WO2008148926A2 - Method for diagnosing immune system diseases and compounds that can be used to treat said diseases - Google Patents

Abstract

The invention relates to a method for the diagnosis and prognosis of a disease associated with stimulation of the immune system, based on the in vitro determination of the phosphorylation level of DGK in the Y335 tyrosine residue in cells of the immune system, as well as a specific antibody of the protein. In addition, the invention relates to nucleotides which inhibit the expression of said protein and can be used in the treatment of autoimmune diseases and cancers of the immune system.

Description

 PROCEDURE FOR DIAGNOSIS OF IMMUNE SYSTEM DISEASES AND USEFUL COMPOUNDS FOR THE TREATMENT OF THE SAME

TECHNICAL FIELD OF THE INVENTION

The present invention is framed in the field of biomedicine, and more specifically in the application of biotechnological tools for the diagnosis and treatment of human diseases, and more specifically of diseases with impaired immune response.

STATE OF THE TECHNIQUE

During the activation of the T lymphocytes, in response to the stimulation of the T cell receptor (TCR), a series of ordered events occur that lead to the development of the immune response (Berridge 1997). Within these events, the tyrosine kinases play a fundamental role, among which p56lck stands out as the axis of all the triggered response. The p56lck protein is a tyrosine kinase of the Src family that is recruited to the TCR after receptor stimulation. In this complex, p56lck phosphorylates the LAT and SPL76 adapter molecules providing anchor sites for other proteins such as PLCγ and ZAP 70. The PLCγ protein hydrolyzes phosphatidyl inositol (4,5) bi-phosphate (PI (4,5) P2) and generates two important messengers: Inositol tri-phosphate (IP3), which causes the Ca ²⁺ exit from the endoplasmic reticulum resulting in the activation of the NFAT transcription factor, and diacylglycerol (DAG), the second lipid messenger involved in the activation of The PKC / Ras / MAPK route, and which results in the activation of the transcription factors AP-1 and NFKB. The action of the NFAT-AP1 complex together with NFKB allows the expression of genes necessary for a correct immune response to occur. The activation of NFAT in the absence of activation of AP-1 results in Ia differential regulation of a series of genes that cause a state of non-response called anergy in cells (Macian, Garcia-Cozar et al. 2002). The maintenance of the immunological tolerance of effector T cells in the periphery is mediated by the induction of anergy in those T cells that are capable of recognizing their own antigens, that is, the antigens generated from proteins from the body itself, avoiding with it auto-immune processes.

The metabolism of DAG is involved in the induction mechanisms of anaerobic processes where the decrease in PLCγ (Heissmeyer, Macian et al. 2004) and the increase in DGKα (Macian, Garcia-Cozar et al. 2002) (Zha, Marks et al. 2006). This increase in DGKα causes a decrease in the location of RasGRP and with this the activation of the Ras / Raf / Erk1-2 route (Zha, Marks et al. 2006) is diminished. On the contrary, the absence of DGKα in a mouse model results in an increase in the activation of the Ras / Raf / Erk1-2 route, thereby interfering with the processes of induction of anergy (Olenchock, Guo et al. 2006 ).

The control of the DAG produced by the PLCγ is essential to modulate the immune response triggered by the TCR. Diacylglycerolinases (DGKs) form a family of enzymes that phosphorylate DAG to give rise to phosphatidic acid (PA), modulating the balance between both second messengers. The family of mammalian DGKs is composed of ten isoforms classified in turn into five subgroups according to their domains of regulation and tissue / cellular expression (Sakane and Kanoh 1997; Topham and Prescott 1999; van Blitterswijk and Houssa 2000; Imai, Kai et al. 2005). All DGKs share a highly conserved catalytic domain, within which the GGDG amino acid sequence stands out. The alteration of this sequence results in the loss of activity of the protein (Sanjuan, Jones et al. 2001). All DGKs have at least two domains rich in cysteine (C1), called C1A and C1 B according to the order they occupy within the amino acid sequence. The original function of C1 domains described in PKCs is to respond to DAG. If of the DGKs, C1 domains are atypical, and except for C1A of DGKβ and γ (Shindo, Irie et al. 2003), the remaining C1 domains of DGKs are not able to join DAG. In addition, the C1 B domain has an extension of fifteen amino acids that has served to postulate that its function is to present the DAG to the catalytic domain (van Blitterswijk and Houssa 1999), although other works show that these domains are dispensable for the activity of the DGK (Abe, Lu et al. 2003).

The DGKα belongs to the DGKs of type I (DGKα, β and γ) that are characterized by having two domains of union to Ca ²⁺ (EF-hands) that allow them to respond to the increase of Ca ²⁺ , being the affinity for the Ca ²⁺ dependent on the isoform (Yamada, Sakane et al. 1997). The DGKα exerts different functions during the immune response triggered in the T cells, on the one hand, it acts as a negative regulator of the activation mediated by the TCR of the RasGRP / PKCΘ route (Sanjuan, Jones et al. 2001; Sanjuan, Pradet-Balade et al. 2003) and, on the other hand, it has a positive function in response to the IL2 receptor (Flores, Casaseca et al. 1996; Flores, Jones et al. 1999), where the generated PA is necessary for proliferation. In addition, the activation mechanism of DGKα is also different depending on the receptor. In the case of TCR, the coordinated action of Ca ²⁺ and tyrosine kinases is responsible for the location of the DGKα in the membrane (Sanjuan, Jones et al. 2001). On the contrary, in response to the IL2 receptor, where there is no increase in Ca ²⁺ , the action of PI3K, which results in phosphorylated lipids in position 3 of the inositol ring, is responsible for modulating the function Ia DGKα (Cypress, Carrasco et al. 2003).

Tyrosine kinases play a fundamental role in the activation of DGKα, not only through the activation of TCR in the immune system, but also outside it, since it has been associated with the response to liver growth factor ( HGF) (Cutrupi, Baldanzi et al. 2000) and α-D-tocopherol (Fukunaga-Takenaka, Shirai et al. 2005), as well as tyrosine activity NPM-ALK protein kinase in certain tumors (Bacchiocchi, Baldanzi et al. 2005). All this suggests that this mediation may be common and necessary in response to different receptors. On the other hand, the activation of the DGKα in these systems shows the importance of the family of tyrosine kinases Src in the activation and function of the DGKα, and points to the tyrosine 335 as an important amino acid for the mobilization of the DGKα from the cytosol to the membrane although no direct evidence of its action is shown or that this translocation is due solely to the action of the DGKα, being also the stimulus other than the activation through TCR (Fukunaga-Takenaka, Shirai et al. 2005 ).

This tyrosine 335 is in a very conserved region within the DGKα of all known species, but not DGKβ or DGKγ, which suggests some functional specificity of the tyrosine 335. On the other hand, the DGKD is not the only isoform present in T lymphocytes. DGKD, which is ubiquitously expressed in numerous tissues, is expressed in T and B lymphocytes. DGKD is a type IV DGK that was originally characterized as a nuclear protein (Goto et al. 1996) and which presents unique structural characteristics. In addition to the catalytic domain and the two atypical C1 domains, common to all DGKs, this protein has a MARKS type domain close to its nuclear localization domain. The regulation by phosphorylation of this domain in the DGKD regulates its nuclear location, which in turn is fundamental in the control of cell proliferation (Topham M, 1998).

As previously mentioned, DGKζ is very abundant in T lymphocytes and the recent generation of mice deficient in this isoform has confirmed its function as a negative modulator of the immune response (Zhong, 2003). T lymphocytes of DGKζ-deficient mice showed a hyper-response to stimulation and a much more robust immune response against virus infection or against tumors. The phenotype analysis of mice deficient for DGKα and ζ suggests Ia importance of both isoforms in the control of the immune response (Olenchock BA, Guo R, Carpenter JH, Jordan M, Topham MK, Koretzky GA, Zhong XP. Disruption of diacylglycerol metabolism impairs the induction of T cell anergy. Nat Immunol. 2006 Nov ; 7 (11): 1174-81. Epub 2006 Oct 8). However, these studies do not allow the possible redundancy in the function of each of these isoforms to be evaluated, which is essential when defining the possible diagnostic or therapeutic interest of specific inhibitors of each of these isoforms.

DESCRIPTION OF THE INVENTION

brief description

An object of the present invention constitutes a diagnostic and prognostic procedure of a disease that is stimulated by the immune system, hereinafter diagnostic procedure of the invention, based on the in vitro determination of the level of phosphorylation of DGKα in the residue. tyrosine Y335 in cells of the immune system, in a biological sample and comprising the following steps: a) identification or determination of the level of phosphorylation of the DGKα protein in the tyrosine residue Y335, in a biological sample of immune origin, and b) comparison of said determination observed in a) with a control sample, and where its increased presence is indicative of the existence of a disease that occurs with stimulation of the immune system.

Another object of the invention constitutes an antibody, either monoclonal or polyclonal, hereinafter antibody of the invention, specific to the phosphorylated DGKα protein in the tyrosine residue Y335, preferably a peptide specific polyclonal antibody of SEQ ID NO3, as the antibody anti pY335 (anti-pTyr335DGKα). Another object of the invention constitutes a phosphorylated DGKα protein, hereinafter phosphorylated protein of the invention, which contains the phosphorylated 355 tyrosine residue or the like, or a fragment or peptide thereof comprising said phosphorylated 355 tyrosine. Another particular object of the invention constitutes a phosphorylated DGKα protein of a mammal belonging, illustrative title and without limiting the scope of the invention, to the following group: mouse, pig, rat and human being, preferably of human origin, and more preferably , The human protein DGKα phosphorylated in tyrosine 355 of SEQ ID NO2. Another object of the present invention constitutes a compound or agent that inhibits the activity of the phosphorylated DGKα protein, hereinafter, an inhibitor compound of the present invention, useful for the preparation of a medicament or pharmaceutical composition for the treatment of a process that involves stimulation of immune system cells. Another particular object of the invention constitutes an inhibitor compound of the DGKα protein in which the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene coding for the human DGKα protein (SEQ ID NO1) and that includes a nucleotide sequence selected from: a) a specific antisense nucleotide sequence specific to the sequence of the gene or mRNA of the DGKα protein, b) a ribozyme specific to the mRNA of the DGKα protein, c) a specific aptamer of the mRNA of the DGKα protein , d) an interference RNA (siRNA or shRNA) specific to the mRNA of the DGKα protein, and e) a microRNA (miRNA) specific to the mRNA of the DGKα protein. Another object of the present invention constitutes a pharmaceutical composition or a medicament useful for the treatment of diseases that occur with stimulation of the immune system, hereinafter pharmaceutical composition of the present invention, which comprises a therapeutically effective amount of a compound or agent that inhibits The protein DGKα, together with, optionally, one or more pharmaceutically acceptable adjuvants and / or vehicles.

Another object of the present invention constitutes the use of the pharmaceutical composition of the invention in a method of treating a mammal, preferably a human being, affected by a disease that stimulates the immune system, henceforth using the pharmaceutical composition. of the present invention, consisting of the administration of said therapeutic composition that inhibits the stimulation of the immune system.

Detailed description

The present invention is based on the fact that the inventors have demonstrated that the activation of T cells, carried out by means of TCR stimulation, induces the phosphorylation of DGKα in tyrosine 335 (Y335) by a mechanism that depends on the p56Lck tyrosine kinase. This Y335 residue is preserved in other DGKα orthologs such as mouse, pig and rat and in the present invention its phosphorylation has been examined using a specific antibody. The use of a non-phosphorylable mutant revealed that this tyrosine is essential for the location of the DGKα in the plasma membrane of the lymphocyte after immune stimulation. The analysis by subcellular fractionation demonstrates that this phosphorylated form of DGKα is located specifically in the membrane, suggesting that the phosphorylation of Y335 stabilizes its location in the membrane (Example 3). This is the first description of the tyrosine phosphorylation of the endogenous DGKα in T lymphocytes and identifies the Y355 as an essential residue for the location and stabilization in the membrane of the enzyme where it exerts its action by terminating the signals regulated by the DAG generated by the TCR when metabolized, thus constituting a marker of proliferation of T lymphocytes, a process that takes place in processes autoimmune or lymphoproliferative alterations such as leukemia and Hodking and non-Hodking lymphomas. The activation of DGKα allows the inactivation of the Ras / ERK route and at the same time its own inactivation through PA-sensitive phosphatases. In addition, it has been observed that the phosphorylation of this tyrosine 335

(Y335) is regulated by the generation of intracellular [Ca ²⁺ ], suggesting that mobilization of Ca ²⁺ , probably through direct interaction with the EF domains, is responsible for a conformational change that favors the phosphorylation of the enzyme (Example 4). Finally, it was observed that using DGKα-specific human sRNAi, an efficient attenuation of the DGKα expression is obtained, demonstrating also a differential action of this isoform against DGKζ (Example 5). These experiments indicate the potential use of this tool to attenuate the expression of DGKα in those cells or tissues where its expression may cause pathologies. These aforementioned polynucleotides can be used in a gene therapy process in which by any technique or procedure the integration thereof into said affected cells of a human patient is allowed.

Therefore, an object of the present invention constitutes a diagnostic and prognostic procedure of a disease that is stimulated by immune system stimulation, hereinafter diagnostic procedure of the invention, based on the in vitro determination of the phosphorylation level of Ia DGKα in the tyrosine residue Y335 in cells of the immune system, in a biological sample and comprising the following steps: a) identification or determination of the level of phosphorylation of the DGKα protein in the tyrosine residue Y335, in a biological sample of immune origin, and b) comparison of said determination observed in a) with a control sample, and where its increased presence is indicative of the existence of a disease that occurs with stimulation of the immune system. As used in the present invention, the term "diseases that occur with stimulation of the immune system" refers to a disease in which the stimulation and proliferation of cells of the immune system, preferably T lymphocytes, and belonging, by way of illustration, occurs. and without limiting the scope of the invention, to the following group: autoimmune, allergic, inflammatory diseases, lymphoproliferative disorders such as leukemias and Hodking and non-Hodking lymphomas. This identification of the level of phosphorylation of the DGKα protein in the Y335 tyrosine residue in a biological sample of a human subject can be extracted therefrom and subsequently ex vivo, the presence or absence of said phosphorylation, which would correlate with the diagnosis of an immune alteration in said subject, which would allow the definition and execution of a therapeutic or diagnostic and / or prognostic approach.

The determination of said levels of said biological sample is preferably carried out in T lymphocytes, which may or may not be purified prior to analysis. Said purification can be easily carried out by an expert in the field.

A particular object of the invention constitutes the diagnostic method of the invention where the determination is made with a phosphorylated tyrosine specific antibody (pY335) of the DGKα protein, more preferably, a polyclonal antibody, and more preferably, with an antibody Polyclonal synthesis of the synthetic peptide of SEQ ID NO3, such as the anti pY335 antibody (anti-pTyr335DGKα) developed in the present invention (see Example 2). Another object of the invention constitutes an antibody, either monoclonal or polyclonal, hereinafter antibody of the invention, specific to the phosphorylated DGKα protein in the tyrosine residue Y335, preferably a peptide specific polyclonal antibody of SEQ ID NO3, as the antibody anti pY335 developed in the present invention (anti-pTyr335DGKα). The antibody of the invention can be used, in addition to the previous use as a diagnostic tool, in other biotechnological methods of identifying the phosphorylated DGKα protein belonging, by way of illustration and without limiting the scope of the invention, to the following group: i) identification procedure of compounds that alter, activators or inhibitors, the kinase activity of the DGKα protein, ii) identification procedure of compounds that alter, activators or inhibitors, the phosphorylation of the DGKα protein, and iii) method of making a composition Therapeutic treatment for the treatment of diseases that occur with an increase in the immune response.

On the other hand, this phosphorylated DGKα protein or a fragment thereof comprising this phosphorylated residue tyrosine Y335, either of synthetic origin or isolated from eukaryotes, can be used in different fields as a biotechnological tool with biomedical applications.

Thus, another object of the invention constitutes a phosphorylated DGKα protein, hereinafter phosphorylated protein of the invention, which contains the phosphorylated 355 tyrosine residue or the like, or a fragment or peptide thereof comprising said phosphorylated 355 tyrosine.

Another particular object of the invention constitutes a phosphorylated DGKα protein of a mammal belonging, illustrative title and without limiting the scope of the invention, to the following group: mouse, pig, rat and human being, preferably of human origin, and more preferably , The human protein DGKα phosphorylated in tyrosine 355 of SEQ ID NO2.

As used in the present invention the term "phosphorylated DGKα protein in tyrosine residue 355" also refers to a protein, of different animal origin, preferably human, as well as any amino acid sequence (aás.) Analogous to the protein of SEQ ID NO2. In the sense used in this description, the term "analog" is intended to include any amino acid sequence that can be isolated or constructed based on the amino acid sequences shown herein, for example, by the introduction of conservative or non-conservative amino acid substitutions, including the insertion of one or more amino acids, the addition of one or more amino acids at any of the ends of the molecule or the deletion of one or more amino acids at any end or inside the sequence, and that constitutes a peptide sequence with activity similar to the sequence SEQ ID NO2 of the invention.

In general, an analogous amino acid sequence is substantially homologous to the amino acid sequence discussed above. In the sense used in this description, the expression "substantially homologous" means that the amino acid sequences in question have a degree of identity of at least 40%, preferably of at least 85%, or more preferably of At least 95%.

Another particular embodiment of the invention constitutes the phosphorylated DGKα protein of the invention that is constituted by a peptide or fragment, for example synthetic or isolated, of the DGKα comprising the phosphorylated amino acid Y335, for example a fragment corresponding to the sequence of the Ia human protein DGKα P329-A339, NH ₂ - CPPSS (phosphoY) PSVLA-COOH (SEQ ID NO3), which contains a phosphorylated tyrosine in a position similar to the tyrosine 335 of the human DGKα protein. The obtaining of different fragments or peptides that contain this sequence SEQ ID NO3 or similar sequence, representative of this domain of the DGKα with the phosphorylated tyrosine, can be easily carried out by one skilled in the art.

Another object of the invention constitutes the use of phosphorylated DGKα protein in the tyrosine residue 355 of the invention in a biotechnological process belonging, by way of illustration and without limiting the scope of the invention, to the following group: i) preparation procedure of monoclonal antibodies and / or polyclonal and / or recombinant anti-phosphorylated DGKα, ii) identification procedure for compounds that alter their phosphorylation, iii) identification procedure for activating or inhibiting compounds of the kinase activity of the DGKα protein itself.

Another particular embodiment of the invention constitutes the use of a fragment or peptide, synthetic or isolated, of the DGKα protein of SEQ ID NO2 containing said phosphorylated tyrosine 355, preferably, the synthetic peptide corresponding to the sequence of DGKα P329-A339, NH ₂ - CPPSS (phosphoY) PSVLA-COOH of SEQ ID NO3 for the preparation of monoclonal and / or polyclonal and / or recombinant anti-DGKα protein antibodies. These peptides can be isolated or synthesized and subsequently used by a person skilled in the art to produce a specific antibody against a phosphorylated DGKα form, preferably human. Another object of the present invention constitutes a compound or agent that inhibits the activity of the phosphorylated DGKα protein, hereinafter, an inhibitor compound of the present invention, useful for the preparation of a medicament or pharmaceutical composition for the treatment of a process that involves stimulation of immune system cells. As used in the present invention the term "compound or inhibitor or antagonist agent" refers to a molecule that when bound or interacts with the phosphorylated DGKα protein (for example, SEQ ID NO2), or with functional fragments thereof , decreases or eliminates the intensity or duration of the biological activity of said protein. This definition also includes those compounds that prevent or decrease the expression of the gene coding for the DGKα protein (for example, SEQ ID NO1), that is, that prevent or diminish the transcription of the gene, the maturation of the mRNA, the translation of the MRNA and post-translational modification. An inhibitory agent may consist of a peptide, a protein, a nucleic acid or polynucleotide, a carbohydrate, an antibody, a chemical compound or any other type of molecule that diminishes or eliminates the effect and / or the function of the DGKα protein.

By way of illustration, said polynucleotide can be a polynucleotide that encodes a specific antisense nucleotide sequence of the gene or mRNA sequence of the DGKα protein, or a polynucleotide encoding a specific ribozyme of the mRNA of the DGKα protein, or a polynucleotide encoding a specific mRNA aptamer of the DGKα protein, either polynucleotide encoding an interference RNA ("small interference RNA" or siRNA or a shRNA) specific to the mRNA of the DGKα protein or a microRNA (miRNA).

These polynucleotides mentioned can be used in a process of gene therapy in which by any technique or procedure the integration of them into the cells of a human patient is allowed. This objective can be achieved by administering to these cells of the immune system, in vivo or ex vivo, of a gene construct comprising one of the aforementioned polynucleotides in order to transform said cells allowing their expression inside them so that the expression of the DGKα protein is inhibited. Advantageously, said gene construct may be included within a vector, such as, for example, an expression vector or a transfer vector.

As used in the present invention, the term "vector" refers to systems used in the process of transferring an exogenous gene or an exogenous gene construct into a cell, thus allowing the vehicle to generate genes and gene constructs. exogenous Said vectors can be non-viral vectors or viral vectors (Pfeifer and Verma, 2001) and their administration can be prepared by an expert in the field according to the needs and specificities of each case. Therefore, another particular object of the invention constitutes an inhibitor compound of the DGKα protein in which the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the coding gene (SEQ ID NO1) of the human DGKα protein and that includes, at least, a nucleotide sequence selected from: a) a specific antisense nucleotide sequence of the sequence of the gene or mRNA of the DGKα protein, b) a ribozyme specific to the mRNA of the DGKα protein, c) a specific aptamer of the mRNA of the DGKα protein, d) an interfering RNA (siRNA or shRNA) specific to the mRNA of Ia DGKα protein, and e) a microRNA (miRNA) specific to the DGKα protein mRNA.

On the other hand, these gene inhibition techniques, and more specifically the vehiculization of the compounds - antisense oligonucleotides, iRNA, ribozymes or aptamers - can be carried out through the use of liposomes, nanoparticles or other vehicles that increase the success of said transfer to inside the cell, preferably to the cell nucleus (Lu and Woodle, 2005; Hawker and Wooley, 2005). In principle, inhibitors of DGKα mRNA translation can be used that bind both their coding and non-coding regions, for example against the 3 'non-coding zone. Thus, a particular embodiment of the invention constitutes a siRNA of d) in which the RNAi preferentially binds to the fragment sequence of the DGKα mRNA AAGCCAGAAGACCATGGATGA (SEQ ID NO4) or to another sequence comprising this or a shorter fragment of The same. Another particular embodiment of the invention constitutes an RNAi of d) in which the siRNA is constituted by a double stranded DNA oligonucleotide comprising an interference sequence, for example, the sequence SEQ ID NO4 and a sequence complementary to it ( for example, TCATCCATGGTCTTCTGGC (SEQ ID NO5) for the case of SEQ ID NO4) (Figure 10), originating a pair of sense and antisense nucleotide sequences, respectively (for the previous case, SEQ ID NO6 and 7, respectively). In addition, these double-stranded RNAi sequences comprise other sequences for their activity (by way of illustration, adapter, fork or polydimine sequences, see example 5). The nucleotide sequences a) -e) mentioned above prevent the expression of the gene in mRNA or mRNA in the DGKα protein, and, thus, cancel its biological function, and can be developed by an expert in the genetic engineering sector in role of existing knowledge in the state of the art on transgenesis and cancellation of gene expression (Clarke, 2002; US20020128220; Miyake et al., 2000; Puerta-Ferández et al., 2003; Kikuchi et al., 2003; Reynolds and cois., 2004).

Another object of the present invention constitutes a pharmaceutical composition or a medicament useful for the treatment of diseases that occur with stimulation of the immune system, hereinafter pharmaceutical composition of the present invention, which comprises a therapeutically effective amount of a compound or agent that inhibits The DGKα protein, together with, optionally, one or more pharmaceutically acceptable adjuvants and / or vehicles. Another particular object of the present invention constitutes a pharmaceutical composition in which the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene coding for the human DGKα protein (SEQ ID NO1) and that includes, at least, a nucleotide sequence selected from: a) a specific antisense nucleotide sequence specific to the sequence of the gene or mRNA of the DGKα protein, b) a ribozyme specific to the mRNA of the DGKα protein, c) a specific mRNA aptamer of the protein DGKα, d) an interference RNA (iRNA) specific to the mRNA of the DGKα protein, and e) a microRNA (miRNA) specific to the mRNA of the DGKα protein. Another particular embodiment of the invention constitutes the pharmaceutical composition of the invention in which the DGKα inhibitor compound is a siRNA that preferentially binds to the DGKα mRNA fragment sequence AAGCCAGAAGACCATGGATGA (SEQ ID NO4) or another sequence comprising it. or to a shorter fragment thereof (see Example 5).

Another particular embodiment of the invention constitutes the pharmaceutical composition of the invention in which the DGKα inhibitor compound is an RNAi constituted by a double stranded DNA oligonucleotide comprising an interference sequence, for example, the sequence SEQ ID NO4 and a complementary sequence to it (for example, TCATCCATGGTCTTCTGGC (SEQ ID NO5) for the case of SEQ ID NO4) (Figure 10), originating a pair of sense and antisense nucleotide sequences, respectively (for the previous case, SEQ ID NO6 and 7, respectively). In addition, these double-stranded RNAi sequences comprise other sequences necessary for their activity (by way of illustration, adapter, fork or polydimine sequences, see example 5) and can be prepared by one skilled in the art.

Another particular object of the present invention constitutes a pharmaceutical composition in which the inhibitor compound is an antibody, either monoclonal or polyclonal, specific for the phosphorylated DGKα protein in the Y335 tyrosine residue, or of a peptide or fragment containing it, preferably a polyclonal antibody specific to the peptide or sequence fragment SEQ ID NO3, more preferably the anti-pTyr335DGKα antibody developed in the invention.

The pharmaceutically acceptable adjuvants and vehicles that can be used in said compositions are the adjuvants and vehicles known to those skilled in the art and commonly used in the elaboration of therapeutic compositions. In the sense used in this description, the expression "therapeutically effective amount" refers to the amount of the agent or compound inhibitor of the activity of the DGKα protein, calculated to produce the desired effect and, in general, will be determined, among other causes, by the characteristics of the compounds, including the age, condition of the patient, the severity of the alteration or disorder , and of the route and frequency of administration.

In a particular embodiment, said therapeutic composition is prepared in the form of a solid form or aqueous suspension, in a pharmaceutically acceptable diluent. The therapeutic composition provided by this invention can be administered by any appropriate route of administration, for which said composition will be formulated in the pharmaceutical form appropriate to the route of administration chosen. In a particular embodiment, the administration of the therapeutic composition provided by this invention is carried out parenterally, orally, intraperitoneally, subcutaneously, etc. A review of the different pharmaceutical forms of drug administration and of the excipients necessary for obtaining them can be found, for example, in Faulí and Trillo, 1993.

Another object of the present invention constitutes the use of the pharmaceutical composition of the invention in a method of treating a mammal, preferably a human being, affected by a disease that stimulates the immune system, henceforth using the pharmaceutical composition. of the present invention, consisting of the administration of said therapeutic composition that inhibits the stimulation of the immune system. Another particular object of the invention constitutes the use of the pharmaceutical composition of the invention in which disease that occurs with stimulation of the immune system belongs, by way of illustration and without limiting the scope of the invention, to the following group: autoimmune diseases, allergic, inflammatory, lymphoproliferative disorders such as leukemia and Hodking and non-Hodking lymphomas. DESCRIPTION OF THE FIGURES

Figure 1.- DGKα is phosphorylated in tyrosine in response to TCR stimulation. A) Jurkat cells were stimulated during the indicated times with an anti-CD3 antibody. The cells were used and the proteins were immunoprecipitated using an anti-phosphotyrosine (anti-PY) antibody and the membrane was revealed with an anti-DGKα antibody. B) The cells were treated as in A. DGKα was immunoprecipitated using a specific antibody and the membrane was revealed with an anti PY antibody and then with anti-DGKα.

Figure 2.- A) Sequence comparison in Type I DGKs. A green sequence indicates a Pro-rich sequence conserved in all members of the DGK family. The Y335 preserved in the different DGKα orthologs is indicated by an arrow. B) p56LcK phosphorylate DGKα in Ia Y335. Jurkat cells were transfected with plasmids encoding wild GFP-DGKα (wt) and mutated GFP-DGKα Y335F together with an empty plasmid or a plasmid encoding p56Lck (505). At 24 hours, the cells were used and the GFP-DGKα was immunoprecipitated using anti-GFP antibodies. Proteins were analyzed by SDS-PAGE and immunoblot. Phosphorylation of DGKα was determined with anti-pY monoclonal antibodies, and the level of expression with anti-DGKα.

Figure 3.- The phosphorylation of DGKα in Y335 is essential for its translocation to the plasma membrane. Jurkat cells were transfected with wild DGKα (wt) or the Y335F mutant fused to GFP. 24 hours after the transfection, the cells were plated on plates coated with antiCD3 / antiCD28 antibodies and the subcellular location of the enzyme was determined by confocal microscopy. Figure 4.- The anti pTyr335 DGKα antibody of the invention recognizes the phosphorylated DGKα in Y335. A) HEK293 cells were transfected with different concentrations of a human DGKα coding plasmid fused to a myc epitope together with control plasmid or a Lck coding plasmid. 24 hours later the cells were collected, used and the levels of pDGKαY335, DGKα and Lck were determined using the corresponding antibodies. B) myc-DGKα was immunoprecipitated using anti-myc antibody and the phosphorylation status was determined with the anti-pDGK Y335 antibody. C) Same experiment as in A but using a plasmid encoding the mouse DGKα fused to an HA epitope. D) HEK293 cells were transfected with HA-DGKα or HA-DGKα Y335F mutant plasmids together with Lck. After 24 hours post-transfection, phosphorylation of DGKα was determined using the anti-pTyr335 antibody.

Figure 5.- A) The phosphorylation of DGKα is dependent on Src kinases. Jurkat cells were incubated with the Src kinase PP2 inhibitor at the indicated concentrations for 1 hour. Cells were collected and used. The proteins were separated by SDS PAGE and the phosphorylation of DGKα was determined with the anti pTyr335 DGKα antibody of the invention. B) The phosphorylation of DGK in T lymphocytes depends on Lck. Cell lysates obtained from HEK293, Jurkat, JcaM and Molt4 cells were analyzed by SDS PAGE and immunoblot. Phosphorylation of DGKα was determined using the anti-pTyr335 DGKα antibody. The expression of DGKα and Lck was determined using specific antibodies.

Figure 6.- Subcellular distribution of the phosphorylated DGKα in Y355.

Subcellular fractions obtained from Jurkat cells were analyzed by SDS PAGE and Western Blot with the indicated antibodies. Figure 7.- Phosphorylation kinetics of Y335 in DGKα in response to TCR. Jurkat cells were stimulated with anti-CD3 or anti-CD3 / -CD28 during the indicated times. Where indicated, the cells were incubated with the DGK pharmacological inhibitor for 30 minutes before antibody stimulation. The phosphorylation of DGKα was determined using the anti-pDGKα-Y335 antibody of the invention as described in previous experiments. The membranes were re-incubated with anti-DGKα antibodies to detect the total protein. Samples from the same lysate were analyzed to determine the phosphorylation of Erk1 / 2. The phosphorylation level was quantified using the lmage J software.

Figure 8.- The flow of Ca ²⁺ increases the phosphorylation of DGKD in Tyr335. Jurkat cells were treated with the indicated stimuli for 5 min. The phosphorylation status of DGK was determined as in previous experiments. As controls, NFAT dephosphorylation was determined as well as ERK1 / 2 phosphorylation.

Figure 9.- DGKα activation model. In response to the stimulation of the TCR, Lck activates and initiates a cascade of signals that lead to the activation of PLCγ that generates DAG and IP ₃ . The latter favors the flow of Ca ⁺² from the endoplasmic reticulum that promotes a conformational change that "opens" the DGKα. This allows its interaction with Lck in the plasma membrane and its phosphorylation in Tyr335, which allows its stabilization in the membrane and its rapid dissociation of Lck. The pY335 DGKα protein is active and, since it locates in the membrane, it can metabolize the DAG generated by the TCR. The activation of DGKα allows the inactivation of the Ras / ERK route and at the same time its own inactivation through PA-sensitive phosphatases. Figure 10.- Scheme of each of the DGKs indicating the oligonucleotide sequence used to generate the human sRNAi of the invention.

Figure 11.- DGKs expression levels after the expression of specific human sRNAi. Western blot analysis of the expression of DGKD (above), DGKζ in the middle, and tubulin (below) in used cells transfected with shRNAi control (C), and specific for each of the isoforms.

Figure 12.- Analysis of the effect of attenuating the expression of DGKs on the Ras / ERK route. The cells were transfected with the corresponding human sRNAi and the activation of the Ras route after the TCR stimulation was determined by analysis of the ERK phosphorylation using antiphosphoresiduous antibodies (pERK, above), the total Erk level in the samples was determined as a control (below) at different times.

Figure 13.- Effect of the attenuation of DGKs in the translocation of PKCs. Jurkat cells, transfected with the indicated human sRNAi were stimulated with antiCD3 / antiCD28 antibodies during the indicated times. The cells were homogenized and membranes were isolated by ultracentrifugation. The location of the indicated PKC isoforms was determined by Western Blot analysis with the corresponding antibodies.

Figure 14.- Analysis of the effect of attenuating the expression of DGKs on the PI3K / AKT route. The cells were transfected with the corresponding human sRNAi and the phosphorylation of AKT was determined by using the corresponding antiphosphoresiduous antibodies. EXAMPLES OF THE INVENTION

Example 1.- The endogenous DG Ka is phosphorylated in tyrosines in response to the stimulation of the TCR receptor, and more specifically in the Y355 residue, this Y355 residue being necessary for the mobilization of the DGKα from the cytosol to the membrane.

Given the importance of tyrosine kinases in the activation of the DGKα in response to the signal triggered by the TCR, the tyrosine phosphorylation of the endogenous DGKα was verified in response to the stimulation of the TCR. For this purpose, the stimulation of the TCR was mimicked by specific antibodies of the CD3 (anti-CD3) of the Jurkat cells and the tyrosine phosphorylated proteins of the lysate of these cells were immunoprecipitated, by means of a specific antibody of said proteins. Immunoprecipitate proteins were separated in polyacrylamide gels under reducing conditions (SDS-PAGE) and transferred to a nitrocellulose membrane by Western blot techniques. The analysis of the membrane with a specific DGKα antibody allowed to detect the presence of the protein, among all the proteins of the immunoprecipitate, only in response to the stimulation of the TCR and in a rapid manner, five minutes after the stimulation, which was the Shortest time analyzed (Figure 1A). However, this result did not allow discriminating between direct phosphorylation of the protein and / or association with phosphorylated proteins in tyrosine. To discriminate between direct phosphorylation of the DGKα and association with phosphorylated proteins in response to the TCR, the TCR of the Jurkat cells was stimulated with anti-CD3 antibodies and the DGKα was immunoprecipitated by a mixture of three monoclonal antibodies that recognize three different epitopes of the Ia protein. Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane by Western blot. The analysis of the membrane through the use of an antibody that recognizes phosphorylated proteins in tyrosine (anti-pY) revealed that the DGKα protein was phosphorylation in tyrosine in response to the stimulation of TCR and that this phosphorylation, in addition to being stoichiometrically low, was rapid and transient, when it was verified that the phosphorylation level reaches its maximum between five and fifteen minutes and then decay after thirty minutes (Figure 1 B).

The alignment of the sequence corresponding to the human, pig, rat and mouse DGKa orthologs (Figure 2A) demonstrates the high degree of conservation of the Y355 (numbering according to the human sequence), located between the second domain C1 and the domain catalytic. This residue that is not present in other type I isoforms has been proposed to be phosphorylated by Src in response to growth factors (Baldanzi, Cutrupi et al. 2002) or alphaD-tocopherol (Fukunaga-Takenalk, Shirai et al. 2003) . To define the possible role of Tyr 335 in the mechanism of DGKα activation by Lck, a substitution mutant of Tyr 335 by Phe was performed on the GFP-DGKα fusion protein (Figure 2A). The first thing that was analyzed was the level of phosphorylation in the presence of Lck, for which the cells of the Ba / F3 line were used, which is a proB line that does not express either Fyn or Lck, although other members of Src such as Lyn or BIk. In these cells, the wild GFP-DGKα (wt) and the Y335F mutant constructs were transfected and the phosphorylation of the proteins expressed in the iodine lysate was analyzed, a lower level of phosphorylation of the muffiness GFP-DGKαY335F being observed respecting the silvesíre form ( Figure 2B). This result indicates that the Tyr 335 is accessible to the Lck tyrosine kinase To determine the importance of the Tyr 335 in the mobilization of the

DGKα in response to the TCR, the mobilization of the wild GFP-DGKα (wí) and the muierie in response to said recipient was studied. For this purpose, Jurkaí line cells were transfected with expression neighbors for both proieins and the mobilization of the proiein was analyzed by confocal microscopy in response to the mimicking of the mimicked TCR with ani-CD3 and CD28 aniic antibodies. The result showed that, unlike of the wild GFP-DGKα (wt), the GFP-DGKα Y335F mutant was unable to mobilize to the plasma membrane in response to the TCR stimulus (Figure 3). These results demonstrate that Y335 is essential for the mechanism of mobilization of DGKα from the cytosol to the membrane in response to the TCR.

Example 2.- Generation of an antibody that specifically recognizes the phosphorylated Y355 residue (anti-phosphotyrosine antibody 335; pTyr335) To better analyze the role of tyrosine 335 in the direct phosphorylation of DGKα, a specific antibody capable of recognize this phosphorylated tyrosine (anti-pTyr335 antibody). To assess the specificity of the new antibody, an expression vector for the human origin DGKα coupled to a myc marker (myc-DGKα) was co-transfected in the HEK293 cell line, together with another for the expression of p56Lck. Twenty-four hours after the transfection, the DGKα of the cell lysate was immunoprecipitated by a specific antibody of the myc marker (anti-myc), and both this immunoprecipitate and a sample of the lysate were separated by SDS-PAGE and transferred to nitrocellulose membranes by Western blot The analysis of the membrane, both of the total lysate (Figure 4A), and of the anti-myc immunoprecipitate (Figure 4B), showed that the new anti-phosphotyrosine 335 antibody (pTyr335) only recognizes the DGKα when expressed together with the p56Lck. The antibody also recognizes the wild form of mouse DGKα labeled with HA (wild HA-DGKα, wt) when overexpressed with Lck (Figure 4C). The antibody recognizes a weaker signal in the absence of Lck in longer exposures. Since HEK293 cells express other TKs of the Src family, that signal may correspond to endogenous Tk phosphorylation.

To check if the anti-pTyr335 antibody was able to specifically recognize phosphorylated 335 tyrosine and not a phosphorylation nonspecific of the protein, an expression vector coding for the p56Lck was co-transfected into cells of the HEK293 line together with another that expresses the wild form of mouse DGKα labeled with HA (wild HA-DGKα, wt) or the mutant form in tyrosine 335 substituted by phenylalanine (HA-DGKα Y335F) of the same species. Twenty-four hours later, the proteins from the cell phones were separated by SDS-PAGE techniques, and transferred to a nitrocellulose membrane by Western blot. Analysis of the membrane with the anti-pTyr335 antibody showed that the antibody is capable of recognizing the direct phosphorylation by p56Lck only when the tyrosine 335 is present in the DGKα demonstrating the specificity and the discriminating ability of the anti-pTyr335 antibody (Figure 4D ).

Example 3.- The phosphorylation of DGKα in Y355 is dependent on p56Lck, being located mostly in the plasma membrane, being induced by TCR stimulation and regulated by the DGKα kinase activity itself.

The p56Lck protein phosphorylates DGKα in tyrosine 335 when both are expressed ectopically in HEK293 cells. To corroborate if the same occurred with the endogenously expressed proteins, the Jurkat cell line expressing both the DGKα and the p56Lck was used, and the tyrosine kinase activity of the members of the Src family was inhibited for one hour by a specific inhibitor, PP2, used at different concentrations. The analysis of the proteins of the used cell phones, through their separation by SDS-PAGE and subsequent transfer to nitrocellulose membrane by Western blot, by means of the anti-pTyr335 antibody and the anti-pY antibody, showed that the phosphorylation level It is inversely proportional to the dose of Src inhibitor, PP2, used, both in the phosphorylation of tyrosine 335 of the DGKα and in the phosphorylation of the rest of the lysate proteins (Figure 4A). But nevertheless, This result did not rule out that other members of the Src family such as p59Fyn could be phosphorylating the DGKα in the tyrosine 335. To discard it, the JCaM cell line derived from Jurkat but not expressing p56Lck and the Molt4 cell line was used, which, at Like Jurkat, it expresses the p56Lck and the DGKα. The cellular proteins of Jurkat, JCaM and Molt4 were separated as in Figure 5A and the analysis of the phosphorylation in tyrosine 335 was carried out by means of the anti-pTyr335 antibody. The result showed that, even expressing the same levels of DGKα, the phosphorylation in tyrosine 335 can only be detected when cells express p56Lck (Figure 5B).

The mobilization of the DGKα protein from the cytosol to the membrane depends on the flow of calcium and the activation of tyrosine kinases (Sanjuan, Jones et al. 2001). To determine how the phosphorylation of tyrosine 335 by p56Lck influenced the subcellular location of DGKα, a subcellular fractionation of Jurkat cells was performed. After fractionation, cell proteins were separated by SDS-PAGE techniques and transferred to a nitrocellulose membrane by Western blotting techniques. Anti-p56Lck, membrane control, anti-lκBα, cytosol and anti-vimentin control, cytoskeleton control antibodies were used for fractionation controls. The result of the fractionation allowed to corroborate the data already described that most of the DGKα was cytosolic compared to a small fraction that is present in the plasma membrane (Sanjuan, Pradet-Balade et al. 2003), and, in addition, to determine that part of the protein is in the cytoskeleton (Figure 6). The visualization of the phosphorylation of the DGKα in the tyrosine 335 by means of the anti-pTyr335 antibody showed that the phosphorylated protein is present exclusively in the plasma membrane fractions, mostly, and cytoskeleton, coinciding therein with the presence of Ia p56Lck. The results of the phosphorylation of the endogenous DGKα protein proposed that the phosphorylation was rapid and transient. To study the possible phosphorylation of DGKα in tyrosine 335 in response to TCR, the stimulation of TCR was mimicked by anti-CD3 and anti-CD3 / -CD28 antibodies in Jurkat cells. After the separation of the proteins from the cell lysate by SDS-PAGE and the subsequent transfer to nitrocellulose membrane by Western blotting, the phosphorylated state of DGKα was analyzed using the anti-pTyr335 antibody. The result showed that phosphorylation increases rapidly, after five minutes there is an increase in transient phosphorylation, at fifteen minutes the phosphorylation returns to its basal levels, and stoichiometrically low (Figure 7). In addition, the co-stimulation signal from the CD28 caused a slight increase in the level of phosphorylation of the tyrosine 335 with respect to the signal of the CD3, thus exerting a positive role in the phosphorylation.

Example 4.- The phosphorylation of DGKα in Y355 is regulated by its own kinase activity and is increased by an increase in the flow of Ca ²⁺ .

The inhibition of the kinase activity of the DGKα causes that the location of the protein, in response to the TCR, instead of being transient is sustained (Sanjuan, Jones et al. 2001), showing the relationship between the activity of the protein and its location in the membrane. Since the DGKα is phosphorylated in tyrosine also with a rapid and transient kinetics in response to the TCR, it was determined if there was any relationship between the increase in the phosphorylated state of the tyrosine 335 and the kinase activity of the DGKα, for which the Ia same for thirty minutes by means of the inhibitor of DGKs of type I, R59949, and before the stimulation with anti-CD3 antibodies. Cell lysate proteins were separated by SDS-PAGE and Western blot techniques. The phosphorylation in tyrosine 335 was analyzed with the anti-pTyr335 Io antibody which showed that the activity DGKα was important to decrease the phosphorylated state of DGKα during TCR activation (Figure 7). This suggests that, through its kinase activity, the DGKα regulates its phosphorylation level after the stimulation of the TCR. On the other hand, the DGKα has two hands-like domains EF, characteristic of the Ca ²⁺ binding and is activated by Ca ^{2 +} in vitro. The deletion of the EF domains induces the constitutive localization of the enzyme in the membrane which suggests that a conformational change dependent on EF is necessary to allow the location in the membrane of the enzyme. The effect of both Ca ²⁺ and DAG on the phosphorylation of DGKα in Y355 was evaluated. Intracellular Ca ²⁺ levels were increased using the ionomycin ionophore while the effects of DAG were mimicked using PMA. As can be seen in Figure 8, ionomycin treatment promoted the phosphorylation of DGKα in Y335. Although the addition of PMA enhanced the phosphorylation of Erk had no effect on the phosphorylation of Y355. Finally, maximum phosphorylation was observed using the two stimuli together. These results demonstrate that the concerted action of the signals regulated by DAGα and Ca ²⁺ induces the maximum phosphorylation in the Y355 residue. The mobilization of Ca ²⁺ , probably through direct interaction with the EF domains, is responsible for a conformational change that favors the phosphorylation of the enzyme.

Example 5.- Validation of the use of human interference RNA (hRNAi) to inhibit the expression of DGKα as a tool to define its function in the immune response

To evaluate the relevance of each of the isoforms of the protein

DGK present in T lymphocytes was decided to independently attenuate the expression of each of these isoforms using the gene silencing technique by interfering RNA. RNA interference (RNAi) represents the most recent and promising technology for gene silencing. This technology is based on the use of a conserved innate defense mechanism, whereby double-stranded RNAs silence the expression of specific genes, catalyzing the degradation of the homologous mRNA (Fire A et al. 1998 Nature 391, 806-811; Elbashir SM et al. 2001 Nature 411; 494-498). RNA interference can be carried out, either by introducing into the presynthesized hRNAi duplex cells or by intracellular expression of hRNAi from plasmid subcloned DNA templates. The use of plasmids is much more versatile, in addition to that the silencing can be prolonged for much longer, even silently stating using retroviral and / or lentiviral vectors (Hemann MT et al 2003, 33; 396-400). Both synthesized and intracellularly expressed RNAi converge in the RISC complex and are capable of inducing gene silencing. The generation of human RNAi against each of the isoforms of the DGK protein was carried out by means of the synthesis of two oligonucleotides of 21 bp corresponding to the regions selected in the corresponding sequence to perform the RNAi (nucleotide sequence of the human DGKD, nt 1153-1173: AAGCCAGAAGACCATGGATGA (SEQ ID NO4); nucleotide sequence of the human DGK.ζ, nt 2290-2310: AACTATGTGACTGAGATCGCA (SEQ ID NO8) (Figure 10). The selected sequences (SEQ ID NO3 and 8) were subsequently used to generate double stranded DNA oligonucleotides that included a seven bp adapter sequence followed by the last 19 nucleotides corresponding to the interference sequence plus a nine bp sequence that originates a hairpin in the produced RNA and the complementary sequence at 19 pb above (TCATCCATGGTCTTCTGGC (SEQ ID NO5) and TGCGATCTCAGTCACATAG (SEQ ID NO8), complementary to DGKα and human DGKζ, respectively) (Figure 10), originating a pair of sense and antisense nucleotide sequences for human DGKα, (SEQ ID NO6 and 7) as for DGKD (SEQ ID NO10 and 11), respectively. By Finally, the oligonucleotide contains a polyimidine sequence that allows the termination of transcription by RNA polymerase III. The RNA obtained by the transcription of this insert consists of a double-stranded RNA with a hairpin ("short hairpin RNA or shRNAi), which is effectively recognized by the Dicer complex or RNA silencing complex.

The generated DNA sequences were cloned into the vector pSUPER and pSUPERGFP (Oligoengine). Vectors were transfected into Jurkat cells by electroporation. Cells were collected 96 hours post-transfection and DGKα and. Y protein levels were evaluated by Western blotting with antibodies specific for both isoforms (Sanjuan, MA, DR Jones, et al. (2001). "Role of diacylglycerol kinase alpha in the attenuation of receptor signaling. "J CeII Biol 153 (1): 207-20. Antidgkalfa antibody; Topham, MK and SM Prescott (1999)." Mammalian diacylglycerol kinases, a family of lipid kinases with signaling functions. "J Biol Chem 274 (17): 11447-50. Anti-DGGzeta antibody; respectively). Transfection with the corresponding plasmids (pSUPERGFP-1153: AAGCCAGAAGACCATGGATGA and pSUPERGFP-2450:

AAGGTGAAGAGCTGATTGAGG) induced a sharp reduction in the levels of each of the DGKα and .ζ proteins (Figure 11).

Next, the effect of attenuating the expression of each of the DGK isoforms on the regulation of the signals originated by TCR stimulation was evaluated. The experiments previously demonstrated the important role of DGKα as a negative modulator of the Ras / ERK route through the location of the RasGRPI membrane. As can be seen, the attenuation of DGKα had a marked effect on the kinetics of ERK phosphorylation that was more intense and transitory compared to the stimulation in cells expressing normal levels of DGKα (Figure 12) However, under these conditions the attenuation of DGKζ had no apparent effect by modulating RasGRPI. The generation of DAG regulates the location to the membrane of protein kinases of the family C (PKCs). The stimulation of the TCR antigen receptor induces translocation to the membrane of the PKC alpha isoform with biphasic kinetics. As can be seen in Figure 13, the attenuation of DGKα expression induces a much more transient translocation kinetics, losing the second translocation peak. On the contrary, the attenuation of DGKζ expression induced a much more sustained translocation kinetics. A similar effect was observed on the translocation kinetics of PKCΘ, which, as is the case for PKCD, translocated much more intensely in cells with reduced levels of DGKΘ.

The activation of the TCR induces a higher PI3K activity which, in turn, regulates the activation of the PDK1 kinase that phosphorylates and activates the AKT kinase. The activation of this kinase is essential for lymphocyte activation. As can be seen in Figure 14, the phosphorylation of AKT in Ia T308, the phosphorylation site by PDK1, is elevated in cells with less expression of both DGKα and DGKζ, the effect being more pronounced in the case of the latter. On the contrary, the phosphorylation of AKT in S473 was not affected by the alteration of the levels of either of the two DGKs. In summary, these experiments demonstrate the effective attenuation of

DGKα using shRNAi and demonstrate the differential action of this isoform against DGKζ. These experiments indicate the potential use of this tool to attenuate the expression of DGKD in those cells or tissues where its expression may cause pathologies.

MATERIAL AND METHODS

Cell lines The BaF3 cell line was maintained in culture in RPMI medium supplemented with 2mM glutamine, 10% fetal bovine serum (FCS), 50 nM β-mercaptoethanol and 50 U / ml recombinant interleukin-2 (I L2) or supernatant of Wehi3B cells that provides interleukin-3 (IL-3) to 10% The HEK293, Jurkat and JCAM lines were maintained with DMEM medium supplemented with 2 mM glutamine, 10% FCS. The SU-DHL1 and Karpas 299 cell lines were maintained with RPMI medium supplemented with 2 mM glutamine, 10% FCS. All lines were maintained at 37C and 10% CO ₂ .

Stimulation of cells with soluble CD3 / CD8 antibodies

The cells of the Jurkat line in exponential growth were collected in HBSS buffer (25 mM of hepes KOH pH 7.4, 1 mM MgCI ₂ , 1 mM CaCI ₂ , 132 mM NaCI, 0.1% BSA) in 1.5 ml tubes, one for each point of stimulation, at a concentration never exceeding 5x10 ⁶ cells / ml. The cells were stimulated with anti-CD3 or anti-CD3 and anti-CD28 antibodies at a final concentration of 1 μg / ml each. In the case of using the DGK inhibitor, R59949, the cells were incubated 30 minutes before stimulation with the inhibitor at a concentration of 30 μM. After stimulation during the indicated times, the cells were frozen at -8O ⁰ C and subsequently used to analyze the proteins by SDS-PAGE and western blot techniques.

Cell lysis

The cells were used in the p70 buffer (10 mM Hepes, pH 7.5, 15 mM KCI, 1 mM EDTA, 1 mM EGTA, 10% glycerol, 0.2% Nonidet P-40, 1 mM dithiothreitol, 50 mM NaF, 10 μg / ml of leupeptin and aprotinin, 1 mM PMSF,

1 mM orthovanadaro sodium, and 20 mM-glycerol phosphate) at 4 ^or for 10 minutes. The lysate was then centrifuged at 15.00Og, 4 ^or for 15 minutes.

In the supernatant, the amount of protein was quantified, once quantified by means of the SDS detergent, the proteins were reduced with Laemmli buffer and these were separated in polyacrylamidated gels and SDS-PAGE electrophoresis. The proteins were transferred to nitrocellulose membranes and these were analyzed with specific antibodies against the protein of interest.

Plasmids and Transfections

Expression vectors for wild GFP-DGKα (wt), GFP-DGKα Δ (1-196) and HA-DGKα used were previously generated and described in the laboratory (Sanjuan, Jones et al. 2001; Cypress, Carrasco et al. 2003). On them, the punctual mutation of tyrosine 335 was performed by alanine or aspartic.

The DNA oligos used to perform the directed mutagenesis are summarized in Table Materials 1:

Materials Table 1

To obtain the specific mutations of tyrosine 335, the Stratagene "QuickChange Site-directed mutagenesis kit" system was used, following the manufacturer's instructions.

For the transfection of the Ba / F3 cells, 12.5 x 10 ⁶ of exponentially growing cells were collected and resuspended in a volume of 500 µl of medium without previously tempered serum. 20 μg of transfected Plasmid DNA of interest with an electric shock that is performed at 304 v and 975 μF. After the electric shock, the cells were recovered with 30 ml of complete medium and 24 hours later the corresponding assay was performed. In the case of Jurkat cells, 20 μg of plasmid DNA of interest was transfected in the same number of cells as in BaF3 but resuspended in 400 μl of medium without previously tempered serum. The electro shock was performed at 270 v and 975 μF and the cells were recovered with 20 ml of complete medium, 24 hours later the assay was performed. HEK293 cells were transfected with lipofectamine according to the manufacturer's instructions.

Polyacrylamide gels and Western Blot

The proteins of the used cell phones were separated in polyacrylamide gels under denaturing conditions (SDS-PAGE). The percentage of gels varied depending on the protein analyzed between 7.5% and 12%. In the case of DGKα the percentage was 10%. Once the separation of the proteins was carried out, they were transferred to nitrocellulose membranes by western blotting techniques.

The analysis of nitrocellulose membranes was performed with specific antibodies following the manufacturer's instructions. Except for specific variations, in the basic protocol the nitrocellulose membranes were incubated with 5% milk in TBS for one hour at room temperature to block them. Then, 2 10 minute washes were performed with 0.1% TBS / Tween-20, followed by a 1 hour incubation with the primary antibody at room temperature. After 1 hour, the nitrocellulose membrane was washed with 3 washes of 0.1% TBS / Tween-20 and incubated with the secondary antibody coupled to the HRP enzyme for one hour at room temperature. Finally, the membrane was washed twice with 0.1% TBS / Tween-20, and revealed by the luminescent reaction that generates the HRP in the presence of its substrate for which the ECL reagent was used. This luminescent reaction was collected by autoradiography and quantified using the lmage J. program. Antibody generation, non-commercial, anti-pY335DGKα

A synthetic peptide corresponding to the sequence of DGKα P329-A339, NH ₂ -CPPSS (phosphoY) PSVLA-COOH was conjugated to KLH. 300 μg of the KLH conjugated antigen was emulsified with complete Freund's adjuvant and injected into 10 month old rabbits. Every two weeks, another 150 μg of antigen is reinjected with incomplete Freund's adjuvant. Three days after the sixth reinjection, the rabbit was bled and the antiserum was collected. The specificity of the antibody was confirmed by dot blot and western blot using a non-phosphorylated peptide, NH ₂ -CPPSSIYPSVLA-COOH, and a DGKα mutant that cannot be phosphorylated in tyrosine 335, Y335F. The antibody reacted with the phosphorylated peptide but not with the non-phosphorylated peptide or with the Y335F mutant.

Immunoprecipitation

The cells were used in NP-40 buffer (1% Nonideí P-40, 50 mM Tris-HCI, pH 7.5, 150 mM NaCI, 10 mM NaF, 10 mM Na ₄ P ₂ O ₇ , 1 mM Na3VO ₄ , 1 mM PMSF, 10 ng / μl approprinin, 10 ng / μl leupepine), then centrifuged at 15.00Og, 4 ⁰ C. Once the supernatany is collected, the amount of proiein thereof was quantified. Immunoprecipiation was performed according to the specifications of each antibody, generally 1-5 μg / ml of an antibody in 300-500 μg of proiein lasting 1 hour at 4 ⁰ C. After that time, the secondary antibody capable of recognizing the Immunoprecipitate used, Gamma-Bind G proiein shepharose, 1 hour at 4 ⁰ C. Finally, the immunoprecipitate was collected by centrifugation, and washed twice with the NP40 lysis buffer used for lysing, once with a LiCI iampon ( 0.5 M LiCI and 50 mM Hepes pH 7.4) and 3 times with 50 mM Hepes buffer pH 7.4.

Subcellular fractionation

The fractionation was performed as described in Cao, Janssen eí al. 2002 with the following modifications. Jurkat cells were harvested and resuspended in previously cooled lysis buffer 1 (5 mM Tris-HCI, pH 7.5, 10 mM NaCI, 0.5 mM MgCI ₂ , 1 mM EGTA, 1 mM DTT and 40 μg / ml digitonin) supplemented with the mixture of protein inhibitors. The cells were used for 15 minutes at 4 ⁰ C, then centrifuged at 4500 g for 4 minutes at 4 ⁰ C and the supernatant (cytosolic fraction, C) was collected. The insoluble fraction was resuspended in previously cooled lysis buffer 2 (5 mM Tris-HCI, pH 7.5, 10 mM NaCI, 0.5 mM MgCI ₂ , 1 mM EGTA, 1 mM DTT and 0.2% NP40) and used for 10 minutes at 4 ⁰ C, then centrifuged at 15,000 g, 15 minutes at 4 ⁰ C and the supernatant (membrane fraction, M1) was collected. The insoluble fraction of this second lysate is resuspended in lysis buffer 3 (5 mM Tris-HCI, pH 7.5, 10 mM NaCI, 0.5 mM MgCI ₂ , 1 mM EGTA, 1 mM DTT and 1% NP40) and subject thereto process than with buffer 2. The supernatant of this second fraction contains the proteins most strongly associated with cell membranes (membrane fraction, M2). The last insoluble fraction was resuspended in protein loading buffer (Laemmli buffer) and corresponds to the protein fraction of the cytoskeleton (Ck). The different fractions are separated by SDS-PAGE and western blot techniques.

DGK test

The proteins were immunoprecipitated according to their protocol and their activity was tested by incorporating the gamma phosphate of a radioactively labeled ATP molecule (P ³² ) into the chain DAG molecule of eight carbon atoms, 1,2-octanoyl-sn-glycerol (C8-DAG), to give rise to phosphatidic acid with a chain of eight carbon atoms labeled with phosphorus 32 (C8-P ³² A). The reaction was carried out at room temperature for 10 minutes, and once it occurred, the lipids were extracted using a solvent composed of CHCL ₃ / Me0H / HCL (2N) (20: 10: 5, v / v / v) . The lipids were dried by centrifugal medium in atmospheric vacuum, then to be resuspended in a solvent of CHCL ₃ , MeOH, and 4 M ammonium (9: 7: 2, v / v / v). These lipids were separated in thin layer chromatography (TLC) and the result of the separation was visualized by autoradiography thereof.

Confocal microscopy

Jurkat cells, 24 hours after transfection, were centrifuged and resuspended in HBSS (25 mM of hepes KOH pH 7.4, 1 mM MgCI ₂ , 1 mM CaCI ₂ , 132 mM NaCI, 0.1% BSA), then transfer them to microscopy chambers coated with poly-D, L-lysine and, after allowing them to adhere, they were kept at 37 ° C. The images were captured with a Leica confocal microscope and analyzed with the ImageJ program.

Stimulation of cells with anti-CD3 / CD28 antibodies attached to the plate

The surface of the microscopy chambers were incubated with a mixture of anti-CD3 / anti-CD28 antibodies (5 μg / ml each) in 150 mM Tris-HCI pH8, at room temperature for 1 hour or at 4 ⁰ C for 16 hours. Jurkat cells, transfected 24 hours before with the indicated construction, were centrifuged and resuspended in HBSS. These cells were incorporated into cameras microscopy previously tempered at 37 ⁰ C, and images were collected by confocal microscopy at the indicated times taking as zero time the time when the cells are incorporated. The images were analyzed with the ImageJ program.

Stimulation of cells with soluble CD3 / CD28 antibodies

The cells of the Jurkat line in exponential growth were collected in HBSS buffer (25 mM of hepes KOH pH 7.4, 1 mM MgCI ₂ , 1 mM CaCI ₂ , 132 mM NaCI, 0.1% BSA) in 1.5 ml tubes, one for each point of stimulation, at a concentration never exceeding 5x10 ⁶ cells / ml. The cells were stimulated with anti-CD3 or anti-CD3 and anti-CD28 antibodies at a final concentration of 1 μg / ml each. In the case of using the DGK inhibitor, R59949, the cells were incubated 30 minutes before stimulation with the inhibitor at a concentration of 30 μM. After stimulation during the indicated times, the cells were frozen at -8O ⁰ C and subsequently used to analyze the proteins by SDS-PAGE and western blot techniques.

BIBLIOGRAPHY Abe, T., X. Lu, et al. (2003). "Site-directed mutagenesis of the active site of diacylglycerol kinase alpha: calcium and phosphatidylserine stimulate enzyme activity via distinct mechanisms." Biochem J 375 (Pt 3): 673-80. Bacchiocchi, R., G. Baldanzi, et al. (2005). "Activation of alpha-diacylglycerol kinase is critical for the mitogenic properties of anaplastic lymphoma kinase." Blood 106 (6): 2175-82.

Berridge, M. J. (1997). "Lymphocyte activation in health and disease." Crit Rev Immunol 17 (2): 155-78.Cipres, A., S. Carrasco, et al. (2003). "Regulation of diacylglycerol kinase alpha by phosphoinositide 3-kinase lipid producís." J Biol Chem 278 (37): 35629-35. Cutrupi, S., G. Baldanzi, et al. (2000). "Src-mediated activation of alpha-diacylglycerol kinase is required for hepatocyte growth factor-induced cell motility." Embo J 19 (17): 4614-22.

Flores, I., T. Casaseca, et al. (nineteen ninety six). "Phosphatidic acid generation through interleukin 2 (IL-2) -induced alpha-diacylglycerol kinase activation is an essential step in IL-2-mediated lymphocyte proliferation." J Biol Chem 271 (17): 10334-40.

Flores, I., DR Jones, et al. (1999). "Diacylglycerol kinase inhibition prevents IL-2-induced G1 to S íransiíion íhrough a phosphaíidylinosiíol-3 kinase- independent mechanism." J Immunol 163 (2): 708-14. Fukunaga-Takenaka, R., Y. Shirai, et al. (2005). "Importance of chroman ring and tyrosine phosphorylation in the subtype-specific translocation and activation of diacylglycerol kinase alpha by D-alpha-tocopherol. "Genes CeIIs

10 (4): 311-9.

Heissmeyer, V., F. Macian, et al. (2004). "Calcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins." Nat Immunol 5 (3): 255-65.

Imai, S. I., M. Kai, et al. (2005). "Identification and characterization of a novel human type Il diacylglycerol kinase, DGKkappa." J Biol Chem.

Macian, F., F. Garcia-Cozar, et al. (2002). "Transcriptional mechanisms underlying lymphocyte tolerance." CeII 109 (6): 719-31. Olenchock, B. A., R. Guo, et al. (2006). "Disruption of diacylglycerol metabolism impairs the induction of T cell anergy." Nat Immunol

Sakane, F. and H. Kanoh (1997). "Molecules in focus: diacylglycerol kinase." lnt J Biochem Cell Biol 29 (10): 1139-43.

Sanjuan, M. A., D. R. Jones, et al. (2001). "Role of diacylglycerol kinase alpha in the attenuation of receptor signaling." J Cell Biol 153 (1): 207-20.

Sanjuan, M. A., B. Pradet-Balade, et al. (2003). "T cell activation in vivo targets diacylglycerol kinase alpha to the membrane: a novel mechanism for

Ras attenuation. "J Immunol 170 (6): 2877-83.

Shindo, M., K. Irie, et al. (2003). "Synthesis and phorbol ester binding of the cysteine-rich domains of diacylglycerol kinase (DGK) isozymes. DGKgamma and DGKbeta are new targets of tumor-promoting phorbol esters." J Biol

Chem 278 (20): 18448-54.

Topham, MK and SM Prescott (1999). "Mammalian diacylglycerol kinases, a family of lipid kinases with signaling functions." J Biol Chem 274 (17): 11447-50. van Blitterswijk, WJ and B. Houssa (1999). "Diacylglycerol kinases in signal transduction." Chem Phvs Lipids 98 (1-2): 95-108. van Blitterswijk, WJ and B. Houssa (2000). "Properties and functions of diacylglycerol kinases." Cell Siαnal 12 (9-10): 595-605. Yamada, K., F. Sakane, et al. (1997). "EF-hand motifs of alpha, beta and gamma isoforms of diacylglycerol kinase bind calcium with different affinities and conformational changes. "Biochem J 321 (Pt 1): 59-64.

Zha, Y., R. Marks, et al. (2006). "T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase-alpha." Nat Immunol

Claims

1.- Diagnostic and prognostic procedure of a disease that is stimulated by the immune system characterized in that it is based on the in vitro determination of the level of phosphorylation of DGKα in the tyrosine residue Y335 in cells of the immune system, in a biological sample and because it comprises the following steps: a) identification or determination of the level of phosphorylation of the DGKα protein in the tyrosine residue Y335, in a biological sample of immune origin, and b) comparison of said determination observed in a) with a control sample, and where Its increased presence is indicative of the existence of a disease that involves immune system stimulation.

2. Method according to claim 1 characterized in that the determination is made with a specific antibody of the phosphorylated tyrosine (pY335) of the DGKα protein (SEQ ID NO2).

3. Method according to claim 2 characterized in that the antibody is a polyclonal antibody.

A - Method according to claim 3 characterized in that the polyclonal antibody is a specific antibody of the synthetic peptide of

SEQ ID NO3, preferably the anti-pTyr335DGKα antibody.

5.- Procedure according to claims 1 to 4, characterized in that the disease that occurs with stimulation of the immune system belongs to the following group: autoimmune, allergic, inflammatory diseases, lymphoproliferative alterations such as leukemia and Hodking and non- lymphomas.

Hodking

6.- Antibody, either monoclonal or polyclonal, specific to the protein

DGKα phosphorylated in tyrosine residue Y335.

7. Antibody according to claim 6 characterized in that it is the specific polyclonal antibody of the peptide-pY335 (SEQ ID NO3), preferably the anti-pTyr335DGKα antibody.

8. Use of the antibody according to claims 6 and 7 in a biotechnological method of identifying the phosphorylated DGKα protein belonging to the following group: i) method of identifying compounds that alter, activators or inhibitors, the kinase activity of the DGKα protein, ii) procedure for the identification of compounds that alter, activators or inhibitors, the phosphorylation of the DGKα protein, and iii) procedure for preparing a therapeutic composition useful for the treatment of diseases that occur with an increase in the immune response.

9.- Phosphorylated DGKα protein characterized in that it contains the phosphorylated 355 tyrosine residue or the like, or a fragment or peptide thereof comprising said phosphorylated 355 tyrosine.

10. Phosphorylated DGKα protein according to claim 9 characterized in that it belongs to a mammal belonging to the following group: mouse, pig, rat and human being.

11. Phosphorylated DGKα protein according to claim 10 characterized in that it is the human DGKα protein phosphorylated in tyrosine 355 of SEQ

ID NO2. 12. Phosphorylated DGKα protein according to claim 9 characterized in that it is a synthetic peptide or fragment corresponding to the sequence of the human protein DGKα P329-A339, NH ₂ -CPPSS (phosphoy) PSVLA-

COOH (SEQ ID NO3).

13.- Use of the phosphorylated DGKα protein in the tyrosine residue 355 in a biotechnological process belonging to the following group: i) method of making monoclonal and / or polyclonal antibodies and / or recombinant anti-phosphorylated DGKα, ii) compound identification procedure that alter their phosphorylation, and iii) identification procedure of activating or inhibiting compounds of the kinase activity of the DGKα protein itself.

14. Use according to claim 13 characterized in that a fragment or peptide, synthetic or isolated, of the DGKα protein of SEQ ID NO2 containing said phosphorylated tyrosine 355 is used for the preparation of monoclonal and / or polyclonal and / or recombinant anti-recombinant antibodies DGKα protein.

15. Use according to claim 14 characterized in that the peptide is the synthetic peptide corresponding to the sequence of DGKα P329-A339, NH ₂ -CPPSS (phosphoY) PSVLA-COOH of SEQ ID NO3. 16.- Useful compound for the elaboration of a drug or pharmaceutical composition for the treatment of a process that involves stimulation of the cells of the immune system characterized in that it is an inhibitor of the activity of the phosphorylated DGKα protein.

17. Compound according to claim 16 characterized in that it is a nucleic acid or polynucleotide that prevents or decreases the expression of the coding gene (SEQ ID NO1) of the human DGKα protein and because it includes, at least, a nucleotide sequence selected from: a ) a specific antisense nucleotide sequence of the gene or mRNA sequence of the DGKα protein, b) a specific ribozyme of the DGKα protein mRNA, c) a specific mRNA aptamer of the DGKα protein, d) an interference RNA (siRNA or shRNA) specific to the mRNA of the DGKα protein, and e) a microRNA (miRNA) specific to the mRNA of the DGKα protein. 18. Compound according to claim 17 characterized in that the siRNA of d) is an RNAi that preferentially binds to the fragment sequence of the DGKα mRNA AAGCCAGAAGACCATG GATGA (SEQ ID NO4) or to another sequence comprising this or a shorter fragment of The same. 19. Compound according to claim 18 characterized in that the siRNA of d) is an RNAi constituted by a double stranded DNA oligonucleotide comprising at least one DGKα interference sequence and a complementary sequence to this, originating a pair of sense and antisense nucleotide sequences, respectively.

20. Compound according to claim 19, characterized in that the interference sequence is the sequence SEQ ID NO4 and the sequence complementary to it is the sequence SEQ ID NO5, the pair of nucleotide sequences being sense and antisense the SEQ ID NO6 and 7, respectively. .

21.- Pharmaceutical composition or a medicament useful for the treatment of diseases that occur with immune system stimulation characterized in that it comprises a therapeutically effective amount of a compound or agent inhibiting the DGKα protein, together with, optionally, one or more adjuvants and / or pharmaceutically acceptable vehicles.

22. Pharmaceutical composition according to claim 21 characterized in that the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene coding for the human DGKα protein and because it includes, at least, a nucleotide sequence selected from: a) an antisense nucleotide sequence specific to the sequence of the gene or mRNA of the DGKα protein, b) a ribozyme specific to the mRNA of the DGKα protein, c) a specific aptamer of the mRNA of the DGKα protein, d) an interference RNA ( iRNA) specific for the mRNA of the DGKα protein, and e) a microRNA (miRNA) specific for the mRNA of the DGKα protein.

23. Pharmaceutical composition according to claim 22, characterized in that the DGKα inhibitor of d) is a siRNA that preferentially binds to the DGKα mRNA fragment sequence AAGCCAGAAGACCATGGATGA (SEQ ID NO4) or another sequence comprising this or a fragment short of it.

24. Pharmaceutical composition according to claim 22, characterized in that the DGKα inhibitor of d) is an RNAi constituted by a double stranded DNA oligonucleotide comprising at least one DGKα interference sequence and a complementary sequence to it, originating a pair of sense and antisense nucleotide sequences, respectively.

25. Pharmaceutical composition according to claim 24, characterized in that the interference sequence is the sequence SEQ ID NO4 and the sequence complementary to it is the sequence SEQ ID NO5, the couple being nucleotide sequences sense and antisense SEQ ID NO6 and 7, respectively.

26.- Pharmaceutical composition according to claim 21, characterized in that the inhibitor compound is an antibody, either monoclonal or polyclonal, specific for the phosphorylated DGKα protein in the Y335 tyrosine residue.

27.- Pharmaceutical composition according to claim 26 characterized in that it is a polyclonal antibody specific to the peptide or fragment pY335 (SEQ ID NO3), preferably the anti-pTyr335DGKα antibody. 28.- Use of the pharmaceutical composition according to claims 21 to 27 in a method of treating a mammal, preferably a human being, affected by a disease that stimulates the immune system, henceforth using the pharmaceutical composition of Ia present invention, consisting of the administration of said therapeutic composition that inhibits the stimulation of the immune system. 29.- Use of the pharmaceutical composition according to claim 28, characterized in that the disease that occurs with stimulation of the immune system belongs to the following group: autoimmune, allergic, inflammatory diseases, lymphoproliferative alterations such as leukemia and Hodking and non-Hodking lymphomas.