WO2008131441A1 - Methods and compositions involving ltas - Google Patents

Abstract

The present invention concerns methods and compositions for screening and identifying compounds with antibacterial properties. In specific embodiments, it involves an LtaS polypeptide for identifying any agents that inhibit the LtaS polypeptide.

Description

DESCRIPTION

METHODS AND COMPOSITIONS INVOLVING LTAS

BACKGROUND OF THE INVENTION

This application claims priority to U.S. Provisional Patent application serial number 60/913,469 filed on April 23, 2007, which is hereby incorporated by reference.

The government owns certain rights in the invention pursuant to grant number AI 052474 from the National Institute of Allergy and Infectious Diseases (NIAID).

1. Field of the Invention

The present invention relates generally to the fields of microbiology and pathology. More particularly, it concerns methods and compositions relating to LtaS, which is an essential protein in certain gram-positive bacterial pathogens. In certain embodiments, there are methods and kits for screening for gram-positive antimicrobial agents.

2. Description of Related Art Staphylococcus aureus is the leading cause of hospital and community acquired soft tissue infections, the therapy of which frequently fails as staphylococcal strains acquire resistance mechanisms for all known antibiotics (Kaplan et al, 2005; Diekema et al, 2001; Weigel et al, 2003). Development of novel antibiotics is urgently needed and requires the identification of new target genes that are required for bacterial growth (Projan and Shlaes, 2004).

Cell wall teichoic acid (WTA) and lipoteichoic acid (LTA) are characteristic envelope components of Gram-positive bacteria (Armstrong et al., 1959; Armstrong et al, 1958; Archibald et al, 1961). WTA and LTA have been researched for several decades, revealing their chemical structure and modifications in many different Gram- positive microbes (McCarty, 1959; Neuhaus and Baddiley, 2003; Fischer, 1990). Earlier work presumed that synthesis of these secondary wall polymers may be essential for bacterial growth and may therefore serve as a target for antibiotic development (Mauel et al, 1989), similar to peptidoglycan, the primary wall polymer and target of penicillin (Tipper and Strominger, 1965). Recent work showed that while WTA is dispensable for growth under laboratory conditions (D'Elia et al, 2006a; D'Elia et al., 2006b; Weidenmaier et al, 2004), staphylococcal mutants unable to synthesize WTA display severe virulence defects in animal models of infection (Weidenmaier et al, 2004; Weidenmaier et al, 2005). S. aureus LTA is a 1-3 linked glycerol-phosphate polymer that is retained by a glycolipid anchor [diglucosyl diacylglycerol (GIc₂-DAG)] in bacterial membranes (FIG. IA) (Duckworth et al, 1975; Fischer et al, 1990). Staphylococci produce polyglycerol-phosphate polymers even in the absence of glycolipids, as mutant strains that cannot synthesize GIc₂-DAG are still able to anchor LTA via diacylglycerol (Kiriukhin et al, 2001; Grundling and Schneewind, 2007). Mutations in the dlt operon abolish D-alanyl esterification of LTA without affecting the synthesis of polyglycerol-phosphate (Heaton and Neuhaus, 1992; Heaton and Neuhaus, 1994; Peschel et al, 1999; Peschel et al, 2000). Both dlt and glycolipid anchor mutants continue to multiply, thereby revealing that these non-essential genes are not ideal targets for antibiotic development (Grundling and Schneewind, 2007; Peschel et al, 1999).

Therefore, there is a need for new antibiotic targets. The present invention provides methods and compositions for identifying candidate antibiotic therapies.

SUMMARY OF THE INVENTION The present invention is based on the identification of a polyglycerol-phosphate synthase, LtaS, in S. aureus and on the confirmation of its requirement for LTA synthesis. Upon ltaS depletion, staphylococci were unable to synthesize LTA and ceased to grow while displaying defects in cell division. Consequently, the present invention concerns methods and compositions that provide information about inhibition of LtaS to identify compounds for antibiotic therapy of S. aureus infections, and other gram-positive infections.

In some embodiments of the invention, there are methods for evaluating a candidate compound for antibacterial activity against a gram-positive bacteria comprising: a) contacting an LtaS polypeptide with the candidate compound in a mixture; and, b) evaluating whether the polypeptide and the candidate compound interact. Such a method may be employed in vitro and/or in vivo.

In other embodiments of the invention, there are methods of evaluating a candidate compound for antibacterial activity comprising a) expressing an LtaS polypeptide in a heterologous cell; b) incubating the cell with a phosphatidyl glycerol (PG) substrate under conditions to allow glycerol-phosphate polymerization; c) incubating the cell with the candidate compound; and, d) comparing the levels of polyglycerol phosphate synthesis in the presence and absence of the candidate compound. A substance that reduces the level of polyglycerol phosphate synthesis may be further qualified as a candidate compound, hi some embodiments, the presence of the candidate compound reduces the level of polyglycerol phosphate synthesis compared to when the candidate compound is absent. It is contemplated that a reference level for the absence of the candidate compound may be used for the comparison, however, this control may also be done in parallel with the evaluation of the candidate compound. Embodiments of the invention involve an LtaS polypeptide, which refers to a polypeptide that can synthesize glycerol-phosphate lipotechoic acid (LTA). In certain embodiments, a candidate substance may reduce the level of glycerol-phosphate LTA synthesis activity by about, at least about, or at most about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%, or any range derivable therein. In certain embodiments, a LtaS polypeptide is a polypeptide having, having at least, or having at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more non-contiguous or contiguous amino acids, or any range derivable therein, of an LtaS from S. aureus, and/or of SEQ ID NO:2. In particular embodiments, the LtaS polypeptide is a Staphylococcus LtaS, which may furthermore, in some embodiments, comprise the amino acid sequence of SEQ ID NO:2. In other embodiments, an LtaS polypeptide is, is at least, or is at most 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:2, or any range derivable therein.

Variants of an LtaS polypeptide may also be employed so long as the variants have glycerol-phosphate LTA synthesis activity, preferably on the order of or better than the wild-type sequence disclosed herein.

In some embodiments, the LtaS polypeptide is truncated. In some embodiments, the LtaS polypeptide comprises a soluble region. For example, a soluble region may encompass 174-646 of SEQ ID NO:2, and therefore, a comparable region from other strains or bacteria may be employed. Methods of the invention may be employed in vitro and/or in vivo. In certain embodiments, the LtaS polypeptide has been isolated. The LtaS polypeptide is recombinant in further embodiments. It is contemplated that the LtaS polypeptide may be membrane-bound in some aspects of the invention. In particular embodiments, the LtaS polypeptide is in a membrane fraction. In other embodiments, the LtaS is part of a cell. In certain embodiments, a LtaS polypeptide is in a heterologous recombinant host cell, which means the polypeptide is in a cell of a different origin than the polypeptide. For example, the LtaS polypeptide may be an S. aureus LtaS polypeptide and the heterologous host cell may be E. coli. In particular embodiments, the heterologous recombinant host cell is a gram-negative bacterium, such as E. coli, though in other embodiments, the host cell may be a gram-positive bacterium.

In methods of the invention, there may be a step of evaluating whether the polypeptide and the candidate compound interact. In certain embodiments, this involves assessing whether there is any binding, particularly specific binding, between the polypeptide and the candidate compound. In certain embodiments, this assessment may involve an antibody that recognizes LtaS or the candidate compound.

In other methods of the invention, there may be a step of comparing the levels of polyglycerol phosphate synthesis in the presence and absence of the candidate compound comprising isolating polyglycerol phosphate reaction products. Comparison may be made to a control that is performed alongside the evaluation of a particular substance or it may be made to a reference level that was previously generated.

In some embodiments of the invention, methods also involve incubating the LtaS polypeptide and/or candidate compound with a phosphatidyl glycerol (PG) substrate under conditions to allow glycerol-phosphate polymerization. Methods may also involve evaluating whether the polypeptide and the candidate compound interact. In some embodiments, this may include assessing the amount of polyglycerol phosphate synthesis in the mixture. Such an assessment can be achieved by isolating polyglycerol phosphate reaction products, such as by filtration and/or sedimentation. In other embodiments, such an assessment may involve one or more antibodies that specifically bind to polyglycerol phosphate. In further embodiments, assessing the amount of polyglycerol phosphate synthesis comprises measuring the amount of released diacylglycerol, either directly or indirectly. Diacylglycerol is phosphorylated by diacylglycerol kinase in the presence of ATP. In certain embodiments, a measurement of the amount of phosphorylated diacylglycerol can be indirectly measured by evaluating or assaying for ATP consumption by diacylglycerol kinase. In some embodiments, ATP is directly or indirectly measured to evaluate the level of LtaS inhibition. In such cases, the rate of ATP consumption is directly correlated with the level of LtaS inhibition. In some embodiments, ATP is measured indirectly by measuring the amount of a substrate or end product there is in a separate reaction that involves or requires available ATP, such as an enzymatic reaction that produces light. In certain embodiments of the invention, a candidate inhibitor is identified in an assay that indirectly measures the levels of ATP by measuring light emission, wherein a greater amount of light compared to a control is indicative of a candidate compound that acts as an LtaS inhibitor. In specific embodiments of the invention, the methods involve luciferase and a luciferase substrate such as luciferin, which will form oxyluciferin in the presence of ATP and O₂.

It is contemplated that these ways of assessing the amount of polyglycerol phosphate synthesis may be combined with one another. Moreover, assessments may involve a label or tag, which may or may not be colorimetric, enzymatic, fluorescent, or radioactive. Candidate compounds may be small molecules, nucleic acids, or proteins (peptides or polypeptides) in some embodiments. Moreover, more than one candidate compound may be evaluated at the same time, or multiple candidate compounds may be evaluated serially. In other embodiments, it is contemplated that multiple candidate compounds may be evaluated as a pool of substances. In cases of evaluating multiple substances, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000 or more substances, or any range derivable therein may be evaluating individually or together. In some embodiments, a candidate compound is contacted with the LtaS polypeptide in a multiwell plate. In further embodiments, evaluating whether the candidate compound interacts with or binds to the LtaS polypeptide is performed in a multiwell plate.

Other embodiments of the invention include exposing gram-positive bacteria to the candidate compound and evaluating the growth of the bacteria.

Candidate compounds may undergo further analysis. In some embodiments, methods may involve assessing the candidate compound in vivo. In some cases, an animal is infected with a gram-positive bacteria and the candidate compound is evaluated after it has been administered to the animal. The animal may be subsequently evaluated for the infection.

Other aspects of the invention include a recombinant host cell comprising a nucleic acid sequence encoding an LtaS polypeptide. Embodiments describing the LtaS polypeptide are applicable to host cells of the invention. In some embodiments, a recombinant host cell may be a gram-negative bacterium, while in others it is a gram- positive bacterium.

In further embodiments, a recombinant host cell expresses LtaS on its cell membrane. In additional embodiments, a recombinant host cell has a nucleic acid sequence that is under the control of a heterologous promoter. Other embodiments of the invention include an isolated polypeptide, such as an LtaS polypeptide discussed herein. In certain embodiments, the polypeptide is purified. In particular, it may be purified to about, at least about, or at most about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homogeneity. In some embodiments, the polypeptide has polyglycerol-phosphate lipotechoic acid synthase activity.

The invention further contemplates that high throughput screens may be employed to implement aspects of the invention. In some embodiments, screens are done using a multi-well plate, such as a 96- well or 384- well plate. Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well.

The embodiments in the Example section are understood to be embodiments of the invention that are applicable to all aspects of the invention.

The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive.

Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.

Following long-standing patent law, the words "a" and "an," when used in conjunction with the word "comprising" in the claims or specification, denotes one or more, unless specifically noted.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

FIG. IA-D. Expression of the S. aureus LtaS in E. coli promotes synthesis of glycerol-phosphate LTA. (A) Chemical structure of S. aureus LTA (Fischer, 1994). (B) Analysis of LTA with polyglycerol-phosphate specific monoclonal antibody. Extracts obtained from E. coli strains ANG490 (pOK12, empty vector), ANG492 (pl0/10E), ANG493 (p36/5F) and ANG491 (pOK-ltaS) were separated on SDS-PAGE, electro- transferred to PVDF membrane and subjected to immunoblotting with LTA-specific antibody. (C) Predicted membrane topology of lipoteichoic acid synthase (LtaS). (D) Separation of E. coli inner and outer membranes by sucrose density centrifugation. Isolated fractions were immunoblotted for LTA as well as PpiD (an inner membrane protein) and OmpF (an outer membrane protein). The migration of protein size standards on SDS-PAGE gels is indicated in kDa.

FIG. 2A-E. S. aureus ltaS is required for LTA synthesis and bacterial growth. (A) S. aureus ANG499, with IPTG-inducible ltaS, and (B) S. aureus ANG501, with anhydrotetracycline-inducible murG. Bacterial strains were grown overnight in the presence of appropriate antibiotics and inducer. The next day, cultures were washed, back-diluted and grown either in the presence or absence of inducer and bacterial growth was monitored by optical density measurements of staphylococcal cultures (OD₆oo). Asterisks indicate time of sample withdrawal for immunoblot analysis. Arrows indicate time of culture dilution (100-fold into fresh media) in order to sustain logarithmic growth. (Q Immunoblot analysis of membrane extracts isolated from UaS (ANG499) and murG (ANG501) strains using antibodies specific for LTA and sortase A (SrtA, loading control). The migration of protein size standards on SDS-PAGE gels is indicated in kDa. (D and E) S. aureus ANG513 (ANG499 pitet) was grown in the presence or absence of IPTG (UaS expression) and LTA was extracted from bacterial membranes. LTA was subjected to hydrophobic interaction chromatography and eluted with a linear gradient of 1-propanol (15% to 65%). Isolated fractions were subjected to (D) immunoblotting with LTA specific monoclonal antibody and subjected to (E) hydrolysis and phosphate analysis. Phosphate content was measured by absorbance at 880 ran (As₈₀).

FIG. 3. LTA is required for proper cell envelope assembly. Electron microscopy of fixed and thin sectioned samples of S. aureus ANG499 grown in the presence or absence of IPTG (inducer of ltaS expression) for 3 and 6 hours. Arrows indicate cell wall septa, whereas arrowheads point to empty cell wall envelopes without cytoplasm and nucleic acid. Bar indicates 1 μm size standard.

FIG. 4A-G. Functional complementation of ltaS depletion in S. aureus ANG499 with B. subtilis ltaS homologues. (A) Schematic representation of chromosomal organization in ltaS complementation strains. (B-F) Bacterial cultures were grown overnight in the presence of IPTG. The next day, cultures were washed and diluted in fresh medium containing anhydrotetracycline (A) (ltaS homologue inducer) or both anhydrotetracycline and IPTG (ltaS inducer) (AI). Bacterial growth was monitored by optical density measurements of staphylococcal cultures (OD₆₀o) and blotted in these graphs. (B) As a control, anhydrotetracycline induction of staphylococcal ltaS restored bacterial growth upon IPTG removal (depletion of ltaS in strain ANG514).

Anhydrotetracycline-mediated induction of (Q B. subtilis yflE (ANG516), (D) yfnl

(ANG515), (E) yqgS (ANG517) or (F) yvgJ (ANG518) was analyzed for restoration of staphylococcal growth upon IPTG removal. (G) Samples of UaS depleted cultures that had been induced with anhydrotetracycline were subjected to immunoblotting using antibodies specific for LTA and sortase A (SrtA, loading control). The migration of protein size standards on SDS-PAGE gels is indicated in kDa.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS I. Lipoteichoic acid (LTA)

S. aureus LTA is a polymer of 1-3 linked glycerol-phosphate subunits that are tethered to GIc₂-DAG (FIG. IA) (Duckworth et al, 1975; Fischer et al., 1990). This glycerol-phosphate structure is conserved in many different gram-positive bacteria including the human pathogens Bacillus anthracis, Enterococcus faecalis, Listeria monocytogenes, Streptococcus agalactiae, and Streptococcus pyogenes (Fischer et al, 1990; McCarty and Morse, 1964). Biosynthesis of LTA has been studied with in vitro experiments using isolated bacterial membranes or toluene-treated cells (Emdu and Chiu, 1975; Childs and Neuhaus, 1980). Phosphatidylglycerol (PG) was demonstrated to function as substrate for LTA synthesis (Childs and Neuhaus, 1980), whereas CDP- glycerol, a sn-glycerol-3 -phosphate and substrate for WTA assembly, cannot substitute during LTA synthesis (Ganfield and Pierginger, 1980). PG is comprised of rø-glycerol-1- phosphate linked to diacylated sn-3 glycerol isomer. While ^n-glycerol-1 -phosphate is incorporated into LTA, its diacylglycerol byproduct is successively converted to phosphatidic acid, CDP-diacylglycerol, phosphatidyl-glycerophosphate and phosphatidylglycerol, thereby completing the LTA biosynthetic cycle (Fischer, 1988).

Pulse-labeling of staphylococci with [¹⁴C]acetate revealed that the label appeared successively in GIc-DAG, GIc₂-DAG and eventually LTA (Koch et al., 1984). Pulse- labeling with [2-³H]glycerol demonstrated incorporation into PG and glycolipid anchored LTA (Koch et al., 1984). Stepwise degradation of pulse-labeled LTA from the glycerol terminus with phosphodiesterase and phosphomonoesterase revealed that the polymer chain grows distal to the lipid anchor (Cabacungan and Pierginger, 1981; Taron et al, 1983). These observations were incorporated into a unifying hypothesis whereby transfer of glycerol- 1 -phosphate from PG to GIc₂-DAG and subsequent stepwise addition of glycerol-phosphate at the distal end leads to LTA assembly possibly requiring two distinct enzymes (Fischer, 1994). YpfP and LtaA are required to synthesize and attach GIc₂-DAG glycolipid anchor to LTA, however ypfP or UaA mutants continue to assemble LTA with DAG lipid anchor moieties (Kiriukhin et al, 2001; Griindling and Schneewind, 2007). These observations are in agreement with our findings that the enzyme, herein named LTA synthase (LtaS), polymerizes polyglycerol-phosphate from phosphatidyl-glycerol substrate, a reaction that proceeds in the presence or absence of GIc₂-DAG. The mechanistic details and whether a second glycerol-phosphate transferring enzyme besides LtaS is required for LTA synthesis remain to be determined.

Disclosed in the Examples is the identification of S. aureus LTA synthase (locus tag SAV0719 in the genome of the Mu50 strain), where ltaS is required for polyglycerol- phosphate LTA synthesis and other cell envelope functions. Expression of ltaS in E. coli led to the formation of polyglycerol-phosphate polymer (FIG. 1). Following depletion of UaS in staphylococci, only minimal amounts of the phosphate-containing LTA could be detected by immunoblot determination (FIG. 2 C-E). UaS depletion also caused growth arrest of staphylococci (FIG. 3). Microscopic examination of /toS-depleted cells revealed an increase in cell size, partially thickened cell walls and aberrant placement of cell division sites (FIG. 3). A precise mechanism for the observed defects in envelope and cell division functions cannot yet be deduced from these data. Nevertheless, the proposed functions of LTA, which include scavenging of Mg²⁺ ions required for enzyme function and the proper targeting of autolysins to the bacterial envelope (Fischer et al, 1981; Cleveland et al, 1975; Lambert et al, 1977), are in agreement with the observed phenotype of UaS depletion. A single UaS gene was identified in the genome sequences of S. aureus, Streptococcus pyogenes, and Streptococcus agalactiae (data not shown). In contrast, multiple UaS homologues were found in other Gram-positive bacteria, including four homologues (Yfnl, YfIE, YqgS and YvgJ) in B. subtilis. Each of these genes can apparently be deleted without abolishing growth of mutant bacilli (Kobayashi et al, 2003), suggesting that any one UaS homologue of B. subtilis may not be required for bacterial replication. Presumably, the different UaS homologues fulfill redundant or overlapping functions in synthesizing polyglycerol-phosphate LTA. In agreement with this conjecture, we observed that two homologues, yflE and yfnl, encode glycerol- phosphate LTA synthases with at least partially overlapping function (FIG. 4). The finding that UaS depletion leads to bacterial growth arrest opens the possibility that targeted inhibition of LtaS may be used as an antibiotic therapy for S. aureus infections. LtaS displays appropriate features of drug targets as polyglycerol- phosphate LTA is not present in eukaryotic cells and specific inhibitors may abolish bacterial growth. The enzymatic domain of LtaS is thought to be displayed outside of the bacterial membranes, obviating the need for inhibitory compounds to cross bacterial membranes. Finally, because LTA is present in many gram-positive bacteria, the development of an LtaS inhibitor could lead to an antimicrobial that is effective against many different human and animal pathogens.

Previous work suspected that daptomycin, a compound in clinical use for treatment of drug-resistant S. aureus infections, may inhibit LTA synthesis (Canepari et al. , 1990), a claim that has been challenged by the finding of resistance mutations in staphylococcal genes that are not involved in LTA synthesis (Laganas et al., 2003; Friedman et al, 2006). Identification of LTA synthase now permits further testing of this hypothesis as well as screening for new inhibitors with therapeutic properties.

Using BLAST search analysis the inventors have been able to identify potential proteins that participate in polyglycerol phosphate LTA biosynthesis. They found homologues in B. anthracis strain Sterne to PgcA (BAS4790), GtaB (BAS4789), YpfP (BAS0483), LtaA (BAS0749), and four homologues to LtaS (BAS2737, BAS5081, BAS3608, and BAS 1327). The fact that B. anthracis has four homologues, which is also the case in to B. subtilis, implies that there is possibly redundancy and overlapping function. Previous studies have shown that two of the four B. subtilis homologues, YfIE and Yfhl, are able to complement LTA production in S. aureus following ltaS depletion. Only YfIE is able to complement the growth defect found following ltaS depletion in S. aureus. Recently the inventors have shown that B. anthracis is in fact able to produce LTA which can be detected with a polyglycerol phosphate monoclonal antibody. II. Gram-Positive Bacteria

In addition to applications involving S. aureus, the present invention can be applied to other gram-positive bacteria as well. Gram-positive bacteria have a cell wall structure that contains peptidoglycan, in addition to polysaccharides and/or techoic acids. There are three general classes of gram-positive bacilli: Bacillacae, Micrococcaceae and Peptococcaceae. There are three major types of gram -positive cocci: Staphylococcus, Enterococcus and Streptococcus. It is contemplated that embodiments of the invention may include or specifically exclude any classes of bacteria disclosed below.

A. Bacillacae

The Bacillacae are non-acid fast straight rod-shaped bacteria that are capable of forming spores. Some are motile, by virtue of peritrichous flagellae. They include aerobes, facultative anaerobes, and strict anaerobes and are generally non-halophylic with a wide growth range depending on the group. The biochemical actions seen in this family include fermentation and proteolytic activity. Some species can fix nitrogen, and a number of them also produce specific toxins. Bacillus is the type genus. The two main genera are Bacillus and Clostridium. Bacillus: These are peritrichoulsly flagellated, form ellipsoidal or spherical, endospores, which may or may not swell the sporangium. They are aerobic to facultatively anaerobic and generally catalase-positive. There are currently very many species in this genus, including, B. anthracis, B. azotoformans, B. cereus, B. coagulans, B. israelensis, B. larvae, B. mycoides, B. polymyxa, B. pumilis, B. stearothormophillus, B. subtilis, B. thuringiensis and B. validus. Other genera include Sporolactobacilli, Sporocarcina, Filibacter and Caryophanum.

Clostridium: An inability to grow in air is the characteristic of this group, although some may tolerate it. Clostridium has many species, including psychrophilic, mesophilic or thermophilic members. They are generally gram-positive with peritrichous flagellation, and can degrade organic materials. Acids, such as butyric acid, are a frequent product of fermentation by these organisms. They can form ellipsoidal or spherical, endospores. They tend to be grouped into saccharolytic or proteolytic species, but some are both.

Saccharolytic species include Cl. aerotolerans, Cl. aurantibutyricum, Cl. beijerinckii, Cl. botulinum B, E, F*, Cl. butyricum, Cl. chauvoei, Cl.difficile, Cl. intestinale, Cl. novyi A, Cl. pateurianum, Cl. saccharolyticum, CL septicum, Cl. thermoaceticum, and Cl. thermosaccharolyticum. The proteolytic species include: Cl. argeninense, Cl. ghoni, Cl. limosum, Cl.putrefaciens, Cl. subterminale and Cl. tetani. The proteolytic and saccharolytic species include Cl. acetobutylicum, Cl. bifermenans,

Cl. botulinum A, B, F (prot.)*, Cl. botulinum C,D*, Cl. cadaveris, Cl. haemolyticum, Cl. novyi B₁C, * CL perfringens, Cl. putrefaciens, Cl. sordelli and Cl.sporogenes. The specialist species include Cl. acidiuήci, Cl. irregularis, CL kluyveri, Cl. oxalicum, CL propionicum, CL sticklandii and CL villosum. Cl. botulinum is subdivided into a number of types according to the serological specificities of the toxins produced. These specificities are based on neutralisation studies (*other Clostridium species that produce botulinum toxins). B. Micrococcoceae

These are gram-positive, non-sporing non-acid fast cocci. They generally occur in tetrads (groups of four) or clusters and are not motile. They are generally aerobes and produce catalase. Carotenoid pigments are produced by most species. Most will grow on bacteriological media such as nutrient agar at 37°C except some psychro tropic and halophyllic species which require cooler temperatures or 5% NaCl. There are only two genera in this family; Arthrobacter and Micrococcus. The genera Staphylococcus and

Planococcus which were once considered part of this family are now excluded, due to marked differences in DNA base composition, cell wall, fatty acids and other compositions.

Arthrobacter: This group includes two species - the A. globiformis/A. citreus group and the A. nicotianae group - based on differences in cell wall structure. They are important soil organisms and the most common isolates on aerobic primary isolation media.

Micrococcus: This genus has nine species, of which M. luteus, M. lylae, M. roseus are most studied. M. agilis differs from other species in being motile, psychrophilic and producing beta-galactosidase. M. kristinae can ferment glucose anaerobically and M. halobius requires at least 5% NaCl for growth.

C. Peptococcocaceae

These are gram-positive, non-acid fast cocci that do not form spores. They are strict anaerobes and are generally non-halophylic with a wide growth range. Many metabolize peptones and amino acids, and some require fermentable carbohydrates. The family includes fermenters, indole producers, nitrate reducers, urease producers, and those that express coagulase or catalase activity. Peptococcus is the type genus, and other genera include Peptostreptococcus, Sarcina and Coprococcus.

Peptococcus: Including only one species, P. niger, the cocci are arranged as diplococci, irregular clumps or regular clusters. They are anaerobic and w-caproic acid and butyric acid are the main metabolic products. Peptostreptococcus: This genus has three groups. Ps. anaerobius is the only representative of one group. It is similar to P. niger, but grows confluently on commercial media and forms short chains. The other two groups form clumps and clusters, while some species form diplococci. Each group includes about five-six species, which are differentiated on their morphology and biochemical reactions including fermentation, reduction of nitrate, production of indole, urease, coagulase or catalase, etc.

Other genera include Ruminococcus, Sarcina, and Coprococcus. D. Streptococcus

Streptococci are spheroidal bacteria in the family Streptococcaceae. The term streptococcus ("twisted berry") refers to the bacteria's characteristic grouping in chains resembling a string of beads. Streptococci can also be classified by the type of carbohydrate contained in the cell wall, a system called the Lancefield classification.

Streptococcus pyogenes: Group A S. pyogenes species of streptococci cause rheumatic fever, scarlet fever, erysipelas, strep throat, tonsillitis, and other upper respiratory infections. In common practice Streptococcus group A is usually found in samples from the throat, nasopharanyx, or in sputum in which a plethora of unimportant normal flora are also present. Its characteristic type of hemolysis is key for detection. If there is an area of clear ("beta") hemolysis, the possibility of the presence of group A organisms exists, although the same type of hemolysis pattern may also be exhibited by some other organisms such as some gram-negative rods which may also be present. Immunofluorescence can be used to confirm the group A diagnosis.

Streptococcus agalactiae: Group B is the most common cause of sepsis (blood infection) and meningitis (infection of the fluid and lining surrounding the brain) in newborns. Group B Streptococcus (GBS) is a frequent cause of newborn pneumonia and is more common than other, better known, newborn problems such as rubella, congenital syphilis, and spina bifida. One of every 20 babies with GBS disease dies from infection. Babies that survive, particularly those who have meningitis, may have long-term problems, such as hearing or vision loss or learning disabilities. In pregnant women, GBS can cause bladder infections, womb infections (amnionitis, endometritis), and stillbirth. Among men and among women who are not pregnant, the most common diseases caused by GBS are blood infections, skin or soft tissue infections, and pneumonia. Approximately 20% of men and nonpregnant women with GBS disease die of the disease. Adults can carry GBS in the bowel, vagina, bladder, or throat. People who carry GBS typically do so transiently.

GBS disease is diagnosed when the bacterium is grown from cultures of sterile body fluids, such as blood or spinal fluid. Cultures take a few days to complete. GBS infections in both newborns and adults are usually treated with i.v. antibiotics.

Streptococcus mutans is part of the normal mouth flora and is responsible for cavities. A vaccine is thought possible for Streptococcus mutans for the prevention of cavities.

E. Staphylococcus

Staphylococcus aureus (literally "Golden Cluster Seed") is the most common cause of staph infections. It is a spherical bacterium, frequently living on the skin or in the nose of a person. S. aureus is a gram-positive coccus, which appears as grape-like clusters when viewed through a microscope and has large, round, golden- yellow colonies, often with hemolysis, when grown on blood agar plates. S. aureus is a facultative anaerobe and opportunistic pathogen. S. aureus is catalase positive (meaning that it can produce the enzyme "catalase") and able to convert hydrogen peroxide (H₂O₂) to water and oxygen, which makes the catalase test useful to distinguish staphylococci from enterococci and streptococci. A large percentage of S. aureus can be differentiated from most other staphylococci by the coagulase test: S. aureus is primarily coagulase-positive (meaning that it can produce the enzyme "coagulase" that causes clot formation) while most other Staphylococcus species are coagulase-negative. However, while the majority of S. aureus are coagulase-positive, some may be atypical in that they do not produce coagulase. Approximately 20-30% of the general population are "staph carriers". Staphylococcus aureus can cause a range of illnesses from minor skin infections, such as pimples, impetigo (may also be caused by Streptococcus pyogenes), boils, cellulitis folliculitis, furuncles, carbuncles, scalded skin syndrome and abscesses, to life- threatening diseases, such as pneumonia, meningitis, osteomyelitis endocarditis, Toxic shock syndrome (TSS), and septicemia. Its incidence is from skin, soft tissue, respiratory, bone, joint, endovascular to wound infections. It is still one of the four most common causes of nosocomial infections, often causing postsurgical wound infections.

Staphylococcus epidermidis (coagulase-negative) appears as white colonies on sheep blood agar plates. Like S. aureus, S. epidermidis is a normal inhabitant of the skin, but it is considered the lesser of the two in terms of virulence. Infections by S. epidermidis, S. haemolyticus, and S. hominis, the latter two also being coagulase negative, are associated with infections of intravascular devices (prosthetic heart valves and intra-arterial or intravenous lines), shunts and prosthetic joints, wound infections, osteomyelitis associated with foreign bodies, and endocarditis. Another clinically significant species is S. saprophyticus. F. Enterococcus

Enterococcus is a genus of lactic acid bacteria of the phylum Firmicutes. Members of this genus were classified as Group D Streptococcus until 1984 when genomic DNA analysis indicated that a separate genus classification was appropriate. Enterococci are gram-positive cocci which often occur in pairs (diplococci) and are difficult to distinguish from Streptococci on physical characteristics alone. Two species are common commensal organisms in the intestines of humans: E. faecalis (90-95%) and E. faecium (5-10%). Enterococci are facultative anaerobic organisms, i.e. they prefer the use of oxygen, but they can survive in the absence of oxygen.^¹ They typically exhibit gamma-hemolysis on sheep's blood agar. Important clinical infections caused by Enterococcus include urinary tract infections, bacteremia, bacterial endocarditis, diverticulitis, and meningitis.

III. Screening Methods The present invention includes methods and compositions concerning screening for antibacterial agents. These aspects of the invention involve using the pathogen's ability to synthesize glycerol-phosphate LTA to identify those agents that may inhibit bacteria that have LTA in their cell wall. In embodiments of the invention, screening methods involve employing LtaS. Agents that modulate LtaS's LTA synthesis activity are candidate anti-bacterial agents {i.e., antibiotics). One generally will determine the activity of LtaS in the presence and absence of the candidate compound, wherein a candidate antibacterial agent is defined as any agent that inhibits, reduces, or attenuates LtaS's LTA synthesis activity. Thus, it is contemplated that the agent will reduce LTA synthesis, and thus, bacteria growth. It is contemplated that this ability may be assayed directly in methods of the invention or that it may be assayed indirectly using an indicator of that activity.

The present invention comprises methods for identifying negative modulators of LTA synthesis activity in the context of a gram-positive bacteria. Candidate compounds are employed in initial screens to identify such modulators. For example, a method generally comprises:

(a) providing a candidate compound;

(b) admixing the candidate compound with an isolated LtaS or cell expressing LtaS;

(c) measuring one or more characteristics of the LtaS or cell in step (b); and (d) comparing the characteristic measured in step (c) with the characteristic of

LtaS or cell in the absence of the candidate compound, wherein a difference that represents a reduction or decrease between the measured characteristics indicates that the candidate compound is, indeed, a negative modulator of LtaS or cell expressing LtaS. Assays may be conducted in cell free systems, in cells, or in organisms including transgenic animals. It will, of course, be understood that all the screening methods of the present invention are useful in themselves notwithstanding the fact that effective candidates may not be found. The invention provides methods for screening for such candidates, not solely methods of finding them. A. Candidate Compounds

Embodiments of the invention involve a screening assay in which candidate compounds are screened. As used herein the term "candidate compound" refers to any agent or substance that may inhibit or decrease LTA synthesis activity in a pathogen that requires LTA. It is contemplated that the candidate compound is not simply any compound but one that conceivably and reasonably is a candidate agent under the conditions of the screening assay. A "candidate antibiotic" refers to a substance that exhibits an ability to inhibit or decrease LTA synthesis activity, particularly activity mediated by LtaS. Such agents may undergo further screening assays. In certain embodiments, assays may be conducted where the candidate compounds that are screened are specifically chosen based on either the structure of LtaS and/or the structure of the agent. Consequently, assays may be used to focus on particular classes of compounds selected with an eye towards structural attributes that are believed to make them more likely to inhibit the function of an LTA synthase enzyme. Alternatively, agents may be screened relatively randomly — for example, irrespective of structural attributes. These assays may comprise screening of large libraries of random candidate substances.

In general, LtaS inhibitory agents can be identified from large libraries of both natural product or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. The screening method of the present invention is appropriate and useful for testing compounds from a variety of sources for possible antibacterial activity. The initial screens may be performed using one or more diverse libraries of compounds, but the method is suitable for a variety of other compounds and compound libraries. Such compound libraries can be combinatorial libraries, natural product libraries, or other small molecule libraries. In addition, compounds from commercial sources can be tested, as well as commercially available analogs of identified inhibitors.

For example, those skilled in the field of drug discovery and development understand that the precise source of test agents is not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available from Brandon Associates (Merrimack, N.H.) and Aldrich Chemical (Milwaukee, Wis.). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, FIa.), and PharmaMar, U.S.A. (Cambridge, Mass.). hi addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction, chromatographic, and/or fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods.

In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication {e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their antibacterial activity should be employed whenever possible.

The candidate compound may be a protein or fragment thereof, a small molecule, or even a nucleic acid molecule. An example of pharmacological compounds are compounds that are structurally related to a substrate of LTA synthesis or other molecules that may fit into the active site of the protein. Alternatively, another example is a compound that binds to LtaS protein, such as an antibody. Using lead compounds to help develop improved compounds is known as "rational drug design" and includes not only comparisons with known inhibitors, but predictions relating to the structure of target molecules.

The goal of rational drug design is to produce structural analogs of biologically active polypeptides or target compounds. By creating such analogs, it is possible to fashion drugs, which are more active or stable than the natural molecules, which have different susceptibility to alteration or which may affect the function of various other molecules. In one approach, one would generate a three-dimensional structure for a target molecule, or a fragment thereof. This could be accomplished by x-ray crystallography, computer modeling or by a combination of both approaches. In some embodiments, one may simply generate or acquire, such as from various commercial sources, small molecule libraries that are believed to meet the basic criteria for useful drugs in an effort to "brute force" the identification of useful compounds. Screening of such libraries, including combinatorially generated libraries (e.g., peptide libraries), is a rapid and efficient way to screen large number of related (and unrelated) compounds for activity. Combinatorial approaches also lend themselves to rapid evolution of potential drugs by the creation of second, third and fourth generation compounds modeled of active, but otherwise undesirable compounds.

Test agents may include fragments or parts of naturally-occurring compounds, or may be found as active combinations of known compounds, which are otherwise inactive.

It is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It will be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Thus, it is understood that the candidate substance identified by the present invention may be peptide, polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known inhibitors or stimulators.

Other suitable modulators include antisense molecules, ribozymes, and antibodies (including single chain antibodies), each of which would be specific for the target molecule (LtaS protein or UaS nucleic acid). Such compounds are well known to those of skill in the art. For example, an antisense molecule that bound to a translational or transcriptional start site, or splice junctions, would be ideal candidate compounds.

In addition to the modulating compounds initially identified, the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the structure of the modulators. Such compounds, which may include peptidomimetics of peptide modulators, may be used in the same manner as the initial modulators.

A test or candidate compound according to the present invention may be one that exerts its inhibitory effect upstream, downstream or directly on LtaS. Regardless of the type of inhibitor identified by the present screening methods, the effect of the inhibition by such a compound will result in an alteration in LTA synthesis as compared to that observed in the absence of the added candidate compound.

Because many of the compounds in libraries such as combinatorial and natural products libraries, as well as in natural products preparations, are not characterized, the screening methods of this invention provide novel compounds which are active as inhibitors or inducers in the particular screens, in addition to identifying known compounds which are active in the screens. Therefore, this invention includes such novel compounds, as well as the use of both novel and known compounds in pharmaceutical compositions and methods of treating a subject infected with a gram-positive pathogen that requires LTA or at risk for infection by such a pathogen.

A technique for high throughput screening of compounds is described in WO 84/03564. Large numbers of small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. Bound polypeptide is detected by various methods.

B. Arrays and Microarrays

To evaluate the efficacy of an agent that binds to or inhibits LtaS expression or activity, for example, a number of high throughput assays may be utilized. For example, to enable mass screening of large quantities of natural products, extracts, or compounds in an efficient and systematic fashion, multiple aliquots of LtaS may be exposed to a library. In certain embodiments, an array or microarray may be implemented.

The present methods and kits may be employed for high volume screening. A library of RNA or DNA can be created using methods and compositions of the invention. This library may then be used in high throughput assays, including microarrays. Specifically contemplated by the present inventors are chip-based nucleic acid technologies such as those described by Hacia et al. (1996) and Shoemaker et al. (1996). Briefly, these techniques involve quantitative methods for analyzing large numbers of genes rapidly and accurately. By using fixed probe arrays, one can employ chip technology to segregate target molecules as high density arrays and screen these molecules on the basis of hybridization (see also, Pease et al., 1994; and Fodor et al, 1991). The term "array" as used herein refers to a systematic arrangement of nucleic acid. For example, a nucleic acid or other amino acid population that is representative of a desired source is divided up into the minimum number of pools in which the screening procedure can be utilized to identify a candidate substance and which can be distributed into a single multi-well plate. Arrays may be of an aqueous suspension of a nucleic acid population obtainable from a desired mRNA source, comprising: a multi-well plate containing a plurality of individual wells, each individual well containing an aqueous suspension of a different content of a nucleic acid population. However, the use of arrays is not intended to be limited to nucleic acids. Examples of arrays, their uses, and implementation of them can be found in U.S. Pat. Nos. 6,329,209, 6,329,140, 6,324,479, 6,322,971, 6,316,193, 6,309,823, 5,412,087, 5,445,934, and 5,744,305, which are herein incorporated by reference.

Microarrays are known in the art and consist of a surface to which probes (e.g., cDNAs, mRNAs, cRNAs, polypeptides, and fragments thereof) can be specifically hybridized or bound at a known position. In one embodiment, the microarray is an array (i.e., a matrix) in which each position represents a discrete binding site for a product encoded by a gene (e.g., a protein or RNA), and in which binding sites are present for products of most or almost all of the genes in the organism's genome. In a preferred embodiment, the "binding site" (hereinafter, "site") is a nucleic acid or nucleic acid analogue to which a particular cognate cDNA can specifically hybridize. The nucleic acid or analogue of the binding site can be, e.g., a synthetic oligomer, a full-length cDNA, a less-than full length cDNA, or a gene fragment.

The probes are attached to a solid support, which may be made from glass, plastic (e.g., polypropylene, nylon), polyacrylamide, nitrocellulose, or other materials. A preferred method for attaching the probes to a surface is by printing on glass plates, as is described generally by Schena et αl., 1995a. See also DeRisi et αl., 1996; Shalon et αl., 1996. Other methods for making microarrays, e.g., by masking (Maskos et αl., 1992), may also be used. In principal, any type of array, for example, dot blots on a nylon hybridization membrane (see Sambrook et αl., 2001, which is incorporated in its entirety for all purposes), could be used, although, as will be recognized by those of skill in the art, very small arrays will be preferred because hybridization volumes will be smaller. Use of a biochip is also contemplated, which involves the hybridization of a labeled molecule or pool of molecules to the targets immobilized on the biochip.

Representative methods and apparatus for preparing a microarray have been described, for example, in U.S. Patent Nos. 5,143,854; 5,202,231; 5,242,974; 5,288,644; 5,324,633; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,432,049; 5,436,327;

5,445,934; 5,468,613; 5,470,710; 5,472,672; 5,492,806; 5,525,464; 5,503,980; 5,510,270;

5,525,464; 5,527,681; 5,529,756; 5,532,128; 5,545,531; 5,547,839; 5,554,501; 5,556,752;

5,561,071; 5,571,639; 5,580,726; 5,580,732; 5,593,839; 5,599,695; 5,599,672;

5,610;287; 5,624,711; 5,631,134; 5,639,603; 5,654,413; 5,658,734; 5,661,028; 5,665,547; 5,667,972; 5,695,940; 5,700,637; 5,744,305; 5,800,992; 5,807,522; 5,830,645;

5,837,196; 5,871,928; 5,847,219; 5,876,932; 5,919,626; 6,004,755; 6,087,102; 6,368,799;

6,383,749; 6,617,112; 6,638,717; 6,720,138, as well as WO 93/17126; WO 95/11995;

WO 95/21265; WO 95/21944; WO 95/35505; WO 96/31622; WO 97/10365; WO

97/27317; WO 99/35505; WO 09923256; WO 09936760; WO0138580; WO 0168255; WO 03020898; WO 03040410; WO 03053586; WO 03087297; WO 03091426;

WO03100012; WO 04020085; WO 04027093; EP 373 203; EP 785 280; EP 799 897 and

UK 8 803 000; the disclosures of which are all herein incorporated by reference.

It is contemplated that the arrays can be high density arrays, such that they contain 100 or more different probes. It is contemplated that they may contain 1000, 16,000, 65,000, 250,000 or 1,000,000 or more different probes. The probes can be directed to targets in one or more different organisms. The oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, or 15 to 40 nucleotides in length in some embodiments. In certain embodiments, the oligonucleotide probes are 20 to 25 nucleotides in length.

The location and sequence of each different probe sequence in the array are generally known. Moreover, the large number of different probes can occupy a relatively small area providing a high density array having a probe density of generally greater than about 60, 100, 600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 different oligonucleotide probes per cm². The surface area of the array can be about or less than about 1, 1.6, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cm². Moreover, a person of ordinary skill in the art could readily analyze data generated using an array. Such protocols are disclosed above, and include information found in WO 9743450; WO 03023058; WO 03022421; WO 03029485; WO 03067217;

WO 03066906; WO 03076928; WO 03093810; WO 03100448 Al, all of which are specifically incorporated by reference.

C. In Vitro Screening Methods

In some embodiments of the invention, a screening method is performed in vitro. A quick, inexpensive and easy assay to run is an in vitro assay. Such assays generally use isolated molecules, can be ran quickly and in large numbers, thereby increasing the amount of information obtainable in a short period of time. A variety of vessels may be used to ran the assays, including test tubes, plates, dishes and other surfaces such as dipsticks or beads. It is contemplated that the term "in vitro" is used according to its ordinary and plain meaning in the field of molecular biology. The term in vitro screening covers screening using isolated cells such as tissue culture cells and cell-free systems. In certain embodiments, the screening method involves an LtaS protein or peptide isolated away from a cell, in which the activity of the protein is monitored in the presence of one or more candidate compounds to evaluate any effect on the activity. As a control, the protein may be monitored in the absence of the candidate compound(s), however, this is not required each time the assay is performed. It is contemplated that in some embodiments, one may compare the activity of the protein in the presence of the candidate compound to a standard for the protein's activity in the absence of the candidate compound.

The present invention also concerns methods in which the protein is not isolated away from the cell. In these embodiments, a pathogen that requires LTA synthesis is employed. A candidate compound is incubated with the pathogen and any effect on growth is evaluated. As discussed above, growth of the pathogen in the absence of the candidate compound may be monitored under the same or similar circumstances in parallel with the screen to serve as a negative and comparative control, though this is not required. One may either refer to previously obtained results in this respect or a standard, or one may simply observe a lack of growth or observe a reduction in growth from what is expected.

In some embodiments a crude extract is found to have antibacterial activity, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having antibacterial activity. Methods of fractionation and purification of such heterogenous extracts are known in the art. If desired, compounds shown to be useful agents for the treatment of bacterial infection are chemically modified according to methods known in the art.

In certain embodiments, intact cells are not involved in the screening methods. One example of a cell free assay is a binding assay. While not directly addressing function, the ability of a modulator to bind to a target molecule in a specific fashion is strong evidence of a related biological effect. For example, binding of a molecule to a target may, in and of itself, be inhibitory, due to steric, allosteric or charge-charge interactions. The target may be either free in solution, fixed to a support, expressed in or on the surface of a cell. Either the target or the compound may be labeled, thereby permitting determination of binding. Usually, the target will be the labeled species, decreasing the chance that the labeling will interfere with or enhance binding. Competitive binding formats can be performed in which one of the agents is labeled, and one may measure the amount of free label versus bound label to determine the effect on binding.

In other in vitro screening methods, intact cells containing a LtaS protein are used. The test cells may be cultured under standard conditions of temperature, incubation time, optical density, plating density and media composition corresponding to the nutritional and physiological requirements of the bacteria. However, conditions for maintenance and growth of the test cell may be different from those for assaying test agents and candidate substances in the screening methods of the invention. Modified culture conditions and media may be used to facilitate detection of the expression of a reporter molecule. Any techniques known in the art may be applied to establish the optimal conditions.

Test cell strains, cell cultures, cell lines generated by the above-described methods for the screening assays may be expanded, stored and retrieved by any techniques known in the art that is appropriate to the test cell. For example, the test cells used in methods of the invention can be preserved by stab culture, plate culture, or in glycerol suspensions and cryopreserved in a freezer (at -20°C. to -100°C) or under liquid nitrogen (-176⁰C to -196°C).

D. In Vivo Screening Methods Screening methods of the invention can also be performed in vivo, for example, in an appropriate animal model. Appropriate animals include mammals that are susceptible to infection by a pathogen that requires LTA synthesis. It is contemplated that an animal may be infected with the pathogen and the ability of a test agent or candidate agent may be assessed in the infected animal and/or animal to be infected. In particular embodiments, the animal model is a mouse. In certain embodiments, the agent is tested for antibacterial activity after the agent has been tested for an ability to reduce or eliminate the activity of a LtaS protein. Antibacterial activity may be evaluated by a number of ways known to those of ordinary skill in the art, including by evaluating bacteria from the animal in an in vitro culture system as discussed in the Examples. IV. Proteinaceous and Nucleic Acid Compositions

The present invention concerns LtaS proteins that can synthesize glycerol- phosphate LTA. The teachings described below provide various protocols, by way of example, of implementing methods and compositions of the invention. They provide background for generating LtaS proteins, including through the use of recombinant DNA technology.

A. Proteinaceous Compositions

LtaS proteins are employed in screening assays of the invention. In certain embodiments, the protein is from S. aureus. As used herein, a "protein" or "polypeptide" refers to a molecule comprising amino acid residues. In some embodiments, a wild-type version of a protein or polypeptide are employed, however, in some embodiments of the invention, a variant of a LtaS is employed. The term "polypeptide" refers to a single molecule containing amino acid residues. The term protein refers to one or more polypeptides that collectively are capable of performing one or more functions or activities, such as synthesizing LTA.

In certain embodiments the size of polypeptide may comprise, comprise at least, or comprise at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000, 2250, 2500 or greater amino molecule residues, and any range derivable therein. It is contemplated that polypeptides may be mutated by truncation or deletion rendering them shorter than their corresponding wild-type form. It is contemplated that such lengths may apply to any of SEQ ID NO:2 or SAV0719, which is hereby incorporated by reference. Proteins may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides or peptides through standard molecular biological techniques, the isolation of proteins from natural sources, or the chemical synthesis of proteins. The nucleotide and protein, polypeptide and peptide sequences for various genes for other LtaS proteins not disclosed herein may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases (World Wide Web at ncbi.nlm.nih.gov/). The coding regions for these known genes may be amplified and/or expressed using the techniques disclosed herein or as would be known to those of ordinary skill in the art. 1. Functional Aspects

When the present application refers to the function or activity of LtaS proteins or polypeptides, it is meant to refer to the activity or function of that protein or polypeptide under physiological conditions, unless otherwise specified. It will be understood that a "LtaS protein" or "LtaS polypeptide" necessarily has LTA synthesis activity.

Determination of which molecules possess this activity may be achieved using assays familiar to those of skill in the art. hi particular embodiments of the invention, an LtaS polypeptide has homology to a sequence disclosed herein. In certain embodiments, polypeptides of an LtaS protein of the invention can have, have at least, or have at most 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100%, or any range derivable therein, homology to SEQ ID NO:2. A polypeptide molecule has "homology" or is considered "homologous" to a second polypeptide molecule if one or more of the following "homology criteria" is met: 1) at least 20% of the proteinaceous molecule has sequence identity with the second proteinaceous molecule with possible gaps of nonidentical residues between identical residues; or, 2) there is some sequence identity at the same positions with the second proteinaceous molecule and at the nonidentical residues, at least 20% of them are conservative differences, as described herein, with respect to the second proteinaceous molecule. It is further contemplated that an LtaS homolog will have LTA synthesis activity. As used herein, the term "homologous" may equally apply to a region of a proteinaceous molecule, instead of the entire molecule. If it applies to the entire molecule and the molecule satisfies the definition of having homology above, it is a "homolog" of that second polypeptide molecule, such as of LtaS from S. aureus. Homologs of SEQ ID NOs are contemplated as part of the invention. If the term "homology" or "homologous" is qualified by a number, for example, "50% homology" or "50% homologous," then the homology criteria, with respect to 1) and 2) is adjusted from "at least 30%" to "at least 50%."

2. Variants of LtaS Polypeptides

Amino acid sequence variants of the polypeptides of the present invention can be substitutional, insertional or deletion variants. A mutation in a gene encoding an LtaS may affect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more non-contiguous or contiguous amino acids of the polypeptide, as compared to wild-type; however, the polypeptide's use in screening methods of the invention will allow for those variants that have LTA synthesis activity ("LtaS variants"). In certain embodiments, LtaS proteins comprise one or more polypeptides having, having at least, or having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more non-contiguous or contiguous amino acids, or any range derivable therein, of a LtaS, or SEQ ID NO:2.

Deletion variants lack one or more residues of the native or wild-type protein. A stop codon may be introduced (by substitution or insertion) into an encoding nucleic acid sequence to generate a truncated protein. Insertional variants typically involve the addition of material at a non-terminal point in the polypeptide. Terminal additions, called fusion proteins, may also be generated.

Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide, with or without the loss of other functions or properties. Substitutions may be conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions (or "differences") are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Alternatively, substitutions may be non-conservative such that a function or activity of the polypeptide is affected. Non-conservative changes typically involve substituting a residue with one that is chemically dissimilar, such as a polar or charged amino acid for a nonpolar or uncharged amino acid, and vice versa.

The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids (see Table 1, below).

TABLE 1 Codon Table

Amino Acids Codons

Alanine Ala A GCA GCC GCG GCU

Cysteine Cys C UGC UGU

Aspartic acid Asp D GAC GAU

Glutamic acid GIu E GAA GAG

Phenylalanine Phe F UUC UUU

Glycine GIy G GGA GGC GGG GGU

Histidine His H CAC CAU

Isoleucine lie I AUA AUC AUU

Lysine Lys K AAA AAG

Leucine Leu L UUA UUG CUA CUC CUG CUU

Methionine Met M AUG

Asparagine Asn N AAC AAU

Proline Pro P CCA CCC CCG CCU

Glutamine GIn Q CAA CAG

Arginine Arg R AGA AGG CGA CGC CGG CGU

Serine Ser S AGC AGU UCA UCC UCG UCU

Threonine Thr T ACA ACC ACG ACU

Valine VaI V GUA GUC GUG GUU

Tryptophan Trp W UGG

Tyrosine Tyr Y UAC UAU

It also will be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5 ' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes. The following is a discussion based upon changing of the amino acids of a protein to create an equivalent, or even an improved, second-generation molecule. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and in its underlying DNA coding sequence, and nevertheless produce a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of genes without appreciable loss of their biological utility or activity, as discussed below. Table 1 shows the codons that encode particular amino acids.

In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine *-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ±2 is contemplated, those that are within ±1 are also contemplated, in addition to those within ±0.5.

As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substiruents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

4. Protein Purification It may be desirable to purify an LtaS polypeptide, or variants thereof, (as well as a test or candidate compound or an antivirulence agent that is a protein). Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion- exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. A particularly efficient method of purifying peptides is fast protein liquid chromatography or even HPLC.

Certain aspects of the present invention may involve the purification, and in particular embodiments, the substantial purification, of an encoded protein or peptide.

The term "purified protein or peptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state. A purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.

Generally, "purified" will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity. Where the term "substantially purified" is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition. Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. A preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number." The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity. Various techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite and affinity chromatography; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide.

There is no general requirement that the protein or peptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified products will have utility in certain embodiments. Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. For example, it is appreciated that a cation-exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater "-fold" purification than the same technique utilizing a low pressure chromatography system. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein.

It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS/PAGE (Capaldi et al, 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary.

High Performance Liquid Chromatography (HPLC) is characterized by a very rapid separation with extraordinary resolution of peaks. This is achieved by the use of very fine particles and high pressure to maintain an adequate flow rate. Separation can be accomplished in a matter of minutes, or at most an hour. Moreover, only a very small volume of the sample is needed because the particles are so small and close-packed that the void volume is a very small fraction of the bed volume. Also, the concentration of the sample need not be very great because the bands are so narrow that there is very little dilution of the sample.

Gel chromatography, or molecular sieve chromatography, is a special type of partition chromatography that is based on molecular size. The theory behind gel chromatography is that the column, which is prepared with tiny particles of an inert substance that contain small pores, separates larger molecules from smaller molecules as they pass through or around the pores, depending on their size. As long as the material of which the particles are made does not adsorb the molecules, the sole factor determining rate of flow is the size. Hence, molecules are eluted from the column in decreasing size, so long as the shape is relatively constant. Gel chromatography is unsurpassed for separating molecules of different size because separation is independent of all other factors such as pH, ionic strength, temperature, etc. There also is virtually no adsorption, less zone spreading and the elution volume is related in a simple matter to molecular weight.

Affinity Chromatography is a chromatographic procedure that relies on the specific affinity between a substance to be isolated and a molecule that it can specifically bind to. This is a receptor-ligand type interaction. The column material is synthesized by covalently coupling one of the binding partners to an insoluble matrix. The column material is then able to specifically adsorb the substance from the solution. Elution occurs by changing the conditions to those in which binding will not occur (e.g., alter pH, ionic strength, and temperature). A particular type of affinity chromatography useful in the purification of carbohydrate containing compounds is lectin affinity chromatography. Lectins are a class of substances that bind to a variety of polysaccharides and glycoproteins. Lectins are usually coupled to agarose by cyanogen bromide. Conconavalin A coupled to Sepharose was the first material of this sort to be used and has been widely used in the isolation of polysaccharides and glycoproteins other lectins that have been include lentil lectin, wheat germ agglutinin which has been useful in the purification of N-acetyl glucosaminyl residues and Helix pomatia lectin. Lectins themselves are purified using affinity chromatography with carbohydrate ligands. Lactose has been used to purify lectins from castor bean and peanuts; maltose has been useful in extracting lectins from lentils and jack bean; N-acetyl-D galactosamine is used for purifying lectins from soybean; N-acetyl glucosaminyl binds to lectins from wheat germ; D-galactosamine has been used in obtaining lectins from clams and L-fucose will bind to lectins from lotus.

The matrix should be a substance that itself does not adsorb molecules to any significant extent and that has a broad range of chemical, physical and thermal stability. The ligand should be coupled in such a way as to not affect its binding properties. The ligand also should provide relatively tight binding. And it should be possible to elute the substance without destroying the sample or the ligand. One of the most common forms of affinity chromatography is immuno affinity chromatography. The generation of antibodies that would be suitable for use in accord with the present invention is discussed below. It is contemplated that protein purification may be combined with recombinant DNA technology to purify an LtaS protein. For example, a nucleic acid sequence encoding a tag may be placed within a nucleic acid sequence encoding the LtaS protein. The tag could be an antigen or other motif that allows for binding, such as a histidine tag. B. Polynucleotides Encoding Polypeptides with LTA Synthesis Activity

The present invention concerns polynucleotides, isolatable from cells, which are capable of expressing all or part of a protein or polypeptide, such as an LtaS polypeptide (or a test or candidate compound or an antivirulent agent).

In some embodiments of the invention, a LtaS protein is generated from recombinant or non-recombinant nucleic acid. Recombinant proteins can be purified from expressing cells to yield active proteins.

As used herein, the term "DNA segment" refers to a DNA molecule that has been isolated free of total genomic DNA of a particular species. Therefore, a DNA segment encoding a polypeptide refers to a DNA segment that contains wild-type, polymorphic, or mutant polypeptide-coding sequences yet is isolated away from, or purified free from, total mammalian or human genomic DNA. Included within the term "DNA segment" are a polypeptide or polypeptides, DNA segments smaller than a polypeptide, and recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like. As used in this application, the term "LtaS polynucleotide" refers to a nucleic acid molecule encoding an LtaS polypeptide that has been isolated free of total genomic nucleic acid. The term "cDNA" is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy.

It also is contemplated that a particular polypeptide from a given species may be represented by natural variants that have slightly different nucleic acid sequences but, nonetheless, encode the same protein (see Table 1 above). Similarly, a polynucleotide comprising an isolated or purified wild-type or mutant polypeptide gene refers to a DNA segment including wild-type or mutant polypeptide coding sequences and, in certain aspects, regulatory sequences, isolated substantially away from other naturally occurring genes or protein encoding sequences. In this respect, the term "gene" is used for simplicity to refer to a functional protein, polypeptide, or peptide-encoding unit (including any sequences required for proper transcription, post-translational modification, or localization). As will be understood by those in the art, this functional term includes genomic sequences, cDNA sequences, and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid encoding all or part of polypeptides disclosed herein may contain a contiguous nucleic acid sequence encoding all or a portion of such a polypeptide of the following lengths: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1095, 1100, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 9000, 10000, or more nucleotides, nucleosides, or base pairs.

In particular embodiments, the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences that encode an LtaS polypeptide. The term "recombinant" may be used in conjunction with a polypeptide or the name of a specific polypeptide, and this generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is the replicated product of such a molecule.

In other embodiments, the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences that encode a polypeptide or peptide that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially corresponding to the polypeptide. The nucleic acid segments used in the present invention, regardless of the length of the coding sequence itself, may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.

It also will be understood that this invention is not limited to the particular nucleic acid and amino acid sequences of these identified sequences. Numerous expression systems exist that comprise at least a part or all of the compositions discussed above. Prokaryote- and/or eukaryote-based systems can be employed for use with the present invention to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Many such systems are commercially and widely available. The insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Patent No. 5,871,986, 4,879,236, both herein incorporated by reference, and which can be bought, for example, under the name MAXBAC^® 2.0 from INVITROGEN^® and BACPACK™ BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH^®. In addition to the disclosed expression systems of the invention, other examples of expression systems include STRATAGENE^®'S COMPLETE CONTROL™ Inducible Mammalian Expression System, which involves a synthetic ecdysone-inducible receptor, or its pET Expression System, an E. coli expression system. Another example of an inducible expression system is available from INVITROGEN^®, which carries the T-REX™ (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter. INVLTROGEN^® also provides a yeast expression system called the Pichia methanolica Expression System, which is designed for high- level production of recombinant proteins in the methylotrophic yeast Pichia methanolica. One of skill in the art would know how to express a vector, such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.

C. Host Cells

As used herein, the terms "cell," "cell line," and "cell culture" may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, "host cell" refers to a prokaryotic or eukaryotic cell, and it includes any transformable organisms that is capable of replicating a vector and/or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors or viruses (which does not qualify as a vector if it expresses no exogenous polypeptides). A host cell may be "transfected" or "transformed," which refers to a process by which exogenous nucleic acid, such as a modified protein-encoding sequence, is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny.

Host cells may be derived from prokaryotes or eukaryotes, including bacteria cells, yeast cells, insect cells, and mammalian cells, depending upon whether the desired result is replication of the vector or expression of part or all of the vector-encoded nucleic acid sequences. Numerous cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials (www.atcc.org). An appropriate host can be determined by one of skill in the art based on the vector backbone and the desired result. A plasmid or cosmid, for example, can be introduced into a prokaryote host cell for replication of many vectors. Many host cells from various cell types and organisms are available and would be known to one of skill in the art.

V. Examples

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1 MATERIALS AND METHODS

Identification of Staphylococcal itaS. Chromosomal DNA of S. aureus SEJl (20) was digested with Sau3A and 3-8 kb fragments were cloned into pOK12 cut with

BamHI. Plasmids were electroporated into E. coli ANG471 (DH5α harboring pCL55- ypfP/ltaA), transformants plated on X-gal indicator agar and white or light blue colonies picked. E. coli cultures were grown in 96-well plates, aliquots of four cultures pooled, and bacterial sediments extracted with 2% SDS containing protein sample buffer. Samples were separated on 15% SDS-PAGE, subjected to immunoblotting with polyglycerol-phosphate specific monoclonal antibody (clone 55, HyCuIt Biotechnology) and LTA expression detected via chemiluminescence.

Inducible Expression of ItaS in Staphylococci. To construct S. aureus ANG499 with IPTG-inducible ItaS expression, the first 471 bases of ItaS and its preceding ribosome binding site were PCR amplified with the primers CCCAAGCTTCTAAATAACGGGGGAAAGAATCATGAGTTC (SEQ ID NO:3) and GGGGTACCGACAGGAACAAATTTCTTACTAAATGCTTTTG (SEQ ID NO:4). The PCR product was cut with HindIII and Kpnl and cloned under IPTG-inducible spac promoter control in pMutin-HA (Bacillus Genetic Stock Center). pMutin-HA-Zto^ was electroporated into S. aureus RN4220 and transformants selected on tryptic soy agar supplemented with 10 μg/ml erythromycin 0.5 mM IPTG. S. aureus ANG501 (murG under tetracycline-inducible promoter control) was obtained by transposon mutagenesis with pLTVl-iTET. Plasmid pLTVl-iTET was constructed by recombining the tetracycline-inducible promoter amplified from plasmid ψtet (Griindling and Schneewind, 2007) and the Gram-positive and Gram-negative kanamycin resistance gene amplified from plasmid pDL276 (Dunny et al, 1991) onto plasmid pLTVl (Camilli et al, 1990) using λ-red recombination technology. pLTVl-iTET was electroporated into S. aureus RN4220 and transposon mutants selected at 44⁰C on tryptic soy agar plates supplemented with 100 μg/ml kanamycin and 150 ng/ml anhydrotetracycline. The transposon insertion site is 30 nucleotides upstream oϊmurG. Polymerase chain reaction (PCR) and specifically designed primers were used to amplify UaS from S. aureus RN4220 or yfnl, yflE, yqgS and yvgj from B. subtilis 168 DNA. PCR products were digested with Avrll and BgIII and ligated with vector pitet that had been cut with the same enzymes. Recombinant plasmids were inserted into the staphylococcal chromosome (Grundling and Schneewind, 2007) yielding S. aureus strains ANG513 (ANG499 pitet), ANG514 (ANG499 pitet-ltaS), ANG515 (ANG499 pitet-yfnl), ANG516 (ANG499 pitet- yflE), ANG517 (ANG499 pitet-yqgS), and ANG518 (ANG499 pitet-yvgj).

Phosphate Determination. Phosphate determinations were performed essentially as described by Schnitger et al. (1959) with some modifications. Briefly, 140 μl of collected FPLC fractions were transferred to 7 ml glass vials and dried for 3 hours at 98⁰C. Compounds were hydrolyzed at 160⁰C in 400 μl acid solution (139 ml concentrated H₂SO₄ and 37.5 ml 70% HClO₄ per liter) and subsequently cooled to room temperature. Samples were then cooled on ice, and 2 ml of a freshly prepared reduction solution (3.75 g ammonium molybdate, 20.4 g sodium acetate and 1O g ascorbic acid per liter) were added. Following a 2 hour incubation period at 37⁰C, A_88O values were determined. For 5 mM glycerol-phosphate and 1.25 mM standard solution A₈₈₀ readings of 3.04 ± 0.13 and 0.93 ± 0.06 were measured.

Electron Microscopy. S. aureus ANG499 was grown overnight at 37⁰C in tryptic soy broth containing 10 μg/ml erythromycin and 1 mM IPTG. Staphylococci were sedimented by centrifugation (8,000 x g for 5 minutes), washed twice and diluted 200- fold into pre-warmed medium without or with 1 mM IPTG and appropriate antibiotic. Three or six hours following dilution, culture aliquots were removed and bacteria (OD_60O equivalent of - 90) were sedimented by centrifugation (8,000 x g for 5 minutes), washed 3 times with 0.8 ml 0.1 M sodium cacodylate (pH 7.4) and subsequently fixed for 15 minutes at room temperature and 2 hours at 4⁰C with 2% glutaraldehyde, 4% paraformaldehyde in 0.1 M sodium cacodylate. Following fixation, bacteria were washed with 0.1 M sodium cacodylate, stained, dehydrated and embedded for electron microscopy. Ninety nm thin sections were examined at 30OkV using a FEI Tecnai F30 microscope and images captured with a Gatan CCD digital camera.

Bacterial Strains and Growth Conditions. Escherichia coli strains were grown at 37⁰C in Luria-Bertani (LB) or in LB-M9 medium (49.3 mM Na₂HPO₄, 14.7 mM KH₂PO₄, 8.55 mM NaCl, 18.7 mM NH₄Cl, 3.7 mM Na succinate, 11.1 mM glucose, 2 mM MgSO₄, 1% tryptone, 0.5% yeast) for ltaS expression. Staphylococcus aureus strains were grown in tryptic soy broth (TSB) at 37⁰C unless otherwise stated. One hundred μg/ml ampicillin (Amp) and 30 μg/ml kanamycin (Kan) were used for plasmid selection in E. coli. When appropriate, S. aureus strains were grown in medium containing 10 μg/ml chloramphenicol (Cam), 10 μg/ml erythromycin (Erm) or 90 to 100 μg/ml Kan. Expression from the tetracycline-inducible promoter was induced by the addition of 150 or 200 ng/ml anhydrotetracycline (Atet) and expression via the spac promoter was induced by the addition of 0.5 or 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG).

The strains used are shown in Table 2. Table 2: Bacterial strains used in this study

S. aureus Library Construction. S. aureus SEJl chromosomal DNA was prepared as previously described using the Wizard Genomic DNA purification kit (Promega) (Bae et ai, 2004). Eighty μg chromosomal DNA was partially digested for 10 min with 8 units Sau3A, fragments ranging from approximately 3 to 8 kb were gel purified and ligated with BamHI cut E. coli vector pOK12 (Vieira and Messing, 1991). Vector pOK12 was prepared by digesting 20 μg plasmid DNA with 120 U BamHI. The linearized vector was gel extracted and dephosphorylated using 45 units alkaline phosphatase (CIP, New England Biolabs). Vector and Sau3A digested S. aureus DNA were ligated for 20 h at 16⁰C, heat inactivated for 20 min at 65⁰C and eloctroporated into E. coli strain ANG471 (DH5α harboring pCL55 -ypfP/ltaA). White or light blue colonies, which contained recombinant plasmids with S. aureus DNA insertion, were picked and used for further analysis.

Screen for S. aureus DNA Clones encoding Polyglycerolphosphate Synthase Activity. One hundred fifty μl LB-M9 supplemented with 30 μg/ml Kan were inoculated with individual E. coli transformants harboring a S. aureus DNA library plasmid. Cultures were grown in 96-well plates with aeration at 37⁰C for approximately 24 hours. Aliquots (50 μl) of 4 cultures were pooled and bacteria sedimented by centrifugation at 16,000 x g for 10 minutes. Bacteria were lysed by boiling for 20 minutes in 20 μl SDS sample buffer and insoluble material sedimented by centrifugation at 16,000 x g for 5 minutes. Sample aliquots (8 μl) were separated on 15% polyacrylamide gels, electrotransferred to PVDF membrane and glycerol-phosphate polymers detected by immunoblotting with monoclonal LTA (clone 55, HyCuIt Biotechnology) and HRP-lined anti-mouse antibodies (Cell Signaling) at 1 :2,000 and 1 :5,000 dilutions, respectively. Immune reactive signals were detected for E. coli strains containing S. aureus DNA library plasmids pl0/10E and p36/5F. Plasmids were isolated, transformed into E. coli DH5α strain and positive signals confirmed by immunoblot. The identity of the S. aureus DNA fragments contained within plasmids pl0/10E (nucleotides 792536 to 785098 of MU50 genome; http://genolist.pasteur.fr/AureoList/index.html) and p36/5F (base 789808 to 793300) was determined by DNA sequencing using pOK12 specific primers puc-f GTTGTAAAACGACGGCCAGT (SEQ ID NO:5) and puc-rr

TTAGCTCACTCATTAGGCACCCCAGGC (SEQ ID NO:6).

Immunoblot Analysis using ltaS expressing E. coli Strain. E. coli DH5α strains harboring empty vector pOK12 (ANG490), library clone pl0/10E (ANG492), p36/5F (ANG493) or plasmid pOK-ltaS (ANG491) were grown at 37⁰C in 4 ml LB-M9 and 30 μg/ml Kan for ~ 20 hours. Bacteria from 1 ml culture aliquots were sedimented by centrifugation at 16,000 x g for 10 minutes and suspended in 2 x sample buffer. Samples were normalized for OD_60O values (1 ml culture with an OD_6Oo of 6 was suspended in 90 μl sample buffer). Samples were boiled for 20 min, insoluble material removed by centrifugation and 2 μl aliquots separated on 15% PAA gels. Glycerol-phosphate compounds were detected by immunoblotting.

Separation of Inner and Outer membranes of E. coli expressing itaS. E. coli membranes were separated on a sucrose gradient as previously described ( Witholt et al, 1976; Guy-Caffey 1992). Briefly, an overnight culture of E. coli ANG491 (DH5α harboring pOK-ltaS) was diluted 100-fold into 1 liter LB-M9 supplemented with 30 μg/ml Kan and grown with aeration at 37⁰C for 4 hours. Bacteria were sedimented by centrifugation at 6,000 x g for 10 min and suspended in 50 ml 0.2 M Tris-HCl (pH 8.0). Fifty ml 0.2 M Tris-HCl (pH 8.0), 1 M sucrose as well as 500 μl 0.5 M EDTA (pH 8.0) and 2 ml lysozyme solution [6 mg/ml in 0.2 M Tris-HCl (pH 8)] were added. Following addition of 100 ml deionized water, the bacterial suspension was incubated with gentle stirring at room temperature for 20 minutes. Subsequently, 5 ml 1 M MgCl₂ solution was added and spheroplasts sedimented by centrifugation at 3,000 x g for 10 minutes, and suspended in 10 ml 10 mM Tris (pH 8) buffer containing 0.01 mg/ml RNase and DNase. Cells were disrupted by two passages in a French pressure cell at 1,000 lb/in². Unbroken cells and large cell debris were removed by centrifugation at 3,000 x g for 10 minutes. Supernatant was layered over a 2 ml 55% sucrose (wt/wt), 12 mM Tris-HCl (pH 8.0) cushion and topped with 0.5 ml 5% sucrose 12 mM Tris-HCl (pH 8.0) (wt/wt). Membranes floating at the 55% sucrose inter-phase were collected after 4 hours ultracentrifugation in a SW41 rotor at 31,000 rpm. Membranes were diluted 1 :2 with 12 mM Tris-HCl (pH 8.0) and passed three times through a 25G needle. Sample aliquots were layered on top of a sucrose step gradient assembled from the bottom: 0.4 ml (60%), 0.9 ml (55%), 2.2 ml (50%), 2.2 ml (45%), 2.2 ml (40%), 1.3 ml (35%), 0.4 ml (30%) sucrose. After centrifugation in a SW41 rotor at 31,000 rpm for 40 hours, 18 fractions were collected from the bottom. Aliquots of these fractions were mixed 1 :1 with 2 x sample buffer, heated for 20 minutes at 95⁰C, separated on 15% PAA gels and proteins were visualized by immunoblot. Rabbit polyclonal antibodies raised against the E. coli inner membrane protein PpiD and the Yersinia enterocolitica outer membrane protein OmpF were used as primary antibodies and a anti-rabbit IgG HRP-linked antibody (Cell signaling) as secondary antibody (both at 1 :20,000 dilution). Immunoblots using the monoclonal polyglycerol-phosphate-specific LTA antibody (1 :2,500 dilution) were performed as described above.

Plasmid and Strain Construction. To express S. aureus ltaS from its native promoter in E. coli, plasmid pOK-ltaS was constructed. S. aureus RN4220 chromosomal DNA and primer pair 5'-BamHI +P SAV0719

CGGGATCCGGAATAGAATATAGAATGCAATTAGAAATG (SEQ ID NO:7) and 3- Xbal SAV0719 CGTCTAGACCGAGTTCGTGTTTAAATATTATTTTTTAG (SEQ ID NO:8) were used to amplify ltaS. The PCR product was digested BamHI and Xbal and ligated with vector pOK12 that had been cut with the same enzymes, thereby yielding plasmid pOK-ltaS. Plasmids pitet-ltaS. pitet-yfhl, pitet-yflE, -pitet-yqgS, pitet-yvgj were constructed for tetracycline-inducible expression of the S. aureus polyglycerol-phosphate synthase gene ltaS and Bacillus subtilis ltaS homologues, yfhl, yflE, yqgS and yvgJ. Primer pairs 5-AvrII-SAV719-22bp

CCGCCTAGGCTAAATAACGGGGGAAAGAATCATGAGTTC (SEQ ID NO:9) / 3- BglII-SAV719 GAAGATCTCCGAGTTCGTGTTTAAATATT ATTTTTTAG (SEQ ID NO: 10), 5-AvrII-YfnI-33bp

CCGCCTAGGGAACTTAAAGTGTTTAAGAAAGTAGAGGTTGCC (SEQ ID NO:11) / 3-BglII-YfnI GAAGATCTGCAATGCGCCCGCTCAAGGCTCTTTTTCATCTTA (SEQ ID NO: 12), 5-AvrII-YflE-32bp CCGCCTAGGGCTCGAACTGGATCGGAAAAAAGGAGTGTAACA (SEQ ID NO: 13) / 3-BglII-YflE

GAAGATCTAAAGCGGAGAGGGCAACCTCTCCGCTTTTTCTTA (SEQ ID NO: 14), 5-AvrII-YqgS- 34bp

CCGCCTAGGCTGATTTTTTTGAGCGTGCTGCATAGGAGGTTG (SEQ ID NO: 15) / 3-BglII-YqgS GAAGATCTCCGCTCACTTCGATGCGGGAGACATTGTGATTA

(SEQ ID NO: 16) and 5-AvrII-YvgJ-33bp

CCGCCTAGGCAGATGATCAAGAAAACGTGAGGAGTCATATTG (SEQ ID NO: 17) / 3-BeglII-YvgJ

GAAGATCTGGACTACAAGGCGAATCTGTCTCATTTAAAC (SEQ ID NO: 18) were used to amplify ltaS from S. aureus RN4220 or yfnl, yflE, yqgS and yvgJ from B. subtilis 168 chromosomal DNA. PCR products were digested with Avrll and BgIII and ligated with vector pitet ( Grϋndling, A. & Schneewind, 2007), which has been cut with the same enzymes. Sequences of inserts were confirmed by automated fluorescence sequencing. No sequence alterations were found within the coding sequence of yfnl, yflE, and yvgJ, while several base changes were identified in yqgS compared to the published sequence of B. subtilis 168 ( Kunst et al, 1997). In addition, several nucleotides of the reverse primer sequence were missing after the yflE stop codon in plasmid pitet-yflE (sequence should read TAAGAAAAAGCGGAGAGGTTGCCCTCTCCGCTTTAGATCT (SEQ ID NO: 19), however the sequence of this clone is

TAAGAAAAAGCGGAGAGGTTGCCCT (SEQ ID NO:20)). These changes do not affect the yflE coding sequence. Plasmid pMutin-HA-Zto^¹ was created for the construction of a S. aureus strain with IPTG-inducible HaS expression. The first 471 nucleotides of ltaS and its preceding ribosome binding site were amplified by PCR using primer pair 5-HindIII-SAV0719_22

CCCAAGCTTCTAAATAACGGGGGAAAGAATCATGAGTTC (SEQ ID NO:21) / 3- Kpnl-S AV0719 471 GGGGTACCGAC AGGAAC AAATTTCTTACTAAATGCTTTTG (SEQ ID NO:22). The PCR product was cut with enzymes HindIII and Kpnl and HaS placed under IPTG inducible spac promoter control in plasmid pMutin-HA (Bacillus Genetic Stock Center), which had been cut with the same enzymes. The resulting plasmid pMutin-HA-ZtaS¹ was electroporated into S. aureus RN4220 and transformants were selected on tryptic soy agar (TSA) plates supplemented with 10 μg/ml Erm and 0.5 mM IPTG, yielding strain ANG499. Correct placement of UaS under spac promoter control was confirmed by PCR and sequencing. A control strain, which contains the essential peptidoglycan synthesis gene murG under tetracycline-inducible promoter control was obtained by transposon mutagenesis using plasmid pLTVl-iTET. Plasmid pLTVl-iTET was constructed by recombining the tetracycline-inducible promoter amplified from plasmid pitet and the Gram-positive and Gram-negative kanamycin resistance gene amplified from plasmid pDL276 ( Dunny et al, 1991) onto plasmid pLTVl ( Camilli et al., 1990) using λ-red recombination technology. Primer pair 5-KpnI-tet GGGGTACCTTGGTTACCGTGAAGTTACCATCACGG (SEQ ID NO:23) / TN917- iTET CATGAGTATTGTCCGAGAGTGTCATTTGATATGCCTCCGAATTCG (SEQ ID NO:24) was used to amplify the inducible-tetracycline promoter region and primer pair 5-KpnI-Kan GGGGTACCTTTCAAAATCGGCTCCGTCGATACTATG (SEQ ID NO:25) / 3-Kan-Cat homology

GAGTTCATAAACAATCCTGCCCTATCTAGCGAACTTTTAGAAAAG (SEQ ID NO:26) was used to amplify the kanamycin resistance gene. PCR products were digested with Kpnl, ligated and amplified using primer pair TN917 homology-red GGGTTTAACATGGATTTTATCATTAAAATCATGAGTATTGTCCGAGAGTG (SEQ ID NO:27) / Cat homology-red

TCATTAGGCCTATCTGACAATTCCTGAATAGAGTTCATAAACAATCCTGC (SEQ ID NO:28). The resulting PCR product was electroporated into λ-red recombination strain ANG526 (strain DY330 (Yu et al, 2000) harboring plasmid pLTVl). Recombinant plasmid pLTVl-iTET was obtained by plating transformations on LB plates supplemented with 30 μg/ml Kan at 3O⁰C and streaking for white colonies on plates containing 30 μg/ml Kan and 30 μg/ml 5-Bromo-4-chloro-3-indolyl β-D- galactopyranoside (X-GaI). Plasmid pLTVl-iTET was introduced by electroporation into S. aureus RN4220 and transformants were selected at 3O⁰C on TSA plates containing 90 μg/ml Kan. Transposon mutagenesis in S. aureus was performed as previously described (Bae et al, 2004) and mutants were selected at 44⁰C on TSA plates containing 100 μg/ml Kan and 150 ng/ml Atet. Strain ANG501 (tet-murG) was unable to grow in the absence of anhydrotetracycline and the transposon insertion site was subsequently determined by arbitrarily primed PCR (O'Toole et al, 1999) using primer pairs ARBl GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT (SEQ ID NO:29) / Tn- Transpos-far GATCCCGAAGTAACTAAGTATATG (SEQ ID NO:30) and ARB2 GGCCACGCGTCGACTAGTAC (SEQ ID NO:31) / Tn-Transpos TCTATTCCTAAACACTTAAGA (SEQ ID NO:32) for first and second round of PCR and primer Tn-Transpos for sequencing. The transposon insertion site was found to be 30 bases upstream of the murG (SAV1418; MU50 genome annotation) start codon and hence placing its expression under tetracycline-inducible promoter control.

Growth and LTA Synthesis in S. aureus Strains with Inducible ltaS and murG Expression. Strain ANG499 (spac-/ta>S) and strain ANG501 (tet-murG) were grown overnight at 37⁰C with shaking in TSB medium containing 10 μg/ml Erm and 1 mM IPTG or 90 μg/ml Kan and 200 ng/ml Atet. The following day, bacteria from 1 ml culture were sedimented by centrifugation at 10,000 x g for 3 minutes and washed twice with 1 ml TSB medium. Washed cultures were diluted 100-fold into fresh medium with or without added inducer (IPTG or Atet) and appropriate antibiotic. Cultures were incubated at 37⁰C with shaking and bacterial growth was monitored over time by determining OD₆₀₀ values of culture aliquots. Four hours after the initial dilution, cultures were again diluted 100-fold to maintain bacteria in logarithmic growth phase. In addition, culture samples were withdrawn 2 hours after the initial dilution and samples prepared for immunoblot analysis using LTA (1 :2,500 dilution) or sortase A (SrtA) specific (1:20,000 dilution) antibodies. Samples for western blot analysis were prepared as previously described (Grundling and Schneewind, 2007). Briefly, 1 ml staphylococcal culture was mixed with 0.5 ml 0.1 mm glass beads and bacteria were lysed by vortexing for 45 minutes in the cold. Glass beads were sedimented by centrifugation at 200 xg for 1 minute and 0.5 ml supernatant was transferred to a new tube. Lysed bacterial debris containing cell associated LTA were collected by centrifugation at 16,000 xg for 10 minutes and were suspended in 2% SDS sample buffer. Samples were normalized for culture OD₆₀₀ values; for example, sample from a culture with an OD₆₀₀ of 1 was suspended in 20 μl buffer. Samples were boiled for 30 minutes, insoluble material removed by centrifugation at 16,000 xg for 5 min and 6 μl or 2 μl sample were separated on 15% PAA gels and subjected to LTA or SrtA immunoblot analysis, respectively. Growth and LTA synthesis in S. aureus ltaS Complementation Strains.

Empty vector pitet or complementation plasmids (pitet-ltaS, ψtet-yfnl, pitet-yflE, pitet- yqgS, pitet-yvgJ) were electroporated into S. aureus strain ANG499 and transformants selected on TSA agar supplemented with 10 μg/ml Cam and 0.5 mM IPTG. Inactivation of the lipase gene (geh) upon plasmid integration was verified on TSA plats containing 3% of an 1 :1 egg yolk: PBS (pH 7.4) suspension. For complementation assays, strains were grown overnight in TSB medium supplemented with 10 μg/ml Erm, 10 μg/ml Cam and 1 mM IPTG, washed as described above and diluted 100-fold into fresh TSB supplemented with 10 μg/ml erythromycin and 200 ng/ml Atet or, where indicated, with 1 mM IPTG. Bacterial cultures were incubated and growth monitored as described above. Samples for immunoblot analysis were removed 4 hours after dilution and prepared as described above. Five μl samples were separated on 15% PAA gels for immunoblotting. LTA Purification. LTA was extracted from lysed bacterial cells with 1-butanol and purified by hydrophobic interaction chromatography as previously described with some modifications (Fischer et al, 1983; Morath et al, 2005; Hashimoto et al, 2006). S. aureus ANG513 was grown overnight in TSB supplemented with 10 μg/ml Erm, 10 μg/ml Cam and 1 mM IPTG. The following day, cultures were washed twice with TSB and diluted 100-fold into 6 liter TSB supplemented with 10 μg/ml Erm and 0.5 mM IPTG or into 12 liter TSB supplemented with 10 μg/ml Erm but no inducer. Cultures were grown for 4 hours at 37⁰C with shaking and bacteria were sedimented by centrifugation at 6,000 x g for 10 minutes. Bacterial pellets were washed with 90 ml 0.1 M sodium citrate (pH 4.7), and stored frozen until further use. For LTA extraction, washed bacteria were suspended in 40 ml 0.1 M sodium citrate (pH 4.7) and lysed in a bead beater (Biospec Products, Inc.) by shearing 5 times for 2 minutes at 4⁰C with 0.1 mm glass beads (40 ml). Glass beads were sedimented by centrifugation for 1 min at 200 xg and the supernatant with bacterial debris transferred to a fresh tube. Glass beads were washed with 40 ml 0.1 M sodium citrate (pH 4.7) buffer, sedimented by centrifugation and cell debris from combined supernatants were collected by centrifugation at 13,000 xg for 60 min. Pellets were washed with 90 ml 0.1 M sodium citrate (pH 4.7) buffer, centrifuged as above and finally suspended in 40 ml 0.1 M sodium citrate (pH 4.7). Bacterial suspensions were mixed with an equal volume of 1-butanol and stirred at room temperature for 30 minutes. Insoluble material was sedimented by centrifugation at 13,000 xg for 20 minutes, extracts transferred to new tubes and phases separated by centrifugation at 13,000 xg for 20 minutes. The aqueous (lower) phase containing LTA was retrieved and extensively dialyzed against 20 mM sodium citrate (pH 4.7) buffer using Spectra/Por 6 (Spectrum laboratories, Inc.) dialysis membranes (1,000 Da cut off). For normalization purposes, protein content in dialyzed extracts was determined using a BCA protein assay kit from (Pierce) and bovine serum albumin (BSA) as standard. Samples were adjusted to contain 0.088 mg/ml protein in 0.1 M sodium citrate (pH 4.7), 15% 1-propanol buffer and 30 ml were loaded onto a 1.6 cm x 15 cm octyl sepharose CL-4B (GE Healthcare, Uppsala Sweden) column equilibrated with 0.1 M sodium citrate (pH 4.7), 15% 1-propanol buffer. Following sample application, the column was washed with 110 ml equilibration buffer at the same flow rate of 0.25 ml/ min. LTA was eluted using a 200 ml linear 15% to 65% 1-propanol gradient in 50 mM sodium citrate (pH 4.7). The flow rate was set to 0.3 ml/min and 5 ml fractions were collected. Columns were cleaned with 80 ml 65% 1- propanol 50 mM sodium citrate (pH 4.7) buffer and equilibrated with 120 ml 15% 1- propanol 0.1 M sodium citrate (pH 4.7) buffer between runs. To determine, which fractions contain LTA, 20 μl of different fractions were mixed with 60 μl 2 x sample buffer, boiled for 20 minutes and 8 μl analyzed by immunoblot using an LTA specific antibody.

Phosphate Determination. Phosphate determinations were performed essentially as described by Schnitger et al. (1959) with some modifications. Briefly, 140 μl of collected FPLC fractions were transferred to 7 ml glass vials and dried for 3 hours at 98⁰C. Compounds were hydrolyzed at 16O⁰C in 400 μl acid solution (139 ml concentrated H₂SO₄ and 37.5 ml 70% HClO₄ per liter) and subsequently cooled to room temperature. Samples were then cooled on ice, and 2 ml of a freshly prepared reduction solution (3.75 g ammonium molybdate, 20.4 g sodium acetate and 1O g ascorbic acid per liter) were added. Following a 2 hour incubation period at 37⁰C, A_88O values were determined. For 5 mM glycerol-phosphate and 1.25 mM standard solution A₈₈₀ readings of 3.04 ± 0.13 and 0.93 ± 0.06 were measured.

Electron Microscopy. S. aureus ANG499 was grown overnight at 37⁰C in tryptic soy broth containing 10 μg/ml erythromycin and 1 mM IPTG. Staphylococci were sedimented by centrifugation (8,000 x g for 5 minutes), washed twice and diluted 200- fold into pre-warmed medium without or with 1 mM IPTG and appropriate antibiotic. Three or six hours following dilution, culture aliquots were removed and bacteria (OD_60O equivalent of ~ 90) were sedimented by centrifugation (8,000 x g for 5 minutes), washed 3 times with 0.8 ml 0.1 M sodium cacodylate (pH 7.4) and subsequently fixed for 15 minutes at room temperature and 2 hours at 4⁰C with 2% glutaraldehyde, 4% paraformaldehyde in 0.1 M sodium cacodylate. Following fixation, bacteria were washed with 0.1 M sodium cacodylate, stained, dehydrated and embedded for electron microscopy. Ninety nm thin sections were examined at 30OkV using a FEI Tecnai F30 microscope and images captured with a Gatan CCD digital camera. EXAMPLE 2

IDENTIFICATION OF S. AUREUS LTAS ENCODING POL YGL YCEROL-

PHOSPHATE LTA SYNTHASE

While proposed LTA synthesis models differ in their details, it is commonly accepted that phosphatidyl glycerol (PG) is used as substrate for polyglycerol-phosphate LTA synthesis (Koch et al, 1984; Fischer, 1994; Chiu et al, 1993). Werner and Fischer proposed a model whereby LTA is polymerized on the outer surface of bacterial membranes (Fischer, 1994). If LTA synthesis were required for envelope assembly and growth of Gram-positive bacteria, it would not be possible to isolate mutants with irreversibly inactivated LTA synthesis. We therefore asked whether expression of the presumed LTA synthase in Escherichia coli, a Gram-negative microbe that lacks polyglycerol-phosphate but harbors PG membrane lipids, could promote LTA synthesis. A plasmid library of staphylococcal genomic DNA fragments was constructed in pOK12 (Vieira and Messing, 1991). Plasmids were introduced into E. coli strain ANG471 and clones producing LTA were identified by SDS-PAGE and immunoblotting with monoclonal antibody specific for polyglycerol-phosphate. Two plasmid clones, pi 0/1 OE and p36/5F, each conferred onto E. coli the ability to produce immune-reactive LTA. As a control, LTA was absent in samples from E. coli harboring only the empty vector pOK12 (FIG. IB). EXAMPLE 3

LTAS-MEDIATED SYNTHESIS OF LTA OCCURS IN THE INNER

MEMBRANE OF i?. COLI

The identity of the S. aureus DNA fragments contained within plasmids pl0/10E and p36/5F was determined by DNA sequencing. A single open reading frame, encoding a previously uncharacterized protein (locus tag SAV0719 in S. aureus MU50), was present in both clones. This gene was named ltaS for lipoteichoic acid synthase. ltaS was cloned with its native promoter into pOK12, generating plasmid pOK-ZtøS. E. coli strains harboring pOK-ZtaS produced glycerol-phosphate polymers, demonstrating that expression of a single staphylococcal gene in E. coli, which encodes LtaS, is indeed sufficient for LTA synthesis (FIG. 1 B). In agreement with the Fischer model for polyglycerol-phosphate synthesis on bacterial surfaces (Fischer, 1994), LtaS is predicted to assemble as a polytopic membrane protein with a large C-terminal domain located on the outer surface of the bacterial membrane. The C-terminal domain (LtaS amino acids 245 to 604) presumably functions as a catalytic domain and is annotated in the Pfam database as a sulfatase domain (FIG. 1C). Initial fractionation experiments suggested that a large fraction of glycerol- phosphate polymer was present in the membranes of E. coli strains expressing ltaS (data not shown). Sucrose gradient centrifugation was used to separate bacterial inner and outer membranes (FIG. ID). LTA floated to the same sucrose density as the inner membrane protein PpiD, but not to that of OmpF, an outer membrane protein (FIG. ID). The glycerol-phosphate polymer therefore appears to be located in the cytoplasmic (inner) membrane of E. coli ANG490 (pOK-ltaS).

EXAMPLE 4 LTAS IS REQUIRED FOR LTA SYNTHESIS AND GROWTH OF S. AUREUS To test whether ltaS is also required for LTA glycerol-phosphate synthesis in staphylococci, S. aureus ANG499, a strain with IPTG-inducible expression of ltaS, was constructed. In the absence of IPTG, strain ANG499 ceased to grow within 4 hours of removing the ltaS inducer IPTG (FIG. 2A). Moreover, within 2 hours of IPTG removal, immunoblot analysis failed to detect LTA in crude bacterial extracts of /taS-depleted staphylococci (FIG. 2C). To examine whether the disappearance of LTA was caused by an arrest in bacterial growth or by a specific blockade in UaS expression, the inventors analyzed S. aureus ANG501, a strain that expresses murG, an essential gene in the peptidoglycan biosynthesis pathway (Mengin-Lecreulx et al, 1991), under control of a tetracycline-inducible promoter. Similar to strain ANG499, S. aureus ANG501 ceased to grow upon removal of the inducer anhydrotetracycline (FIG. 2B). In contrast to ANG499, anhydrotetracycline removal and depletion of murG in strain ANG501 did not abolish staphylococcal LTA synthesis (FIG. 2C). Thus, the observed block in LTA synthesis of strain ANG499 is likely caused by the depletion of UaS.

To examine further whether polyglycerol-phosphate synthesis ceased upon ltaS depletion, LTA was purified from the /tøS-inducible S. aureus strain ANG513 that had been grown in the presence or absence of IPTG. Briefly, LTA was extracted from bacterial lysates, subjected to octyl sepharose chromatography and eluted with a linear gradient of 1-propanol (15 to 65%) in 50 niM sodium citrate (pH 4.7) (Morath et al, 2005; Hashimoto et al, 2006; Fischer et al, 1983). Large quantities of LTA could only be purified from S. aureus ANG513 cultures that had been grown in the presence of IPTG, but not from cultures grown without IPTG, as judged by immunoblot and phosphate determinations (FIG. 2DE). Together these data demonstrate that ltaS is not only required for staphylococcal growth but also for the synthesis of glycerol-phosphate LTA. EXAMPLE 5

DEPLETION OF LTAS AND LTA RESULTS IN STAPHYLOCOCCAL ENVELOPE AND CELL DIVISION DEFECTS

To examine the physiological role of LTA during staphylococcal growth, S. aureus ANG499 cultures that had been grown in the presence or absence of IPTG were subjected to electron microscopy. Briefly, bacterial cells were sedimented by centrifugation, glutaraldehyde and paraformaldehyde fixed, stained, embedded and thin sectioned. When viewed at 300 kV in an electron microscope, S. aureus ANG499 grown in the presence of IPTG displayed the expected morphology of staphylococci: round cells with a thick cell wall envelope, central division septa and perpendicular positioned septa in adjacent cells that display subsequent division events (Giesbrecht et al., 1998; Tzagoloff and Novick, 1977) (FIG. 3). Within 3 hours of IPTG removal, S. aureus ANG499 that had been depleted of LTA displayed aberrant positioning of division septa, which were spaced very closely to the previous division plane (FIG. 3). Further, cells harbored parallel, but not perpendicular, division septa. Upon 6 hours of LTA depletion, large numbers of aberrantly shaped cells with empty envelopes, lacking both cytoplasm and nucleic acid, could be observed. These results provide evidence that LTA synthesis and deposition of this secondary wall polymer within the envelope are essential for the proper positioning of cell wall septa and for cell division processes. Taken together, these experiments identify staphylococcal HaS as being required for LTA synthesis, cell division and staphylococcal growth. EXAMPLE 6 LTAS FUNCTION IS CONSERVED IN GRAM-POSITIVE BACTERIA

Glycerol-phosphate LTA has been isolated from the cell wall envelope of many Gram-positive bacteria including Bacillus subtilis, Bacillus anthracis, Bacillus cereus, Listeria monocytogenes, Streptococcus pyogenes (group A streptococci) and Streptococcus agalactiae (group B streptococci) (Fischer, 1990a; Fischer et ah, 1990b). Using BLAST database searches of microbial genomes, one or more UaS homologues were identified in the genome sequences of each of the aforementioned bacterial species. For example, while 5. aureus has one UaS gene, B. subtilis 168 contains four ltaS homologues (yfiil, yflE, yqgS, and yvgJ with P- values < Ie- 100 and > 40% identity) (Kunst et al., 1997). In previous work, each of these genes could be deleted without abolishing growth of bacilli (Kobayashi et al., 2003), prompting the conclusion that any one of four UaS homologues of B. subtilis may not be required for bacterial replication. Nevertheless, the multiple different UaS homologues of B. subtilis may fulfill redundant or overlapping functions similar to those of S. aureus LtaS in synthesizing polyglycerol- phosphate LTA. To address this question, B. subtilis yfhl, yflE, yqgS, yvgJ or S. aureus UaS were cloned under control of the tetracycline-inducible promoter in the integration vector pitet (Grϋndling and Schneewind, 2007). Plasmids were integrated into the chromosome of S. aureus ANG499. Functional complementation of UaS depletion was examined following removal of IPTG by adding anhydrotetracycline to the culture medium (FIG. 4). Anhydrotetracycline-inducible expression of staphylococcal UaS or B. subtilis yflE restored both LTA glycerol-phosphate synthesis and bacterial growth in medium lacking IPTG (FIG. 4B, 4C, 4G). B. subtilis yqgS or yvgJ did not restore staphylococcal growth and/or LTA synthesis (FIG. 4E, 4F, 4G). In contrast, anhydrotetracycline-inducible expression of yfnl promoted LTA synthesis, albeit that its polyglycerol-phosphate product migrated with a different mobility on SDS-PAGE than LTA synthesized in UaS ox yflE expressing strains (FIG. 4G). Unlike yflE, expression of yfnl could not restore staphylococcal growth following UaS depletion (FIG. 4D). These results provide evidence that B. subtilis yflE and yfnl both encode glycerol-phosphate LTA synthases with at least partially overlapping functions, which may explain why these genes can be deleted without loss of viability in bacilli. EXAMPLE 7 ASSAY FOR IDENTIFYING LTAS INHIBITORS

A high-throughput assay can be used to detect LtaS activity in vitro. This method can be used to screen potential inhibitors of LtaS that can be used as antimicrobials. As previously stated, LtaS catalyzes the formation of polyglycerol phosphate from phosphatidyl glycerol. A side product of this reaction is diacylglycerol. Diacylglycerol is phosphorylated by diacylglycerol kinase in the presence of ATP. As this reaction procedes the consumption of ATP can be measured using the Kinase-Glo Luminescent Kinase Assay (Promega V6072). This assay can be performed in a 96-well format. We will first add purified S. aureus LtaS, phosphatidyl glycerol (Sigma P0514), diacylglycerol kinase (Fisher NC9888025), and an inhibitor from an inhibitor library. After the inhibitor has had a chance to bind to LtaS, we will add ATP and then the Kinase-Glo Reagent. This reagent contains Beetle Luciferin and Luciferase which in the presence of ATP and O₂ will form Oxyluciferin, AMP, CO₂, PP₁, and most importantly light. The luminescence can then be measured using a luminometer and the quantity of light emitted from the assay is inversely proportional to LtaS activity. For each inhibitor the assay will need to be performed in the absence of LtaS and the presence of purchased diacylglycerol. This will exclude the possibility false positives arising from direct inhibition of the diacylglycerol kinase by the candidate LtaS inhibitors. This assay should lead to the identification of various inhibitors potentially with therapeutic properties.

v ~ S

+ ATP + 1/2 O₂ ^→^{SΘ 0}VY^A AMP ₊ CO_{2 +} PP₁ REFERENCES

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

U.S. Patent 4,554,101

U.S. Patent 5,143,854

U.S. Patent 5,202,231

U.S. Patent 5,242,974 U.S. Patent 5,288,644

U.S. Patent 5,324,633

U.S. Patent 5,384,261

U.S. Patent 5,405,783

U.S. Patent 5,412,087 U.S. Patent 5,424,186

U.S. Patent 5,429,807

U.S. Patent 5,432,049

U.S. Patent 5,436,327

U.S. Patent 5,445,934 U.S. Patent 5,468,613

U.S. Patent 5,470,710

U.S. Patent 5,472,672

U.S. Patent 5,492,806

U.S. Patent 5,503,980 U.S. Patent 5,510,270

U.S. Patent 5,525,464

U.S. Patent 5,527,681

U.S. Patent 5,529,756

U.S. Patent 5,532,128 U.S. Patent 5,545,531 U.S. Patent 5,547,839

U.S. Patent 5,554,501

U.S. Patent 5,556,752

U.S. Patent 5,561,071 U.S. Patent 5,571,639

U.S. Patent 5,580,726

U.S. Patent 5,580,732

U.S. Patent 5,593,839

U.S. Patent 5,599,672 U.S. Patent 5,599,695

U.S. Patent 5,610,287

U.S. Patent 5,624,711

U.S. Patent 5,631,134

U.S. Patent 5,639,603 U.S. Patent 5,654,413

U.S. Patent 5,658,734

U.S. Patent 5,661,028

U.S. Patent 5,665,547

U.S. Patent 5,667,972 U.S. Patent 5,695,940

U.S. Patent 5,700,637

U.S. Patent 5,744,305

U.S. Patent 5,800,992

U.S. Patent 5,807,522 U.S. Patent 5,830,645

U.S. Patent 5,837,196

U.S. Patent 5,847,219

U.S. Patent 5,871,928

U.S. Patent 5,876,932 U.S. Patent 5,919,626

U.S. Patent 6,004,755 U.S. Patent 6,087,102 U.S. Patent 6,309,823 U.S. Patent 6,316,193 U.S. Patent 6,322,971 U.S. Patent 6,324,479 U.S. Patent 6,329,140 U.S. Patent 6,329,209 U.S. Patent 6,368,799 U.S. Patent 6,383,749 U.S. Patent 6,617,112 U.S. Patent 6,638,717 U.S. Patent 6,720,138

Archibald et al, Nature, 191 :570-572, 1961. Armstrong et al, J. Chem. Soc, 4344-4354, 1958.

Armstrong et al, Nature, 184, 247-249, 1959.

Bae et al, Proc. Natl. Acad. ScL USA, 101 :12312-12317, 2004.

Cabacungan and Pierginger, J. Bacteriol, 147:75-79, 1981.

Camilli et al, J. Bacteriol, 172:3738-3744, 1990. Canepari et al, Antimicrob. Agents Chemother., 34:1220-1226, 1990.

Capaldi et al, Biochem. Biophys. Res. Comm., 74(2):425-433, 1977.

Childs and Neuhaus, J Bacteriol, 143:293-301, 1980.

Chiu et al, Biochim. Biophys. Acta., 1166:222-228, 1993.

Cleveland et al, Biochem. Biophys. Res. Commun., 67:1128-1135, 1975. D'Elia et al, J. Bacteriol, 188:4183-4189, 2006a.

D'Elia et al, J. Bacteriol, 188:8313-8316, 2006b.

Diekema et al, Clin. Infect. Dis., 32:S114-132, 2001.

Duckworth et al, FEBS Lett., 53:176-179, 1975.

Dunny et al, Appl Env. Microbiol, 57:1194-1201, 1991. Emdu and Chiu, FEBS Lett. , 55, 1975.

European Appln. 373 203 European Appln. 785 280

European Appln. 799 897

Fischer et al., Biochem. Cell Biol, 68:33-43, 1990.

Fischer et al., Eur. J. Biochem., 133:523-530, 1983. Fischer et al, J. Bacteriol, 146:461-415, 1981.

Fischer, Adv. Microb. Physiol, 29:233-302., 1988

Fischer, In: Handbook of lipid research, Hanahan (Ed.), Plenum Press, NY, 6:123-234, 1990.

Fischer, Med. Microbiol. Immunol, 183:61-76, 1994. Fodor et al, Biochemistry, 30(33):8102-8108, 1991.

Friedman et al, Antimicrob. Agents Chemother., 50:2137-2145, 2006.

Ganfield and Pierginger, J. Biol Chem., 255:5164-5169, 1980.

Giesbrecht et al, Microbiol. MoI Biol. Rev., 62:1371-1414, 1998.

Goto et al, The Tohoku J. Exp. Medicine. 2008; Vol. 214, No. 3 pp.199-212. Griindling and Schneewind, J. Bacteriol, 189:2521-2530, 2007.

Grundling A, Schneewind O. Proc Natl Acad Sci [752007 May 15;104(20):8478-83

Gny-Caffey et al, J. Bacteriol, 174:2460-2465, 1992.

Hacia et al, Nature Genet., 14:441-449, 1996.

Hanahan, J. MoI Biol, 166:557-572, 1983. Hashimoto et al, J. Immunol, 111:3162-3169, 2006.

Heaton and Neuhaus, J. Bacteriol, 174:4707-4017, 1992.

Heaton and Neuhaus, J. Bacteriol, 176:681-690, 1994.

Kaplan et al, Clin. Infect. Dis., 40:1785-1791, 2005.

Kiriukhin et al, J. Bacteriol, 183:3506-3514, 2001. Kobayashi et al, Proc. Natl Acad. Sci. USA, 100:4678-4683, 2003.

Koch et al, Eur. J. Biochem., 138:357-363, 1984.

Kxeiswϊrth et al, Nature, 305:709-712, 1983.

Kunst et al, Nature, 390:249-256, 1997.

Kyte and Doolittle, J. MoI Biol, 157(l):105-132, 1982. Laganas et al, Antimicrob. Agents Chemother., 47:2682-2684, 2003.

Lambert et al, Biochim. Biophys. Acta., 472:1-12, 1977. Lee et al, Gene, 103:101-105, 1991.

Maskos et al, Nucleic Acids Res., 20(7): 1679-1684, 1992.

Mauel et al, Mol Gen. Genet., 215:388-394, 1989.

McCarty and Morse, Adv. Immunol, 4:249-286, 1964. McCarty, J. Exp. Med., 109:361-378, 1959.

Mengin-Lecreulx et al, J. Bacteriol, 173:4625-4636, 1991.

Morath et al, J. Endotoxin Res., 11 :348-356, 2005.

Neuhaus and Baddiley, Microbiol. MoI Biol. Rev., 67:686-723, 2003.

O'Toole et al, Methods Enzymol, 310:91-109, 1999. PCT Appln. WO 0138580

PCT Appln. WO 0168255

PCT Appln. WO 03020898

PCT Appln. WO 03022421

PCT Appln. WO 03023058 PCT Appln. WO 03029485

PCT Appln. WO 03040410

PCT Appln. WO 03053586

PCT Appln. WO 03066906

PCT Appln. WO 03067217 PCT Appln. WO 03076928

PCT Appln. WO 03087297

PCT Appln. WO 03091426

PCT Appln. WO 03093810

PCT Appln. WO 03100012 PCT Appln. WO 03100448 Al

PCT Appln. WO 04020085

PCT Appln. WO 04027093

PCT Appln. WO 09923256

PCT Appln. WO 09936760 PCT Appln. WO 93/17126

PCT Appln. WO 95/21265 PCT Appln. WO 95/21944

PCT Appln. WO 95/35505

PCT Appln. WO 96/31622

PCT Appln. WO 97/10365 PCT Appln. WO 97/27317

PCT Appln. WO 9743450

PCT Appln. WO 99/35505

PCT Appln.WO 95/11995

Pease et al, Proc. Natl. Acad. ScL USA, 91 :5022-5026, 1994. Peschel et al, Antimicrob. Agents Chemother., 44:2845-2847, 2000.

Peschel et al, J. Biol. Chem., 274:8405-8410, 1999.

Projan and Shlaes, Clin. Microbiol. Infect, 10:18-22, 2004.

Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3^rd Ed., Cold Spring

Harbor Laboratory Press, 2001. Schena, et al, Science, 210:461-410, 1995.

Schnitger et al, Biochem. Z., 332:167-185, 1959.

Shalon et al, Genome Res., 6(7):639-645, 1996.

Shoemaker et al, Nature Genetics, 14:450-456, 1996.

Taron et al, J. Bacteriol, 154:1110-1116, 1983. Tipper and Strominger, Proc. Natl Acad. Sd. USA, 54:1133-1141, 1965.

Tzagoloff and Novick, J. Bacteriol, 129:343-350, 1977.

UK Appln. 8 803 000

Vieira and Messing, Gene, 100:189-194, 1991.

Weidenmaier et α/., J. Infect. Dis., 191 :1771-1777, 2005. Weidenmaier et al, Nat. Med., 10:243-245, 2004.

Weigel et al, Science 302:1569-1571, 2003.

Witholt et al, Anal Biochem., 74:160-170, 1976.

Yu et al, Proc. Natl. Acad. ScL USA, 97:5978-5983, 2000.

Claims

1. A method for evaluating a candidate compound for antibacterial activity against a gram-positive bacteria comprising: a) contacting an LtaS polypeptide with the candidate compound in a mixture; b) evaluating whether the polypeptide and the candidate compound interact.

2. The method of claim 1, wherein the LtaS polypeptide is truncated.

3. The method of claim 2, wherein the LtaS polypeptide comprises a soluble region.

4. The method of claim 3, wherein the soluble region comprises a catalytically active region.

5. The method of claim 1 , wherein the LtaS polypeptide has been isolated.

6. The method of claim 1 , wherein the LtaS polypeptide is recombinant.

7. The method of claim 1 , wherein the LtaS polypeptide is membrane-bound.

8. The method of claim 7, wherein the LtaS polypeptide is in a membrane fraction.

9. The method of claim 7, wherein the LtaS polypeptide is part of a cell.

10. The method of claim 9, wherein the LtaS polypeptide is in a heterologous recombinant host cell.

11. The method of claim 10, wherein the heterologous recombinant host cell is a gram-negative bacterium.

12. The method of claim 1, wherein the LtaS polypeptide is a Staphylococcus LtaS polypeptide.

13. The method of claim 12, wherein the LtaS polypeptide is at least 80% identical to SEQ ID NO:2.

14. The method of claim 12, wherein the LtaS polypeptide comprises at least 50 contiguous amino acids from SEQ ID NO:2.

15. The method of claim 14, wherein the LtaS polypeptide comprises at least 100 contiguous amino acids from SEQ ID NO:2.

16. The method of claim 15, wherein the LtaS polypeptide comprises at least 200 contiguous amino acids from SEQ ID NO:2.

17. The method of claim 16, wherein the LtaS polypeptide comprises the amino acid sequence of SEQ ID NO:2.

18. The method of claim 1 , wherein evaluating whether the polypeptide and the candidate compound interact comprises assessing binding between the polypeptide and the candidate compound.

19. The method of claim 1 , further comprising c) incubating the LtaS polypeptide and/or candidate compound with a phosphatidyl glycerol (PG) substrate under conditions to allow glycer phosphate polymerization, and wherein evaluating whether the polypeptide and the candidate compound interact comprises assessing the amount of polyglycerol phosphate synthesis.

20. The method of claim 19, wherein assessing the amount of polyglycerol phosphate synthesis comprises isolating polyglycerol phosphate reaction products.

21. The method of claim 20, wherein isolating polyglycerol phosphate reaction products involves filtration or sedimentation.

22. The method of claim 19, wherein assessing the amount of polyglycerol phosphate synthesis involves one or more antibodies that specifically bind to polyglycerol phosphate.

23. The method of claim 19, wherein assessing the amount of polyglycerol phosphate synthesis comprises measuring the amount of released diacylglyerol.

24. The method of claim 19, wherein assessing the amount of polyglycerol phosphate synthesis comprises including ATP in the mixture and measuring the rate of ATP consumption in the mixture.

25. The method of claim 24, wherein measuring the amount of available ATP mixture comprises measuring the level of a reaction product that requires ATP for its formation.

26. The method of claim 25, wherein the reaction product is one that emits light.

27. The method of claim 25, wherein assessing the amount of polyglycerol phosphate synthesis comprises using a luminometer.

28. The method of claim 19, wherein assessing the amount of polyglycerol phosphate synthesis involves a label or tag.

29. The method of claim 28, wherein the label or tag is colorimetric, enzymatic, fluorescent, or radioactive.

30. The method of claim 1, wherein the candidate compound is a small molecule.

31. The method of claim 1 , wherein more than one candidate compound is evaluated at the same time.

32. The method of claim 31 , wherein the candidate compound is contacted with the LtaS polypeptide in a multiwell plate.

33. The method of claim 32, wherein evaluating whether the candidate compound interacts with the LtaS polypeptide is performed in a multiwell plate.

34. The method of claim 1, further comprising exposing a gram-positive bacteria to the candidate compound and evaluating the growth of the bacteria.

35. The method of claim 1 , further comprising infecting an animal with a gram- positive bacteria, administering the candidate compound to the animal, and evaluating the infection in the animal.

36. A method of evaluating a candidate compound for antibacterial activity comprising: a) expressing an LtaS polypeptide in a heterologous cell; b) incubating the cell with a phosphatidyl glycerol (PG) substrate under conditions to allow glycerol-phosphate polymerization; c) incubating the cell with a candidate compound; and, d) comparing the levels of polyglycerol phosphate synthesis in the presence and absence of the candidate compound.

37. The method of claim 36, wherein the heterologous cell is a gram-negative bacterium.

38. The method of claim 37, wherein the gram-negative bacterium is Escherichia coli.

39. The method of claim 36, wherein the presence of the candidate compound reduces the level of polyglycerol phosphate synthesis compared to when the candidate compound is absent.

40. The method of claim 36, wherein comparing the levels of polyglycerol phosphate synthesis in the presence and absence of the candidate compound comprises isolating polyglycerol phosphate reaction products.

41. The method of claim 40, wherein isolating polyglycerol phosphate reaction products involves filtration or sedimentation.

42. The method of claim 36, wherein comparing the levels of polyglycerol phosphate synthesis involves one or more antibodies that specifically bind to polyglycerol phosphate.

43. The method of claim 36, wherein comparing the levels of polyglycerol phosphate synthesis comprises measuring the amount of released diacylglyerol.

44. The method of claim 36, wherein comparing the levels of polyglycerol phosphate synthesis involves a label or tag.

45. The method of claim 44, wherein the label or tag is colorimetric, enzymatic, fluorescent, or radioactive.

46. The method of claim 36, wherein comparing the levels of polyglycerol phosphate synthesis comprises indirectly measuring the amount of released diacylglyerol.

47. The method of claim 46, wherein measuring the amount of released diacylglycerol comprises including ATP and diacylglycerol kinase in the mixture and measuring the rate of ATP consumption in the mixture.

48. The method of claim 47, wherein measuring the amount of available ATP mixture comprises measuring the level of a reaction product that requires ATP for its formation.

49. The method of claim 48, wherein the reaction product is one that emits light.

50. The method of claim 48, wherein assessing the amount of polyglycerol phosphate synthesis comprises using a luminometer.

51. The method of claim 36, further comprising e) exposing a gram-positive bacteria to the candidate compound and evaluating the growth of the bacteria.

52. The method of claim 51 , further comprising infecting an animal with a gram- positive bacteria, administering the candidate compound to the animal, and evaluating the infection in the animal.

53. The method of claim 36, wherein the candidate compound is a small molecule.

54. The method of claim 53, wherein multiple small molecules are evaluated.

55. A recombinant host cell comprising a nucleic acid sequence encoding an LtaS polypeptide.

56. The recombinant host cell of claim 55, wherein the LtaS polypeptide is from S. aureus.

57. The recombinant host cell of claim 56, wherein the nucleic acid sequence encodes an LtaS polypeptide that is at least 80% identical to SEQ ID NO:2.

58. The recombinant host cell of claim 55, wherein the nucleic acid sequence encodes an LtaS polypeptide that comprises at least 50 contiguous amino acids of SEQ ID NO:2.

59. The recombinant host cell of claim 58, wherein the nucleic acid sequence encodes an LtaS polypeptide that comprises at least 100 contiguous amino acids of SEQ ID NO:2.

60. The recombinant host cell of claim 59, wherein the nucleic acid sequence encodes an LtaS polypeptide that comprises at least 150 contiguous amino acids of SEQ ID NO:2.

61. The recombinant host cell of claim 60, wherein the nucleic acid sequence encodes an LtaS polypeptide that comprises the sequence of SEQ ID NO:2.

62. The recombinant host cell of claim 55, wherein the cell is a gram-negative bacterium.

63. The recombinant host cell of claim 55, wherein the cell expresses LtaS on its cell membrane.

64. The recombinant host cell of claim 55, wherein the nucleic acid sequence is under the control of a heterologous promoter.

65. An isolated polypeptide comprising at least 50 contiguous amino acids of SEQ ID NO:2.

66. The isolated polypeptide of claim 65, wherein the polypeptide comprises at least 100 contiguous amino acids of SEQ ID NO:2.

67. The isolated polypeptide of claim 66, wherein the polypeptide comprises at least 200 contiguous amino acids of SEQ ID NO:2.

68. The isolated polypeptide of claim 65, wherein the polypeptide is purified.

69. The isolated polypeptide of claim 68, wherein the polypeptide is purified to at least about 80% homogeneity.

70. The isolated polypeptide of claim 65, wherein the polypeptide has polyglycerol- phosphate lipotechoic acid synthase activity.