WO2008113983A2

WO2008113983A2 - Cancer cell specific promoter comprising nf-kappa b binding sites

Info

Publication number: WO2008113983A2
Application number: PCT/GB2008/000906
Authority: WO
Inventors: Weiguang Wang
Original assignee: University Of Wolverhampton
Priority date: 2007-03-16
Filing date: 2008-03-14
Publication date: 2008-09-25
Also published as: WO2008113983A3; GB0705062D0

Abstract

The invention relates to a nucleic acid molecule which comprises a cancer cell specific promoter and an enhancer element which comprises more than one NF-ϰB binding site, to a rector comprising said nucleic acid, to a pharmaceutical composition comprising said vector and to a method of treating cancer comprising administration of said vector.

Description

TRANSCRIPTION ENHANCING MOLECULE

FIELD OF THE INVENTION

The invention relates to a nucleic acid molecule which comprises a cancer cell specific promoter and an enhancer element which comprises more than one NF-κB binding site, to a vector comprising said nucleic acid, to a pharmaceutical composition comprising said vector and to a method of treating cancer comprising administration of said vector.

BACKGROUND OF THE INVENTION

A significant limitation with respect to current cancer treatment is the ability to identify an agent which is specifically and selectively toxic to malignant cells. This limitation is one of the major obstacles for the success of cancer chemotherapy. Gene directed enzyme prodrug therapy (GDEPT) is one approach used to improve the therapeutic index of active anticancer drugs.

GDEPT involves a two step process. Firstly, a vector (typically a viral vector) containing a gene which encodes a prodrug activating enzyme (often referred to as a suicide gene) is administered to a cancer patient. The vector will be specific for cancer cells and administration therefore results in transduction of the vector into the cancer cell and consequent expression of the prodrug activating enzyme (often referred to as a suicide enzyme) . Secondly, a prodrug which is non-toxic or which has only minor toxicity to normal cells is administered to the cancer patient. The prodrug will be selected based on the ability to be converted by the suicide enzyme to an active, toxic metabolite in the transduced cancer cells. The cancer cells are therefore killed. It has also been found that the GDEPT approach may also kill bystander (i.e. untransduced) cells following prodrug activation by mechanisms which include direct transfer of activated drug through gap junctions, ingestion of apoptotic bodies from killed cells, effects on tumour vasculature or immunological responses. It is therefore possible that transduction does not need to occur in all cancer cells if untransduced neighbouring cells will also be killed.

The clinical application of the GDEPT approach is severely limited by the relatively weak transcriptional activity of the currently available cancer specific promoters (Rooseboom M et al. (2004) Pharmacol Rev 56, 53- 102; Aghi M et al (2000) J Gene Med 2, 148-64) .

Examples of prodrugs, prodrug activating enzymes and the resultant cytotoxic drugs activated by the enzymes are listed in Rooseboom, M et al. (2004) Pharmacol. Rev. 56, 53-102.

One example of a cancer specific promoter is the carcinoembryonic antigen (CEA) promoter. The CEA protein is not expressed or expressed at low levels in normal tissues and overexpressed in epithelial cancer cells

(Shively JE et al (1985) Crit Rev Oncol Hematol 2, 355-99) . Four cis- acting DNA binding elements mapped on the CEA promoter region within

300 bp upstream of the CEA translation starting point, especially the first 3 elements, have been shown to be essential for specific CEA transcription (Hauck W and Stanners CP. (1995) J Biol Chem 270, 3602-

10; Richards CA et al. (1995) Hum Gene Ther 6, 881-93) .

Utilization of the CEA promoter in an adenovirus vector for cytosine deaminase (CD) gene expression has been shown to improve the selectivity of the conversion of 5 ' -deoxy-5-fluorocytidine (5-DFCR) to 5- fluorouracil (5-FU) in CEA-expressing tumours (Richards CA et al.

(1995) Hum Gene Ther 6, 881-93; Lan KH et al (1996) Gastroenterology

111 , 1241-51) . However, the transcriptional activity of CEA in most cancer cell lines has been found to be 10- to 300-fold lower than that of

CMV and RSV viral promoters (Ueda K et al. (2001) Cancer Res 61 , 6158-62; Lan KH et al. (1996) Gastroenterology 111 , 1241-51) and adenovirus driven delivery of CEA promoter-suicide gene has largely been unsuccessful in vivo. Although a 2.1-kb CEA enhancer has been shown to increase CEA promoter activity, this is still highly dependent on the intrinsic level of CEA expression (Nyati MK et al. (2002) Cancer Res

62, 2337-42; Richards CA et al (1995) Hum Gene Ther 6, 881-93) . The use of this CEA enhancer-promoter-based prodrug approach in cells with low levels of CEA expression cannot induce sufficient CD activity to convert 5-DFCR to 5-FU other than at very low levels (Richards CA et al (1995) Hum Gene Ther 6, 881-93) .

WO 03/004063 (Georg-August Universitat Gotingen) describes the use of a nucleic acid construct comprising a therapeutic gene under the control of a NF-κB responsive promoter in targeting tumours positive for gonadotropin-releasing hormone. This system is related to the GDEPT approach but relies upon the further administration of a gonadotropin analogue to activate NF-κB and cause cytotoxicity rather than use a cancer cell specific promoter.

Low promoter activity is a major obstacle for using promoter-based GDEPT in vivo and in clinical trials. There is therefore a need for a cancer specific promoter having enhanced transcriptional activity.

SUMMARY OF THE INVENTION According to a first aspect of the invention there is provided a nucleic acid molecule which comprises a cancer cell specific promoter and an enhancer element which comprises more than one NF-κB binding site.

According to a second aspect of the invention there is provided a vector comprising a nucleic acid molecule as hereinbefore defined. According to a third aspect of the invention there is provided a pharmaceutical composition comprising a vector wherein said vector comprises a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule.

According to a fourth aspect of the invention there is provided a method of treatment of cancer which comprises administration to a patient in need thereof a therapeutically effective amount of: (a) a vector comprising a nucleic acid molecule having more than one

NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule; and

(b) a prodrug which is non-toxic or which has only minor toxicity to normal cells and is convertible to a cytotoxic agent by the prodrug activating molecule.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 : Schematic representation of the CEA promoter region and NF-κB enhancer and CEA promoter related constructs described herein. Figure IA describes the promoter region of the CEA gene and Figure IB describes the NF-κB enhancer and CEA promoter related constructs.

Figure 2: Results of the analysis of the expression of CEA and TP protein, CEA transcript and NF-κB activity in CRC and normal cells (Example 1) .

Figure 3: Results of the analysis of transcriptional activity and specificity of CEA205 and CEA421 basal promoters in combination with or without κB4 in CRC and normal human cell cultures (Example 2) . Figure 4: Results of the analysis of the TP enzyme status and cytotoxicity of 5 ' -DFUR in transiently transfected CRC cell lines (Example 3) .

Figure 5: Results of the comparison of TP protein (Figure 5A) and enzyme activity (Figure 5B) levels in TP cDNA stably transfected cancer cell lines (Example 4) .

Figure 6: Results of the analysis of the bystander killing effect of CRC cells transfected with CMV- or κB4-CEA205-driven TP cDNA (Example

5) .

Figure 7: Results of the comparison of transcriptional activities of κB4 and κB8 (Example 6) .

Figure 8: Schematic representation of the hTERT promoter region and NF- KB enhancer and hTERT promoter related constructs described herein.

Figure 9: Results of the analysis of the enhancing effect of κB8 on the transcriptional activity of the hTERT promoter (Example 7) .

Figure 10: Results of the analysis of the enhancing effect of κB8 on TP protein expression levels (Example 8) .

DETAILED DESCRIPTION OF THE INVENTION

According to one aspect of the invention there is provided a nucleic acid molecule which comprises a cancer cell specific promoter and an enhancer element which comprises at least one NF-κB binding site. According to a first aspect of the invention there is provided a nucleic acid molecule which comprises a cancer cell specific promoter and an enhancer element which comprises more than one NF-κB binding site.

Nuclear factor-kappa B (NF-κB; Ephrussi A et al. (1985) Science 227, 134-40) is a transcription factor which is composed of 5 subunits [p50/pl05, p52/pl00, p65 (ReIA) , ReIB and c-Rel] forming hetero- or homodimers. NF-κB is normally retained in the cytoplasm as an inactive complex through the direct binding of the natural inhibitor of KB (IKB; Karin M. (1999) Oncogene 18, 6867-74) . NF-κB activity remains at very low levels in normal cells and is overexpressed in human cancer cell lines and tumour tissues. NF-κB can also be activated by cytokines, UV radiation, reactive oxygen species and anticancer drugs (Karin M. (1999) supra) . All of these stimuli trigger phosphorylation and degradation of IKB and release NF-κB homo- or heterodimers which are then translocated into the nucleus and bind to a target DNA site (KB site; herein referred to as the NF-κB binding site) to influence downstream gene expression.

Surprisingly, the presence of more than one NF-κB binding site on the nucleic acid molecule provides a strong cis-acting enhancer sequence which results in a significant enhancement of the transcriptional activity of the cancer cell specific promoter.

In one embodiment, the NF-κB binding site comprises the following nucleotide sequence:

5 ^' -GGG-Pu-N₁-N₂-Py₁-Py₂-CC-S ^' wherein Pu represents a purine nucleotide (e.g. adenine and guanine) , Py₁ and Py₂ independently represent a pyrimidine nucleotide (e.g. thymine and cytosine) and N₁ and N₂ independently represent any nucleotide.

In one embodiment, Pu represents adenine.

In one embodiment, N₁ represents adenine, cytosine or thymine. In a further embodiment, N₁ represents adenine or cytosine (e.g. adenine) .

In one embodiment, N₂ represents thymine or adenine (e.g. thymine) .

In one embodiment, Py₁ represents thymine.

In one embodiment, Py₂ represents thymine or cytosine (e.g. thymine) .

In a further embodiment, the NF-κB binding site comprises the following nucleotide sequence:

5 ^' -GGG AAT TTC C-3 ^' (SEQ ID NO: 1 ; also known as KB) .

In an alternative embodiment, the NF-κB binding site comprises the following nucleotide sequences:

5'-AGA AAT TCC-3' ; or 5'-AGG AAA GTA C-3' (SEQ ID NO: 2) .

In a further alternative embodiment, the NF-κB binding site comprises the following nucleotide sequence:

5'-Pu,-GGAGA-Py-TT-Pu₂-3' wherein Pu, and Pu₂ independently represent a purine nucleotide (e.g. adenine and guanine) and Py represents a pyrimidine nucleotide (e.g. thymine and cytosine) .

In a further embodiment, the nucleic acid molecule comprises more than one NF-κB binding site. In a yet further embodiment, the nucleic acid molecule comprises 4 or 8 tandem copies of the NF-κB binding site. For example, the nucleic acid molecule may comprise 4 tandem copies of SEQ ID NO: 1 (which is also known as κB4) . In a further embodiment, the nucleic acid molecule may comprise 8 tandem copies of SEQ ID NO: 1 (which is also known as κB8) . The presence of multi-tandem copies of the NF-κB binding site further improves the enhancing activity of NF-κB.

In one embodiment, the more than one NF-κB binding sites are located upstream of the cancer cell specific promoter.

It will be appreciated that references to "nucleic acid molecule" refers to any nucleic acid moiety capable of resulting in transcription of a downstream gene. In one embodiment, the nucleic acid molecule comprises a cloned DNA fragment, plasmid DNA, a cDNA library, a PCR product or mRNA. It will be appreciated that the nucleic acid molecule defined herein may be obtained by a variety of procedures known to those skilled in the art by employing standard molecular biology techniques. For example, PCR or reverse transcription-PCR amplification using appropriately designed primers.

It will be appreciated that references to "cancer cell specific promoter" refer to any promoter which is capable of selectively promoting transcription of a downstream gene when introduced into a cancer cell. Selective transcription refers to a level of transcriptional activity in a cancer cell which is greater than the level of transcriptional activity in a non-cancer cell (e.g. normal cell) . For example, a level of transcriptional activity which is any one of 2, 4, 6, 8, 10, 20, 50 or 100 times greater in a cancer cell than a normal cell. Suitably, the promoter results in only negligible (i.e. undetectable) transcriptional activity in a normal cell.

It will be appreciated that a truncated form of the cancer cell specific promoter may be used. For example, the nucleic acid molecule may comprise the entire length of the promoter or it may comprise only the nucleotide sequence which constitutes the essential promoter elements (e.g. cis acting elements) required to result in transcription of a downstream gene.

It will be appreciated that the cancer cell specific promoter will be any one of a number of cancer cell specific promoters well known to those skilled in the art and which may be enhanced by the molecules of the invention. Suitable non-limiting and non-exhaustive examples of cancer cell specific promoters include: carcinoembryonic antigen (CEA) promoter, hTERT (human telomerase reverse transcriptase) , HRE (hypoxia response elements) , hTR (human telomerase RNA) , Survivin,

Mucl and the like.

In one embodiment, the cancer cell specific promoter is the carcinoembryonic antigen (CEA) promoter. In a further embodiment, the cancer cell specific promoter comprises a nucleotide sequence which constitutes all four CEA cis-acting elements (e.g. nucleotide positions - 303 to -143 of the CEA promoter) . In a yet further embodiment, the cancer cell specific promoter comprises nucleotide positions -421 to + 1 of the CEA promoter. In an alternative embodiment, the cancer cell specific promoter comprises a nucleotide sequence which constitutes three CEA cis-acting elements (e.g. nucleotide positions -245 to -143 of the CEA promoter) . In a further embodiment, the cancer cell specific promoter comprises nucleotide positions -245 to -41 of the CEA promoter. When the more than one NF-κB binding sites are located upstream from the cancer cell specific promoter, it is generally desirable that a small number of nucleotides are present between the more than one NF-κB binding site and the first cis-acting element of the CEA promoter.

In an alternative embodiment, the cancer cell specific promoter is the human telomerase reverse transcriptase (hTERT) promoter. Telomeres are tandemly repeated DNA sequences [(TTAGGG)n] located at chromosome ends. The telomeric DNAs progressively shorten with each cell division in normal human somatic cells because of little or no telomerase activity to synthesize new telomeres. In contrast, most cancer cells possess high telomerase activity and have mechanisms to compensate for telomere shortening and allowing them to stably maintain their telomeres and grow indefinitely. Thus, activation of telomerase is a rate-limiting step in human carcinogenesis, and telomerase repression in normal human somatic cells can act as a tumor-suppressive mechanism. Two major components of the human telomerase enzyme are thus far identified: the RNA component (hTR) , which acts as an intrinsic template for telomeric repeat synthesis and a telomerase catalytic subunit, hTERT. Since the specific expression of telomerase in cancer cells, the telomerase promoters have been investigated for human cancer gene therapy. Compared with hTR, the hTERT promoter has much higher cancer specificity but much weaker transcriptional activity. Although it is widely accepted that the hTERT promoter is highly cancer specific, the very weak transcriptional activity limits its cancer gene therapy application.

In one embodiment, the nucleic acid molecule additionally comprises a gene encoding a prodrug activating molecule operatively linked to the promoter thereto. It will be appreciated that the term "prodrug activating molecule" refers to a molecule which is capable of modification of a prodrug (which will ideally be non-toxic or have only minor toxicity to normal cells) to an active, toxic metabolite. It will be appreciated that references to "non-toxic" or "minor toxicity" refer to a toxicity level which may be tolerated by a cancer patient and which would result in a medicament which would be approved by the medicines regulatory authorities (e.g. the FDA or MHRA) . In a further embodiment, the prodrug activating molecule is a prodrug activating enzyme.

Examples of prodrug activating molecules include human (e.g. endogenous) enzymes such as oxidoreductases (e.g. aldehyde oxidase, amino acid oxidase, cytochrome P450 reductase, DT-diaphorase, cytochrome P450 and tyrosinase) , transferases (e.g. thymidylate synthase, thymidine phosphorylase, glutathione S-transferase and deoxycytidine kinase) , hydrolases (e.g. carboxylesterase, alkaline phosphatase and β- glucuronidase) and lyases (e.g. cysteine conjugate β-lyase) as well as non- human enzymes such as nitroreductase, cytochrome P450, purine nucleoside phosphorylase, thymidine kinase, alkaline phosphatase, β- glucuronidase, carboxypeptidase, penicillin amidase, β-lactamase, cytosine deaminase and methionine γ-lyase.

The prodrugs which are activated by the above mentioned prodrug activating molecules and the resultant metabolites are described in Rooseboom, M et al. (2004) Pharmacol. Rev. 56, 53-102, the drugs, prodrugs, prodrug activating molecules and processes of which are herein incorporated by reference.

In one embodiment, the prodrug activating molecule is thymidine phosphorylase (TP) which catalyses the conversion of 5 ' -deoxy-5- fluorouradine (5 ' -DFUR) to 5-fluorouracil (5-FU) . The nucleic acid molecule may additionally comprise one or more transcriptional regulatory sequences, untranslated leader sequences, sequences encoding cleavage sites (e.g. restriction sites) , recombination sites, transcriptional terminators or ribosome entry sites.

According to a second aspect of the invention there is provided a vector comprising a nucleic acid molecule as hereinbefore defined.

It will be appreciated that the vector will comprise any suitable molecule capable of carrying the nucleic acid molecule into a host cell to allow transcription. In one embodiment, the vector is a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome. In a further embodiment, the plasmid is a virus (e.g. a retrovirus or an adenovirus) .

According to a third aspect of the invention there is provided a pharmaceutical composition comprising a vector wherein said vector comprises a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule.

In one embodiment, the pharmaceutical composition is an injectable composition. In a further embodiment, the pharmaceutical composition additionally comprises one or more pharmaceutically acceptable carriers, excipients, buffers, adjuvants, stabilizers, or other materials.

Pharmaceutical compositions of the invention can be formulated in accordance with known techniques, see for example, Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA, USA. According to a fourth aspect of the invention there is provided a method of treatment of cancer which comprises administration to a patient in need thereof a therapeutically effective amount of:

(a) a vector comprising a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule; and

(b) a prodrug which is non-toxic or which has only minor toxicity to normal cells and which is convertible to a cytotoxic agent by the prodrug activating molecule.

The method of the invention is based primarily on the GDEPT approach which allows the vector to specifically target cancer cells. The presence of the more than one NF-κB binding sites advantageously enable transcription of high levels of the prodrug activating molecule which therefore improves the efficiency of the production of the cytotoxic agent and consequently the efficiency of cancer cell death.

It will be appreciated that step (b) should be performed once sufficient time has elapsed since step (a) has been performed to allow transduction of the vector into the cancer cells and transcription of the gene encoding the prodrug activating molecule. In one embodiment, step (b) is performed more than 12 hours after step (a) . In a further embodiment, step (b) is performed at least 24 hours after step (a) .

In one embodiment, the vector in step (a) and the prodrug in step (b) are both administered by injection. In a further embodiment, the vector and the prodrug are administered intravenously or directly administered to the tumour. The non-toxic and selective benefits of the invention provide the advantage that the vector and the prodrug do not need to be administered specifically at the site of the tumour (which often is not possible) . In an alternative arrangement, it may be envisaged that the vector and the prodrug may be administered at the same time via differing routes of administration. For example, the vector may be administered intravenously and the prodrug may be administered orally as a controlled release formulation. The controlled release formulation will be selected such that the prodrug will be released into the blood stream at an appropriate time following administration of the vector in step (a) .

In one embodiment the vector is as defined hereinbefore.

In one embodiment, the gene encodes thymidine phosphorylase (TP) , the prodrug is capecitabine (CAP) and the cytotoxic agent is 5-fluorouracil (5- FU) .

Capecitabine (CAP) , a prodrug of 5-fluorouracil (5-FU; Malet-Martino M and Martino R. (2002) Oncologist 7, 288-323; Petty RD and Cassidy J. (2004) Curr Cancer Drug Targets 4, 191-204) , has been approved as the first line therapeutic agent for colorectal cancer chemotherapy. CAP is first converted into 5-FU in vivo by a three-enzyme-catalysed process. CAP is converted to 5 '-deoxy-5-fluorocytidine (5 ^'-DFCR) and then to 5 ^' - deoxy-5-fluorouradine (5 ' -DFUR) by carboxylesterase and cytosine deaminase (CD) respectively. Both conversions take place in the liver and are not limiting steps for efficient conversion of CAP to 5-FU. The final and critical step is the conversion of 5 ' -DFUR to 5-FU by thymidine phosphorylase (TP) . TP is currently only detected in 24% to 66% of tumours (Evans TR et al. (2002) Ann Oncol 13, 1469-78) , therefore, the method of the present invention is believed to provide an enhancement of TP expression and consequently more efficient cancer cell death.

The invention also provides a use of a vector comprising a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule in the treatment of cancer.

The invention also provides a use of a vector comprising a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule in the manufacture of a medicament for the treatment of cancer.

The invention also provides a pharmaceutical composition comprising a vector wherein said vector comprises a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule for use in the treatment of cancer.

Examples of cancers in which the invention may be useful include: Cardiac: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma) , myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma) , alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma;

Gastrointestinal: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma) , stomach (carcinoma, lymphoma, leiomyosarcoma) , pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma) , small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma) , large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma) ; Genitourinary tract: kidney (adenocarcinoma, Wilm's tumor (nephroblastoma) , lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma) , prostate (adenocarcinoma, sarcoma) , testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma) ; Liver: hepatoma (hepatocellular carcinoma) , cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma; Bone: osteogenic sarcoma (osteosarcoma) , fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma) , multiple myeloma, malignant giant cell tumor chordoma, osteochronfroma (osteocartilaginous exostoses) , benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors;

Nervous system: skull (osteoma, hemangioma, granuloma, xanthoma, osteitis deformans) , meninges (meningioma, meningiosarcoma, gliomatosis) , brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma (pinealoma) , glioblastoma multiform, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors) , spinal cord neurofibroma, meningioma, glioma, sarcoma);

Gynecological: uterus (endometrial carcinoma), cervix (cervical carcinoma, pre-tumor cervical dysplasia) , ovaries (ovarian carcinoma (serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma) , granulosa-thecal cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, malignant teratoma) , vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma (embryonal rhabdomyosarcoma) , fallopian tubes (carcinoma) ; Hematologic: blood (myeloid leukemia (acute and chronic) , acute lymphoblastic leukemia, acute and chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome) , Hodgkin' s disease, non-Hodgkin's lymphoma (malignant lymphoma) , B-cell lymphoma, T-cell lymphoma, hairy cell lymphoma, Burkett's lymphoma, promyelocytic leukemia; Skin: malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, psoriasis;

Adrenal glands: neuroblastoma; and Other tumors: including xenoderoma pigmentosum, keratoctanthoma and thyroid follicular cancer. It will therefore be appreciated that treatment of cancer includes treatment of cancerous cells, including cells afflicted by any one of the above-identified conditions.

In one embodiment, the cancer is colorectal cancer.

The invention will now be illustrated with reference to the following non- limiting Examples in which:

MATERIALS AND METHODS

Cell lines and chemicals

The human CRC cell lines HT29, HCT15, HCT116, LoVo, Caco2, DLD- 1 and RKO were obtained from ATCC. H630 were generously provided by Prof. P. G. Johnstone. The cancer cell lines were cultured in DMEM medium supplemented with 10% FCS, 50 units/ml penicillin, 50 μg/ml streptomycin. The normal human mammary epithelial cells (HMEC, Clonetics, USA) , human primary endothelial cells (HUVEC, Clonetics, USA) , normal human nasal epithelial cells (HNEpC, PromoCell, Heidelberg, Germany) were subcultured and maintained according to the instructed culture system for each kind of cell. The human endothelial cell line EAhy926 was kindly provided by Dr Angel Armesilla (University of Wolverhampton, UK) and cultured in RPMI 1640 medium supplemented with 10% FCS, 50 units/ml penicillin, 50 μg/ml streptomycin. Thymine, thymidine, 5 ' -DFUR and MTT were purchased from Sigma (Dorset, UK) . Construction of luciferase and TP expression vectors

The human CEA promoter cDNA (pDRIVE-hCEA) purchased from InvivoGen (San Diego, CA, USA) was subcloned by polymerase chain reaction (PCR) . The CEA basal promoter sequences described herein are numbered relative to the middle nucleotide of the first ATG (Schrewe H et al. (1990) MoI Cell Biol 10, 2738-48) . Two basal CEA promoter sequences (CEA205: -245 to -41 and CEA421 : -421 to + 1) were used to construct luciferase reporter vectors in combination with or without NF- KB enhancer elements. As shown in Figure 1 , both basal promoter sequences contain the essential CEA promoter region. CEA205 covered the first 3 and CEA421 covered all 4 cis-acting elements, respectively. The BgIII and HindIII restriction sites were introduced into the forward and reverse primers respectively.

The primers used are as follows (the underlined sections refer to restriction sites) :

CEA205 forward: 5 ' -GCG CAG ATC TGA AAA TAG AAG GGA AAA AAG-3 ' (SEQ ID NO: 3) ;

CEA205 reverse: 5 ' -GCG CAA GCT TGA GTT CCA GGA ACG TTT- 3 ' (SEQ ID NO: 4) ;

CEA421 forward: 5 ' -GCG CAG ATC TAG AGC ATG GGG AGA CCC GGG A-3 ' (SEQ ID NO: 5) ; and

CEA421 reverse: 5 ' -GCG CAA GCT TGG TCT CTG CTG TCT GCT CTG TC-3 ' (SEQ ID NO: 6) .

The PCR fragments were subcloned downstream of 4 tandem NF-κB binding sites (κB4; 5 ' -GGGAATTTCC-3 ' (SEQ ID NO: 1) x 4) replacing the TATA-like promoter fragment into a commercially available pNF-κB- Luc vector (BD Biosciences, CA, USA) . In order to produce the pκB4- Luc vector without the essential promoter sequence, the TATA-like promoter sequence was removed by restriction enzyme cutting and the backbone plasmid DNA was blunt-ended using DNA polymerase Klenow fragment (Promega, Southampton, UK) and religated. To produce the expression vectors without NF-κB enhancer, the KB binding sites in pκB4- CEA205-Luc and pκB4-CEA421-Luc were removed and the backbones religated as described above. The TP cDNA (pCMV6-XL5/TP) was purchased from Origene (MD, USA). The TP cDNA was subcloned into pcDNA3 (Invitrogen, Paisley, UK) using EcoRI/Xbal to develop pcDNA3-TP in which TP cDNA is under the control of CMV promoter. To develop TP expression vectors for transient transfection, the luciferase cDNA in the above luciferase reporter gene expression vectors was replaced with TP cDNA derived from pcDNA3-TP by Hindlll/Xbal cutting. For stable expression of TP in CRC cell lines, the CEA205-TP and κB4-CEA205-TP fragments were subcloned into a pFastBacDual vector (Invitrogen, Paisley, UK) from which the plO and polyhedrin promoters have been removed (pFastBacDualΔpromoter) . The integrity of the sequences of the constructs was verified by DNA sequencing.

(a) Construction of pκB4-hTERTcore-TP and pκB4-hTERTcore-Luc shuttle vectors

The hTERTcore DNA sequence was amplified by PCR from pd2NTRhTERT249 plasmid kindly provided by Dr Nicol Keith, Beatson

Institute for Cancer Research, Glasgow, UK using the primers with BgIII and HindIII restriction enzyme cutting site overhangs. To produce the pκB4-hTERTcore-Luc and pκB4-hTERTcore-Luc vectors, the PCR product, pκB4-CEA205-TP and pκB4-CEA205-Luc vectors were cut with restriction enzymes BgIII and HindIII. After agarose gel purification, the CEA205 fragment in both vectors was replaced by the hTERTcore PCR product and backbone vector ligation. The sequences of primers for PCR amplification were as follows:

BglII-hTERT-F: 5'-TCTTCCCAGATCTAGTGGATTCGCGGGCACAGA- 3' (SEQ ID NO: 11) ; HindIII-hTERT-R: 5'- TCTTGGAAGCTTGACGCAGCGCTGCCTGAAAC-3' (SEQ ID NO: 12) .

(b) Construction of pκB8-CEA205-TP, pκB8-CEA205-Luc, pκB8- hTERT-TP and pκB8-hTERTcore-Luc constructs

The 132 bases single strand DNA template containing 8 KB sites: 5 ^' -

GACTCATGGTACCGAGCTCTTACGCGTGCTAGCGGGAATTTCCGG GAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTT CCGGGAATTTCCGGGAATTTCCAGATCTGCATCATCGATAC^' (SEQ ID NO: 13) was synthesised and PCR amplified using primers with Kpnl and BgIII overhangs:

κB8-Forward-KpnI: 5 ^' -GACTCATGGTACCGAGCTCT^ ^' (SEQ ID NO: 14) ; and

κB8-Reverse-BglII: 5 ' -GTATCGATGATGCAGATCTG-3 ^' (SEQ ID NO 15) .

The pκB4-CEA205-TP, pκB4-CEA205-Luc, pκB4-hTERTcore-TP, pκB4- hTERTcore-Luc and the κB8 PCR product were Kpnl/Bglll digested. After gel purification, the κB8 fragment was subcloned into the backbone vectors to replace κB4 and produce ρκB8-CEA205-TP, pκB8-CEA205- Luc, pκB8-hTERTcore-TP and pκB8-hTERTcore-Luc. (c) Construction of κB8-Luc construct

To construct κB8-Luc, the hTERTcore sequence was removed from pκB8- hTERTcore-Luc using restriction enzymes BgIII and Hindlll. The backbone plasmid was end-blunted using DNA polymerase Klenow fragment and religated.

(d) Construction of phTERTcore-Luc and phTERTcore-TP constructs The phTERTcore-Luc and phTERTcore-TP were constructed by removing the κB8 sequence from pκB8-hTERTcore-Luc and pκB8-hTERTcore-TP using Kpnl/Bglll, backbone end-blunted using Klenow polymerase and then religated.

The phTR-Luc vector was kindly provided by Dr Nicol Keith, Beatson Institute for Cancer Research, Glasgow. The pSV40-Luc vector was purchased from Promega Ltd.

TP-activity assay The TP enzyme activity was assayed using the method published by Yoshimura, A et al. (1990) Biochim Biophys Acta 1034, 107-13 with minor modification. Briefly, 10 μl of total protein extracted in RIPA buffer was mixed with 90 μl of reaction buffer consisting of 10 mM thymidine, 10 mM KH₂PO₄ (pH 7.4) . The reaction was incubated at 37°C for 2 hours and terminated by addition of 400 μl of 0.2 N NaOH. The concentration of thymine converted from thymidine was measured spectrophotometrically at 300 nm. The amount of thymine in the reaction was calculated from a standard curve plotted from known thymine concentrations. The TP activity was presented as nmol thymine/mg protein/hr. Western blot

The total protein was extracted in RIPA buffer. The lysate was centrifuged for 5 minutes in a microfuge and the supernatants retained. The protein (200 μg/cell line) was electrophoresed through a 10% SDS- PAGE and transferred to a PVDF membrane (Millipore, Hertfordshire, United Kingdom) using a semi-dry electrophoretic transfer chamber (Millipore) . The nonspecific binding was blocked by incubating the membranes for 1 hour in TBS-T with 5% non-fat milk which was also used to dilute primary (TP, Novocastra, Newcastle upon Tyne, UK, 1 :250; CEA, Abeam, Cambridge, UK, 1 :2000) and secondary (Amersham, Little Chalfont, UK; 1 :5,000) antibodies. The signal was detected using an ECL Western blotting detection kit (Amersham) , and visualized by exposure to X-ray film.

Total RNA isolation and RT-PCR

Cells (70% confluent) cultured in 25 cm flasks were harvested by trypsinisation. Total RNA was isolated using TRIzol reagent (Invitrogen, Paisley, UK) according to the manufacturer's protocols. The CEA mRNA expression levels in different cell lines were determined using the one-step Access RT-PCR system (Promega, Southampton, UK) following the instruction of the supplier. The CEA-specific primers:

forward: 5 ' -CGC CAA AAT CAC GCC AAA TAA TAA-3 ' (SEQ ID NO: 7); and

reverse: 5 ' -ACC CCA ACC AGC ACT CCA ATC AT-3 ^' (SEQ ID NO:

8) ,

were used to amplify a 171 bp PCR product. The human housekeeping gene GAPDH was used as the RNA loading control which was amplified by the same RT-PCR system using the following primers: forward: 5 ' -CAT GAC AAC TTT GGT ATC GTG-3 ^' (SEQ ID NO: 9) ; and

reverse: 5 ' -GTG TCG CTG TTG AAG TCA GA-3 ^' (SEQ ID NO: 10) .

The RT-PCR products were separated on a 1% agarose gel and the bands visualized and photographed under UV light.

MTT assay

For in vitro cytotoxicity analysis, the overnight cultured cells (5,000/well in 96-well flat-bottomed microtiter plates) were constantly exposed to 5 ^' - DFUR for 72 h subjected to a standard MTT assay as described in Plumb JA et al. (1989) Cancer Res 49, 4435-40. To test the effect transient expression of TP on cytotoxicity of 5 ' -DFUR, the cells were transiently transfected with TP expression vectors for 48 hours and subjected to MTT assay. To determine the bystander effect, the IC₅₀ of 5 ^' -DFUR to the mixtures of pcDNA3 and pcDNA3-TP or pκB4-CEA205-TP transfected H630 and RKO cells at different ratios (0: 100, 5:95, 10:90, 20:80, 40:60, 60:40 and 100:0) was measured by MTT analysis.

In vitro transfection

Stable transfection: CRC cell lines (1 x 10⁶/well) were cultured in 6-well plates overnight and transfected with pcDNA3-TP or pFastBacDualΔpromoter/κB4-CEA205-TP using Lipofectamine 2000 (Invitrogen, Pasley, UK) following the manufacturer's instructions. The pcDNA3 or pFastBacDual empty vector transfected cells were used as a negative control. The successfully transfected clones were selected in G418 (lmg/ml) . After TP enzyme activity assay and western blotting analyses, the positive clones were selected and cultured in G418- containing medium to enlarge the cell population. Two positive clones were subjected to further analysis.

Transient transfection: H630 and RKO cells (2 x 10⁶/flask) were cultured in 25 cm tissue culture flasks overnight and transfected with pcDNA3, pcDNA3-TP, pκB4-TP, pCEA205-TP, pκB4-CEA205-TP, pκB8- hTERTcore-TP and phTERTcore-TP using Lipofectamine 2000 following the manufacturer's instruction. After 48 hours transfection, the transfected cells were collected and split for MTT, western blotting and TP activity assays respectively.

Luciferase reporter gene assay

All the transfections were performed using Lipofectamine transfection reagent according to the instruction of the manufacturer (Invitrogen, Paisley, UK) . Briefly, 5 x lOVwell cells were cultured in 24-well plates overnight. One set of luciferase reporter vectors (pκB4-Luc, pCEA205- Luc, pκB4-CEA205-Luc, pNF-κB-Tal-Luc and pGL3-Basic; 4μg/well) were co-transfected with 0.04 μg/well pSV40-Renilla DNA as an internal control to normalize the transcription activity of the reporter vectors. A further set of luciferase reporter vectors (pκB8-Luc, pκB4-Luc, pSV40- Luc, pκB8-CEA205-Luc, pκB8-hTERTcore-Luc, phTERTcore-Luc, phTR-Luc and pGL3-Basic; 0.8μg/well) were co-transfected with 0.008 μg/well pSV40-Renilla DNA, an internal control for normalization of the transcriptional activity of the reporter vectors. Forty-eight hours after transfection, the cells were lysed and luciferase activities were determined using Dual Luciferase Assay reagents (Promega, Southampton, UK) according to the manufacturer's instruction. The adjusted luciferase activity was calculated using the formula ALU = FW x (RM/RW) ; FW = firefly luciferase activity of the well, RM = mean renilla activity of the wells from same cell line; and RW = renilla luciferase activity of the well. The relative luciferase activity in each well was normalized to pSV40-Renilla using the formula of Ln = L/R (Ln: normalized lucif erase activity; L: luciferase activity reading and R: Renilla activity reading) . The Ln will be further standardized by the transcriptional activity of the pGL3-Basic using the formula of RLU = Ln/pGL3-Basic (RLU: relative luciferase unit) . AU transfections were performed in triplicate and all experiments were repeated for at least 2 times.

EXAMPLES

Example 1

Investigation of CEA and TP gene expression and the transcriptional activity of NF-κB in CRC and normal cells

In order to evaluate the efficacy of NF-κB-CEA enhancer-promoter system in 5 ' DFUR prodrug based GDEPT, the background status of TP (protein) , CEA (mRNA and protein) and NF-κB (transcriptional activity) in cancer and normal cells was determined. TP is the key enzyme for converting the prodrug, 5 'DFUR, into its active form, 5FU, and also the limiting factor for the success of CAP in cancer treatment. Western blotting was performed (using Vinculin as control) and in a panel of 8 CRC cell lines, only two (LoVo and HCT116) expressed the 55 kDa TP protein at moderate levels (25%) . No TP protein expression was detected in the remaining 6 CRC and normal endothelial and epithelial cells (Fig. 2A) . The 180 kDa CEA protein was detected in 4 CRC cell lines (50%) . RT-PCR detection of CEA mRNA transcription was performed (using GAPDH as control) and although CEA mRNA was detected in most of the CRC cell lines (7/8, Fig. 2B), it was only expressed at relatively high levels in 3 cell lines (LoVo, Caco2 and HT29) and at very low levels in the other 4 cell lines (DLD-I , HCTl 16, H630 and RKO) . In contrast with cancer cell lines, no CEA protein and mRNA were identified in normal cells (Fig. 2A and 2B) . The transcriptional activity of NF-κB in CRC and normal cells was also examined. The high NF-κB activity was detected in all 8 CRC cell lines by the luciferase reporter gene assay. In contrast, the normal human cells only demonstrated negligible background levels of NF-κB activity (Fig. 2C).

Example 2

Analysis of the transcriptional activity and specificity derived from different combinations of CEA basal promoters and NF-κB enhancer The transcriptional activity of chimeric enhancer-promoter system described in Figure 1 were investigated. In this system, the basal CEA promoter sequences were placed downstream of the 4 directly linked NF- KB DNA binding sites in tandem (κB4) . There are 4 cis-acting DNA binding sites located within -303 to -143 base pairs of the CEA promoter region. The transcription factors SpI , Spl-like and USF bind to the first 3 DNA binding sites and the transcription factors for the 4^lh element are still not clear (Hauck W and Stanners CP. (1995) J Biol Chem 270, 3602-10) .

The transcriptional activity and specificity of the luciferase reporter vectors driven by the basal CEA promoter regions covering the first 3 (CEA205) or 4 (CEA421) DNA binding elements in combination with or without κB4 enhancer (Fig. 1) was compared. The transcriptional activities of the κB4 enhancer, CEA basal promoters (CEA205 and CEA421) and chimeric enhancer-promoter elements (κB4-CEA205 and κB4-CEA421) were examined in CRC and normal human endothelial and epithelial cells. For example, the cells were co-transfected with luciferase expression vectors (ρCEA205-Luc, pκB4-CEA205-Luc, pCEA421-Luc, pκB4-CEA421-Luc and pGL3-Basic) and Renilla expression vector (pRL3- SV40) . The luciferase activity of each transfection was normalized by the Renilla reading. The luciferase activity is represented by the ratio of the specific promoter over the activity of pGL3-Basic. The results are shown in Figure 3A wherein each column represents the mean of three measurements and the bar represents the SD. As showed in Fig.3 A, both CEA205 and CEA421 basal promoters demonstrated selective transcriptional activity in all CRC cell lines but not in normal endothelial and epithelial cells. In combination with κB4, the transcriptional activity of both CEA205 and CEA421 in cancer cell lines was enhanced. The κB4 enhancer demonstrated significantly higher enhancing effect on the CEA205 promoter than that on CEA421 promoter (Fig. 3A). The κB4 enhancer alone showed very low transcriptional activity in all tested cancer cell lines (Table 1).

Table 1: Transcriptional activities of κB4, CEA205 and κB4-CEA205 in CRC and normal cells

DLD-I RKO EAhy92 HUVEC HMEC HNEpC 6 pκB4- 34.4±3 4 12 .2±0. 3 l.O±O. l.O±O 08 1 .o±o 08 0.7±0. Luc 5 003 pCEA 191.3 + 1 42 .0±2. 3 l.l±O. l.l±O 02 1 .l±O 02 2.3±0.

205- 8.9 6 01

The data in Table 1 represent mean relative luciferase units from 3 replicates + SD.

Only background transcriptional activity of CEA promoters, κB4 enhancer and the chimeric κB4-CEA enhancer-promoter cassette was detected in the normal cells (Fig. 3A and Table 1) . Furthermore, the transcriptional activity of κB4-CEA205 was compared with a strong SV40 virus promoter. To avoid the transcriptional interference between the SV40 promoter in pRL3-SV40 and pGL3-SV40, the CRC cell lines were singly transfected with pκB4-CEA205 and pGL3-SV40. Equal amount of protein (10 μg) from each transfection was subjected to luciferase assay. The transcriptional activity of κB4-CEA205 enhancer-promoter system was highly comparable to that of the strong SV40 virus promoter in all CRC cell lines (Fig. 3B) . The SV40 promoter also demonstrated high transcriptional activity in a panel of 7 normal human cell lines and primary cell cultures. In contrast, the transcriptional activity of pκB4- CEA205 in normal cells was negligible (Fig. 3C) . Therefore, transcriptional activity in cancer cell lines was found to be highly increased by the combination of κB4 and CEA promoters while simultaneously retaining the cancer-targeting specificity. Furthermore, the transcriptional efficacy of κB4-CEA205 was found to be comparable to that of the strong viral promoter CMV. Example 3

Analysis of 5 'DFUR cytotoxicity to the TP expression vector transiently transfected CRC cell lines

In the TP expression vectors, the TP cDNA was placed under the control of the CMV, CEA205, κB4-CEA205 or κB4 promoters, respectively. Two CRC cell lines with low CEA expression (H630 and RKO; see Figure 2B) were transiently transfected with pκB4-TP, pCEA205-TP, pκB4-CEA205- TP, pcDNA3-TP or pcDNA3 empty vector. After 48 hours transfection, the cells were harvested and subjected to different analysis. High levels of TP protein were detected in both pcDNA3-TP and pκB4-CEA205-TP transfected cells. Only very low levels of TP protein were detected in the pCEA205-TP transfected cells and no TP protein was detected by western blotting analysis (using Vinculin as a control) in the pcDNA3 and pκB4- TP transfected cell lines (Fig. 4A) . In line with protein expression levels, the pcDNA3-TP and pκB4-CEA205-TP transfected cells also possessed high TP enzyme activity (Fig. 4B) . The TP activity and protein expression patterns were highly consistent with one another in the transfected cells. The transiently transfected cells were then subjected to MTT analysis. In comparison with the control (pcDNA3 transfected) , the pκB4-CEA205-TP transfected RKO and H630 cells were 7.6 and 10 times more sensitive to the 5 ^' DFUR-induced cytotoxicity. The cytotoxicity of 5 'DFUR to the pκB4-CEA205-TP and pcDNA3-TP transfected cell lines was highly comparable. In comparison with pcDNA3-TP and pκB4-CEA205-TP transfected cells, the pκB4-TP and pCEA205-TP transfection only slightly increased the cytotoxicity of 5 ' DFUR to the CRC cell lines (Fig. 4C, 4D and Table 2) . The curves in Figures 4C and 4D were derived from 3 replicates and bars represent SD. Table 2: The cytotoxicity of 5 -DFUR on the transiently transfected CRC cell lines

The data in Table 2 represent the mean IC₅₀ (μm) of 5 ^'-DFUR from 3 replicates ± SD.

Example 4

Comparison of 5 'DFUR cytotoxicity in TP expression vector stably transfected CRC cell lines In order to produce cell lines for the bystander effect analysis in Example 5, the H630 and RKO cell lines were also stably transfected with pFastBacDualΔpromoter/κB4-CEA205-TP or pcDNA3-TP. Two positively transfected clones (designated pFBD/KCT-1 and pFBD/KCT-2 for pJFastBacDualΔpromoter/κB4-CEA205-TP) were selected from each cell line for further study. Western blotting was performed using Vinculin as a control and the TP protein expression and TP enzyme activity in the pFastBacDualΔpromoter/κB4-CEA205-TP transfected cell lines were found to be high and comparable to that in the pcDNA3-TP transfected cells (Figure 5 A and B) . Furthermore, the cytotoxicity of 5 ' DFUR to the pcDNA3-TP and pFastBacDualΔpromoter/κB4-CEA205-TP stably transfected cell lines was determined by MTT analysis. The pFastBacDualΔpromoter/κB4-CEA205-TP stable transfection significantly enhanced the cytotoxicity of 5 ' DFUR to both RKO (10-fold) and H630 (12-fold) cell lines. The IC₅₀S of 5 ' DFUR to the pFastBacDualΔpromoter/κB4-CEA205-TP transfected cells were similar to those of pcDNA3-TP transfected cells (Table 3) .

Table 3: The cytotoxicity of 5 -DFUR on the stably transfected CRC cell lines

The data represent the mean IC₅₀ (μm) of 5 ^' -DFUR from 3 replicates ± SD. Cl and C2: clones 1 and 2.

Example 5

Analysis of the bystander effect of pFastBacDualΔpromoter/κB4- CEA205-TP transfected CRC cells on neighbour cells

Low transfection rate is a major barrier for the success of cancer GDEPT in the clinic. It has been reported that the small portion of CMV promoter-driven TP transfected cells can effectively convert 5 ' DFUR into 5-FU which can be released and perform cytotoxic effect onto the neighbour cells (bystander effect; Patterson AV et al. (1995) Br J Cancer 72, 669-75) . Figure 6 shows that when composing only 5% pcDNA3-TP or pFastBacDualΔρromoter/κB4-CEA205-TP transfected RKO or H630 in whole population, the sensitivity of H630 (Fig 6A) and RKO (Fig 6B) cell lines to 5 'DFUR was significantly enhanced. The curves shown in Figure 6 were derived from 3 replicates and the bars represent SD. If the percentage of the transfected cells was further increased, the IC₅₀S of 5 ^' DFUR in these cells were further reduced but the curves significantly levelled off. The bystander effect of pFastBacDualΔpromoter/κB4- CEA205-TP and pcDNA3-TP transfected cells was comparable.

Example 6 Comparison of Transcriptional activities of κB4 and κB8

The kB4 enhancer was replaced with a kB8 enhancer in which 8 NF-κB binding sites were tandemly linked together. The results of this comparison may be seen in Figure 7 which demonstrated that in comparison with the κB4 enhancer, the κB8 enhancer manifested higher enhancing effect on CEA promoter in most of the 9 colorectal cancer cell lines. Similar to the κB4 enhancer, the κB8 enhancer alone shows very weak transcriptional activity in all cancer cell lines.

Example 7 Analysis of the enhancing effect of the kB8 enhancer on the transcriptional activity of the human telomerase promoter

Figure 8 shows the schematic structure of the constructs used in this analysis. The 245 bp core hTERT promoter sequence (between 210 bp upstream and 35 bp downstream of the transcriptional starting point of the hTERT gene) was used in this analysis. This region of the hTERT promoter cDNA fragment is known to contain all of the essential transcriptional elements which determine the transcriptional activity and cancer specificity (Takakura, M. et al. (1999) Cancer Research; 59(3), 551-7; Horikawa, I. et al. (1999) Cancer Research 59(4), 826-30) . The luciferase or thymidine phosphorylase cDNAs were constructed downstream of the hTERTcore promoter in combination with or without kB binding sites (4 or 8 in tandem) .

The transcriptional activity of kB8-hTERTcore, hTERTcore and hTR was compared in a panel of 21 cancer cell lines (colon: H630, HT29, HCT15, Caco2, LoVo, BE, DLD-I ; breast: MDA-MB-231 , MCF7, T47D, ZR75 ; Lung: CALU, L-DAN, NCI-H23, NCI-H125, WIL; brain: IN1528, IN859, G-CCM; Kidney: ACHN; Skin: A431) and normal cell lines (fibroblasts: MRC5, LF114, EWLU, WI38; endothelium: Eahy926) . The results of this analysis are shown in Figure 9, wherein the adjusted luciferase values of all cell lines are shown in Figure 9A and the relative luciferase values of the cancer cell lines are shown in Figure 9B. These results demonstrate that the kB8 enhancer improved the transcriptional activity of the hTERTcore promoter. The activity of kB8-hTERTcore appears to be higher or comparable to that of the strong hTR promoter (Zhao, JQ et al. (1998) Oncogene, 16(10) , 1345-50) . By contrast, the transcriptional activity of kB8-hTERTcore remained at very low levels in the normal cell lines.

Example 8

Analysis of the enhancing effect of the kB8 enhancer upon TP protein expression levels

Colon cancer (H630 and RKO) and normal endothelial (Eahy926) cell lines were transiently transfected with different expression vectors followed by Western blotting (using Vinculin as a control) . The results of this analysis are shown in Figure 10 which demonstrates that the pkB8- hTERTcore-TP transfected cancer cell lines expressed significantly higher TP protein than those transfected with phTERTcore-TP. The pcDNA3-TP (CMV promoter driven TP) and pcDNA3 (empty vector) transfected cells were used as positive and negative controls, respectively. There was no TP expression in phTERTcore and pkB8-hTERTcore-TP transfected normal cell line. Abbreviations

5-FU: 5-fluorouracil

5 ' -DFCR: 5 ' -deoxy-5-fluorocytidine

5 ' -DFUR: 5 ' -deoxy-5-fluorouradine

CAP: capecitabine

CD: cytosine deaminase

CEA: carcinoembryonic antigen

CRC: colorectal cancer

GDEPT: gene-directed enzyme prodrug therapy hTERT: human telomerase reverse transcriptase

MTT: Tetrazolium-based semiautomated colorimetric

NF-κB: nuclear factor-kappa B

TP: thymidine phosphorylase

Claims

1. A nucleic acid molecule which comprises a cancer cell specific promoter and an enhancer element which comprises more than one NF-κB binding site.

2. A nucleic acid molecule as defined in claim 1, wherein the cancer cell specific promoter is the carcinoembryonic antigen (CEA) promoter.

3. A nucleic acid molecule as defined in claim 1 , wherein the cancer cell specific promoter is the human telomerase reverse transcriptase (hTERT) promoter.

4. A nucleic acid molecule as defined in any preceding claims, wherein the NF-κB binding site comprises the following nucleotide sequence:

5 ^' -GGG-Pu-N₁-N₂-Py₁-Py₂-CC^ ^'

wherein Pu represents a purine nucleotide (e.g. adenine and guanine) , Py₁ and Py₂ independently represent a pyrimidine nucleotide (e.g. thymine and cytosine) and N₁ and N₂ independently represent any nucleotide.

5. A nucleic acid molecule as defined in claim 4, wherein Pu represents adenine.

6. A nucleic acid molecule as defined in claim 4 or claim 5, wherein N₁ represents adenine or cytosine (e.g. adenine) .

7. A nucleic acid molecule as defined in any of claims 4 to 6, wherein N₂ represents thymine or adenine (e.g. thymine) .

8. A nucleic acid molecule as defined in any of claims 4 to 7, wherein Py, represents thymine.

9. A nucleic acid molecule as defined in any of claims 4 to 8, wherein Py₂ represents thymine or cytosine (e.g. thymine) .

10. A nucleic acid molecule as defined in any preceding claims, wherein the NF-κB binding site comprises the following nucleotide sequence:

5 ' -GGG AAT TTC C-3 ' (SEQ ID NO: 1 ; KB) .

11. A nucleic acid molecule as defined in any preceding claims, which comprises 4 tandem copies of SEQ ID NO: 1.

12. A nucleic acid molecule as defined in any of claims 1 to 10, which comprises 8 tandem copies of SEQ ID NO: 1.

13. A nucleic acid molecule as defined in any preceding claims, wherein the more than one NF-κB binding sites are located upstream of the cancer cell specific promoter.

14. A nucleic acid molecule as defined in any preceding claims, which comprises a cloned DNA fragment, plasmid DNA, a cDNA library, a PCR product or mRNA.

15. A nucleic acid molecule as defined in claim 2, wherein the cancer cell specific promoter comprises nucleotide positions -245 to -41 of the CEA promoter.

16. A nucleic acid molecule as defined in any preceding claims, which additionally comprises a gene encoding a prodrug activating molecule (e.g. a prodrug activating enzyme) operatively linked to the promoter thereto .

17. A nucleic acid molecule as defined in claim 16, wherein the prodrug activating molecule is thymidine phosphorylase (TP) .

18. A nucleic acid molecule as defined in any preceding claims, which additionally comprises one or more transcriptional regulatory sequences, untranslated leader sequences, sequences encoding cleavage sites (e.g. restriction sites) , recombination sites, transcriptional terminators or ribosome entry sites.

19. A vector comprising a nucleic acid molecule as defined in any preceding claims.

20. A vector as defined in claim 19, which is a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.

21. A vector as defined in claim 20, wherein the plasmid is a virus (e.g. a retrovirus or an adenovirus) .

22. A pharmaceutical composition comprising a vector wherein said vector comprises a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule.

23. A method of treatment of cancer which comprises administration to a patient in need thereof a therapeutically effective amount of: (a) a vector comprising a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule; and

24. A method as defined in claim 23, wherein step (b) is performed at least 24 hours after step (a) .

25. A method as defined in claim 23 or claim 24, wherein the vector and the prodrug are administered intravenously or directly administered to the tumour.

26. A method as defined in any of claims 23 to 25, wherein the vector is as defined in any of claims 19 to 21.

27. A method as defined in any of claims 23 to 26, wherein the gene encodes thymidine phosphorylase (TP) , the prodrug is capecitabine (CAP) and the cytotoxic agent is 5-fluorouracil (5-FU) .

28. Use of a vector comprising a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule in the treatment of cancer.

29. Use of a vector comprising a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule in the manufacture of a medicament for the treatment of cancer.

30. A pharmaceutical composition comprising a vector wherein said vector comprises a nucleic acid molecule having more than one NF-κB binding site, a cancer cell specific promoter and a gene encoding a prodrug activating molecule for use in the treatment of cancer.