptides for targeting tumors. J Med Chem. 2006; 49(7):2268-75. 21. Li C, Wang W, Wu Q, Ke S, Houston J, Sevick-Muraca E, Dong L, Chow D, Charnsangavej C, Gelovani JG. Dual optical and nuclear imaging in human melanoma xenografts using a single targeted imaging probe. Nucl Med Biol. 2006; 33(3):349-58.
22. Reich SJ, Fosnot J, Kuroki A, Tang W, Yang X, Maguire AM, Bennett J, Tolentino MJ. Small interfering RNA (siRNA) targeting VEGF effectively inhibits ocular neovascularization in a mouse model. MoI Vis. 2003; 9: 210-6.
23. Bitko, V. et al. Inhibition of respiratory viruses by nasally administered siRNA. Nature Medicine. 2004, 11, 50-55.
24. Li, B.J., Tang Q, Cheng D, Qin C, Xie F.Y., Wei Q, Xu J, Liu Y, Zheng B.J., Woodle M.C., Zhong N, Lu PY. (2005): Using siRNA in prophylactic and therapeutic regimens against SARS coronavirus in Rhesus macaque. Nature Medicine. 11. 944-951.
25. Soutschek, J., et al, (2004). Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature. 432, 173-8.
26. Palliser D, Chowdhury D, Wang QY, Lee SJ, Bronson RT, Knipe DM, Lieberman J. An siRNA-based microbicide protects mice from lethal herpes simplex virus 2 infection. Nature. 2006 Jan 5; 439(7072):89-94. Epub 2005 Nov 23.
27. Zimmermann TS, Lee AC, Akinc A, Bramlage B, Bumcrot D, Fedoruk MN, Harborth J, Heyes JA, Jeffs LB, John M, Judge AD, Lam K, McClintock K, Nechev LV, Palmer LR, Racie T, Rohl I, Seiffert S, Shanmugam S, Sood V, Soutschek J, Toudjarska I, Wheat AJ, Yaworski E, Zedalis W, Koteliansky V, Manoharan M, Vornlocher HP, Maclachlan I. RNAi-mediated gene silencing in non-human primates. Nature. 2006
28. Morrissey DV, Lockridge JA, Shaw L, Blanchard K, Jensen K, Breen W, Hartsough K, Machemer L, Radka S, Jadhav V, Vaish N, Zinnen S, Vargeese C, Bowman K, Shaffer CS, Jeffs LB, Judge A, MacLachlan I, Polisky B. Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs. Nat Biotechnol. 2005
29. Song, E., et al., (2005) Antibody mediated in vivo delivery of small interfering RNAs via cell- surface receptors. Nat Biotechnol. 23(6):709-17.
30. Ge, Q. et al. Inhibition of influenza virus production in virus-infected mice by RNA interference. Proc Natl Acad Sci U S A. 101, 8676-81 (2004).
31. Lu, Patrick Y., Frank Y. Xie and Martin Woodle, (2003): SiRNA-Mediated Antitumorigenesis For Drug Target Validation And Therapeutics. Current Opinion in Molecular Therapeutics, 5(3): 225-234. 32. Lu, Patrick Y. and Martin C. Woodle, (2004): Delivering siRNA in vivo for functional genomics and novel therapeutics. RNA Interference Technology. Cambridge University Press. P.303-317.
33. Schiffelers, R. M., et ah, (2004). Cancer siRNA therapy by tumor selective delivery with ligand-targeted sterically stabilized nanoparticle. Nucleic Acids Res. 32, el49.
34. Kim B, Tang Q, Biswas PS, Xu J, Schiffelers RM, Xie FY, Ansari AM, Scaria PV, Woodle MC, Lu P, Rouse BT. Inhibition of ocular angiogenesis by siRNA targeting vascular endothelial growth factor pathway genes: therapeutic strategy for herpetic stromal keratitis. Am J Pathol. 2004; 165 (6):2177-85.
35. Schiffelers RM, Mixson AJ, Ansari AM, Fens MH, Tang Q, Zhou Q, Xu J, Molema G, Lu PY, Scaria PV, Storm G, Woodle MC. Transporting silence: design of carriers for siRNA to angiogenic endothelium. J Control Release. 2005; 109(l-3):5-14.
36. Lu, Patrick Y., Frank Y. Xie and Martin C. Woodle. (2005): Modulation of Angiogenesis Pathway Using siRNA for Gene Function Validation and Novel Therapeutics. Trend in Molecular Medicine. Vol.11 No.3.
37. Xie, Y.F., M. Woodle and PY Lu, (2006). Harnessing in vivo siRNA delivery for functional genomics and novel therapeutics. Drug Discovery Today, Vol. 11, 67-74.
38. McColm JR, Geisen P, Hartnett ME. VEGF isoforms and their expression after a single episode of hypoxia or repeated fluctuations between hyperoxia and hypoxia: relevance to clinical ROP. MoI Vis. 2004 JuI 21; 10:512-20.
39. Zheng M, et a DNA containing bioactive CpG motifs induces angiogenesis. PNAS 99, 8944-8949 (2002).
40. Cursiefen C, Maruyama K, Jackson DG, Streilein JW, Kruse FE. Time Course of Angiogenesis and Lymphangiogenesis After Brief Corneal Inflammation. Cornea. 2006 May;25(4):443-447.
41. Shen J, Samul R, Silva RL, Akivama H, Liu H, Saishin Y, Hackett SF, Zinnen S, Ko s sen K, Fosnaugh K, Vargeese C, Gomez A, Bouhana K, Aitchison R, Pavco P, Campochiaro PA. Suppression of ocular neovascularization with siRNA targeting VEGF receptor 1. Gene Ther. 2006; 13 (3):225-34.
42. Klotz O, Park JK, Pleyer U, Hartmann C, Baatz H. Inhibition of corneal neovascularization by alpha (v)-integrin antagonists in the rat. Graefes Arch Clin Exp Ophthalmol. 2000; 238(l):88-93.
43. Leng Q, Scaria P, Zhu J, Ambulos N, Campbell P, Mixson AJ. Highly branched HK peptides are effective carriers of siRNA. J Gene Med. 2005; 7(7):977-86. 44. Leng Q, Mixson AJ. Small interfering RNA targeting Raf-1 inhibits tumor growth in vitro and in vivo. Cancer Gene Ther. 2005. 12(8):682-90.
45. Woodle, M. C, et al, (2001). Sterically stabilized polyplex: ligand-mediated activity. Journal of Controlled Release. 74:309-311.
46. Kerbel, R. and Folkman, J. (2002) Clinical translation of angiogenesis inhibitors. Nat. Rev. Cancer. 2:727-739.
47. Johnson BM, Song IH, Adkison KK, Borland J, Fang L, Lou Y, Berrey MM, Nafziger AN, Piscitelli SC, Bertino JS Jr. Evaluation of the drug interaction potential of aplaviroc, a novel human immunodeficiency virus entry inhibitor, using a modified cooperstown 5 + 1 cocktail. J Clin Pharmacol. 2006, 46(5):577-87.
48. Zheng, B. Q. Tang and P. Lu, et al. (2004): Prophylactic and therapeutic effects of small interfering RNA targeting SARS-coronavirus. Antiviral Therapy. 9:365-374.
49. de Jonge MJ, Verweij J. Multiple targeted tyrosine kinase inhibition in the clinic: All for one or one for all? Eur J Cancer. 2006. [Epub ahead of print]
50. Michels, S, PJ. Rosenfeld, CA. Puliafito, E.N.Marcus and A. S. Venkatraman (2005). Systemic Bevacizumab (Avastin) Therapy for Neovascular Age-Related Macular Degenration. Ophthalmology, 112(6), 1035-47.
51. Li, BJ. PY Lu et al. (WO 2005/076999) METHODS AND COMPOSITIONS FOR COMBINATION RNAI THERAPEUTICS.

Claims

CLAIMSWhat is claimed is:
1. A mixture comprising a plurality of small interfering RNA (siRNA) oligonucleotides and a pharmaceutical carrier, wherein each of said siRNA molecules targets an RNA molecule encoding a gene product whose activity promotes at least one of inflammation, neovascularization and angiogenesis in the eye arising in an ocular disease.
2. The mixture according to claim 1 wherein said ocular disease is selected from the group consisting of herpetic stromal keratitis, uveitis, rubeosis, conjunctivitis, keratitis, blepharitis, sty, chalazion, iritis, age-related macular degeneration, proliferate diabetic retinopathy and retinopathy of prematurity.
3. A mixture according to any of claims 1-2 wherein a targeted RNA molecule encodes a gene selected from the group consisting of herpesvirus essential genes, proinflammatory pathway genes, pro-angiogenesis pathway genes, pro-cell proliferation pathway genes, and viral infectious agent genome RNA, and viral infectious agent genes.
4. A mixture according to any one of claims 1-3 comprising at least three siRNA molecules.
5. A mixture according to any one of claims 1-4 wherein at least one siRNA molecule targets an mRNA molecule.
6. A mixture according to any one of claims 1-4 wherein at least one siRNA molecule targets a viral RNA molecule.
7. A mixture according to claims 1-4 wherein an siRNA molecule targets an mRNA molecule of encoding a human gene.
8. A mixture according to claims 1-4 wherein an siRNA molecule targets an mRNA molecule encoding orthologous human and mouse genes.
9. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-cuguagacacacccacccacauaca -3' (SEQ ID NO:622), a second siRNA molecule comprises a sense strand 5'-cuaccucaagagcaaacgugacuua -3' (given by SEQ ID NO:295 after all u nucleotides are changed to t), and a third siRNA molecule comprises a sense strand: 5'- cggagcacggagacggguaucccuu-3' (given by SEQ ID NO:469 after all u nucleotides are changed to t).
10. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-cuguagacacacccacccacauaca -3' (SEQ ID NO:622), a second siRNA molecule comprises a sense strand 5'-aactgagtttaaaaggcacccagca -3' (SEQ ID NO:623), and a third siRNA molecule comprises a sense strand: 5'- cggagcacggagacggguaucccuu-3' (given by SEQ ID NO:469 after all u nucleotides are changed to t).
11. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-ccaugccaaguggucccaggcugca-3' (SEQ ID NO:596) and an antisense strand 5'- ugcagccugggaccacuuggcaugg-3' (SEQ ID NO:597), a second siRNA molecule comprises a sense strand 5'-ccaacuaccucaagagcaaacguga-3' (SEQ ID NO:598) and an antisense strand 5'- ucacguuugcucuugagguaguugg-3' (SEQ ID NO:599), and a third siRNA molecule comprises a sense strand 5'-gacuuccugaccuuggagcaucuca-3' (SEQ ID NO:600) and an antisense strand 5'-ugagaugcuccaaggucaggaaguc-3' (SEQ ID NO:601).
12. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-gacuuccugaccuuggagcaucuca-3' (SEQ ID NO:600) and an antisense strand 5'-ugagaugcuccaaggucaggaaguc-3' (SEQ ID NO:601), a second siRNA molecule comprises a sense strand 5'-ccaugccaaguggucccaggcugca-3' (SEQ ID NO:596) and an antisense strand 5'-ugcagccugggaccacuuggcaugg-3' (SEQ ID NO:597), and a third siRNA molecule comprises a sense strand 5'-ccaacuaccucaagagcaaacguga-3' (SEQ ID NO:598) and an antisense strand 5'-ucacguuugcucuugagguaguugg-3' (SEQ ID NO:599).
13. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-gaguuggcagugcaauaccugaaca-3' (SEQ ID NO:602) and an antisense strand 5'- uguucagguauugcacugccaacuc-3' (SEQ ID NO:603), a second siRNA molecule comprises a sense strand 5'-ccaugccaaguggucccaggcugca-3' (SEQ ID NO:596) and an antisense strand 5'- ugcagccugggaccacuuggcaugg-3' (SEQ ID NO:597), and a third siRNA molecule comprises a sense strand 5'-ccaacuaccucaagagcaaacguga-3' (SEQ ID NO:598) and an antisense strand 5'- ucacguuugcucuugagguaguugg-3' (SEQ ID NO:599).
14. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-gaagagagaggaguugugucuauca-3' (SEQ ID NO:604) and an antisense strand 5'-ugauagacacaacuccucucucuuc-3' (SEQ ID NO: 605), a second siRNA molecule comprises a sense strand 5'-ccaugccaaguggucccaggcugca-3' (SEQ ID NO:596) and an antisense strand 5'- ugcagccugggaccacuuggcaugg-3' (SEQ ID NO:597), and a third siRNA molecule comprises a sense strand 5'-ccaacuaccucaagagcaaacguga-3' (SEQ ID NO:598) and an antisense strand 5'- ucacguuugcucuugagguaguugg-3' (SEQ ID NO:599).
15. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-cugagagauuguaccuucuaguuga-3' (SEQ ID NO:606) and an antisense strand 5'- ucaacuagaagguacaaucucucag-3' (SEQ ID NO:607), a second siRNA molecule comprises a sense strand 5'-ccaugccaaguggucccaggcugca-3' (SEQ ID NO:596) and an antisense strand 5'-ugcagccugggaccacuuggcaugg-3' (SEQ ID NO:597), and a third siRNA molecule comprises a sense strand 5'-ccaacuaccucaagagcaaacguga-3' (SEQ ID NO:598) and an antisense strand 5'-ucacguuugcucuugagguaguugg-3' (SEQ ID NO:599).
16. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-cugagagauuguaccuucuaguuga-3' (SEQ ID NO:606) and an antisense strand 5'- ucaacuagaagguacaaucucucag-3' (SEQ ID NO:607), a second siRNA molecule comprises a sense strand 5'-ccaugccaaguggucccaggcugca-3' (SEQ ID NO:596) and an antisense strand 5'-ugcagccugggaccacuuggcaugg-3' (SEQ ID NO:597), a third siRNA molecule comprises a sense strand 5'-ccaacuaccucaagagcaaacguga-3' (SEQ ID NO:598) and an antisense strand 5'- ucacguuugcucuugagguaguugg-3' (SEQ ID NO:599), and a fourth siRNA molecule comprises a sense strand 5'-gaagagagaggaguugugucuauca-3' (SEQ ID NO:604) and an antisense strand 5'-ugauagacacaacuccucucucuuc-3' (SEQ ID NO:605).
17. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-ccuguggcuacaaguuccaccagca-3' (SEQ ID NO:608) and an antisense strand 5'- ugcugguggaacuuguagccacagg-3' (SEQ ID NO:609), a second siRNA molecule comprises a sense strand 5'-gcgcgaaccucagggcaagaugcuu-3' (SEQ ID NO:610) and an antisense strand 5'- aagcaucuugcccugagguucgcgc-3' (SEQ ID NO:611), a third siRNA molecule comprises a sense strand 5'-caggacaguacaggaugcuugccaa-3' (SEQ ID NO:612) and an antisense strand 5'- uuggcaagcauccuguacuguccug-3' (SEQ ID NO:613), and a fourth siRNA molecule comprises a sense strand 5'-gugguccugguagcuuuuauuggca-3' (SEQ ID NO:614) and an antisense strand 5'-ugccaauaaaagcuaccaggaccac-3' (SEQ ID NO:615).
18. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-ccuguggcuacaaguuccaccagca-3' (SEQ ID NO:608) and an antisense strand 5'- ugcugguggaacuuguagccacagg-3' (SEQ ID NO:609), a second siRNA molecule comprises a sense strand 5'-gcgcgaaccucagggcaagaugcuu-3' (SEQ ID NO:610) and an antisense strand 5'- aagcaucuugcccugagguucgcgc-3' (SEQ ID NO:611), and a third siRNA molecule comprises a sense strand 5'-caggacaguacaggaugcuugccaa-3' (SEQ ID NO:612) and an antisense strand 5'- uuggcaagcauccuguacuguccug-3' (SEQ ID NO:613).
19. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-ccuguggcuacaaguuccaccagca-3' (SEQ ID NO:608) and an antisense strand 5'- ugcugguggaacuuguagccacagg-3' (SEQ ID NO:609), a second siRNA molecule comprises a sense strand 5'-gcgcgaaccucagggcaagaugcuu-3' (SEQ ID NO:610) and an antisense strand 5'- aagcaucuugcccugagguucgcgc-3' (SEQ ID NO:611), and a third siRNA molecule comprises a sense strand 5'-gugguccugguagcuuuuauuggca-3' (SEQ ID NO:614) and an antisense strand 5'-ugccaauaaaagcuaccaggaccac-3' (SEQ ID NO:615).
20. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-cccugagagauuguaccuucuaguu-3' (SEQ ID NO:616) and an antisense strand 5'-aacuagaagguacaaucucucaggg-3' (SEQ ID NO:617), a second siRNA molecule comprises a sense strand 5'-cgcagacguguaaauguuccugcaa-3' (SEQ ID NO:618) and an antisense strand 5'- uugcaggaacauuuacacgucugcg-3' (SEQ ID NO:619), a third siRNA molecule comprises a sense strand 5'-ccaacuaccucaagagcaaacguga-3' (SEQ ID NO:598) and an antisense strand 5'- ucacguuugcucuugagguaguugg-3' (SEQ ID NO:599), and a fourth siRNA molecule comprises a sense strand 5'-gacuuccugaccuuggagcaucuca-3' (SEQ ID NO:600) and an antisense strand 5'-ugagaugcuccaaggucaggaaguc-3' (SEQ ID NO:601).
21. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-cccugagagauuguaccuucuaguu-3' (SEQ ID NO:616) and an antisense strand 5'-aacuagaagguacaaucucucaggg-3' (SEQ ID NO:617), a second siRNA molecule comprises a sense strand 5'-cgcagacguguaaauguuccugcaa-3' (SEQ ID NO:618) and an antisense strand 5'- uugcaggaacauuuacacgucugcg-3' (SEQ ID NO:619 ), a third siRNA molecule comprises a sense strand 5'-gugacugugcagcgcugugguggcu-3' (SEQ ID NO:620) and an antisense strand 5'-agccaccacagcgcugcacagucac-3' (SEQ ID NO:621), and a fourth siRNA molecule comprises a sense strand 5'-gaagagagaggaguugugucuauca-3' (SEQ ID NO: 604) and an antisense strand 5'-ugauagacacaacuccucucucuuc-3' (SEQ ID NO:605).
22. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'-cgcgcgcggagcacggagacgggua-3' (SEQ ID NO:590) and an antisense strand 5'- uacccgucuccgugcuccgcgcgcg-3' (SEQ ID NO:591), a second siRNA molecule comprises a sense strand 5'-cgcagacguguaaauguuccugcaa-3' (SEQ ID NO:618) and an antisense strand 5'- uugcaggaacauuuacacgucugcg-3' (SEQ ID NO:619), a third siRNA molecule comprises a sense strand 5'- gguaggcguggagcuuggccaugua -3' (SEQ ID NO:586) and an antisense strand 5'-uacauggccaagcuccacgccuacc-3' (SEQ ID NO: 587), and a fourth siRNA molecule comprises a sense strand 5'-ggucguugccggccaugccguagua-3' (SEQ ID NO:588) and an antisense strand 5'-uacuacggcauggccggcaacgacc-3' (SEQ ID NO:589).
23. A mixture according to claim 5 wherein said mRNA molecule encodes a VEGF pathway gene, an FGF pathway gene, or a protein kinase gene.
24. A mixture according to claim 5 wherein said mRNA molecule encodes a pro- angiogenesis gene, a pro-inflammatory gene, or an endothelial cell proliferation gene.
25. A mixture according to claim 4 wherein said RNA molecule encodes a herpes simplex virus gene.
26. A mixture according to claim 5 wherein the siRNA molecules target two or more different mRNA molecules.
27. The mixture according to claim 1 wherein the pharmaceutical carrier is selected from the group of a saline solution, sugars, polymer, lipid, or micelle solutions.
28. A mixture according to claim 27 where said carrier is selected from the group consisting of a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, and a ligand functionalized-hydrophilic polymer grafted polymer.
29. A mixture according to claim 27 where said carrier comprises a polymer which forms a nanoparticle with an siRNA molecule.
30. A mixture according to claim 29 wherein said nanoparticle has a diameter of 100-400 nm.
31. The mixture according to any preceding claim wherein said siRNA molecule is a dsRNA oligonucleotide having a length of 19, or 20, or 21, or 22, or 23, or 24, or 25, or 26 or 27 nucleotides.
32. The mixture according to any preceding claim wherein said siRNA molecule is a dsRNA oligonucleotide having blunt ends at both ends.
33. The mixture according to any preceding claim wherein said siRNA molecule is a dsRNA oligonucleotide having staggered ends at both ends.
34. The mixture according to any preceding claim wherein said siRNA molecule is a dsRNA oligonucleotide having one blunt end and one staggered end.
35. The mixture according to any preceding claim wherein said siRNA molecule consists of naturally occurring nucleotides.
36. The mixture according to any preceding claim wherein said siRNA molecule comprises one or more chemically modified nucleotides.
37. A method for treating ocular disease in a subject, wherein said disease is characterized at least in part by inflammation, neovascularization, and/or angiogenesis, the method comprising administering to said subject a mixture comprising a plurality of small interfering RNA (siRNA) oligonucleotides and a pharmaceutical carrier, wherein each of said siRNA molecules targets an RNA molecule encoding a gene product whose activity promotes at least one of inflammation, neovascularization and angiogenesis in the eye arising in an ocular disease of said subject.
38. A method according to claim 37 where said mixture is administered at a site distal to the eye wherein said site is selected from the group consisting of a subconjunctival site, an intravenous site, an intraocular site, and a subcutaneous site.
39. A method according to claim 37 wherein said mixture is administered topically to the eye.
40. A method according to claim 37 where said pharmaceutical carrier is selected from the group of a saline, sugars, polymer, lipid, or micelle solutions.
41. A method according to claim 37 wherein said ocular disease is selected from the group consisting of herpetic stromal keratitis, uveitis, rubeosis, conjunctivitis, keratitis, blepharitis, sty, chalazion, iritis, age-related macular degeneration, proliferate diabetic retinopathy and retinopathy of prematurity.
42. A method according to claim 37 wherein said mixture inhibits expression of at least one gene selected from the group of herpesvirus essential genes, pro-inflammatory pathway genes, pro-angiogenesis pathway genes, pro-cell proliferation pathway genes, and viral infectious agent genome RNA, and viral infectious agent genes.
43. A method according to claim 37 wherein said mixture inhibits expression of a plurality of genes.
44. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS: 61-158.
45. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS: 1-60 and SEQ ID NOS:459-509.
46. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS: 189-218 and SEQ ID NOS:279-338.
47. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS: 159-218 and SEQ ID NOS:279-308.
48. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS: 189-218, SEQ ID NOS:279-308 and SEQ ID NOS:429-458.
49. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS: 189-218, and SEQ ID NOS:249-308.
50. A method according to claim 41 wherein said mixture inhibits expression of VEGF-A, VEGF-B, VEGF Rl, and b-FGF.
51. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS: 189-218, SEQ ID NOS:279-308, and SEQ ID NOS:399-428.
52. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS:159-188 and SEQ ID NOS:369-428.
53. A method according to claim 41 wherein said mixture comprises siRNA molecules that target sequences selected from the group consisting of SEQ ID NOS:159-188, SEQ ID NOS:369-428, and SEQ ID NOS:510-539.
54 A method according to claim 41 wherein said mixture inhibits expression of VEGF pathway genes, FGF pathway genes, or a combination thereof.
55. A method according to claim 41 wherein said mixture inhibits expression of a pro-angiogenesis gene, a pro-inflammatory gene, or a combination thereof.
56. A method according to claim 41 wherein said mixture inhibits expression of a pro-angiogenesis gene, a herpes simplex virus gene, or a combination thereof.
57. The method according to claim 41 wherein said mixture inhibits expression of a pro-angiogenesis gene, an endothelial cell proliferation gene, or a combination thereof.
58. The method according to claim 41 wherein said mixture inhibits expression of a pro-inflammation gene, a herpes simplex virus gene, or a combination thereof.
59. A method according to claim 41 wherein said carrier is selected from the group consisting of a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, and a ligand functionalized-hydrophilic polymer grafted polymer.
60. A method according to claim 59 wherein the carrier and the siRNA mixture are combined to form a nanoparticle prior to the administering.
61. A mixture according to claim 4 wherein the at least three siRNA molecules are selected from the group consisting of a siRNA duplex comprising SEQ ID NOS:541and 542, a siRNA duplex comprising SEQ ID NOS: 543 and 544, a siRNA duplex comprising SEQ ID NOS:545and 546, a siRNA duplex comprising SEQ ID NOS:547and 548, a siRNA duplex comprising SEQ ID NOS:576 and 577, and a siRNA duplex comprising SEQ ID
NOS:55 land 552.
62. A method according to claim 41 wherein said mixture comprises at least three siRNA molecules selected from the group consisting of a siRNA duplex comprising SEQ ID NOS: 54 land 542, a siRNA duplex comprising SEQ ID NOS: 543 and 544, a siRNA duplex comprising SEQ ID NOS:545and 546, a siRNA duplex comprising SEQ ID NOS:547and 548, a siRNA duplex comprising SEQ ID NOS:549 and 550, and a siRNA duplex comprising SEQ ID NOS:551and 552.
63. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand 5'- gguaggcguggagcuuggccaugua -3' (SEQ ID NO:586) and an antisense strand 5'-uacauggccaagcuccacgccuacc-3' (SEQ ID NO:587), a second siRNA molecule comprises a sense strand 5'-ggucguugccggccaugccguagua-3' (SEQ ID NO:588) and an antisense strand 5'- uacuacggcauggccggcaacgacc-3' (SEQ ID NO:589), and a third siRNA molecule comprises a sense strand: 5'-cgcgcgcggagcacggagacgggua-3' (SEQ ID NO:590) and an antisense strand 5'-uacccgucuccgugcuccgcgcgcgc-3' (SEQ ID NO:591).
64. A mixture according to claim 4 wherein a first siRNA molecule comprises a sense strand: 5'-caagcccugguaugagcccaucuau-3' (SEQ ID NO: 113) and an antisense strand 5'-auagaugggcucauaccagggcuug-3' (SEQ ID NO: 114), a second siRNA molecule comprises a sense strand: 5'-guuccccaacugguacaucagcacc-3' (SEQ ID NO:592) and an antisense strand 5'-ggugcugauguaccaguuggggaac-3' (SEQ ID NO:593), and a third siRNA molecule comprises a sense strand 5'-ggucuggugccuggucugaugaugu-3' (SEQ ID NO:594) and an antisense strand 5'-acaucaucagaccaggcaccagacc-3' (SEQ ID NO:595).
PCT/US2008/066298 2007-06-08 2008-06-09 Sirna compositions and methods of use in treatment of ocular diseases WO2008154482A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US94289807P 2007-06-08 2007-06-08
US60/942,898 2007-06-08

Publications (2)

Publication Number Publication Date
WO2008154482A2 true WO2008154482A2 (en) 2008-12-18
WO2008154482A3 WO2008154482A3 (en) 2009-04-09

Family

ID=40130463

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/066298 WO2008154482A2 (en) 2007-06-08 2008-06-09 Sirna compositions and methods of use in treatment of ocular diseases

Country Status (1)

Country Link
WO (1) WO2008154482A2 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015128651A1 (en) * 2014-02-26 2015-09-03 The University Of Liverpool Nucleic acids, and uses thereof
US9227956B2 (en) 2013-04-17 2016-01-05 Pfizer Inc. Substituted amide compounds
JP2016507514A (en) * 2013-01-08 2016-03-10 ベニテック バイオファーマ リミテッド Treatment of age-related macular degeneration
WO2016161378A1 (en) * 2015-04-03 2016-10-06 University Of Massachusetts Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
US9809817B2 (en) 2015-04-03 2017-11-07 University Of Massachusetts Oligonucleotide compounds for targeting huntingtin mRNA
WO2018013957A1 (en) * 2016-07-14 2018-01-18 Greco Chad Hybrid formulation of responsive polymeric nanocarriers for therapeutic and diagnostic delivery
KR20180020929A (en) * 2016-08-19 2018-02-28 주식회사 툴젠 Engineered Neovascularization-controling system
USRE46873E1 (en) 2007-11-06 2018-05-29 Sirnaomics, Inc. Multi-targeted RNAi therapeutics for scarless wound healing of skin
CN109937053A (en) * 2016-09-09 2019-06-25 奎罗津生命科学 For treating the pharmaceutical composition containing mTOR inhibitors of macular degeneration
US10478503B2 (en) 2016-01-31 2019-11-19 University Of Massachusetts Branched oligonucleotides
US10633653B2 (en) 2015-08-14 2020-04-28 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery
WO2023288141A1 (en) * 2021-07-16 2023-01-19 Sirnaomics, Inc. Composition and use of sirnas against vegfr2 and tgf-beta1 in combination therapy for cancer
US11702659B2 (en) 2021-06-23 2023-07-18 University Of Massachusetts Optimized anti-FLT1 oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
US11753638B2 (en) 2016-08-12 2023-09-12 University Of Massachusetts Conjugated oligonucleotides
US11827882B2 (en) 2018-08-10 2023-11-28 University Of Massachusetts Modified oligonucleotides targeting SNPs

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060217332A1 (en) * 2001-05-18 2006-09-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20070004667A1 (en) * 2002-02-20 2007-01-04 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20070087989A1 (en) * 2004-04-13 2007-04-19 Andrew Huang Methods of treating ocular conditions

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060217332A1 (en) * 2001-05-18 2006-09-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20070004667A1 (en) * 2002-02-20 2007-01-04 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20070087989A1 (en) * 2004-04-13 2007-04-19 Andrew Huang Methods of treating ocular conditions

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
USRE46873E1 (en) 2007-11-06 2018-05-29 Sirnaomics, Inc. Multi-targeted RNAi therapeutics for scarless wound healing of skin
JP2016507514A (en) * 2013-01-08 2016-03-10 ベニテック バイオファーマ リミテッド Treatment of age-related macular degeneration
US9227956B2 (en) 2013-04-17 2016-01-05 Pfizer Inc. Substituted amide compounds
WO2015128651A1 (en) * 2014-02-26 2015-09-03 The University Of Liverpool Nucleic acids, and uses thereof
EP3995581A3 (en) * 2015-04-03 2022-10-26 University of Massachusetts Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
US9862952B2 (en) 2015-04-03 2018-01-09 University Of Massachusetts Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
US9809817B2 (en) 2015-04-03 2017-11-07 University Of Massachusetts Oligonucleotide compounds for targeting huntingtin mRNA
US11345917B2 (en) 2015-04-03 2022-05-31 University Of Massachusetts Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
WO2016161378A1 (en) * 2015-04-03 2016-10-06 University Of Massachusetts Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
US11230713B2 (en) 2015-04-03 2022-01-25 University Of Massachusetts Oligonucleotide compounds for targeting huntingtin mRNA
US10435688B2 (en) 2015-04-03 2019-10-08 University Of Massachusetts Oligonucleotide compounds for targeting huntingtin mRNA
US10774327B2 (en) 2015-04-03 2020-09-15 University Of Massachusetts Oligonucleotide compounds for targeting huntingtin mRNA
US10519451B2 (en) 2015-04-03 2019-12-31 University Of Massachusetts Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
US10633653B2 (en) 2015-08-14 2020-04-28 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery
US10478503B2 (en) 2016-01-31 2019-11-19 University Of Massachusetts Branched oligonucleotides
US10799591B2 (en) 2016-01-31 2020-10-13 University Of Massachusetts Branched oligonucleotides
US11896669B2 (en) 2016-01-31 2024-02-13 University Of Massachusetts Branched oligonucleotides
WO2018013957A1 (en) * 2016-07-14 2018-01-18 Greco Chad Hybrid formulation of responsive polymeric nanocarriers for therapeutic and diagnostic delivery
US11753638B2 (en) 2016-08-12 2023-09-12 University Of Massachusetts Conjugated oligonucleotides
EP3502261A4 (en) * 2016-08-19 2020-07-15 Toolgen Incorporated Artificially engineered angiogenesis regulatory system
KR102145092B1 (en) * 2016-08-19 2020-08-14 주식회사 툴젠 Engineered Neovascularization-controling system
US20210254054A1 (en) * 2016-08-19 2021-08-19 Toolgen Incorporated Artificially-manipulated neovascularization regulatory system
KR20180020929A (en) * 2016-08-19 2018-02-28 주식회사 툴젠 Engineered Neovascularization-controling system
CN109937053A (en) * 2016-09-09 2019-06-25 奎罗津生命科学 For treating the pharmaceutical composition containing mTOR inhibitors of macular degeneration
CN109937053B (en) * 2016-09-09 2023-09-26 赛德摩金有限公司 Pharmaceutical composition for the treatment of macular degeneration comprising an mTOR inhibitor
EP3517133A4 (en) * 2016-09-09 2020-04-08 CuroGene Life Sciences Co., Ltd. Pharmaceutical composition containing mtor inhibitor for treating macular degeneration
US11827882B2 (en) 2018-08-10 2023-11-28 University Of Massachusetts Modified oligonucleotides targeting SNPs
US11702659B2 (en) 2021-06-23 2023-07-18 University Of Massachusetts Optimized anti-FLT1 oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
WO2023288141A1 (en) * 2021-07-16 2023-01-19 Sirnaomics, Inc. Composition and use of sirnas against vegfr2 and tgf-beta1 in combination therapy for cancer

Also Published As

Publication number Publication date
WO2008154482A3 (en) 2009-04-09

Similar Documents

Publication Publication Date Title
WO2008154482A2 (en) Sirna compositions and methods of use in treatment of ocular diseases
Kim et al. Inhibition of ocular angiogenesis by siRNA targeting vascular endothelial growth factor pathway genes: therapeutic strategy for herpetic stromal keratitis
Mulik et al. Role of miR-132 in angiogenesis after ocular infection with herpes simplex virus
KR101471732B1 (en) Combination therapy for the treatment of ocular neovascular disorders
CA2493499C (en) Compositions and methods for sirna inhibition of angiogenesis
Ng et al. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease
ES2390499T3 (en) Compositions and methods for inhibition of angiogenesis by sirna
US20090247604A1 (en) RNAi Therapeutics for Treatment of Eye Neovascularization Diseases
Qazi et al. Nanoparticle-mediated delivery of shRNA. VEGF-a plasmids regresses corneal neovascularization
US20130123330A1 (en) Dual Targeted siRNA Therapeutics for Treatment of Diabetic Retinopathy and Other Ocular Neovascularization Diseases
KR20070091337A (en) Rnai inhibition of ctgf for treatment of ocular disorders
RU2699706C2 (en) Substances and methods of modulating tendon healing
Kanwar et al. Aptamer-based therapeutics of the past, present and future: from the perspective of eye-related diseases
JP2007536937A (en) Compositions and methods for siRNA interference of primate polyomavirus genes
US9801953B2 (en) Nanoparticles carrying nucleic acid cassettes for expressing RNA
JP2001523959A (en) Materials and methods for ribozyme treatment of disease
Elbadawy et al. Targeting herpetic keratitis by gene therapy
JP2006516027A (en) Materials and methods for treatment of eye related disorders
NZ320006A (en) An adjuvant composition comprising hyaluronic acid for gene therapy either in the sense or antisense direction
CA2559436A1 (en) Materials for treating vascular leakage in the eye
CA2561978A1 (en) Therapeutic molecules for modulating stability of vegf transcripts
TW200916117A (en) RNAi-related inhibition of TNF α signaling pathway for treatment of ocular angiogenesis
JP7394815B2 (en) siRNA for inhibiting NRARP gene expression and their use in methods and compositions therefor
Yuan et al. Lentivirus-mediated RNA interference of vascular endothelial growth factor in monkey eyes with iris neovascularization
KR20080082655A (en) Rnai-mediated inhibition of igf1r for treatment of ocular angiogenesis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08770482

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08770482

Country of ref document: EP

Kind code of ref document: A2