WO2008109823A2 - Primers for melting analysis - Google Patents
Primers for melting analysis Download PDFInfo
- Publication number
- WO2008109823A2 WO2008109823A2 PCT/US2008/056217 US2008056217W WO2008109823A2 WO 2008109823 A2 WO2008109823 A2 WO 2008109823A2 US 2008056217 W US2008056217 W US 2008056217W WO 2008109823 A2 WO2008109823 A2 WO 2008109823A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- primer
- probe element
- nucleic acid
- template
- target nucleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Definitions
- SSCP Single strand conformation polymorphism
- SSCP single strand conformation polymorphism
- Snapback SSCP a complementary 8-11 bp p ⁇ mer tail loops back on its complementary sequence in the extension product, creating a hairpin m the smgle stranded amphcon, which is later detected by gel separation
- Snapback p ⁇ mers may be used to introduce a secondary loop structure into an extension product
- Snapback p ⁇ mers and other p ⁇ or art methods discussed herein rely on post-amplification gel separation, or use expensive fluorescently labeled p ⁇ mers
- the methods of the present invention use a dsDNA dye and melting analysis to monitor hybridization of the hairpin Accordmg to one aspect of the present application, after PCR, illustrat
- genotypmg One issue that has prevented a better method of genotypmg revolves around the fact that most genetic diseases are complex Many different sequence alterations m the same or different genes may contribute to a disease phenotype The initial hope that most human diseases are caused by a handful of sequence va ⁇ ants has proven not to be true Many genes can cont ⁇ bute to a particular phenotype, and many different mutations within a gene may cause the same or similar disease patterns Therefore, to determine the link between a genotype and its resultant phenotype, genetic testing often requires parallel analysis of many coding and regulatory regions Several methods of screening DNA for abnormalities are available and are known as “scanning" methods While “genotypmg” focuses on detecting specific sequence alterations, mutation scanning can flag the presence of an abnormality, which can then be identified through methods such as genotypmg or sequencing
- Sequencing is currently the gold standard for identifying sequence va ⁇ ation Even though costs are decreasing, sequencing is still a complex process that is not rapid, simple, or inexpensive when applied to specific genetic diagnosis or pharmacogenetics This remains true for methods that use polonies (6) or emulsion PCR (7) Standard sequencing requires seven steps 1) amplification by PCR, 2) clean up of the PCR product, 3) addition of cycle sequencing reagents, 4) cycle sequencing for dideoxy termination, 5) clean up of the termination products, 6) separation by capillary electrophoresis, and 7) data analysis This complexity can be automated and has been in A- some sequencing centers, but sequencing still remains much more complex than the methods of the present invention. Further, when large or multiple genes are analyzed, over 90% of the sequenced products come back normal. A simple method that could identify normal sequences and common variants would eliminate most of the time, cost, and effort of sequencing.
- Snapback primers of the present invention may be used to integrate mutation scanning and genotyping in the same reaction
- Scanning may be performed by high- resolution amplicon melting (8) in the same reaction and using the same melting curve as Snapback genotyping
- Asymmetric PCR for Snapback genotyping results in two species with different melting transitions, an excess single strand in a hairpin conformation and a double stranded PCR product, preferably with each species melting at a different temperature
- the Snapback hairpm will melt at low temperature
- the full-length amplicon will melt at high temperature.
- the hairpin provides targeted genotyping for common vanants, while the full-length amplicon allows scanning for any sequence vanant withm the PCR product.
- Snapback genotyping typically can eliminate at least 90% and perhaps as much as 99% of the need for sequencing in the analysis of complex genetic disease.
- Combined scanning and genotyping with Snapback primers is attractive because only PCR reagents and a dsDNA dye are needed. No expensive modified oligonucleotides, separations, purifications or reagent addition steps are necessary Closed-tube analysis eliminates the risk of PCR contamination.
- Snapback primer annealing is rapid and compatible with the fastest PCR protocols.
- a method for nucleic acid analysis comprising the steps of mixing a target nucleic acid with a first p ⁇ mer and a second primer to form a mixture, the p ⁇ mers configured for amplifying the target nucleic acid, wherein the first p ⁇ mer comprises a probe element specific for a locus of the target nucleic acid and a template-specific primer region, wherein the probe element is 5' of the template-specific p ⁇ mer region, amplifying the target nucleic acid to generate an amplicon, allowing the probe element to hyb ⁇ dize to the locus to form a hairpin, generating a melting curve for the probe element by measuring fluorescence from a dsDNA binding dye as the mixture is heated, wherein the dye is not covalently bound to the first p ⁇ mer, and analyzing the shape of the melting curve
- a number of va ⁇ ations on this method are provided herein
- methods for simultaneous scanning and genotyping of a target nucleic acid, the methods comprising the steps of mixing the target nucleic acid with a first p ⁇ mer and a second pnmer to form a mixture, the primers configured for amplifying the target nucleic acid, wherein the first p ⁇ mer comp ⁇ ses a probe element specific for a locus of the target nucleic acid and a template- specific p ⁇ mer region, wherein the probe element is 5' of the template-specific p ⁇ mer region, amplifying the target nucleic acid to generate an amplicon, generating a melting curve for the amplicon by measuring fluorescence from a dsDNA binding dye as the mixture is heated, adjusting the mixture to favor hairpin formation by the probe element binding mtramolecularly to the target nucleic acid, and generating a melting curve for the probe element by measu ⁇ ng fluorescence from the dsDNA binding dye as the mixture is heated
- a kit for nucleic acid analysis, the kit comp ⁇ smg a first p ⁇ mer and a second pnmer, the primers configured for amplifying a target nucleic acid, wherein the first p ⁇ mer comp ⁇ ses a probe element specific for a locus of the target nucleic acid and a template-specific p ⁇ mer region and the probe element is 5' of the template-specific p ⁇ mer region, and a dsDNA binding dye
- the dsDNA binding dye is a saturation dye
- the kit further comp ⁇ ses a thermostable polymerase and dNTPs Additional features of the present invention will become apparent to those skilled in the art upon consideration of the following detailed description of preferred embodiments exemplifying the best mode of carrying out the invention as presently perceived
- Fig 1 shows a schematic of the action of Scorpion ® p ⁇ mers
- the black circle is the blocker
- the red circle is the quencher
- the small green circle is the quenched fluorophore
- the large green circle is the unquenched fluorophore
- Fig. 2 shows the intramolecular hyb ⁇ dization of a Snapback primer
- Fig. 3 shows SNP genotyping using a saturation dye and unlabeled oligonucleotide probes.
- Fig. 4 is a schematic of genotyping using Snapback primers.
- Fig. 5A shows genotyping using a Snapback primer following symmetric PCR.
- the genotypes shown are C/C (blue), A/A (black) and A/C (red)
- Fig. 5B shows genotyping using a Snapback primer with an extension blocker
- Fig. 6A diagrams Snapback primers having different length probe elements
- Fig. 6B is a denvative melting plot of amplification products of probe elements of Fig. 6 A.
- Figs. 6C-F show derivative melting plots for SNP genotyping using Snapback primers having different probe element lengths: Fig. 6C has an 8 base probe element; Fig 6D has a 14 base probe element; Fig. 6E has a 20 base element; Fig. 6F has a 24 base element Fig. 6G shows predicted and observed melting temperatures for different hairpin duplex lengths varying from 6 to 28 bps. Base mismatches were not present at the 5 '-end of the snapback primers Predicted melting temperatures (filled squares) were determined by standard nearest neighbor calculations, including dangling ends on both sides, but without consideration of the hairpin loop. After asymmetric PCR and melting, observed Tms (filled circles) were determined as maximum peak heights on negative derivative plots after normalization and exponential background subtraction. The GC% of the hairpm duplex va ⁇ ed from 8.3-32.1%
- Figs. 7A-B diagram a possible mechanism for inhibition of PCR with Snapback primers, with Fig. 7A showing possible extension from the 3' end of the minor strand, and Fig 7B showing how a two base mismatch prevents this extension.
- Fig. 7C shows normalized derivative melting plots for one hundred clinical samples using a Snapback p ⁇ mer having a two-base mismatch of the type diagrammed in Fig. 7B. Genotypes were homozygous wild type (black), heterozygous (light grey), and homozygous mutant (dark grey).
- Fig. 8A shows derivative melting plots of 8, 12, 16, and 20 base probe elements in
- Fig. 8B shows derivative melting plots of 12 and 20 base probe elements after asymmetric amplification with homozygous and matched heterozygous templates.
- Fig 9B shows derivative melting plots of the amplicons of Fig 9 A, black (120 bp), red (180 bp), blue (221 bp), green (271 bp), and yellow (321 bp)
- Fig 1OB shows de ⁇ vative melting plots of the amplicons of Fig 1OA Exponential background subtraction was not performed, explaining the downward slope of the de ⁇ vative curve
- Fig 1 IA shows de ⁇ vative melting plots wherein a Snapback p ⁇ mer was used to amplify four different homozygous templates, each varying solely with a different base at the va ⁇ able position
- Fig 1 IB shows de ⁇ vative melting plots wherein a Snapback p ⁇ mer was used to amplify one matched homozygous template, and three different heterozygous templates each sha ⁇ ng one matched allele
- Fig 11C shows de ⁇ vative melting plots wherein a Snapback pnmer was used to amplify one matched homozygous template, and three different heterozygous templates with both alleles mismatched to the probe element
- Figs 12 A-B show de ⁇ vative melting plots wherein the Snapback p ⁇ mer has a mismatch near the ends of a 22-base probe element
- Fig 12A demonstrates a mismatch at position 2
- the Fig 12B has a mismatch at position 20
- Figs 12C-D show de ⁇ vative melting plots wherem the Snapback p ⁇ mer has a mismatch near the middle of a 22-base probe element Fig 12C has a mismatch at position 8, while Fig 12D has a mismatch at position 14
- Fig 13 shows a de ⁇ vative melting plot of the cystic fibrosis G542X mutation using a Snapback pnmer Genotypes shown are homozygous wild type (blue), heterozygous (black), and homozygous mutant (red)
- Figs 14A-B show de ⁇ vative plots (Fig 14A) and normalized melting curves (Fig 14B) of the probe element of a Snapback p ⁇ mer interrogating the F507 - F508 region of CFTR exon 10 wild type (yellow), F507del het (black), F508del het (blue), F508C het (red) and F508del homo (green)
- Fig 15 shows a de ⁇ vative plot of multi-locus genotyping with bilateral Snapback primers interrogating CFTR exon 10 wild type (circles), compound F508del/Q493X heterozygote (connected small diamonds), I506V heterozygote (small diamonds), F508C heterozygote (small squares), I507del heterozygote (large squares), F508del heterozygote (connected large diamonds), and F508del homozygote (connected squares)
- Fig 16 shows a de ⁇ vative plot of resonance energy transfer from LCGreen Plus to LCRed640 using a 5'-LCRed640-labeled Snapback p ⁇ mer (red trace melting at 72°C) In comparison, the melting curve from a non-attached LCRed640 labeled probe is shown in blue with a melting transition of 63°C
- Fig 17 is a schematic of genotypmg and scanning using Snapback primers
- Figs 18 A-B show simultaneous mutation scanning and genotypmg of the CFTR exon 4 using symmetric PCR and one snapback primer
- Fig 18A shows a melting curve of the full length amphcon before dilution with water
- Fig 18B shows a de ⁇ vative curve following 1OX dilution with water
- the samples were denatured by heat and cooled p ⁇ or to melting wild-type (black) and Rl 17H heterozygote (red)
- SYBR ® Green I (Invitrogen Corp, Carlsbad, California) is a dye extensively used for melting analysis, as it shows a large change in fluorescence dunng PCR (10, 15) SYBR Green I was first used in melting analysis to distinguish different PCR products that differed in Tm by 2° C or more (21) Subsequently, SYBR ® Green I was used to identify deletions (16), genotype dinucleotide repeats (17), and identify va ⁇ ous sequence alterations (18-21) However, the Tm difference between genotypes can be small and may challenge the resolution of current instruments Indeed, it has been suggested that SYBR ® Green I, "should not be used for routine genotypmg applications" (22) Melting curve genotypmg with commonly used double-strand-specific DNA dyes can result in an increased Tm with broadening of the melting transition (23), and compression of the Tm difference between genotypes These factors lower the potential of SYBR ® Green I for genotype discnmmation Heterozygous DNA is made up of four
- heteroduplex products are readily observable with saturation dyes
- the ability to detect and identify heteroduplexes is particularly useful for detecting heterozygous genotypes as well as for scanning unknown mutations In many circumstances, this is not possible with conventional dsDNA dyes used in real-time PCR, such as SYBR ® Green I, SYBR ® Gold, and ethidmm bromide, where heteroduplex products are generally not observable
- heteroduplexes affect the shape of the melting curve, particularly at the "early,” low temperature portion of the transition Different melting curves can be temperature matched by translating the X-axis to superimpose the "late,” high temperature portion of the transition The presence or absence of heteroduplexes can then be inferred with greater accuracy
- Unlabeled oligonucleotides can be used in combination with saturation dyes for genotypmg by closed-tube melting analysis (11)
- the product strand complementary to the unlabeled probe is overproduced by asymmetric PCR, illustratively with the complementary p ⁇ mer in 5-10 fold excess
- the unlabeled probe may be blocked at the 3 -end to prevent extension, but no other modifications are needed
- Fig 3 shows a typical result of unlabeled probe genotypmg from genomic DNA
- a segment carrying the cystic fibrosis SNP G542X mutation was amplified in the presence of a 28-mer unlabeled probe (11) All three genotypes are shown (homozygous wild type - solid black line, heterozygous - red hne, and homozygous mutant - dashed line) using probes matched to either the wild type (top) or mutant (bottom)
- an unlabeled probe one can genotype the region under the probe, as shown in Fig 3, and one can use the melting
- FIG. 4 An illustrative Snapback genotypmg protocol is diagrammed in Fig 4
- the Snapback p ⁇ mer is shown on the left, as it has a tail 8 that does not hybndize to the target nucleic acid 20
- the standard primer 12 is shown on the ⁇ ght
- the nucleic acid is amplified, illustratively by asymmetric PCR, producing more of the strand 14 made from extension of Snapback primer 10 than of the complementary strand 16
- the amplification product is then cooled, producing a mixture of intramolecular hairpin products 30 from the Snapback p ⁇ mer 10, along with some double stranded full-length amplicon 40
- a de ⁇ vative melt of this amplification mixture produces low temperature peaks representing melting of the hairpin structure 35, and high temperature peaks representing melting of the full-length amplicon 40
- PCR is the amplification method used m the examples herein, it is understood that any amplification method that incorporates a p ⁇ mer may be suitable
- PCR polymerase chain reaction
- SDA strand displacement amplification
- NASBA nucleic acid sequence-based amplification
- CRCA cascade rolling circle amplification
- LAMP loop-mediated isothermal amplification of DNA
- ICAN isothermal and chime ⁇ c p ⁇ mer-mitiated amplification of nucleic acids
- HDA target based-hehcase dependant amplification
- TMA transcription-mediated amplification
- the Snapback pnmer serves both as a p ⁇ mer and as a probe for such methods, as are known in the art Example 1. Genotyping with a snapback primer after symmetric PCR.
- Fig 5A shows de ⁇ vative melting curve plots for all genotypes of an A/C SNP
- aniplicon (78-82 0 C) and snapback probe (66-73 0 C) melting transitions are apparent Conside ⁇ ng first the amplicon region, the peak of the C homozygote is at a higher temperature than the A homozygote, as expected Furthermore, the AC heterozygote shows a broad transition at lower temperatures because of the influence of heteroduplexes (12) Melting of the probe element of the Snapback primer depends on the genotype The perfectly matched A template melts at the highest temperature (71 0 C), the mismatched C template melts at 68°C, and the heterozygote shows melting peaks at both temperatures Although the signal intensity is low, the ability to genotype by observing the melting of the probe element of the Snapback primer is clearly evident
- Example 2 Snapback primer genotyping with an extension blocker usine symmetric PCR.
- an extension blocker was incorporated between the template-specific primer and the probe element of the Snapback p ⁇ mer Shown as an "X" in the forward p ⁇ mer, the blocker used was an abasic tetrahydrofuran de ⁇ vative incorporated as the dSpacer CE phosphoramidite available from Glen Research (cat no 10-1914-90) Ten contiguous dSpacer units were incorporated in order to ensure blockage of the polymerase The p ⁇ mers used are forward 5'-AATCGTCATAAATATTCATTGAATCCCC(X)iotcattctcgttttctgaactg-3' (SEQ ID NO 3, with tail shown in caps and variable position on the template after the Snapback hairpm is formed shown in bold), and reverse 5'-atgtttagactggatagcgt-3 ' (SEQ ID NO 4)
- One advantage of using symmetric PCR for Snapback p ⁇ mer geno typing is that two Snapback p ⁇ mers can be used (one on each end) to interrogate two different loci within the PCR product Each tail is made complementary to one locus and the probe elements may be va ⁇ ed in length and/or GC content to separate the Tms of the alleles of the two probe elements
- Another illustrative way to interrogate distant loci is to use only one Snapback p ⁇ mer with a single probe element, but divide the probe element into two or more segments, each segment complementary to one of the loci
- the template DNA forms loops between the loci and haplotyping is possible (13)
- one Snapback p ⁇ mer and one unlabeled probe (11) can be used, illustratively with asymmet ⁇ c PCR
- Another option is to mix several Snapback p ⁇ mers together, each with the same template-specific p ⁇ mer region but different probe elements that target different
- Example 3 Effect of the length of the probe element on the signal of Snapback primers after asymmetric PCR.
- PCR and melting were performed as in Example 1 , except that 45 cycles were used, the limiting forward primer concentration was O 05 ⁇ M and the Snapback reverse p ⁇ mer concentration was 0 5 ⁇ M While a 10 1 ratio was used, it is understood that other p ⁇ mer ratios may be suitable, as are known in the art, for example from 2 1 to 20 1, or even as high as 100 1
- Fig 6A The resultant melting curves are shown in Fig 6B
- the melting curves of Snapback p ⁇ mers are visible even with a probe region as small as 6 bases long
- the ability to see duplex melting transitions as small as six base pairs was surprising Compared to unlabeled probes of the same sequence (11), the melting transitions appear to be stabilized by 5- 1O 0 C or more
- Example 4 Using a 2-base terminal mismatch to increase the probe element signal: the effect of probe element length after asymmetric PCR.
- a 2-base mismatch incorporated at the 5 '-terminus of the probe element of Snapback primers results in strong probe melting signals As discussed above, such a mismatch prevents PCR inhibition that may otherwise occur after extension from the 3 '- end of the minor strand during PCR
- Different probe element lengths with 2-bp terminal mismatches were investigated using asymmetric PCR
- the Ml 3 p ⁇ mers used are shown in Table 2, wherein upper case indicates the probe element or tail, lower case defines the template-specific primer region, lower case italics indicates bases that are mismatched to the target, and the bold face base indicates the va ⁇ able position on the template after the Snapback hairpm has formed
- Fig 8 A shows de ⁇ vative melting profiles after asymmetric PCR using the perfectly matched "A" template All probe element peaks are large and easily identified Surprisingly, the area under the 8-base probe element is as large as the longer length probe elements
- the probe element has a G T mismatch to the mutant allele.
- Fig. 7C shows that the genotypes are readily distinguishable The genotype of all samples in Fig. 7C agreed with the genotypes that were previously determined by high resolution melting of small amphcons.
- Example 5 Influence of amplicon length on Snapback primer signal with a two base mismatch on the probe element 5'-end using asymmetric PCR.
- a Snapback primer having a two-base terminal mismatch was used to study different amplicon lengths.
- the distance from the snapback primer to the SNP site was kept constant (the secondary structure loop remains the same), while the length of the amplicon was va ⁇ ed
- Asymmetric PCR was performed as in Example 3
- the M 13 primers used are shown in Table 3, wherein upper case indicates the probe element or tail, lower case defines the template-specific primer region, lower case italics indicates bases that are mismatched to the target, and the bold face base indicates the variable position on the template after the Snapback hairpm has formed.
- the expenmental design is diagrammed in Fig. 9A.
- the Snapback primer is the same, thus forming the same loop size when the probe element anneals to the amplicon, with the same 2 bp mismatch at the 5' end.
- the amplicon length is va ⁇ ed from 120 bp to 321 bp.
- Results are shown in Fig. 9B.
- the longer the amplicon the smaller the size of the probe element signal compared to the amplicon signal. That is, shorter amphcons will generally result in stronger relative signals from the probe elements Example 6. Effect of the loop length on the probe element signal.
- Example 3 The effect of differing loops lengths was investigated by varying the distance between the Snapback p ⁇ mer and the locus to be interrogated Asymmetric PCR was performed as in Example 3
- the Ml 3 primers used are shown in Table 4, wherein upper case indicates the probe element tail, lower case defines the template-specific p ⁇ mer region, and the bold face base indicates the va ⁇ able position on the template after the snapback hairpin has formed In this case, 2 bp 5 '-mismatches adjacent to the probe element were not used
- Example 7 Genotyping all possible single base variants with one snapback primer.
- a single Snapback pnmer was used to amplify various plasmid templates to demonstrate that the shape of the probe element melting curve depends on the amplified sequence
- Ml 3 plasmids were used as the target, wherein each plasmid differed only at one position with an A, C, G, or T
- Asymmetric PCR was performed as in Example 3
- the M 13 p ⁇ mers used are IF tcattctcgttttctgaactg (SEQ ID NO 5) and lR22Tmisl0 ⁇ cATTCAATGAATATTTATGACGAatgtttagactggatagcgt (SEQ ID NO 31), wherein upper case indicates the probe element or tail, lower case defines the template-specific pnmer region, lower case italics indicates bases that are mismatched to the target,
- Fig 1 IB shows the matched template along with all three partially matched heterozygotes
- the matched template shows a single probe element melting peak around 68°
- All three heterozygotes show composite probe element melting peaks with one allele matched and the other mismatched, usually resolving into two distmct peaks with one peak around 68 0 C and the other peak depending upon the particular mismatch
- Fig HC shows the matched template along with three heterozygotes with both alleles mismatched
- the matched duplex is most stable, while the mismatched heterozygotes form less stable duplexes with the probe element
- Each heterozygote melts in a unique broad apparent single transition composed of two mismatched components that are not resolved into distinct peaks
- Example 8 Effect of mismatch position within the probe element of Snapback primers.
- Snapback primers with different probe elements were used to amplify the same target sequence
- the probe elements were designed to place the va ⁇ able base at different positions along the probe element, with the same length amplicon
- the probe element length was 22 bases, with the va ⁇ able base placed at position 2, 8, 14, or 20, resulting in loop lengths of 26 to 44 bases and an amplicon size of 120 bps
- the loop lengths vaned up to a maximum of an 18 base difference this should only affect the absolute Tm and not the ability to distinguish homozygotes from heterozygotes
- Asymmetric PCR was performed as in Example 3
- the M 13 p ⁇ mers used are shown in Table 5, wherein upper case mdicates the probe element or tail, lower case defines the template specific primer region, lower case italics indicates bases that are mismatched to the target, and the bold face base mdicates the variable position on the template after the Snapback hairpm has formed
- Snapback primer genotyping was performed for the CFTR mutation G542X, a single base change of G to T in exon 11
- Genotyped human genomic DNA samples were obtained from Co ⁇ ell Institute for Medical Research (Camden, NJ) and used at 50 ng/ ⁇ l in the PCR
- the limiting forward p ⁇ mer was tgtgcctttcaaattcagattg (SEQ ID NO:36) (0.05 ⁇ M) and the reverse snapback p ⁇ mer was rtGAAAGACAATATAGTTCTTGGAGAcagcaaatgcttgctagacc (SEQ ID NO:37) (0 5 ⁇ M).
- the sequence of the probe element matched the wild type target sequence.
- the amplicon size was 228 bps.
- PCR was performed as in Example 3, except that an initial denaturation at 95 0 C for 20 s was performed, the annealing temperature was 53 0 C, 55 cycles were performed, and the melting analysis was done at 0.2°C/s from 55 to 88 0 C.
- the Snapback primer loop size was 88 bases and the probe element was 24 bases.
- the resultant Snapback primer genotyping is shown in Fig. 13 Derivative melting curves are shown with the higher temperature amplicon melting peak on the right, and the lower temperature probe element peaks are on the left Melting of the probe element from the mismatched template occurs at about 63 0 C, while the matched template melts at about 68°C All three genotypes are easy to discern.
- Example 10 Genotyping of cystic fibrosis exon 10 sequence variants (F508del, F507del, and F508C) with snapback primers.
- Snapback primer genotyping was performed at the CFTR mutation hotspot in exon 10, including, F507del, F508del, and F508C.
- Genotyped human genomic DNA samples were obtained from Co ⁇ ell Institute for Medical Research (Camden, NJ) and used at 50 ng/ ⁇ l in the PCR.
- the limiting forward p ⁇ mer was acttctaatgatgattatggg (SEQ ID NO:38) (0.05 ⁇ M) and the reverse Snapback p ⁇ mer was fcAATATCATCTTTGGTGTTTCCTATGATGacatagtttcttacctcttc (SEQ ID NC-39) (0.5 ⁇ M).
- the sequence of the probe element matched the wild type sequence.
- the amplicon size was 231 bps and the Snapback primer loop size was 58 bases.
- Figs. 14A-B The resultant Snapback primer probe element melting curves are shown in Figs. 14A-B, as both denvative (Fig. 14A) and normalized melting curve (Fig. 14B) plots.
- Example 11 Multi-locus geno typing with bilateral Snapback primers.
- Snapback genotypmg can be multiplexed along the temperature axis, similar to other melting techniques (9).
- two or more sets of primers (each with one Snapback primer) can be used to amplify and genotype multiple loci, illustratively by having all alleles separated in melting temperature with their respective probe elements.
- multiple loci within an amplicon can be genotyped with amplification using two Snapback primers, or one Snapback primer and one unlabeled probe, each of which may interrogate more than one loci by looping out the template between constant regions (13).
- symmetric PCR may be used to result in sufficient concentration of both product strands
- the CFTR gene was amplified using symmetric PCR, with each p ⁇ mer at 0.5 ⁇ M
- the primers included a two-base 5 '-end mismatch and either a 17-base (Snapback 1) or a 28-base (Snapback 2) probe element producmg a 249 bp PCR product of exon 10 of CFTR with hairpin loops of 69 and 66 bases, respectively.
- Template DNA concentrations were 5 ng/ ⁇ l Reaction volumes of 2 ⁇ l m a 96-well plate were overlaid with 10-15 ⁇ L of mineral oil (Sigma), the plate was cent ⁇ fuged (1500 g for 3-5 mm), and PCR performed in a PTC-200 thermal cycler (Bio-Rad). An initial denaturation was performed at 95 0 C for 3 minutes, followed by 35 cycles of 95 0 C for 15 seconds, 55 0 C for 10 seconds, and 72 0 C for 15 seconds.
- the CFTR samples were diluted with water (18 ⁇ l for a 1OX dilution), cent ⁇ fuged, heated to 95 0 C (above the melting temperature for the full-length amphcon) in a LightScanner ® , removed from the instrument for cooling to ⁇ 40°C (room temperature, which is below the melting temperature for the hairpins of this example), followed by fluorescence acquisition during heating at 0 15°C/s on a LightScanner ® It has been found that heating and cooling, illustratively rapid cooling (illustratively at least 2°C/s, and more illustratively at least 5 0 Cs),
- High pH illustratively from pH 8 5 to 11 0, also favors formation of hairpins over full length duplex amplicons PCR can either be performed at high pH, or the pH increased after PCR, illustratively by adding a dilute solution of NaOH or a high pH buffer
- hairpin formation is favored after PCR amplification in AMP (aminomethyl propanol) buffers from pH 8 9 to 10 8
- AMP aminomethyl propanol
- PCR can be performed in 10 mM Tns buffer, pH 8 5, and 10 niM AMP buffers between pH 9 and 11 added after PCR to make the solution more basic
- Dilute unbuffered NaOH can also be added directly, for example, 1-9 ⁇ l of 0 01 M NaOH may be added into the reaction products of a 10 ⁇ l PCR buffered with 10 mM Tns, pH 8 5
- the amplification product may be adjusted by a combination of one or more of the following to favor hairpm formation over mtermole
- Example 12 Snapback primers as an energy transfer donor for multicolor genotyping.
- a Snapback primer with a 5'-terminal, covalently-attached dye, LCRed640 (Roche Diagnostics) was compared to a 5 '-labeled probe of the same sequence.
- the forward primer sequence was IF (tcattctcgttttctgaactg (SEQ ID NO:5)) and the Snapback primer was Red640- GGATTCAATGAATATTTATGACGAatgtttagactggatagcgt (SEQ ID NO: 15).
- the forward primer was again IF
- the reverse primer was IR (atgtttagactggatagcgt (SEQ ID NO:40)) and the labeled probe was Red640-GGATTCAATGAATATTTATGACGA-P (SEQ ID NO:41), where "P" is a 3'- phosphate.
- PCR was performed in the presence of 0.5X LCGreen Plus as described in Example 3 except that the extension temperature was 74°C, 50 cycles were performed, the forward p ⁇ mer concentration was 0.1 ⁇ M, the reverse p ⁇ mer concentration (Snapback or normal) was 0 5 ⁇ M, and the labeled probe (if present) was at 0.5 ⁇ M Melting analysis was performed on the LightCycler ® m the F2 (LCRed640) channel at 0.2C/s from 50- 87 0 C.
- Fig. 16 shows derivative melting plots in the LCRed640 channel that demonstrate resonance energy transfer between LCGreen Plus and covalently attached LCRed640.
- LCRed640 melting transitions are apparent using either Snapback primers or labeled probes, although the intramolecular loop stabilizes the Snapback duplex by about 9°C relative to the mtermolecular duplex.
- Snapback primer with different fluorophores that are excited by the same dsDNA dye (e g LCGreen Plus)
- Color multiplexing can be achieved
- Color compensation techniques preferably methods that account for the effect of temperature on crosstalk between channels (9), are used to de- convolute the complex spectral signal into individual components
- the labeled probe control reaction reveals a melting peak at 63°C, a result of FRET between bound LCGreen Plus and the labeled probe
- the labeled Snapback primer stabilized by about 9 0 C from intramolecular binding, has a melting temperature of about 72°C.
- Example 13 Combined Snapback genotyping and amplicon scanning.
- Asymmetric amplification with Snapback primers produces both a hairpin for genotypmg and double stranded product for amplicon scanning Hence, both genotyping and scanning from the same melting curve is possible with Snapback primers
- a schematic for such a method is shown in Fig 17 Because Snapback genotypmg is usually done with asymmetric PCR, the amplicon signal is not as strong as with symmetric amplification, and the heterozygote scanning accuracy is currently unknown Nevertheless, the potential to screen for mutations and genotype specific sequence variants in one process is attractive and can potentially eliminate 99% of the sequencing burden m whole gene analysis Any sequence difference in the sequence between the p ⁇ mers skews the amplicon melting transition to lower temperatures because of the heteroduplexes formed In addition, with Snapback hairpins, common variants under the probe element can be definitively identified Homozygous va ⁇ ants are also identified by the probe element, but may not alter amplicon melting Finally, if the amplicon transition indicates a heterozygous variant but the Snapback transition is normal,
- asymmetric PCR scanning and genotypmg may be done in two steps using a Snapback primer and symmetric PCR, with and without dilution
- symmetric PCR to plateau phase favors formation of full-length double- stranded amplicon, while dilution favors Snapback loop formation
- the p ⁇ mers were tctcagggtattttatgagaaataaatgaa (SEQ ID NO 42) and gzAAGGAGGAACGCTCTATCtcctcacaataataaagagaaggca (SEQ ID NO 43) and amplified a 211 bp PCR product including exon 4 of CFTR
- the hairpin loop was 46 bases with a hairpm duplex length of 18 bps PCR was performed as in Example 11 except that 5 ⁇ l volumes were used with 2 mM Mg ++ and 0 25 ⁇ M of each p ⁇ mer Temperature cycling included an initial denaturation of 95°C for 5 mm, followed by 36 cycles of
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Sampling And Sample Adjustment (AREA)
- Investigating Or Analyzing Materials Using Thermal Means (AREA)
Abstract
Description
Claims
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008800148410A CN101918587B (en) | 2007-03-08 | 2008-03-07 | Primers for melting analysis |
| DK08731668.3T DK2134861T3 (en) | 2007-03-08 | 2008-03-07 | Process for melt analysis of nucleic acids |
| JP2009552907A JP5424903B2 (en) | 2007-03-08 | 2008-03-07 | Primers for melting analysis |
| ES08731668T ES2386487T3 (en) | 2007-03-08 | 2008-03-07 | Nucleic Acid Fusion Analysis Method |
| AU2008222649A AU2008222649B2 (en) | 2007-03-08 | 2008-03-07 | Primers for melting analysis |
| EP08731668A EP2134861B1 (en) | 2007-03-08 | 2008-03-07 | Method for melting analysis of nucleic acids |
| AT08731668T ATE554187T1 (en) | 2007-03-08 | 2008-03-07 | METHOD FOR THE MELTING ANALYSIS OF NUCLEIC ACIDS |
| CA2680121A CA2680121C (en) | 2007-03-08 | 2008-03-07 | Primers for melting curve analysis in methods of nucleic acid analysis |
| US12/530,052 US8399189B2 (en) | 2007-03-08 | 2008-03-07 | Primers for melting analysis |
| US13/770,539 US9771610B2 (en) | 2007-03-08 | 2013-02-19 | Primers for melting analysis |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US90572107P | 2007-03-08 | 2007-03-08 | |
| US60/905,721 | 2007-03-08 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/530,052 A-371-Of-International US8399189B2 (en) | 2007-03-08 | 2008-03-07 | Primers for melting analysis |
| US13/770,539 Continuation US9771610B2 (en) | 2007-03-08 | 2013-02-19 | Primers for melting analysis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008109823A2 true WO2008109823A2 (en) | 2008-09-12 |
| WO2008109823A3 WO2008109823A3 (en) | 2008-11-13 |
Family
ID=39739135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/056217 Ceased WO2008109823A2 (en) | 2007-03-08 | 2008-03-07 | Primers for melting analysis |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US8399189B2 (en) |
| EP (1) | EP2134861B1 (en) |
| JP (1) | JP5424903B2 (en) |
| CN (1) | CN101918587B (en) |
| AT (1) | ATE554187T1 (en) |
| AU (1) | AU2008222649B2 (en) |
| CA (1) | CA2680121C (en) |
| DK (1) | DK2134861T3 (en) |
| ES (1) | ES2386487T3 (en) |
| WO (1) | WO2008109823A2 (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010054254A1 (en) | 2008-11-07 | 2010-05-14 | University Of Utah Research Foundation | Allele amplification bias |
| EP2436777A4 (en) * | 2009-05-26 | 2012-11-07 | Univ Xiamen | METHOD OF DETECTING VARIATIONS IN NUCLEIC ACID SEQUENCES |
| KR101357237B1 (en) | 2011-12-09 | 2014-02-06 | 한국 한의학 연구원 | SNP genotyping method using the melting analysis comprising a dilution step of PCR amplicon |
| US8815515B1 (en) | 2009-09-24 | 2014-08-26 | University Of Utah Research Foundation | Methods, compositions, and kits for rare allele detection |
| EP2705162A4 (en) * | 2011-05-04 | 2014-12-17 | Biocept Inc | METHOD FOR DETECTING VARIANTS IN A NUCLEIC ACID SEQUENCE |
| EP2895627A4 (en) * | 2012-09-17 | 2016-06-29 | Univ Brandeis | COMBINATION OF DNA-BINDING DYE AND PROBES FOR DNA SEQUENCE CHARACTERIZATION |
| WO2016104949A1 (en) * | 2014-12-24 | 2016-06-30 | 주식회사 시선바이오머티리얼스 | Method for guaranteeing quality of artificial synthetic oligo using pna probe |
| US10752939B2 (en) | 2014-08-11 | 2020-08-25 | Luminex Corporation | Probes for improved melt discrimination and multiplexing in nucleic acid assays |
Families Citing this family (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008109823A2 (en) | 2007-03-08 | 2008-09-12 | Idaho Technology | Primers for melting analysis |
| GB201017978D0 (en) * | 2010-10-25 | 2010-12-08 | Oxitec Ltd | Multiplex amplification and detection |
| EP2740804A4 (en) * | 2011-08-05 | 2015-06-24 | Toshiba Kk | Nucleic acid analysis method |
| CN102643910B (en) * | 2012-04-10 | 2014-10-15 | 中国人民解放军第三军医大学第一附属医院 | Application of asymmetric multicolor fluorescence hairpin probe chain reaction in pathogenic bacterium detection |
| CA2922813C (en) | 2013-08-30 | 2022-08-16 | University Of Utah Research Foundation | A quantum method for fluorescence background removal in dna melting analysis |
| GB201411567D0 (en) * | 2014-06-30 | 2014-08-13 | Epistem Ltd | Quantification methods |
| US20170335382A1 (en) * | 2014-11-10 | 2017-11-23 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Isothermal Amplification Assay for the Detection of Short Nucleic Acid Sequences |
| CN104845967B (en) * | 2015-04-15 | 2020-12-11 | 苏州新海生物科技股份有限公司 | Oligonucleotide fragment, method for selectively amplifying target nucleic acid sequence variant by using same and application of oligonucleotide fragment |
| US10961573B2 (en) | 2016-03-28 | 2021-03-30 | Boreal Genomics, Inc. | Linked duplex target capture |
| CA3048420C (en) * | 2016-12-09 | 2025-05-20 | Ncan Genomics, Inc. | Linked ligation |
| US20190093155A1 (en) * | 2017-05-25 | 2019-03-28 | Roche Molecular Systems, Inc. | Multiplex Nucleic Acid Amplification Assay |
| CN109055526A (en) * | 2018-08-17 | 2018-12-21 | 潍坊德诺泰克生物科技有限公司 | For detecting the primed probe group and its application of rs662 |
| WO2020039261A1 (en) | 2018-08-23 | 2020-02-27 | Boreal Genomics, Inc. | Linked target capture and ligation |
| US11473136B2 (en) | 2019-01-03 | 2022-10-18 | Ncan Genomics, Inc. | Linked target capture |
| CN110257492A (en) * | 2019-07-04 | 2019-09-20 | 黄劭 | One group of FRET hybridization amplimer and detection probe group |
| EP4457360A4 (en) * | 2021-12-29 | 2025-10-22 | Co Diagnostics Inc | Methods and systems for the analysis of nucleic acids using enhanced IFRET with multiple acceptor fluorophores |
| CN115728276B (en) * | 2022-11-14 | 2024-01-23 | 中船重工安谱(湖北)仪器有限公司 | Explosive detection method and detection system |
| CN118866099B (en) * | 2024-09-03 | 2025-07-29 | 国际遗传工程和生物技术中心泰州区域研究中心 | Method, system and storage medium for designing TAQMAN SNP genotyping probe and primer set |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPS076802A0 (en) * | 2002-02-26 | 2002-03-21 | Commonwealth Scientific And Industrial Research Organisation | Selective nucleic acid amplification |
| JP2005523701A (en) * | 2002-04-26 | 2005-08-11 | ユニバーシティ・オブ・ユタ・リサーチ・ファウンデーション | Characterization of single-stranded nucleic acids by secondary structure melting analysis using double-stranded nucleic acid-specific dyes |
| ES2527068T3 (en) | 2002-10-23 | 2015-01-19 | University Of Utah Research Foundation | Fusion analysis of amplicons with saturation dyes |
| US20050053950A1 (en) * | 2003-09-08 | 2005-03-10 | Enrique Zudaire Ubani | Protocol and software for multiplex real-time PCR quantification based on the different melting temperatures of amplicons |
| US7387887B2 (en) * | 2004-04-20 | 2008-06-17 | University Of Utah Research Foundation | Nucleic acid melting analysis with saturation dyes |
| US7456281B2 (en) | 2005-04-20 | 2008-11-25 | Idaho Technology, Inc. | Nucleic acid melting analysis with saturation dyes |
| AU2006244035A1 (en) * | 2005-05-11 | 2006-11-16 | Stratagene California | Snapback oligonucleotide probe |
| AU2006292252B2 (en) | 2005-09-20 | 2011-09-15 | University Of Utah Research Foundation | Melting curve analysis with exponential background subtraction |
| WO2008109823A2 (en) | 2007-03-08 | 2008-09-12 | Idaho Technology | Primers for melting analysis |
| EP2116614A1 (en) * | 2008-05-06 | 2009-11-11 | Qiagen GmbH | Simultaneous detection of multiple nucleic acid sequences in a reaction |
-
2008
- 2008-03-07 WO PCT/US2008/056217 patent/WO2008109823A2/en not_active Ceased
- 2008-03-07 AT AT08731668T patent/ATE554187T1/en active
- 2008-03-07 AU AU2008222649A patent/AU2008222649B2/en active Active
- 2008-03-07 DK DK08731668.3T patent/DK2134861T3/en active
- 2008-03-07 EP EP08731668A patent/EP2134861B1/en active Active
- 2008-03-07 ES ES08731668T patent/ES2386487T3/en active Active
- 2008-03-07 CA CA2680121A patent/CA2680121C/en active Active
- 2008-03-07 JP JP2009552907A patent/JP5424903B2/en active Active
- 2008-03-07 CN CN2008800148410A patent/CN101918587B/en active Active
- 2008-03-07 US US12/530,052 patent/US8399189B2/en active Active
-
2013
- 2013-02-19 US US13/770,539 patent/US9771610B2/en active Active
Non-Patent Citations (3)
| Title |
|---|
| LEE LG; CONNELL CR; BLOCH W.: "Allelic discrimination by nick-translation PCR with fluorogenic probes", NUCLEIC ACIDS RES., vol. 21, no. 16, 11 August 1993 (1993-08-11), pages 3761 - 6, XP000470188 |
| SOLINAS A; BROWN LJ; MCKEEN C; MELLOR JM; NICOL J; THELWELL N; BROWN T.: "Duplex Scorpion primers in SNP analysis and FRET applications.", NUCLEIC ACIDS RES, vol. 29, 2001, pages E96 |
| WHITCOMBE D; THEAKER J; GUY SP; BROWN T; LITTLE S.: "Detection of PCR products using self-probing amplicons and fluorescence", NAT BIOTECHNOL, vol. 17, 1999, pages 804 - 7, XP002226672, DOI: doi:10.1038/11751 |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012508023A (en) * | 2008-11-07 | 2012-04-05 | ユニバーシティ・オブ・ユタ・リサーチ・ファウンデイション | Allele amplification bias |
| US10351903B2 (en) | 2008-11-07 | 2019-07-16 | University Of Utah Research Foundation | Allele amplification bias |
| WO2010054254A1 (en) | 2008-11-07 | 2010-05-14 | University Of Utah Research Foundation | Allele amplification bias |
| US9422597B2 (en) | 2008-11-07 | 2016-08-23 | Biofire Diagnostics, Inc. | Allele amplification bias |
| US9334533B2 (en) | 2009-05-26 | 2016-05-10 | Xiamen University | Method for detecting variations in nucleic acid sequences |
| EP2436777A4 (en) * | 2009-05-26 | 2012-11-07 | Univ Xiamen | METHOD OF DETECTING VARIATIONS IN NUCLEIC ACID SEQUENCES |
| US8691504B2 (en) | 2009-05-26 | 2014-04-08 | Xiamen University | Method for detecting variations in nucleic acid sequences |
| EP2436777B1 (en) | 2009-05-26 | 2015-08-19 | Xiamen University | Method for detecting variations in nucleic acid sequences |
| US8815515B1 (en) | 2009-09-24 | 2014-08-26 | University Of Utah Research Foundation | Methods, compositions, and kits for rare allele detection |
| US9765390B2 (en) | 2009-09-24 | 2017-09-19 | University Of Utah Research Foundation | Methods, compositions, and kits for rare allele detection |
| EP2705162A4 (en) * | 2011-05-04 | 2014-12-17 | Biocept Inc | METHOD FOR DETECTING VARIANTS IN A NUCLEIC ACID SEQUENCE |
| US9834817B2 (en) | 2011-05-04 | 2017-12-05 | Aegea Biotechnologies | Methods for detecting nucleic acid sequence variants |
| EP3382039A1 (en) * | 2011-05-04 | 2018-10-03 | Biocept, Inc. | Methods for detecting nucleic acid sequence variants |
| US10745749B2 (en) | 2011-05-04 | 2020-08-18 | Biocept, Inc. | Methods for detecting nucleic acid sequence variants |
| AU2020201291B2 (en) * | 2011-05-04 | 2023-03-09 | Aegea Biotechnologies | Methods for detecting nucleic acid sequence variants |
| KR101357237B1 (en) | 2011-12-09 | 2014-02-06 | 한국 한의학 연구원 | SNP genotyping method using the melting analysis comprising a dilution step of PCR amplicon |
| EP2895627A4 (en) * | 2012-09-17 | 2016-06-29 | Univ Brandeis | COMBINATION OF DNA-BINDING DYE AND PROBES FOR DNA SEQUENCE CHARACTERIZATION |
| US10752939B2 (en) | 2014-08-11 | 2020-08-25 | Luminex Corporation | Probes for improved melt discrimination and multiplexing in nucleic acid assays |
| US10975419B2 (en) | 2014-08-11 | 2021-04-13 | Luminex Corporation | Probes for improved melt discrimination and multiplexing in nucleic acid assays |
| US12480152B2 (en) | 2014-08-11 | 2025-11-25 | Luminex Corporation | Probes for improved melt discrimination and multiplexing in nucleic acid assays |
| WO2016104949A1 (en) * | 2014-12-24 | 2016-06-30 | 주식회사 시선바이오머티리얼스 | Method for guaranteeing quality of artificial synthetic oligo using pna probe |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2134861B1 (en) | 2012-04-18 |
| CN101918587B (en) | 2013-03-27 |
| CA2680121A1 (en) | 2008-09-12 |
| ATE554187T1 (en) | 2012-05-15 |
| AU2008222649A1 (en) | 2008-09-12 |
| JP2010520756A (en) | 2010-06-17 |
| CN101918587A (en) | 2010-12-15 |
| CA2680121C (en) | 2016-05-10 |
| DK2134861T3 (en) | 2012-07-30 |
| AU2008222649B2 (en) | 2014-06-12 |
| ES2386487T3 (en) | 2012-08-21 |
| US20160348157A1 (en) | 2016-12-01 |
| EP2134861A4 (en) | 2010-03-03 |
| US9771610B2 (en) | 2017-09-26 |
| US8399189B2 (en) | 2013-03-19 |
| WO2008109823A3 (en) | 2008-11-13 |
| AU2008222649A8 (en) | 2011-01-27 |
| JP5424903B2 (en) | 2014-02-26 |
| US20100196890A1 (en) | 2010-08-05 |
| EP2134861A2 (en) | 2009-12-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2008222649B2 (en) | Primers for melting analysis | |
| EP2663651B1 (en) | Methods, compositions, and kits for determing the presence/absence of a variant nucleic acid sequence | |
| JP5112592B2 (en) | Hybridization beacon and method for rapid detection and discrimination of sequences | |
| US7785776B2 (en) | Genotyping by amplicon melting curve analysis | |
| EP2439283B1 (en) | Method for the detection of multiple single nucleotide variations or single nucleotide polymorphisms in a single tube | |
| US8206929B2 (en) | Nucleic acid amplification with allele-specific suppression of sequence variants | |
| CN101680029B (en) | Nucleic acid detection | |
| US9765390B2 (en) | Methods, compositions, and kits for rare allele detection | |
| AU2001242634A1 (en) | Hybridisation beacon and method of rapid sequence detection and discrimination | |
| Dujols et al. | High-resolution melting analysis for scanning and genotyping | |
| CN104995312A (en) | Combination of DSDNA binding dye and probes for characterization of SSDNA sequences | |
| Frayling et al. | PCR-based methods for mutation detection | |
| Lopez‐Crapez et al. | A separation‐free assay for the detection of mutations: Combination of homogeneous time‐resolved fluorescence and minisequencing | |
| Dahl et al. | Methods for detection of subtle mutations in cancer genomes | |
| ZA200207652B (en) | Hybridisation beacon and method of rapid sequence detection and discrimination. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880014841.0 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08731668 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2680121 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009552907 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008222649 Country of ref document: AU |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008731668 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2008222649 Country of ref document: AU Date of ref document: 20080307 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12530052 Country of ref document: US |
