WO2008148306A1 - A prophylactic and/or therapeutic vaccine against allergic asthma - Google Patents

Abstract

The present invention discloses a prophylactic and/or therapeutic vaccine against allergic asthma. The mixture of protein antigen or epitope peptide triggering allergic asthma, and recombinant eukaryotic vector expressing said protein antigen or epitope peptide is as active ingredient.

Description

 Vaccine for preventing and/or treating allergic asthma

 The present invention relates to a vaccine for preventing and/or treating allergic asthma.

Background technique

 Asthma (asthma) is a chronic airway inflammation involving many cells such as mast cells, eosinophils, and T lymphocytes. The pathogenesis of asthma is mainly type I hypersensitivity (allergic).

 Allergic asthma is more common than in childhood. Patients often have atopic physiques that are allergic to certain substances, such as inhalation of cold air, pollen, dust mites, etc.; eating fish, shrimp, milk, etc.; or exposure to certain drugs, such as penicillin. When these allergens enter the patient's body, they pass through a series of reactions, causing mast cells or basophils to release sensitizing active substances, acting on the bronchus, causing extensive small airway stenosis, wheezing symptoms, such as not being treated in time, asthma Can be fatal.

 When the allergen enters the body, it is processed by antigen-presenting cells such as dendritic cells and presented to tau cells. CD28 on T cells and B7 molecules on dendritic cells and their secreted IL-1, IL Under the interaction of -12, T cells differentiate into Th2 cells, IL_3, IL-4, IL-5, IL-13 and TNF_a, GM-CSF secreted by Th2 cells, among which IL-3, IL-5 and GM -CSF affects eosinophil differentiation, maturation and survival, while IL-4, IL-5, IL-13 and TNF-α upregulate adhesion molecule VCAM-1, which can cause neutrophils and eosinophilia Granulocytes, monocytes adhere to the vascular endothelium or migrate to the vascular endothelium. IL-4 and IL-13 promote the differentiation of B cells into IgE-synthesized cells, and this process requires an effective signal for CD40 and CD40 ligand interaction on T cells. Thl cells secrete IL_2, IL-12, and IFN-γ, which can inhibit IgE synthesis and its type I hypersensitivity. Therefore, the proportion and function of Thl I Th2 cells are important and play an important role in the pathogenesis of asthma. After IgE synthesis, mast cells and eosinophils are activated to degranulate and release inflammatory mediators to cause airway inflammation, which in turn triggers asthma. When eosinophils in the airways are activated, IL-8 and RANTS are produced, allowing more eosinophils to penetrate into the site of inflammation.

 Clinical treatment of allergic asthma In addition to allergens, hormones are used primarily to control the frequency and duration of asthma attacks. However, long-term oral administration of hormones may cause obesity, osteoporosis, high blood pressure and other side effects; inhalation of hormone spray may occur in the mouth and throat of Candida albicans infection.

As early as around 1920, studies have found a correlation between the amount of dust in the room and the occurrence of asthmatic disease. It was not until 1965 that house dust mites were one of the most important sources of allergens in indoor dust. Dust mites are a kind of eight-footed tiny insects; the warm and humid environment is conducive to its growth and reproduction, and human flaking dander is its main source of food. Dust mites are an important component of human allergens, followed by the worm itself, and dead mites still have the ability to cause allergies. Some people have done such an experiment, diluting the dust mites to a concentration of 1/100,000, and performing an intradermal test on patients who are allergic to dust mites, and still have a positive reaction. The high incidence rate is quite amazing. It is reported that more than 60% of bronchial asthma patients in Germany have skin test results, and the positive rate of sputum response is as high as 89.4%; The hospital counted 120 cases of perennial allergic rhinitis, 94 cases of sputum skin test positive, accounting for 78.3% of the total. In the north, the spring and autumn seasons are the breeding peak of dust mites. At this time, indoor and food contain the highest amount of sputum; the south air is humid, which is more conducive to the growth and reproduction of dust mites. Patients who are allergic to dust mites often develop symptoms throughout the year, and during the dust mites breeding season, symptoms can be aggravated. Therefore, indoor dust mite allergens are the most important sensitizing factors in the room, which can cause allergic diseases such as asthma, allergic rhinitis, and allergic bulbar conjunctivitis. Der pi is an important protein component of dust mite allergens. Der pi is a protease that shares homology with the sequence of other cysteine enzymes such as cathepsin H, which cleaves CD25 and the human IgE low affinity receptor CD23. It can induce a strong allergic reaction in the body (ABC of allergies : Avoiding exposure to indoor allergens. BMJ 1998; 316: 1075. Is allergen exposure the major primary cause of asthma. Thorax 2000; 55: 424).

 Asthma caused by inhalation of flowers and grass powder is called "pollen asthma", which is a seasonal episode of asthma caused by inhaled certain sensitized pollen and grass in certain areas and seasons. Or seasonally increased. It is also common that some spores produced by mold are also allergens, such as punctate, bud, Alternaria, and Aspergillus fumigatus.

Invention disclosure

 It is an object of the present invention to provide a vaccine for the prevention and/or treatment of allergic asthma.

 The vaccine for preventing and/or treating allergic asthma provided by the present invention, wherein the active ingredient is a mixture of the following a) or b) or c) or d) - 1) by a protein antigen causing allergic asthma and at the same time a cloning site inserted into a mixture of recombinant eukaryotic expression vectors encoding the gene encoding a protein antigen of allergic asthma;

 2) a mixture consisting of a protein epitope polypeptide causing allergic asthma and a recombinant eukaryotic expression vector in which the gene encoding the protein epitope polypeptide of the allergic asthma is inserted at the multiple cloning site;

3) a mixture consisting of a protein antigen causing allergic asthma and a recombinant eukaryotic expression vector in which the gene encoding the protein epitope polypeptide of the allergic asthma is inserted at the multiple cloning site;

 4) A mixture of a protein epitope polypeptide which causes allergic asthma and a recombinant eukaryotic expression vector which inserts the gene encoding the protein antigen of allergic asthma at the multiple cloning site.

The protein antigen causing allergic asthma may be selected from any one of the following antigens: an amino acid sequence such as Gtei^osia trifida shown by GenBank Accession Number X56279; ι±min Amb t V; 2 , amino acid sequence such as GenBank Accession Number AMBPV2A, perennial ragweed C^^ros a /wi7ostecy3⁄4ya) allergen Amb p V; 3, amino acid sequence such as GenBank Accession Number AMBPV3A perennial ragweed allergen Amb p V; 4 , amino acid sequence such as GenBank Accession Number AMBPVIB, the perennial ragweed allergen Amb p V; 5, amino acid sequence such as GenBank Accession Number AMBPV2B shown perennial ragweed allergen Amb p V; 6, amino acid sequence such as GenBank Accession Number AMBPV3B The perennial ragweed allergen Arab p V is shown; 7. The amino acid sequence is as shown in GenBank Accession Number S39330 (Aspergillus / 匪 allergen I / a ^ IgE - binding ribotoxin; 8, amino acid sequence 歹 ij GenBank Accession Number AJ002026, the Aspergillus fumigatus allergen rAsp f 13; 9, amino acid sequence such as GenBank Accession Number AJ001732, the Aspergillus fumigatus allergen rAsp f 4;

75 10. Amino acid sequence such as the Aspergillus fumigatus allergen rAsp f 7 shown in GenBank Accession Number AJ001732; 11. Amino acid sequence such as the Aspergillus fumigatus allergen rAsp f 8 shown in GenBank Accession Number AJ224333; 12. Amino acid sequence such as GenBank Accession Number AJ223327 The Aspergillus fumigatus allergen rAsp f 9 is shown; 13. The amino acid sequence such as the Aspergillus fumigatus allergen rAsp f 11 shown in GenBank Accession Number AJ006689; 14. Amino acid sequence such as GenBank Accession

80 Number AJ937743 The Aspergillus fumigatus allergen cyclophilin (asp f 27); 15, amino acid sequence such as GenBank Accession Number AJ937744 shown by the Aspergillus fumigatus allergen thioredoxin (asp f 28); 16, amino acid sequence such as GenBank Accession Number AJ937745 Aspergillus fumigatus allergen thioredoxin (asp f 29); 17, amino acid sequence 歹lj such as GenBank Accession Number AF282850 European Betula flavonoid reductase (Betula pendula isoflavone

85 reductase) -like protein Bet v 6. 0102 (BETY6. 0102); 18, amino acid sequence such as GenBank Accession Number AF135127 European buckthorn isoflavone reductase- homolog Bet v 6. 0101 (BETV6); 19, amino acid sequence GenBank Accession Number BGU40767: Blattella germanica allergen Bla g 4; 20, amino acid sequence such as GenBank Accession Number BGU92412 German cockroach allergen Bla 5; 21, amino

90 acid sequence such as GenBank Accession Number BGU28863, the German aspartic protease precursor (aspartic protease precursor) per prion; 22, amino acid sequence 歹 'J such as GenBank Accession Number AF072219 shown in Germany Allergen (Bla g 1. 0101); 23, amino acid sequence such as GenBank Accession Number AF072221, the main allergen of German cockroach (Bla g 1. 0101); 24, amino acid sequence such as GenBank Accession Number AF072220

The major allergen of German cockroach shown in 95, Bla g 1. 02; 25, the amino acid sequence such as the Dermatophagoides farinae Der f 2 allergen shown in GenBank Accession Number AY283288; 26, the amino acid sequence such as GenBank Accession Number AY947536 Dermatophagoides pteronyssinus Der Der - pi allergen; 27, amino acid sequence 歹l [H. vulgare Iaml-monomer a-starch 00 enzyme inhibitor (monomeric alpha- as shown by GenBank Accession Number X63517) Amylase inhibitor; 28, amino acid sequence such as GenBank Accession Number AJ243504 lorry (Lolium perenne) pollen allergen (5C);

29. Amino acid sequence such as Malassezia sympodialis thioredoxin (mala s 13 gene) as shown in GenBank Accession Number AJ937746

30. The amino acid sequence is the major allergen of Periplaneta americana (Per aplaneta americana) as shown by GenBank Accession Number AF072222 (Per a 1. 0101); 31. Amino acid sequence

GenBank Accession Number AF106961: Periplaneta americana tropomyosin; 32, amino acid sequence such as Trichophyton rubrura allergen (Trir 2) shown by GenBank Accession Number AF082515; 33. Amino acid sequence such as the Trichophyton rubrum allergen (Trir 4) shown by GenBank Accession Number AF082514; 34. Amino acid sequence such as the genus Trichophyton rubrum represented by GenBank Accession Number AF082514 (rj'cwpAWoy? rubru allergy, Tri r 4; 35, amino acid sequence such as the dust mite Der pi shown in the sequence 1 in the sequence listing; 36, the amino acid sequence is pip323 of KISQAVHAAHAEINEAG.

Among them, 1, GenBank Accession Number X56279, 289 bp mRNA, Ambrosia trifida allergen gene Amb t V., coding region 27..248; 2, GenBank Accession Number AMBPV2A, 234 bp mRNA perennial lap grass (Ambrosia psilostachya) allergen gene Amb p V (A2 clone), coding region 1..234; 3, GenBank Accession Number AMBPV3A, 234 bp mRNA perennial ragweed allergen gene Amb p V (A3 clone), coding region 1. .234; 4, GenBank Accession Number AMBPV1B, 234 bp mRNA Perennial ragweed allergen gene Amb p V (Bl clone), coding region 1..234; 5, GenBank Accession Number AMBPV2B, 234 bp mRNA Perennial ragweed allergen gene Amb p V (B2 clone), coding region 1..234; 6, GenBank Accession Number AMBPV3B, 234 bp mRNA perennial ragweed allergen gene Amb p V (B3 clone), coding region 1..234; 7, GenBank Accession Number S39330, 450 bp mRNA Aspergillus fumigatus allergen I/a=IgE-binding ribotoxin gene, coding region 1..450; 8, GenBank Accession Number AJ002026, 721bp mRNA Aspergillus fumigatus allergen rAs Pf 13 gene, coding region 1..721; 9, GenBank Accession Number AJ001732, 861bp mRNA Aspergillus fumigatus allergen rAsp f 4 gene, coding region 1..861; 10, GenBank Accession Number AJ001732, 855bp mRNA Aspergillus fumigatus allergen rAsp f 7 gene, coding region 1..339; 11, GenBank Accession Number AJ224333, 336bp mRNA Aspergillus fumigatus allergen rAsp f 8 gene, coding region 1..336; 12, GenBank Accession Number AJ223327, 906bp mRNA Aspergillus fumigatus allergen rAsp f 9 gene, coding region 1..906; 13, GenBank Accession Number AJ006689, 675bp mRNA Aspergillus fumigatus allergen rAsp f 11 gene, coding region 1..537; 14, GenBank Accession Number AJ937743, 492bp mRNA Aspergillus fumigatus allergen cyclophilin Gene (asp f 27), coding region 1.. 492; 15, GenBank Accession Number AJ937744, 600 bp mRNA Aspergillus fumigatus allergen thioredoxin gene (asp f 28), coding region 78..404; 16, GenBank Accession Number AJ937745, 582bp mRNA Aspergillus fumigatus allergen thioredoxin gene (asp f 29), coding region 116..448; 17, GenBank Accession Number AF282850, 927bp mRNA European white birch Betula pendula isoflavone reductase-like protein Bet v 6.0102 gene (BETV6.0102), coding region 1..927; 18, GenBank Accession Number AF135127, 900bp mRNA European birch isoflavone reductase- homolog Bet v 6.0101 gene (BETV6), coding region 1..900; 19, GenBank Accession Number BGU40767, 601bp mRNA Blattella germanica allergen gene Bla g 4, coding region 1..550; 20, GenBank Accession Number BGU92412, 1140bp mRNA German cockroach allergen gene 145 Bla g 5, coding region 1. 605; 21, GenBank Accession Number BGU28863, 1317 bp mRNA Aspartic protease precursor Allergen gene, coding region 3, .1061; 22, GenBank Accession Number AF072219, 1429bp mRNA The major allergen gene of German cockroach, clone 1 ( Bla g 1. 0101 ), coding region 1. . 1239 ; 23, GenBank Accession Number AF072221, 715bp mRNA German cockroach major allergen gene, gram

150 隆 2 ( Bla g 1. 0101 ) , coding region 1. . 569; 24, GenBank Accession Number AF072220, 1791 bp mRNA German cockroach major allergen gene Bla g 1. 02, coding region 1. . 1479; 25 , GenBank Accession Number AY283288, 423bp mRNA dust mites

( Dermatophagoides farinae ) Der f 2 allergen gene, coding region 1. . 423 ; 26 , GenBank Accession Number AY947536 , 650bp mRNA house dust mites ( Dermatophagoides

155 pteronyssinus ) Der Der- pi allergen gene, coding region 1. 650; 27, GenBank Accession Number X63517, 579bp mRNA barley (H. vulgare) Iaml-monomer a-amylase inhibitor ( monomeric ic alpha- amylase inhibitor Gene, coding region 1. · 441; 28, GenBank Accession Number AJ243504, 1215bp mRNA ryegrass (Lolium perenne) pollen allergen (5C) gene, coding region 1. 906; 29, GenBank Accession Number AJ937746,

160 318 bp mRNA Malassezia sympodialis thioredoxin

 (thioredoxin, mala s 13 gene) gene, coding region 1. 318; 30, GenBank Accession Number AF072222, 870bp mRNA Periplaneta americana major allergen (Per a 1. 0101 ) gene, coding region 1. 698; 31, GenBank Accession Number AF106961, 1325bp mRNA Periplaneta americana tropomyosin gene

165 (tropomyosin), coding region 70. . 924 ; 32, GenBank Accession Number AF082515, 1505bp mRNA Trichophyton rubrum allergen gene (Tri r 2), coding region 41. 1279; 33, GenBank Accession Number AF082514, 2325bp mRNA Trichophyton rubrum allergen gene (Trir 4 ), coding region 77. 2257; 34, GenBank Accession Number AF082514, 2325bp mRNA Trichophyton rubrum allergen gene (Tri r

170 4) , coding region 77. . 2257; 35, nucleotide sequence such as the dust mites Der pi gene shown in sequence 2 in the sequence listing.

 The dust mite Der pi gene shown in SEQ ID NO: 2 in the sequence listing has a coding sequence from the 1st to 963th deoxyribonucleotides at the 5' end of the sequence 2.

 The vaccine for preventing and/or treating allergic asthma is preferably a recombinant eukaryotic expression vector in which a protein causing allergic asthma is resistant to 175 and a protein antigen encoding gene causing allergic asthma is inserted at a multiple cloning site. a mixture of components.

 In the co-immunization composition, a mixture of an allergic asthma self-protein antigen and a recombinant eukaryotic expression vector in which the allergic asthma self-protein epitope polypeptide-encoding gene is inserted at the multiple cloning site may also be employed. This mixture can also produce regulatory T cells to inhibit the development of allergic asthma.

180 Similarly, it is also possible to use the allergic asthma self-protein epitope peptide and the insertion site at the multiple cloning site. A mixture of recombinant eukaryotic expression vectors for the allergic asthma self-protein antigen-encoding gene. This mixture can also produce regulatory tau cells to inhibit the development of allergic asthma.

 The effect of immunization with the above two mixtures is combined with an allergic asthma self-protein antigen and a recombinant eukaryotic expression vector in which the allergic asthma self-protein antigen-encoding gene is inserted at the multiple cloning site.

185 The mixture produced the same effect.

 The protein antigen causing allergic asthma is preferably an amino acid sequence such as the dust mite Der pl shown in SEQ ID NO: 1 in the Sequence Listing. The protein antigen-encoding gene causing allergic asthma is preferably a dust mites Der pi gene represented by SEQ ID NO: 2 in the nucleotide sequence.

 The eukaryotic expression vector for inserting the allergic asthma self-protein antigen-encoding gene or the allergic asthma self-protein 190 epitope polypeptide-encoding gene may be a mammalian cell expression vector such as pcDNA3.0 or pVAXl or provax (Tu Yizhen, Jin Huali, Zhang Xinyu, Yang Ruoye, Yang Fu, Zhang Fuchun, Wang Bin. Comparison of expression efficiency and immune effect of eukaryotic expression vector of classical swine fever virus E2 gene. Journal of China Agricultural University, 2005, 10 (6) : 37 -41).

 The active ingredient of the vaccine for preventing and/or treating allergic asthma may specifically be an amino acid sequence such as the dust mites Der pi and pVAX- Der pl shown in SEQ ID NO: 1 in the list of 195.

 The active ingredient of the vaccine for preventing and/or treating allergic asthma may specifically be the active ingredient of pep323 and the vaccine for preventing and/or treating allergic asthma, 1) allergic asthma self-protein antigen and in polyclonal The mass ratio of the recombinant eukaryotic fine 200 cell expression vector into which the allergic asthma self-protein antigen-encoding gene is inserted is 1:5-5:1; preferably 1:1- 1: 2;

 2) a mass ratio of the allergic asthma self-protein epitope polypeptide and the recombinant eukaryotic expression vector inserted into the multiple cloning site of the allergic asthma self-protein epitope polypeptide encoding gene is 1:5-5:1; Preferably 1:1 to 1: 2;

 3) The mass ratio of the allergic asthma self-protein antigen and the recombinant eukaryotic expression vector in which the allergic asthma self-protein 205 epitope polypeptide-encoding gene is inserted at the multiple cloning site is 1:5-5:1; preferably

1:1-1: 2;

 4) The mass ratio of the allergic asthma self-protein epitope polypeptide and the recombinant eukaryotic expression vector in which the allergic asthma self-protein antigen-encoding gene is inserted at the multiple cloning site is 1:5-5:1; preferably 1 :1-1: 2.

 210 The vaccine for preventing and/or treating allergic asthma can be introduced into the body such as muscle, intradermal, subcutaneous, intravenous, mucosal tissue by injection, jetting, nasal drops, eye drops, infiltration, absorption, physical or chemical mediated methods. Or be mixed or wrapped with other substances and introduced into the body.

The vaccine for preventing and/or treating allergic asthma is generally used in an amount of from 200 ug to 10 m _{g of} active ingredient per kg of body weight per time, once every 7 to 30 days, and generally from 2 to 5 times.

 215 BRIEF DESCRIPTION OF THE DRAWINGS

Figure la shows the total number of cells in the lung tissue lavage fluid of each group, eosinophils, monocytes, lymph Bar cell counting result

 Figure lb shows the total number of cells in the lung tissue lavage fluid of each group and the results of eosinophil count. Figure 2a shows the HE- 20 X staining of lung tissue of each group of mice.

220 Figure 2b shows the HE-40 X staining of lung tissue of each group of mice

 Figure 2c shows the PAS-40 X staining of lung tissue of each group of mice

 Figure 3a shows the results of detection of antibodies in serum of each group of mice.

 Figure 3b shows the results of detection of cytokines in serum of each group of mice.

 Figure 4a shows the number of T regulatory cells of CD4+CD25+ in each group of mice.

225 Figure 4b shows the total number of cells and eosinophil counts in the lung tissue lavage fluid of each group of mice after antibody injection.

 Figure 5a shows the inhibition of target cell expansion by spleen cells, non-T cells, T cells, CD4+, CD8+, CD4+CD25- T cells in each immunized group by flow cytometry.

 Figure 5b shows the eosinophil counts in the pep323 and pD323 co-immunization groups and the pep323 and pcDNA3.0 co-immunized mice 230.

 Figure 6 shows the proliferation of T cells proliferating with OVA or BSA antigen by CD4+CD25-T regulatory cells in the pep323 and pD323 co-immunization groups and in the pep323 and pcDNA3.0 co-immunization groups.

 Figure 7a shows the expression of IL-10 in the pep323 and pD323 co-immunization groups and the pep323 and pcDNA3.0 co-immunization groups by flow cytometry.

235 Figure 7b shows the expression of IFN-γ in the pep323 and pD323 co-immunization groups and the pep323 and pcDNA3.0 co-immunization groups by flow cytometry.

 Figure 7c shows the expression of Foxp3 in the pep323 and pD323 co-immunized groups and the pep323 and pcDNA3.0 co-immunized groups by flow cytometry.

 Figure 7d shows the expression of IL-4 in the pep323 and pD323 co-immunization groups and the pep323 and pcDNA3. 0 240 co-immunization groups by flow cytometry.

 Figure 7e shows the expression of TGF-β in the pep323 and pD323 co-immunized groups and the pep323 and pcDNA3.0 co-immunized mice 7 days after immunization by RT-PCR.

 Figure 8 shows the results of flow cytometry analysis of IL- 10 and TGF-β cytokines involved in the regulation of CD4+CD25-Τ regulatory cells in vitro.

245 Figure 9 shows the results of flow cytometry analysis of IL-10 and TGF-β cytokines involved in the regulation of CD4+CD25-Τ regulatory cells in vivo.

 Figure 10 is a skin test of a dust mite allergen-induced asthma model.

 Figure 11 shows the proliferation of sputum cells specific for dust mite allergens.

 The best way to implement the invention

 250 Experimental methods in the following examples, unless otherwise specified, are conventional methods

 The concentration of PBS in the following examples was 0. Olmol/pH was 7. 0.

Example 1, pep323 and pD323 combined immunosuppressive asthma Experimental animals: Female BALB/c mice (8-10 weeks old) were purchased from the Institute of Laboratory Animals, Chinese Academy of Medical Sciences. D011. 10 mice (8-10 weeks old) were purchased from Shanghai Slack Laboratory Animals Co., Ltd. 255 (SLAC).

 Neutralizing antibodies: various neutralizing antibodies used in the experiments, including anti-CD25, anti-CD4, anti-IL-10, anti-IFN-γ, anti-TGF-β R anti-IL-4, anti-IL -2 were obtained by culturing hybridoma cells purchased from ATCC (Manassas, VA, USA).

 First, the experimental method

 260 1. Asthma model induction: OVA (Sigma, USA; lmg/ml in PBS) was used as an allergic antigen and mixed with an equal volume of 10% aluminum salt (Sigma, USA), and shaken at room temperature for 2 hours. After centrifugation at 750 X g for 5 min, the supernatant was discarded and the OVA/aluminum complex was resuspended in deionized water to a concentration of 1 mg/ml. On day 0, each female BALB/c mouse (8-10 weeks old) was intraperitoneally injected with 100 μl OVA/aluminum complex, on days 8, 14, 16 and 18, using 100 μg/100 μl OVA, respectively.

265 (dissolved in PBS) was injected into the lung tissue of mice via trachea and induced by asthma model.

 2. Preparation of vaccine: The synthetic peptide vaccine is obtained by synthesizing the peptide of 323-339 of the 0VA antigen (amino acid sequence is KISQAVHAAHAEINEAG) and emulsification with incomplete Freund's adjuvant, named pep323; the nucleic acid vaccine will express The cDNA of this peptide was cloned into a eukaryotic expression vector and designated as PD323; finally, the vector control pcDNA3.0 (Invitrogen).

 270 wherein pD323 is constructed as follows: The DNA sequence encoding the 323-339 peptide of OVA antigen (AAGATATCTCAAGCTGTCCATGCAGCACATGCAGAAATCAATGAAGCAGGC) is synthesized in vitro by Beijing Aoke Company, and the upstream and downstream sequences are respectively added with the cleavage sites of H ll and Bs sHI. Then, it was cloned into the H /7GlII and Ba l multiple cloning sites of the eukaryotic expression vector pcDNA3.0, and the resulting recombinant vector was named pD323.

275 3. Vaccine immunization: Before inducing asthma in mice, mice were grouped and intramuscularly injected with pe _P 323

 (100 μl/100 μg/mouse), pD323 (100 μl/100 μg/mouse), pep323+pD323, Pep323+pcDNA3, 6 mice per group, at - 15 days (15 days before induction) And - 5 days (5 days before induction) were injected twice; in the dose experiment, different doses of nucleic acid vaccine PD323 will be mixed with fixed dose of pep323 and immunized, the specific dose is shown in the results. The specific immunization method is as follows -

280 72 female BALB/c mice (8-10 weeks old) were divided into 12 groups, 6 mice per group,

Group 1 was the control group. On day 0, each mouse was intraperitoneally injected with ΙΟΟ μ Ι OVA/aluminum complex. The second group was the model group, and the asthma model was induced according to the method of step 1. The third group was the pD323 immunization group, which was intramuscularly immunized twice, 10 days after the first immunization, and once again, each time each was immunized with 100 μl of a 0.9% NaCl aqueous solution containing 100 μg of pD323; 5 days after the immunization, follow step 1

The 285 method was used to induce asthma model. Group 4 was pep323 immunized group, which was intramuscularly immunized twice, 10 days after the first immunization, and then boosted once, each time immunizing 100 μl of a 0.9% NaCl aqueous solution containing 100 μg of pep323, respectively; Five days after the immunization, asthma model induction was performed according to the method of step 1. Group 5 is pcDNA3.0 and pep323 co-immunization group (V + P or V + Pep), total intramuscular injection Two epidemics, 10 days after the first immunization, and once again, each time each immunization contains 100 micrograms

290 pe _P 323 and 100 μg of pcDNA3.0. 0. 9% NaCl aqueous solution 100 μl; 5 days after the second immunization, asthma model induction was performed according to the method of step 1. Group 6 was pep323 and pD323 co-immunization group (pD323+p-print 323, D + P or D + Pep), which were injected twice by intramuscular injection, 10 days after the first immunization, and then strengthened once, each time Immunize 100 μl of a 0.9% NaCl aqueous solution containing 100 μg of pep323 and 100 μg of pD323; 5 days after the second immunization, follow the method of step 1 for asthma mode

Type 295 induction. The third group was pep323 and pD323 (4: 1) co-immunization group, which was intramuscularly immunized twice, 10 days after the first immunization, and then boosted once, each time containing 100 micrograms of pep323 and 25 micrograms of pD323. 0. 9% NaCl aqueous solution 100 μl; 5 days after the second immunization, asthma model induction was performed according to the method of step 1. Group 8 was pep323 and pD323 ( 2: 1 ) co-immunization group, which was injected twice by intramuscular injection, 10 days after the first immunization, and then boosted once, each time each immunized with 100 micron.

300 g of pep323 and 50 μg of pD323 in a 0.9% NaCl aqueous solution of 100 μl; 5 days after the second immunization, the asthma model was induced according to the method of step 1. Group 9 was pep323 and pD323 (1:1) co-immunization group, which was injected twice by intramuscular injection, 10 days after the first immunization, and then boosted once, each time containing 100 micrograms of pep323 and 100 micrograms of pD323. 0. 9% NaCl aqueous solution 100 μl; 5 days after the second immunization, asthma model induction was performed according to the method of step 1. Group 10 is pep323 and

305 pD323 ( 1: 2 ) co-immunization group, a total of two intramuscular immunizations, 10 days after the first immunization, and then once again, each time each immunized with 100 μg pep323 and 200 μg pD323 0. 9% NaCl 100 μl of the aqueous solution; 5 days after the second immunization, the asthma model was induced according to the method of Step 1. Group 1 1 was pep323 and pD323 ( 1: 4 ) co-immunization group, which was intramuscularly immunized twice, 10 days after the first immunization, and then boosted once, each time containing 100 micrograms of pep323 and 400 micrograms of pD323. of

310 0. 9% NaCl aqueous solution 100 μl; 5 days after the second immunization, asthma model induction was performed according to the method of step 1. The 12th group was pcDNA3.0 and pep323 (1:2) co-immunization group, which was intramuscularly immunized twice, 10 days after the first immunization, and then boosted once, each time containing 100 micrograms of pep323 and 200 micrograms respectively. 100 μl of a 0.9% NaCl aqueous solution of pcDNA3.0; 5 days after the second immunization, induction of asthma model was performed according to the method of Step 1.

 315 4. Antibody Neutralization: In some experiments, in order to neutralize the function of cytokines in vivo, 50 g of neutralizing antibody (including anti-IL-10 and TGF-β).

 5. Determination of the number of cells in the lung tissue lavage fluid: The mice were anesthetized and killed 24 hours after the last OVA antigen was administered to the lung. The trachea was removed by laryngeal surgery, and injected with 0.8 ml of normal saline through the trachea and repeatedly lavaged.

320 lung tissue 3- 5 times. The lavage fluid was collected, centrifuged and resuspended in 100 ml of physiological saline containing 0.1% BSA.

 After the cells were stained with Swiss-Jimosa stain, the total number of cells, eosinophils, monocytes, and lymphocytes were counted.

6. Histological examination: The mice were anesthetized and killed 24 hours after the last OVA antigen was administered to the lungs. The lung tissue of the mouse was taken for fixation, embedding and sectioning. H&E (hematoxyl in for Evaluation) Dyeing and PAS (periodic acid-Schiff) staining.

 7. Antibody detection: Mouse antiserum was isolated 5 days after the last OVA antigen was administered to the lung. The levels of OVA antigen-specific IgG1, IgG2a and IgE antibodies in serum were determined by ELISA. Among them, the antigen used for coating was OVA (Sigma, USA), lmg/ral was dissolved in PBS; the anti-segregation serum was the horseradish peroxidase-labeled goat anti-mouse IgGl, IgG2a and IgE (these secondary antibodies were purchased from Sigma).

 8. RT-PCR: 24 hours after the last OVA antigen was administered to the lungs, the lung tissue lavage fluid was collected and centrifuged to obtain total cells. Total RNA was extracted by TRIzol reagent (Proraega, USA), reverse transcription, and HPRT was amplified by PCR using specific foreign bodies, as well as cytokines such as IL-2, IFN-y IL-4, IL-5, IL-13 and TGF-β. Among them, the housekeeping gene hypoxanthine phosphoribosyltransferase (HPRT) was used as an endogenous expression standard, and the cDNA concentrations of each group were adjusted to be consistent. Gel electrophoresis was used to detect changes in various cytokines.

 The PCR reaction conditions and primer sequences are shown in Table 1.

 Table 1 PCR primers

 Second, the experimental results

 (a) The combination of pep323 and pD323 immunosuppressive asthma

According to the method of the reference, BALB/c mice were induced by OVA antigen and lung stimulation to induce an asthma model in mice. One of the symptoms of asthma is the infiltration of a large number of inflammatory cells in the lungs. As shown in the second group (model group) and the model groups in 2a, 2b and 2c in Fig. la, there are a large number of inflammatory cells, including eosinophils and monocytes, in the lung tissue lavage fluid of the model group. And lymphocytes. At the same time, other indicators related to asthma were also tested. For example, the levels of IgE and IgG1 in serum were significantly increased in the model group compared with the control (Fig. 3a), and the infiltrating cells expressed higher levels of Th2 type cytokine IL. - 4, IL-5 and IL-13 (Fig. 3b). These results indicate that successful induction of mouse asthma patterns Type. In Figures la, lb, 3a, 3b, 4b, 5b, 6 and 9, "+" indicates that the substance was added or the treatment was carried out, or "-" indicates that the substance was not added or not treated; OVA Sensitized indicates that on day 0, each mouse was intraperitoneally injected with ΙΟΟ μ Ι OVA/aluminum complex; OVA challenge for days 8, 14, 16 and 18, respectively, using 100 μ _§ /100 μ 1 OVA (dissolved in PBS) The trachea was injected into the lung tissue of the mouse.

In order to immunotherapy of asthmatic diseases by the combined immunization method, the nucleic acid vaccine pD323 expressing the OVA epitope 323-339 was co-immunized with its corresponding in vitro synthesized peptide pe _P 323, and immunized alone as a control. The results showed that the inflammatory cell infiltration of lung tissue in group 6 and pep323 and pD323 co-immunization group (D+P) was significantly lower than that in the model group (group 2) (Fig. la and Fig. 2a to c), serum. The levels of IgE and IgGl were also significantly reduced compared to the model group (Fig. 3a), and infiltrating cells expressed lower levels of Th2 type cytokines (Fig. 3b). However, the two groups immunized with pD323 alone (Group 3) or pep323 (Group 4) did not inhibit these disease indicators for asthma. It shows that only co-immunization can inhibit the occurrence of asthma. Furthermore, co-immunization of the vector pcDNA3 with pep323 (Group 5) did not inhibit the development of asthma. It is indicated that the effect of mixed immunization is not due to the CpG sequence on the vector.

 (ii) Dosage of combined immunization with pep323 and pD323

 After demonstrating that co-immunization of pD323 and pep323 inhibited the occurrence of asthma, the effect of changes in the dose of co-immunization on the inhibitory effect was compared. The dose of the nucleic acid vaccine pD323 was divided into 25, 50, 100, 200 and 400 μg/s, while the dose of the peptide vaccine pep323 was fixed at 100 μg/head. The results demonstrate that when the dose of pD323 reaches or exceeds 100 u g/head, it can significantly inhibit the inflammatory cell infiltration of lung tissue (Fig. lb). The dose of PD323 of 25 μg/only and 50 μg/only did not inhibit inflammatory cell infiltration. The inhibitory effect of pep323 and PD323 combined immunization was dose-dependent.

 (C) CD4+CD25+ T regulatory cells do not participate in the inhibition of combined immunization

 To demonstrate whether regulatory T cells are involved in the inhibition of co-immunization, first analyze the natural T regulatory cells of CD4+CD25+.

Thirty female BALB/c mice (8-10 weeks old) were divided into 5 groups, namely group 13 to group 17, 6 mice in each group, and group 13 was normal group. 10 days after the first immunization, strengthen once again, each time each was immunized with 0.9% NaCl aqueous solution 100 μl; the 14th group was PD323 immunization control group, a total of two intramuscular immunizations, the first immunization After the next 10 days, the rats were incubated once more, and each time each was immunized with 100 μl of a 0.9% NaCl aqueous solution containing 100 μg of pD323. The 15th group was the pep323 immunization control group, which was intramuscularly immunized twice. After 10 days of the first immunization, it was boosted once again, and each time each was immunized with 100 μl of a 0.9% NaCl aqueous solution containing 100 μg of p323. . The 16th group was pip323 and pcDNA3.0. The co-immunization control group was intramuscularly immunized twice, 10 days after the first immunization, and once again, each time each was immunized with 100 micrograms of pep323 and 100 micrograms of pcDNA3.0. 0. 9% NaCl aqueous solution 100 microliters. Group 17 was a co-immunization control group of pep323 and pep323, which was intramuscularly immunized twice, 10 days after the first immunization, and once again, each time each immunized with 100 Micrograms of pep323 and 100 μg of pep323 in a 0.9% NaCl aqueous solution of 100 μl.

385 mice were co-immunized and immunized separately, and the spleen cells were stained with CD4+CD25+ for fluorescent antibody and flow cytometry. The mice were sacrificed 21 days after immunization, and the spleen single cell suspension was prepared and 2 ml of red blood cells were added for lysis. The solution was dissolved in red blood cells, and the cells were counted; appropriate amount of OVA antigen and CD28 antibody were added according to the number of cells, and the overnight stimulation was performed; the second day, the protein transport inhibitor monensi _n (2 mol/L) was added to prevent the secretion of cytokines to the outside of the cells. After mixing, the cells were incubated at 37 ° C and 5% CO 2 for 2 h. Then anti-Fc antibody was occluded (closed in reagent instructions, eBioscience), blocked for 30 minutes; add 2-3 ml of washing solution, mix well, centrifuge at 2000 rpm for 5 minutes, discard the supernatant, and add appropriate amount of anti-CD4 to each tube. And CD25 fluorescently labeled monoclonal antibody (see reagent manual, eBioscience), react at room temperature for 30 minutes in the dark; add 2- 3 mL of washing solution, mix well, centrifuge at 2000 rpm for 5 minutes, discard the supernatant, add each tube Resuspend cells in 300 L wash solution; analysis by upflow cytometry. The results showed that mice immunized with pep323 and pD323 395 showed no significant difference in the number of CD4+CD25+ T cells compared with the other controls (Fig. 4a).

 To further analyze whether CD4+CD25+ T regulatory cells are involved in the inhibition of co-immunization, mice were co-immunized and model-induced, while anti-CD25 antibodies were injected intravenously into mice in groups 2, 5 and 6. The body's CD4+CD25+ T regulatory cells were cleared in vivo at a dose of 20 g/mouse. Simultaneously

400 One isotype control antibody IgGl was used as a control at an injection dose of 20 g/mouse. The number of cells in the lung tissue lavage fluid was determined according to the method of step 5 in step 1. As a result, the inhibition of co-immunization of pep323 and pD323 was still present in the case where CD4+CD25+ T regulatory cells were cleared (Fig. 4b). This indicates that the inhibition of co-immunization does not depend on CD4+CD25+ T regulatory cells.

 (iv) CD4+CD25-T cells participate in the inhibition of combined immunity

 405 For further analysis, regulate whether T cells participate in the inhibition of co-immunization and its cell type. In vitro T cell proliferation experiments were used.

 1. DC cell culture: DC cells are obtained by in vitro culture of mouse bone marrow cells. Female BALB/c mice (8-10 weeks old) were anesthetized to death, and bone marrow cells were isolated from their leg bones under sterile conditions, and the cell concentration was adjusted to RPMI-1640 medium (Gibco, Eggenstein, Germany) to 5

410 X 10 ⁶ cells/ml, 10% (by volume) fetal bovine serum and 20 ng/ml murine GM-CSF were added for 6-8 days in vitro. Thereafter, sorting was performed using CD11C+ magnetic beads to obtain purified DC cells.

 2. Isolation of T cells, CD4+, CD8+, CD4+CD25- T cells

Purified CD4+, CD4+CD25-Τ cells were obtained using negative selection according to the instructions for the Τ Cell Separation Kit (US R&D). The purification method of the total sputum cells is as follows: Take the mouse spleen cells 415 and remove the red blood cells to prepare a single cell suspension, and filter the nylon column to obtain sputum cells. Purification of CD8+ Τ cells was as follows: After total sputum cells were obtained, the cell concentration was adjusted to 1×10 ⁷ cells/ml; an appropriate amount of anti-mouse CD4 antibody (eBioscience) was added and incubated in a 2- 8 ° C refrigerator for 30 minutes; Add appropriate rabbit complement (Sigma), mix gently, incubate in a 37 ° C refrigerator for 30 minutes; add PBS, mix gently, 2000 rpm for 5 minutes, re-select cells; repeat steps 2-4, finally re-select cells CD8+ cell flow 420 cytometry analysis purity > 85%.

Regulating T cell inhibition function: In order to detect the inhibitory function of regulatory cells, CD4+ T ( 5 X 10 ⁵ cells) of D011. 10 mice were selected as target cells after staining with green fluorescent dye CFSE; CD4+CD25 of immunized mice was selected. — T cells (1×10 ⁵ ) were used as regulatory T cells; DC cells (1×10 ⁵ cells) cultured in vitro were selected as antigen-presenting cells. Three cells were co-cultured in a 48-well culture plate and used

The 425 OVA antigen (20μ _§ /πι1) was stimulated in vitro for 48 hours, and the proliferation of target cells was detected by flow cytometry to determine the inhibitory function of regulatory sputum cells.

 D011. 10 Mouse CD4+ T cells were isolated and stained with fluorescent dye CFSE as target cells, and antigen-specific amplification was induced by antigen-presenting cells (DC) and OVA antigens in vitro. The amplification was analyzed by flow cytometry and showed a decrease in CFSE fluorescence intensity, as shown in Figure 5a.

430 In this culture medium, the control group (group 1), model group (group 2), pD323 immunization group (group 3), pep323 immunization group (group 4), pep323 and pcDNA3.0 were co-immunized. Groups (Group 5, V+P), or pep323 and pD323 co-immunization groups (Group 6) mice spleen cells (1 X 10 ⁵ ), the results are shown in Figure 5a, when added simultaneously in the culture medium When the spleen cells of the pep323 and pD323 co-immunized groups (group 6) were mice, this amplification was significantly inhibited, indicating pep323 and

The 435 _P D323 co-immunized group (Group 6, D + P) has modulating cells in the spleen cells of mice. No inhibition occurred in the other groups (Fig. 5a). In order to further analyze the regulation of cell sorting, T cells, CD4 ⁺ , CD8 ⁺ , CD4+CD25-T cells in spleen cells were separately separated and added to the culture medium for co-culture with target cells, and it was found that pep323 and pD323 were co-cultured. CD4+CD25-T cells in the immunized group (Group 6, D + P) significantly inhibited the expansion of target cells, indicating that the pep323 and pD323 co-immunization groups

440 (Group 6, D+P) induced inhibition was involved by CD4+CD25- T cells. The percentage in Figure 5a is the proportion of D011.10 mouse CD4 T cell proliferation. In Figure 5a, Non-T Cel l is a non-T cell, and the percentage is the percentage of proliferating cells to total cells.

 In order to further demonstrate in vivo that CM+CD25-T cells are involved in the co-immunization inhibition function, the pep323 and pD323 co-immunization groups (Group 6, D+P) and pep323 and pcDNA3. 0 co-immunization groups (Group 5,

445 V+P) CD4+CD25-T cells were isolated from mouse spleens and adoptively transferred to OVA antigen-treated mice. Among them, CD4+CD25-T cell isolation and adoptive transfer methods are as follows: The mice are sacrificed by anesthesia, and their spleen single cell suspensions are prepared aseptically, and purified by using a regulatory T cell isolation kit (R&D Systems, Inc., USA). CD4+CD25-T cells have a purity of 96-98%. The obtained CD4+CD25-T cells were adoptively transferred to the same female mouse BALB/c mice (8-10 weeks old) by intravenous injection, and transferred.

The number of 450 is 2 X 10 ⁵ , 1 X 10 5 X 10 ⁶ cells/only. The results demonstrate that adoptive transfer of CD4+CD25_T cells significantly inhibited asthma in mice (Fig. 5b). This indicates that the phenomenon of co-immuno-inhibition of asthma by pep323 and pD323 is caused by the induction of CD4+CD25-T cells with regulatory functions.

3, CD4 ⁺ CD25" T regulatory cells have antigen specific inhibition

In order to analyze whether co-immunization-induced CD4+CD25-T regulates cytostatic function, it has an antigenic 455-sexual characteristic. CD4+CD25-T regulatory cells were co-immunized with pep323 and pD323 (Group 6, D + P) or pcDNA3 and pcDNA3.0 co-immunized groups (Group 5, V+P) were isolated and transferred to the same line immunized with OVA antigen (100 g/mouse) or BSA antigen (100 g/mouse). Mouse female BALB/c mice (8-10 weeks old) in vivo, and then isolated the latter spleen T cells for in vitro expansion experiments, the specific method is: under sterile conditions, the spleen is taken to make a single cell suspension, Removed with red blood cell lysate

460 erythrocytes were washed three times with PBS, centrifuged and counted, adjusted to a concentration of IX 10 ⁶ /ml, and each group of cell suspension was added to a 96-well culture plate in 4 portions. One of them was added to ΙΟΟμΙ Con A (mitogen) to a final concentration of 5 g/ml, and one part of the corresponding specific antigen (0VA antigen) was added as a stimulator to a final concentration of 5 g/ml, one without irritant. Add one ΙΟΟμΙ BSA to a final concentration of 2 g/ml as an irrelevant antigen. After incubating for 48 h at 37 ° C in a C0 ₂ incubator, add ΙΟΟμΙ MTS to each well.

After 465 to a final concentration of 5 mg/ml, after incubation for 4 hours, the 0D value at 492 nm was read on a microplate reader, and the stimulation index (SI = experimental 0D ÷ non-stimulated 0D) was calculated. The results are shown in Figure 6. It is demonstrated that the CD4+CD25-T regulatory cells of the adoptively transferred p-printing 323 and PD323 co-immunized groups (Group 6, D+P) can only specifically inhibit the proliferation of T cells immunized with 0VA antigen. It does not inhibit the proliferation of T cells by BSA antigen immunization (Fig. 6).

 470 4, CD4+CD25-T regulatory cell cytokine expression analysis

To analyze whether the pep323 and pD323 co-immunization groups (Group 6, D + Pep ) induce CD4 ⁺ CD25" T regulatory cells to express cytokines associated with regulatory functions. pep323 and pD323 co-immunization groups (Group 6, D+ Pep) and pep323 and pcDNA3. 0 co-immunization group (Group 5, V+ Pep) mice were isolated from CD4+CD25 in their spleen at different times (1, 3, 7, 14 days) after co-immunization treatment.

475 T cells were subjected to intracellular cytokine staining and flow cytometry. The specific methods are as follows: In order to detect changes in cell surface molecules and intracellular cytokine levels, flow cytometry combined with fluorescent antibody technology was employed. First, a single cell suspension of spleen cells is prepared, and the anti-Fc antibody blocks the Fc receptor on the cell surface; secondly, PBS washes directly stains cell surface molecules such as CD4 and CD25; again, when intracellular cytokines are required When staining, spleen cells were stimulated overnight with ConA and anti-CD28 mAb, followed by 4% aggregation.

480 formaldehyde fixation and 0.1% saponin treatment of the membrane, staining the cells with fluorescently labeled antibodies. Finally, the stained cells were subjected to flow cytometry and software analysis. (United States eBioscience)

It was found that the pe _P 323 and pD323 co-immunized groups (Group 6, D + Pep ) expressed higher levels of IL-10 compared to the pep323 and pcDNA3.0 co-immunization groups (Group 5, V + P). Figure 7a), IFN- y (Fig. 7b), FoxP3 (Fig. 7c), and TGF-β (Fig. 7e). IL-10, TGF-

485 β, and FoxP3 have been previously associated with regulatory functions. This indicates that co-immunization-induced CD4+CD25-T regulatory cells are capable of expressing high levels of mediator-associated cytokines. The percentages in Figures 7a-7d are the ratio of expression of various cytokines. In Fig. 7e, 1, 2, and 3 represent the RT-PCR results of TGF- in CD4+CD25-T cells isolated from groups 1, 5, and 6, respectively.

 5. IL-10 and TGF-β are involved in the inhibition of CD4+CD25-Τ regulatory cells in vitro.

490 For further analysis, whether IL-10 and TGF-beta are expressed in mediating sputum cells are affected or involved in their mediating function. Or choose the in vitro sputum cell proliferation experiment. In order to detect the inhibitory function of the regulatory cells, CD4+ T (5×10 ⁵ cells) of D011.10 mice were selected as target cells after staining with green fluorescent dye CFSE; co-immunization group was selected for pep323 and pcDNA3.0 (group 5, V+P), pep323 and pD323 co-immunization groups (Group 6, D+P) immunized mice with 495 CD4+CD25-T cells (1×10 ⁵ ) as regulatory T cells; selection of DC cells cultured in vitro (1 X 10 ⁵ ) As antigen presenting cells. Three kinds of cells were co-cultured in a 48-well culture plate and stimulated with OVA antigen (20 g/ml) for 48 hours in vitro. At the same time of stimulation, anti-IL-10 was added to the culture system (final concentration was 5 g/ml). , or anti-IFN- γ (final concentration 5 g/ml), or anti-TGF-β (final concentration 5 g/ml) antibody or anti-IL-10 (final concentration 5 g/ml) And anti-500 TGF-β (final concentration 5 g/ml) antibody. At the same time, a control without antibody was added, and an isotype control IgG1 antibody control was used. The proliferation of target cells was detected by flow cytometry to determine the inhibitory function of regulatory T cells. The results showed that antibodies added to IL-10 or TGF-β significantly disrupted the inhibitory function of CD4+CD25-Τ regulatory cells (Fig. 8). This suggests that both IL-10 and TGF-β cytokines are involved in the mediating function of CD4+CD25-Τ regulatory cells. The percentage in Figure 8 is the ratio of D011.10 mouse CD4 Τ cell 505 proliferation.

6. IL-10 and TGF-β are involved in the inhibition of CD4+CD25-Τ regulation in vivo in order to further demonstrate in vivo whether IL-10 and TGF-β regulate CD4 ⁺ CD25-Τ regulation of cellular inhibitory function, pep323 and CD4+CD25-T cells were isolated from the spleen of pcDNA3.0 co-immunized group (Group 5, V+P), pep323 and pD323 co-immunized group (Group 6, D+P), with 5 X 10 ⁶ 510 / adoptive transfer to OVA antigen-treated female BALB/c mice (8-10 weeks old) with anti-IL-10 (5 g/ml/only) or anti-TGF-β ( 5 g/ml/only antibody or anti-IL-10 (5 g/ml/only) and anti-TGF-β (5 g/ml/only) antibodies were injected into mice. At the same time, an isotype control IgG1 antibody control was set. The results indicate that injection of anti-IL-10 and anti-TGF-β antibodies can disrupt the inhibition of mediating sputum cells (Fig. 9). It was further confirmed that IL-10 and 515 TGF-β cytokines are indeed involved in the mediating function of CD4+CD25-Τ regulatory cells.

 Example 2. Der pi protein and pVAX- Der pi combined immunosuppressive asthma

 I. Molecular cloning of Der pi

 (1) Acquisition of Der pi cDNA sequence

 The design was performed using overlapping fragment PCR to obtain the full sequence. The cDNA of Der pi is shown in Sequence 1 520 of the Sequence Listing. The full-length cDNA of Der pi is 963 bp, of which there is only one EcoR I and two Hindlll cleavage sites. The former is located at position 221, and the latter two are at positions 252 and 681, respectively. Therefore, according to the Hindlll site, the overlapping fragment PCR is used first. Three fragments of Der pi were obtained.

 Fragment 1: is the 1-260th position from the 5' end of the sequence 1. The primers are as follows, each primer is 50 bp, and the overlap between them is 20 bp.

525 FDerpl : atgaaaattgttttggccatcgcctcattgttggcattgagcgctgttta

FDerp2: TCAAAAGTTTTGATCGATGATGGACGAGCATAAACAGCGCTCAATGCCAA FDerp3: tcatcgatcaaaacttttgaagaatacaaaaaagccttcaacaaaagtta FDerp4: CGGGCAGCTTCTTCATCTTCGAAGGTAGCATAACTTTTGTTGAAGGCTTT

 FDerp5: gaagat gaagaagctgcc c g a aaaaac tttttggaatcagt aaaat at g t

 FDerp6: AAATGGTTGATGGCACCTCCATTTGATTGAACATATTTTACTGATTCCAA

 FDerp7: ggaggtgccatcaaccatttgtccgatttgtcgttggatgaattcaaaaa

 FDerp8: TCAAAAGCTTCTGCACTCATCAAAAATCGGTTTTTGAATTCATCCAACGA

 PCR system: FDerpl, FDerp2, FDerp3, FDerp4, FDerp5, FDerp6, FDerp7, FDerp8, each of the 8 primers took 2 μ 1 (each primer has a concentration of 25 uM), and the mixture was uniformly mixed in the EP tube, taking 2 μ 1 as the PCR system. 5 μl (Ferpl and Fprep8 are both 25uM) as the upstream and downstream primers; 2. 5ul of 10 X PCR buffer (purchased from Kezhenze Company) was added to the PCR system; dNTP (2mM) 2. 5ul; Finally add dd 0 to complete the system to 25ul.

 Overlapping sequence PCR conditions: 94 ° C for 3 min; 94 ° C for 40 s, 50 ° C for 40 s, 72 ° C for 40 s for 30 cycles; 72 ° C for 10 min.

 Take the first PCR product 2 μ 1, plus FDerpl and FDerp8 each 0.5 μl (the concentration of both FFDpl and FDerp8 is 25 uM) as the upstream and downstream primers, and then carry out the PCR of the above conditions.

 Take the second PCR product 2 μ 1, and add FDerpl and FDerp8 each 0.5 μl (the concentration of FDRpl and FDerp8 are 25 uM) as the upstream and downstream primers, and then carry out PCR under the above conditions to obtain the final product.

 Fragment 2: For the sequence 1 from the 5' end of the 240-690 position, the primers are as follows, the overlap rule is as above.

 FDerp9: atgagtgcagaagcttttgaacacctcaaaactcaattcgatttgaatgc

 FDer plO: TTTCCATTGATACTGCAGGCGTTAGTTTCAGCATTCAAATCGAATTGAGT

 FDer pll : gcctgcagtatcaatggaaatgctccagctgaaatcgatttgcgacaaat

 FDer pl2: CCTTGCATACGAATGGGAGTGACAGTTCGCATTTGTCGCAAATCGATTTC

 FDer pl3: actcccattcgtatgcaaggaggctgtggttcatgttgggctttctctgg

 FDer pl4: GCCAAATAAGCTGATTCAGTTGCGGCAACACCAGAGAAAGCCCAACATGA

 FDer pi 5: actgaatcagcttatttggcttaccgtaatcaatcattggatcttgctga

 FDer pl6: TGTTGGGAAGCACAATCGACTAATTCTTGTTCAGCAAGATCCAATGATTG

 FDer pl7: gtcgattgtgcttcccaacacggttgtcatggtgataccattccacgtgg

 FDer pl8: ACGACACCATTATGTTGGATGTATTCAATACCACGTGGAATGGTATCACC

 FDer pl9: atccaacataatggtgtcgtccaagaaagctactatcgatacgttgcacg

 FDerp20: TGTGCATTTGGTCGTCGGCATGATTGTTCTCGTGCAACGTATCGATAGTA

 FDerp21 : tgccgacgaccaaatgcacaacgtttcggtatctcaaactattgccaaat

 FDerp22: AGCCAAAGCTTCACGAATTTTGTTTACATTTGGTGGGTAAATTTGGCAAT

 AGTTTGAGAT

PCR system: The above primers FERRp9, FDerpl 0, FDerpl 1 , FDerpl2, FDerpl 3 , FDerpH, FDerpl5, FDerpl6, FDerpl7, FDerpl8, FDerpl9, FDerp20, FDerp21, FDerp22 each take 14 μl (each primer) Concentration is 25uM), in EP tube 5 碌的 10 X PCR buffer ( purchased from the section), using 2 μl of the template as a template, adding FFDp9 and FFDp22 (concentration is 25uM) each 0.5 μl 565 1 as the upstream and downstream primers, adding 2. 5ul of 10 X PCR buffer to the PCR system昊泽公司); Add dNTP (2mM) 2. 5ul _; finally add dd 0 to complete the system to 25ul.

 Overlap PCR conditions: 94 °C 3min; 94 °C 40s, 50 °C 40s, 72 °C 40s for 30 cycles; 72 °C lOrain o

 Take the first PCR product 2 μl, add FDerp9 and FDerp22 (concentration is 25uM) each 0.55 570 μ ΐ as the upstream and downstream primers, and then carry out PCR under the above conditions.

 Take the second PCR product 2 μl, add FDerp9 and FDerp22 (concentration is 25uM) each 0.5 μμ ΐ as the upstream and downstream primers, and then carry out PCR of the above conditions to obtain the final product.

 Fragment III: For position 1 from position 670-963 at the 5' end, the primers are as follows.

 FDerp23 aaattcgtgaagctttggctcaaacccacagcgctattgccgtcattatt FDerp24 ATGACGGAATGCGTCTAAATCTTTGATGCCAATAATGACGGCAATAGCGC FDerp25 atttagacgcattccgtcattatgatggccgaacaatcattcaacgcgat FDerp26 GACAGCGTGATAGTTTGGTTGGTAACCATTATCGCGTTGAATGATTGTTC FDerp27 aaccaaactatcacgctgtcaacattgttggttacagtaacgcacaaggt FDerp28 CCAACTGTTTCGTACGATCCAATAATCGACACCTTGTGCGTTACTGTAAC FDerp29 ggatcgtacgaaacagttgggataccaattggggtgataatggttacggt

FDerp30: CATCATCAAATCGATGTTGGCAGCAAAATAACCGTAACCATTATCACCCC FDerp31 : ccaacatcgatttgatgatgattgaagaatatccatatgttgtcattctctaa FDerp32 : TTAGAGAATGACAACATATGGAT

PCR system: FDerp23, FDerp24, FDerp25, FDerp26, FDerp27, FDerp28, 585 FDerp29, FDerp30, FDerp31, FDerp32, each of the 10 primers took 2 μ 1 (each primer has a concentration of 25 uM), and the mixture was uniformly mixed in the EP tube. 5 μ 的 10 PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR Add dNTP (2mM) 2. 5ul _; finally add dd 0 to complete the system to 25ul.

 590 Overlap PCR conditions: 94 °C 3min; 94 °C 40s, 50 °C 40s, 72 °C 40s for 30 cycles; 72 lOrain.

 Take the first PCR product 2 μ 1, and add FDerp23 and FDerp32 (concentration is 25uM) each 0.5 μl as the upstream and downstream primers, and then carry out PCR of the above conditions.

 Take the second PCR product 2 μ 1, add FDerp23 and FDerp32 (concentration is 25uM) each 595 0. 5 μ 1 as the upstream and downstream primers, and then carry out the above conditions of PCR to obtain the final product.

 After obtaining the correct fragments of the three fragments, the three fragments were ligated by the overlapping fragment PCR method. The three fragments were first obtained by PCR, and the pfu enzyme was used for the enzyme, and the PCR conditions were the same.

 PCR conditions: 94 ° C for 3 min; 94 ° C for 40 s, 55 ° C for 40 s, 72 ° C for 40 s for 30 cycles; 72 ° C

10min. 600 ligation PCR system: each fragment 1 and fragment 3 each 1 μ 1, take the fragment 2 2 μ 1, as a template, add

FDerpl and FDerp32 (at a concentration of 25 uM) each of 0.5 μl as the upstream and downstream primers.

Overlap PCR conditions: 94 ° C for 3 min _; 94 ° C for 40 s, 50 ° C for 40 s, 72 ° C for 65 s for 30 cycles; 72 ° C for 10 min, to obtain the full-length cDNA sequence of 963. After DNA sequencing, the nucleotide sequence of the fragment was confirmed to be Sequence 1 in the Sequence Listing.

 605 2. Cloning and subcloning of Der pi gene

 (1) Cloning the Der pi gene into the T vector

The PCR product was recovered using the Takara PCR Fragment Recovery Kit according to the instructions. The recovered cDNA fragment and pMD 18- T vector (purchased from Takara Company) 16Ό overnight under the effect of T ₄ DNA ligase, so Der pi gene was obtained by PCR connected to a 18- T vector pMD. Connection production

610 transformation of E. coli DH5 ci competent cells, preparation and transformation of competent cells and plasmid extraction by reference (Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual, (2 ^nd ed) . New York : Cold Spring Harbor Laboratory Press, 1989. 19-56). The extracted plasmid was identified by digestion with BamH I and Sal I to obtain a product of about 963 bp, and then the direction of insertion was confirmed by BamH I and EcoR I. The ATG carried by the cloned gene itself was carried.

615 The plasmid adjacent to the vector M13R (-48) universal primer was named T-Der pl. The correct colony will then be identified and stored after extraction with the plasmid.

 (II) Prokaryotic expression of Der pi protein

 In order to use Der pi protein for induction of asthma model and vaccine preparation, Der pi was subcloned into pET-28a prokaryotic expression vector to express Der pi prokaryotic protein. The specific method is as follows:

620 BamH I and Sal I were used to digest the pET28a (+) (Novagen product) vector and the T- Der pi plasmid, respectively. After the Der pi was ligated into pET28a (+), the E. coli DH5 ci competent cells were transformed into competent cells. Preparation and transformation are by reference (Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual, ( ^2nd ed). New York: Cold Spring Harbor Laboratory Press, 1989. 19-56). A recombinant plasmid of about 963 bp will be identified (named

625 _P ET28a-Der pi ) , preserve the strain. The expression of Der pi in the prokaryotic system under the induction of IPTG is as follows:

1 After the recombinant plasmid pET28a- Der pi was transformed into E. coli BL21 (DE3) competent cells, the monoclonal bacteria were picked and cultured to A ₆ with a 37-inch constant temperature shaker at 220 rpm/min. . =0. 5.

2 Add 3 mL of pre-cultured pET28a- Der pi solution and 300 630 50 mg/mL kanamycin to 300 mL LB medium, and incubate to A ₆ at 37 ° C with a constant temperature shaker at 220 rpm/min. . =0. 5.

 3 600 μ ί 0. 5M IPTG was added to the culture medium, and the expression was induced by a 37 ° C constant temperature shaker for 4 h.

 4 Culture medium The cells were collected by centrifugation at 4 ° C, 12000 rpm, 5 min, and the supernatant was decanted. The pellet was resuspended in Binding Buffer.

The cells were disrupted by ultrasonication at 5 °C for 20 min. The precipitate was collected by centrifugation at 4 ° C, 12000 rpra, 5 min. After SDS 635 PAGE detection. - 20 Ό frozen. The expression product was Der pi antigen by SDS PAGE electrophoresis and Western detection (antibody was purchased from the extract of the "Attatta" Dust mites adult of ALK Company of Denmark).

 (iii) Eukaryotic expression of Der pi

 1. Construction of eukaryotic expression vector - When designing primers, the eukaryotic expression of Kozak sequence was added to ATG before the sequence was

GCCACCATGAAAATTGTTTTGGCCA, BamH I and Sal I were used to digest the pVAX (Invitrogen product) vector and T-Der pi plasmid, respectively, and Der pi was ligated into pVAX to obtain the recombinant plasmid pVAX - Derpl. pVAX- Derpl was transformed into E. coli DH5 α competent cells (the method is the same as above), and the plasmid was extracted and sequenced.

 2. Identification of eukaryotic expression: pVAX-Derpl was transfected into BHK cells, and the expression of Der pi in eukaryotic cells was detected after transfection. RT-PCR with Der pi specific primers can detect about 963 bp of expression product and ultrasonically disrupted cells, and then use Der pi polyclonal antibody (rabbit resistance) to detect a protein of about 65 kd by Western method, and determined to be pVAX. -Derpl can be expressed in eukaryotic cells.

 Third, Der pi protein and pVAX_Der pi combined immunosuppressive asthma

 Experimental animals: Female BALB/c mice (8-10 weeks old) were purchased from the Laboratory Animal Research Institute of the Chinese Academy of Medical Sciences.

 (1) Construction of asthma model

 1. Induction of asthma model

Dust mites extract (Anta, purchased from Aierka-Abeyou; diluted to 1 mg/ml with PBS) as an allergic antigen mixed with an equal volume of 10% aluminum salt (Sigma, USA), room temperature conditions The mixture was shaken for 2 hours to obtain a dust mite extract/aluminum composite. After centrifugation at 750 X g for 5 min, the supernatant was discarded, and the dust mite extract/aluminum complex was resuspended in deionized water to a concentration of 1 mg/ml. On day 0, each female BALB/c mouse (8-10 weeks old) was intraperitoneally injected with ΙΟΟμ 螨 dust mites extract/aluminum complex (dissolved in PBS at a final concentration of 1 mg/ml), 8th, 14th, 16th And 18 days, 100 μΐ of 100 μ _§ /100 μ 1 of dust mites extract (dissolved in PBS) was injected into the lung tissue of mice through the trachea, and the asthma model was induced.

 At the same time, a negative control group was set. On day 0, each female BALB/c mouse (8-10 weeks old) was intraperitoneally injected with 100 μl PBS, and on days 8, 14, 16 and 18, 100 μl of PBS was infused through the trachea. The lung tissue of the mouse served as a negative control (Na'ive).

 2, skin test response

 On the 20th day of the preparation of the asthma model, 3 mice in the model group and the control group were selected for the skin test.

 48 hours before the skin test, the hair of the right abdomen of the mouse was removed with a depilatory cream, and the different mice were treated as follows on the 0th day:

 1) Inject 50 ul of dust mites into the right abdomen of the mice (final concentration is l y g / μ ΐ soluble)

PBS ) ; 2) Inject the 50 μl histamine solution (final concentration lg/μ ΐ in PBS) into the right abdomen of the mice as a positive control;

 3) 50 μl of PBS was intradermally injected into the right abdomen of the mice as a negative control.

 The diameter of the blister was measured after 15 minutes of injection.

 3, the results

 According to the method of the reference, BALB/c mice were induced by the dust mites extract and lung stimulation to induce an asthma model in mice. One of the symptoms of asthma is a positive reaction to the original skin test for dust mite allergies. Generally, the average value of the blister size caused by the PBS of the positive control histamine and the negative control group is taken as the standard value 1 in the allergic skin test reaction, and the sample having the blister diameter greater than 1 can be judged as the hypersensitivity positive, less than 1 Negative.

 The results are shown in Fig. 10. The results in Fig. 10 are the mean standard deviations. The skin test response of the mice in the model group to the dust mite extract was significantly higher than that in the Naive control group (p<0.01), indicating that the mouse model of allergic reaction to dust mites was successfully induced.

 (B) Der pi protein and pVAX- Der pi combined immunosuppressive asthma

 1, vaccine immunization

 Female BALB/c mice were divided into intramuscular injections of Derpl recombinant protein (100 μl/100 U g/mouse), pVAX- Derpl plasmid (100 μl/100 μg/mouse), Derpl recombinant protein + pVAX- Derpl plasmid; In the dose experiment, different doses of the nucleic acid vaccine pVAX- Derpl and Derpl recombinant protein were mixed and immunized, and the specific dose is shown in the results.

 Twenty-five female BALB/c mice (8-10 weeks old) were divided into 5 groups of 5 mice each. The specific immunization methods are as follows:

 The first group was the pVAX- Derpl plasmid immunization group, which was intramuscularly immunized twice, 14 days after the first immunization, and once again, each mouse was immunized with 100 μg of pVAX- Derpl plasmid (100 μg pVAX- Derpl plasmid). Dissolved in 100 μl of 0.9% aqueous NaCl solution).

 The second group was Derpl recombinant protein immunization group, which was injected twice by intramuscular injection. After 14 days of the first immunization, it was boosted once again. Each mouse was immunized with 100 μg of the above-mentioned prokaryotic Derpl recombinant protein (100 μg Derpl recombinant). The protein was dissolved in 100 μl of 0.9% NaCl aqueous solution).

 Group 3 was co-immunized with pVAX- Derpl plasmid and Derpl recombinant protein, and was intramuscularly immunized twice, 14 days after the first immunization, and once again, each mouse was immunized with 100 μg of pVAX- Derpl plasmid (100 Microgram pVAX- Derpl plasmid was dissolved in 100 μl of 0.9% NaCl aqueous solution) and 100 μg of the above prokaryotic expressed Derpl recombinant protein (100 μg of Derpl recombinant protein dissolved in 100 μl of 0.9% NaCl aqueous solution).

Group 4 was co-immunized with pVAX-Derpl plasmid and Derpl recombinant protein, and was intramuscularly immunized twice, 14 days after the first immunization, and once again, each mouse was immunized with 134 micrograms of pVAX- Derpl plasmid (134 Microgram pVAX- Derpl plasmid is dissolved in 100 μl of 0.9% NaCl aqueous solution) and 66 μg of the above prokaryotic expressed Derpl recombinant protein (66 μg of Derpl recombinant protein is dissolved in 100 μl of 0.9% NaCl Aqueous solution).

 Group 5 was a negative control group and no immunotherapy was performed.

710 2. T cell proliferation experiment

On the 7th day after the second immunization, 3 mice in each group were selected. After the neck was sacrificed, the spleen T cells were isolated and added to 96-well plates at a volume of lOOul (about 2 X). 10 ⁵ cells), each set has 3 parallel holes. Add 20 ul of stimulant to the above-mentioned prokaryotic-expressing Derpl recombinant protein, 20 ul of stimulant ConA (positive control well), 20 ul of stimulator BSA (negative control well), and the final concentrations of the above 3 715 excitons are Lug/hole. After incubation for 48 hours at 37 °C, add 5 mg/ml of MTT 20 ul. After further incubation for 4 hours, centrifuge at 2000 g for 15 minutes. After discarding the supernatant, add 100 ul of dimethyl sulfoxide per well to dissolve the precipitate, and place the spectrophotometer at 595 nra. The absorbance value was read and the stimulation index (SI = experimental OD + 0D of the background well) was calculated, wherein the well without the stimulus was the bottom hole.

 3, the results

 720 In order to immunotherapy of asthmatic diseases by the combined immunization method, the nucleic acid vaccine pVAX- Derpl expressing Derpl antigen was co-immunized with the corresponding Derpl recombinant protein expressed in prokaryotic expression, and the immunization alone was used as a control.

 The results are shown in Figure 11. The result in Figure 11 is the mean soil standard deviation. a is the average result of ConA as a stimulator for T cells of the first to fifth groups of immunized mice; g is the T of the immunized mice of the first to fifth groups

725 The average result of BSA as a stimulator; b is the result of using Derpl recombinant protein as a stimulator in group 1 immunized mice; c is the result of using Derpl recombinant protein as a stimulator in group 2 immunized mice; d is the first Three groups of immunized mice were treated with Derpl recombinant protein as a stimulator; e was the result of using Derpl recombinant protein as a stimulator in group 4 immunized mice; f was the result of using Derpl recombinant protein as a stimulator in group 5 immunized mice . The results showed that: Derpl recombinant protein and pVAX- Derpl plasmid co-immunization group (3rd

The level of T cell proliferation in group 730 was significantly lower than that in the immunized group alone, indicating that only co-immunization can inhibit the antigen-specific T cell suppression caused by dust mite antigen.

 After demonstrating that the co-immunization of Derpl recombinant protein and pVax-Derpl plasmid can inhibit the occurrence of asthma, the effect of the dose change of co-immunization on the inhibitory effect was further compared. The dose of the nucleic acid vaccine pVAX-Derpl was 100, 134 g/head, and the dose of Derpl recombinant protein was 100, 66 w g/only.

The results of 735 are shown in Figure 11. The results showed that when the doses of pVAX- Derpl and Derpl recombinant proteins were

At 100 μg/day, it can significantly inhibit the proliferation of T cells by dust mite antigen. The dose of pVAX- Derpl is 134 ug/only, and the protein of 66 g/only can not inhibit the proliferation of T cells, indicating that Derpl recombinant protein The inhibitory effect of immunization with pVAX-Derpl plasmid was dose dependent.

 Fourth, combined immunosuppressive asthma

 740 (a) induced Der pi asthma model

80% of asthma patients are allergic to dust mites, which are important allergens to asthma. The use of dust mites-induced asthma models should better reflect asthma characteristics. Allergens were sensitized by subcutaneous injection of C57BL/6 mice with Der pi protein (Derp I, 10 ug, Al (0H) 31 mg) expressed in prokaryotic cells, and dust mite was instilled on the 14th day. Extract (purchased from the ALK company's "Anta", which contains 48% Der pi, 49% Derp2)

After 745 stimulation, large airway, alveolar EOS infiltration, mucus plug formation, and dose-related changes were observed after 3 days, and it was not related to the presence or absence of serum IgE. Derpl can also be passively metastatic, and it is demonstrated that airway inflammation AHR is mediated by antigen-specific lymphocytes, and rapid-rising airway response is mediated by serum factors [FL van der Heijden, RJ Joost van Neerven, M van Katwijk, JD Bos, and ML Kapsenberg. Serum-IgE-faci litated al lergen presentation in atopic

750 disease. J. Immunol., Apr 1993; 150 : 3643. ].

 1. Experimental design of induced asthma model

 A total of six groups were designed: 5 C57 mice per group, 6-8 weeks old, and the induction immunization method for each mouse is shown in Table 2:

 Table 2 Method of inducing immunity

 755 In Table 2, the extract is a dust mite extract (purchasing "Anta" from ALK, Denmark, which contains 48% Der pi, 49 Derp2); the fusion protein is the Der pi protein expressed in prokaryotic expression in step 2 above; Sal Ine is physiological saline (0.9 g sodium chloride, dissolved in a small amount of distilled water, diluted to 100 ml); aluminum adjuvant is a 10% aluminum salt (Sigma, USA) solution.

 2, the test of the experiment

 760 1 BAL Collection

 After the last antigen sensitization for 24 h, the mice were sacrificed by bleeding. 1ml Hank's solution, lavage lung 4 times, the collection liquid 700g centrifuged for 10min, 4 °C, suspended with lOOul Hank's liquid, counted and classified.

 2 pathological analysis

 765 The lungs were perfused with 4% paraformaldehyde, cut and immersed in the fixative.

 The induction results of the asthma model are shown in Table 3.

 Table 3 Asthma model induction results

 Skin test histological test first induction second induction

 (8, 10, (lymphocyte infiltration) (0 days) (7 days)

12, 14 days) 50wg extract + 50wg extract +

 A 50 μg extract + + +

 4mg aluminum adjuvant 4mg aluminum adjuvant

 B 4mg aluminum adjuvant 4mg aluminum adjuvant 51wg extract

50 μg fusion protein 50 μg fusion protein 50 _μg fusion egg

 C + + +

 + 4mg aluminum adjuvant + 4mg aluminum adjuvant white

50 μg natural protein 50 μg natural protein 50μ _§ natural egg

D ^{+ + +}

 + 4mg aluminum adjuvant + 4mg aluminum adjuvant white

 E Saline Saline 50 μg extract

 F Saline Saline Saline

 In Table 3, + + + represents severe T cell affinities, with an average score greater than 2; represents no or mild T cell affinities, with an average score of less than 2.

 After sectioning, staining was used to detect T cell infiltration and was coded and graded using the reproducible scoring system. There are two criteria: 1: peripheral inflammation; 2: perivascular inflammation.

 Grading criteria: no inflammation, 0: incidental inflammatory cells, 1: surrounded by 1-5 layers of inflammatory cells in the bronchi and blood vessels, 2: surrounded by more than 5 layers of inflammatory cells, 3: each slice immediately Select 10-15 regions and calculate the average of these regions.

 Another film was stained with toluidine blue for mast cells.

3 Specific IgE, IgG _2a , IgG1 levels were detected by ELISA according to the method of Example 1.

4 RT-RCR method for detecting cytokines

 After reverse transcription of mRNA of spleen cells was extracted, the expression of allergic-related cytokines such as IL-4, IL-9, IL-5, IL-13, IF-γ was detected as in Example 1.

 5 skin test

 The skin test was performed on the lateral abdomen by 50 μl each of histamine, dust mites extract, Saline, and BSA.

 (ii) Prevention/therapeutic immunization programme

 The prevention group was designed in 11 groups: A- Η group 5 C57 mice, 6-8 weeks old, I- Κ group 3 C57 small treatment group design also 1 Γ group: A- Η group 5 C57 mice, 6- At 8 weeks of age, 3 C57 mice in the sputum-sputum group were changed to 14 days after successful induction of asthma. The immunization started from 16 days, 30 days were exempted, and the test was started at 37 days.

 Induced asthma model group First immunization (0d) Second immunization (14d)

 (21 days)

Der pi protein (100wg) + Der pi protein (100 g) + pVAX-Der

 A

 pVAX-Der pl(100 g) pl(lOOug)

 B Der pi protein (100 g) Der pi protein (100 μg)

 C pVAX-Der pl(100ug) pVAX-Der ρ1(100 g)

 OVA protein (100 μg) + pVAX- OVA protein (100 g) + pVAX-Der

 Der pKlOOu g) pKlOOu g)

Der pi protein (100ug) + Der pi protein (100 g) + pVAX- pVAX-OVA (lOOug) OVA (100u g) F ppVVAAXX vveeccttoorr ((110000 uu gg)) pVAX vector (100 g)

 G SSaalliinnee Saline

 H SSaalliinnee Saline

 Fragment one peptide (100 μ fragment one peptide (100 μ g) + pVAX- g) + pVAX-fragment one (lOO w g) fragment one (lOO w g)

 Fragment two peptide (100 μ fragment two peptide (100 w g) + pVAX- g) + pVAX-fragment two (100 u g) fragment two (lOO u g)

 Fragment three eptide (100 fragment three peptide (100 g) + pVAX- g) + pVAX-fragment three (100 g) fragment three (lOO w g)

 ^Table induced asthma model; representative does not induce asthma model

 1 BAL collection

 790 After the last antigen sensitization for 24 h, the mice were sacrificed by bleeding. 1ml Hank's solution, lavage lung 4 times, the collection liquid 700g centrifuged for 10min, 4 °C, suspended with lOOulHank liquid, counted and taken to the veterinary hospital for classification and statistics.

 2 pathological analysis

 The lungs were perfused with 4% paraformaldehyde, cut and immersed in a fixative.

After 795 sections, staining was used to detect T cell infiltration and was coded and graded using the reproducible scoring system.

 The other piece was stained with toluidine blue for mast cell activity.

1 ELISA detects specific IgE, IgG _2a , IgGl levels.

 2 RT-RCR method for detecting cytokines

 800 After extracting spleen mRNA reverse transcription, detect allergic-related cytokines such as IL-4, IL-

9. IL-5, IL-13, IL-10, IF-γ, TGF-β.

 5 skin test

 The skin test was performed on the lateral abdomen by 50 μl each of histamine, dust mites extract, Saline, and BSA.

3 Τ Cell proliferation experiment

 The 805 was tested by two methods, ΜΤΤ and CFSE. The group was designed to be stimulated by Der pl, BSA, and ConA. The peptide group was combined with a set of peptide stimulation.

 4 detection of T cell subtypes

 For example, CD4+CD25+ cells account for the proportion of all spleen cells and CD4+ cells.

 7 intracellular staining experiment

 810 mainly stains the following cytokines: IL_10, IF- y, TGF-β, IL-13, IL-5

 8 mixed lymphocyte culture and inhibition experiments

 Inhibitory T cells: T cells from co-immunized mice

 Activated T cells: T cells from normal C57 mice

DC: from Balb/c mice 9 Adoptive transfer experiment

 The τ cells were isolated and transferred into normal mice from the above immunized mice, and the anti-CD25 antibody was injected simultaneously with the immunized group, and then asthma was induced, and the above various indexes were detected.

 (iii) Results

 1. Prevention of immunization results:

 Induced asthma histological test group model (21 first immunization (28 days) second immunization (42 days) T cell activity (lymphocyte infiltration)

 Der pi protein (100 u Der pi protein (100 μ

 A g) + pVAX-Der pi g)+ pVAX-Der

 (100 g) pl(lOOug)

 Der pi protein (100 μ Der pi protein (100 u

 B

 g) g) + + +

 pVAX-Der pi (100 pVAX-Der pi (100 μ)

 C

 g) g) + + +

OVA protein (100 g) + OVA protein (100wg) +

 D + + + pVAX-Der pi (100 μ pVAX-Der pi (100 μ + + + g) g)

 Der pi protein (100 μ Der pi protein (100 μ)

 E g) + pVAX-OVA g) + p VAX-OVA (100 + + +

 (100 ug) g)

 pVAX vector (100 μ pVAX vector (100 u

 F

 g) g) + + +

 G Saline Saline + + +

 H Saline Saline

 Fragment one

 Fragment one peptide (100

 Peptide (100 μ

g)+ _P VAX-fragment one

 g) +pVAX-fragment one

 (lOOu g)

 (100μg)

 Fragment two

 Fragment two peptide (100

 Peptide (100 μ

 J + + + wg) + pVAX - Fragment II

 g) +pVAX-fragment two

 (lOOug)

 (lOOug)

 Fragment three

 Fragment three peptide (100

 Peptide (100 u

 K wg)+pVA-fragment three

 g) +pVAX-fragment three

 (lOO g)

 (lOOug)

+ + + represents a serious T cell intimacy in histology, with an average score greater than 2 _; representing no or slightly T-cell intimacy, with an average score of less than 2.

 2. Therapeutic immune results:

 Histological examination, induced asthma model, T cell survival

 First immunization (0 days) second immunization (14 days) (lymphocytes

 (21 days) sex

 infiltration)

Der pi protein (100 μ Der pi protein (100 μ)

 g)+ pVAX-Der g) + pVAX-Der

pKlOOu g) pKlOOu g) _n Der pi protein (100μ Der pi protein (100 μ

 B g) g) + + + pVAX-Der pi (100 μ pVAX-Der pi (100 μ

 c g) g) + + +

OVA protein (ΙΟΟμ g) + OVA protein (100wg) +

 D pVAX-Der pi (100 μ pVAX-Der pi (100 μ

 g) g)

 Der pi protein (ΙΟΟμ Der pi protein (100 μ

 E g) + pVAX-OVA(100 g)+ pV AX-OVA (100 + + + g) g)

 „ pVAX vector (100 μ pVAX vector (100 μ

 F g) g) + + + + + + G Saline Saline + + + + + + H Saline Saline

 Fragment one peptide (100 fragment one peptide)

 I u g) +pVAX-fragment one ug)+pVAX-fragment one

 (100 ug) (lOO g)

 Fragment two peptide (100 fragment two peptide (100

J g)+ _P VAX-fragment two g)+pVAX-fragment two

 (lOOug) (lOO g)

 Fragment three peptide (100 fragment three peptide (100

K wg)+pVAX-fragment three wg)+ _P VAX-fragment three

 (100μg) (lOO g)

 Adoptive transfer

M 10 ^s X CD4+CD25- 10 ⁵ X CD4+CD25- T cells* T cells'

 + + + represents the histological examination of severe T cell pro-wet, the average score is greater than 2; the representative did not occur or slightly occurred T cell affinity, the average score is less than 2

 *: Der pi protein (100 g) + pVAX-Der pi (100 μg) was immunized from mice and isolated and purified.

 in conclusion:

 1. Combined immunization can prevent asthma caused by dust mites (Result 2). The reason is that the pathological T cell proliferation is reduced and the histopathological cellular response of asthmatic mice is also reduced.

 2. Both immunological and pathological indicators reflect that this type of immunity can be used to treat type I hypersensitivity (result 3), which is induced by antigen-specific CD4+CD25-regulation. T cells come into play.

Industrial application

The experiment proves that the mixture of the 0VA epitope polypeptide pep323 and the recombinant eukaryotic cell inserted with the pep323 encoding gene at the multiple cloning site can inhibit the proliferation of T cells in the immunized mice, induce the production of immunosuppression, and effectively prevent it. And/or treatment of the development of allergic asthma induced by 0VA protein. Since the external allergens are mostly proteins, and the allergens causing asthma are mostly inhaled, the animal model of bronchial asthma is mostly made after allergen sensitization, and then allergen-induced asthma is induced by airway. Happened. Allergens for animal models of allergic asthma are mainly oval protein (OVA), locust 840 eggs, dust mites, ragweed pollen, fungal spores, mites and certain occupational asthmatic substances. Therefore, OVA (chicken egg protein, grade V, Sigraa) is used in the world for sensitization and stimulation in mice, and asthma is induced in the trachea. It is used as a representative and repeatable animal model for asthma to evaluate the preventive and therapeutic effects of asthma. (Current Protocols in Immunology; research status of animal models of bronchial asthma http: //www.biantaifanying.cn/News/news- detail. asp?id=83). The present invention uses a combination of pep323 and pD323 in an epitope of 845 OVA allergen to immunosuppressive OVA allergen-induced asthma, as well as protein antigens or epitopes thereof that cause allergic asthma from other allergen proteins. A mixture of the polypeptide and a recombinant eukaryotic expression vector in which the protein antigen of the allergic asthma or its epitope polypeptide-encoding gene is inserted at the multiple cloning site also inhibits asthma.

Claims

850 claims

A vaccine for the prevention and/or treatment of allergic asthma, the active ingredient of which is a mixture of a) or b) or c) or d):

 1) a mixture of a protein antigen causing allergic asthma and a recombinant eukaryotic expression vector in which a gene encoding the 855 protein antigen causing allergic asthma is inserted at a multiple cloning site;

 2) a mixture consisting of a protein epitope polypeptide causing allergic asthma and a recombinant eukaryotic expression vector in which the gene encoding the protein epitope polypeptide of the allergic asthma is inserted at the multiple cloning site;

3) a mixture consisting of a protein antigen causing allergic asthma and a recombinant eukaryotic expression vector in which the gene encoding the protein epitope polypeptide of the allergic asthma is inserted at the multiple cloning site;

 860 4) A mixture of a protein epitope polypeptide which causes allergic asthma and a recombinant eukaryotic expression vector which inserts the gene encoding the protein antigen of allergic asthma at the multiple cloning site.

 The vaccine according to claim 1, wherein the protein antigen causing allergic asthma is selected from any one of the following antigens: an amino acid sequence such as the ragweed shown by GenBank Accession Number X56279 O^br^ s trifida) allergen Amb t V; 2, amino acid sequence

865 GenBank Accession Number AMBPV2A The perennial ragweed (A3⁄43⁄4rosia psilostachya) allergen Amb p V; 3. The amino acid sequence such as GenBank Accession Number AMBPV3A, the perennial ragweed allergen Amb p V; 4, amino acid sequence such as GenBank Accession Number The perennial ragweed allergen Amb p V shown in AMBPV1B; 5. The amino acid sequence such as the perennial ragweed allergen Amb p V shown in GenBank Accession Number AMBPV2B; 6. Amino acid sequence such as GenBank Accession

870 Number AMBPV3B shows the perennial ragweed allergen Amb p V; 7. The amino acid sequence such as Aspergillus oryzae (As^er ^i^ fumigatus) shown in GenBank Accession Number S39330 is allergen I/a=IgE-binding ribotoxin; 8 The amino acid sequence such as the Aspergillus fumigatus allergen rAsp f 13 shown in GenBank Accession Number AJ002026; 9, the amino acid sequence such as the Aspergillus fumigatus allergen rAsp f 4 shown in GenBank Accession Number AJ001732; 10, amino acid sequence such as GenBank

875 Accession Number AJ001732 shows the Aspergillus fumigatus allergen rAsp f 7 ; 11, amino acid sequence such as the Aspergillus fumigatus allergen rAsp f 8 shown in GenBank Accession Number AJ224333; 12, amino acid sequence such as GenBank Accession Number AJ223327 The original rAsp f 9 ; 13, the amino acid sequence such as the Aspergillus fumigatus allergen rAsp f 11 shown in GenBank Accession Number AJ006689; 14, the amino acid sequence such as the cigarette shown in GenBank Accession Number AJ937743

880 Aspergillus allergen cyclophilin (asp f 27); 15, amino acid sequence such as GenBank Accession

Number AJ937744 shows the Aspergillus fumigatus allergen thioredoxin (asp f 28); 16, amino acid sequence such as GenBank Accession Number AJ937745, the Aspergillus fumigatus allergen thioredoxin (asp f 29); 17, amino acid sequence as shown by GenBank Accession Number AF282850 Betula pendula isoflavone reductase -like protein 885 Bet v 6. 0102 (BETV6. 0102); 18, amino acid sequence such as GenBank Accession Number

European buckthorn isoflavone reductase-homolog Bet v 6. 0101 (BETV6) shown in AF135127; 19, amino acid sequence such as GenBank Accession Number BGU40767 German Blass (Bla «ella germanica) allergen Bla g 4; 20, amino acid The sequence 歹lj is the German cockroach allergen Bla g 5 shown in GenBank Accession Number BGU92412; 21, amino acid sequence such as GenBank Accession

German steroidal cysteine protease precursor (aspartic protease) as shown in 890 Number BGU28863

 Precursor); 22, amino acid sequence such as GenBank Accession Number AF072219, the main allergen of German cockroach (Bla g 1. 0101); 23, amino acid sequence such as GenBank

 Accession Number AF072221 is the main allergen of German cockroach (Bla g 1. 0101); 24, amino acid sequence such as GenBank Accession Number AF072220

895 original Bla g 1. 02; 25, amino acid sequence such as GenBank Accession Number AY283288, Dermatophagoides farinae Der f 2 allergen; 26, amino acid sequence such as GenBank Accession Number AY947536 of household dust mites (Dermatophagoides

 Pteronyssinus) Der Der-pl allergen; 27, amino acid sequence 歹 [|, such as GenBank Accession Number X63517, barley (H. vulgare) Iaml-monomer a-amylase inhibitor (monomeric

900 alpha- amylase inhibitor); 28, amino acid sequence such as GenBank Accession Number

Aloe powder (Lolium perenne) pollen allergen (5C) shown in AJ243504; 29, amino acid sequence such as the glucoredoxin, mala s 13 gene of Malassezia sympodialis shown in GenBank Accession Number AJ937746 30; amino acid sequence 歹 ij as shown in GenBank Accession Number AF072222 (Periplaneta)

 905 americana) major allergen (Per a 1. 0101); 31, amino acid sequence such as GenBank

 Accession Number AF106961: Periplaneta americana tropomyosin; 32, amino acid sequence such as Trichophyton rubrum allergen (Trir 2) shown by GenBank Accession Number AF082515; 33 , an amino acid sequence such as the Trichophyton rubrum allergen (Trir 4) shown by GenBank Accession Number AF082514;

910 34, Amino acid sequence such as GenBank Accession Number AF082514

 Trichophyton ηώινπί) Ί3⁄4α Ύτϊ r 4; 35. The amino acid sequence is as shown in Sequence Listing 1 of the dust mites Der pl.

 The vaccine according to claim 1 or 2, wherein the vaccine for preventing and/or treating allergic asthma is caused by a protein antigen causing allergic asthma and insertion at a multiple cloning site.

A mixture of 915 aberrant protein antigen-encoding genes for recombinant eukaryotic expression vectors.

 The vaccine according to claim 1 or 2, wherein the vaccine for preventing and/or treating allergic asthma is a protein epitope polypeptide which causes allergic asthma and is inserted at a multiple cloning site. A mixture of recombinant eukaryotic expression vectors encoding a protein epitope polypeptide encoding gene for allergic asthma.

920. The vaccine according to claim 1 or 2, wherein: the allergic asthma is caused. The protein antigen is an amino acid sequence such as the dust mite Der pl shown in SEQ ID NO: 1 in the Sequence Listing.

 The vaccine according to claim 1 or 2, wherein the protein antigen-encoding gene for causing allergic asthma is a nucleotide sequence such as the dust mite Der pi gene shown in SEQ ID NO: 2 in the Sequence Listing.

 The vaccine according to claim 1 or 2, wherein the active ingredient of the vaccine for preventing and/or treating allergic asthma is an amino acid sequence such as Dust pi and pVAX as shown in SEQ ID NO: 1 in the Sequence Listing. -

The vaccine according to claim 3, wherein: the allergic asthma self-protein antigen and the recombinant eukaryotic expression vector in which the allergic asthma self-protein antigen-encoding gene is inserted at a multiple cloning site It is 1:5 - 5:1; preferably 1:1 - 1: 2.

 The vaccine according to claim 4, wherein: the allergic asthma self-protein epitope polypeptide and the recombinant eukaryotic gene inserted into the multiple cloning site of the allergic asthma self-protein epitope polypeptide-encoding gene; The cell expression vector has a mass ratio of 1:5 to 5:1; preferably 1:1 to 1:2.

 The vaccine according to claim 1 or 2, wherein the vaccine for preventing and/or treating allergic asthma is caused by the allergic asthma self-protein antigen and the allergy in the multiple cloning site. a mixture of recombinant eukaryotic expression vectors encoding the polypeptide gene of the asthma self-protein epitope; or inserting the allergic asthma self-protein antigen from the allergic asthma self-protein epitope polypeptide and at the multiple cloning site A mixture of recombinant eukaryotic expression vectors encoding the gene.