WO2008104857A2 - Method for predicting susceptibility of hiv infection - Google Patents

Abstract

The present invention relates to a method for predicting susceptibility to infection with HIV and especially HIV-1 virus in a subject. Another object of the invention is to provide a medicament for the treatment or prevention of AIDS as well as a method for predicting AIDS progression in an HIV-1 infected subject.

Description

METHOD FOR PREDICTING SUSCEPTIBILITY TO HIV INFECTION

FIELD OF THE INVENTION

The present invention relates to a method for predicting susceptibility to infection with HTV and especially HTV-I virus in a subject. Another object of the invention is to provide a medicament for the treatment or prevention of AIDS as well as a method for predicting ATDS progression in an HIV-I infected subject.

BACKGROUND OF THE INVENTION

The Lymphocyte Antigen 6 (LY-6) protein domain is approximately 80 amino acids long, characterized by a conserved pattern of 8-10 cysteine residues that have a defined pattern of disulphide bonding. Most members of the LY-6 superfamily are extracellular GPI (glycosyl phosphatidylinositol) anchored proteins, such as CD59, the urokinase plasminogen activator (uPA) receptor (uPAR) and sperm acrosomal protein (SP-IO) (reviewed byPalfree, 1996 Tissue 48,71-79).

Some secreted members of the superfamily lacking the GPI anchor, such as the snake neurotoxins (Fleming etal, 1993 J. Immunol.150, 5379-90), and human SLURP-I (secreted LY-6/uPAR related protein 1 ) (Andermann et al, 1999 Protein Sci. 8, 810-819) have also been described. LY-6 superfamily members have been identified in a number of different organisms, including a wide variety of mammalian species such as human, mouse, rat, fox and baboon; amphibian species such as newt and frog; and in invertebrates such as squid and C. elegans (Chou etal, 2001 Geneticsl57,211-224). The biological function of the LY-6 superfamily members in mammals is not known, except for CD59, which is an inhibitor of the complement cascade, inhibiting the formation of the membrane attack complex (Davies et al, 1989 J. Exp. Med.170, 637-654), and uPAR, which plays an important role in proteolysis of extracellular matrix proteins (Tarui et al, 2001 J. Biol. Chem.276, 3983-90).

Genes of the LY-6 superfamily are frequently found in clusters. On human chromosome 8

(8q24-qter), a cluster of five LY-6 family members has been identifϊed,(Brakenhoff et al, 1995 J. Cell Biol. 129,1677-89) containing E48, RIG-E (Retinoic acid induced gene E) (Mao etal, 1996 Proc. Natl. Acad. Sci. USA 93,5910-14), PSCA (Prostate Stem Cell Antigen) (Reiter et al, 1998 Proc. Natl. Acad. Sci. USA 95,1735-40), LY-6H (Apostolopoulos etal, 1999 Irnmunogenetics 49,987-990) and SLURP-I. On mouse chromosome 15 there is a cluster of nine Ly-6 family members, containing ThB (Gumley et al, 1992 J. Lnmunol.149, 2615- 18),TSA-1/Sca2 (MacNeil et al, 1993J. Immunol. 151, 6913-23), Ly-6a/e, Ly-6c, Ly-6f, Ly-6g, (Gumley et al, 1995, Immunol. Cell Biol. 73,277-96) Ly-6h (Horie et al, 1998 Genomics 53,365-368), Ly-6i (Pflugh et al, 2000 J. lmmunol.165, 313-321) and Ly-6m (Patterson et al, 2000 Blood 95,3125-32). This mouse region is syntenic to human chromosome 8q24. Human E48 and mouse ThB, human RIG-E and mouseTSA-l/Sca-2, and human and mouse Ly-6h are thought to be orthologous genes. The human orthologues of the remaining members of the murine cluster have not yet been identified. The members of this murine cluster have been well studied, and a possible role for these LY-6 family members in T cell activation, differentiation and maturation has been suggested, hi addition it has been shown that Ly- 6c can regulate endothelial adhesion and homing of T cells by activating integrin dependent pathways (Hanninen et al, 1997 Proc. Natl. Acad. Sci. USA 94,6898-6903) and that Ly- 6A has a role in mediating cell-cell adhesion (Bamezai etal, 1995 Proc. Natl. Acad. Sci. USA 92, 4294-98).

WO04001034 (MEDICAL RES COUNCIL ) discloses an isolated nucleic acid molecule which comprises at least part of the sequence of intron 1 of a human LY-6 superfamily gene or of a homologous gene from an animal or a corresponding sequence, and a method of regulating the expression of a gene using the aforementioned molecule.

EPl 514 926 (INOKO HIDETOSHI et al.) discloses a quantitative real-time RT-PCR analysis using total RNA extract to compare SLURP-2 gene expression between psoriatic lesional skin, non-lesional skin, and normal skin, to indicate that the SLURP-2 gene is significantly upregulated in psoriasis lesions. Thus, SLURP-2 gene can be used as a diagnostic marker for inflammatory skin diseases such as psoriasis.

WO 04/091646 (UNTVERSITE DE LAUSANNE) discloses is the use of SLURP- 1 for the treatment or prevention of neurological disorders and for the treatment or prevention of skin pathologies. The application further discloses the use of SLURP-I for the modulation of acetylcholine receptor activity. Antibodies generated against SLURP-I and related proteins are also disclosed.

Advances in large-scale analysis of human genomic variability provide unprecedented opportunities to study the genetic basis of susceptibility to infectious agents.

Some individuals do not appear to become infected despite repeated exposures to the HTV-I virus, and among those that do, there is marked variation in the clinical course and progression to AIDS (i). Although a number of host genetic determinants of susceptibility to HIV-I have been identified through analysis of candidate genes - most notably CCR5 Δ32 and HLA alleles, only a fraction of the observed phenotypic variation can be explained by variation at these loci (2, 3). Thus, there is a considerable interest in applying unbiased methods such as whole genome analysis for the identification of novel susceptibility loci to human pathogens (1). This hunt is however plagued by numerous confounding factors such as lack of ascertainment of informative patient cohorts and difficulties to control for variability of the infectious agent. Hence, until now, whole genome mapping for viral susceptibility has been reported only in mice for the murine adenovirus type 1 (4), and in mosquitoes for the dengue-2 virus (J).

Whole genome scans can be performed using families (linkage) or unrelated individuals (association studies). Analysis of family data using linkage analysis, widely used in the mapping of monogenic disorders, depends on several hundred polymorphic markers spread throughout the genome to identify the chromosomal regions involved (for example in rare familial syndromes of susceptibility to infectious diseases) (6, 7). The need for family-based data limits this approach to HIV-I investigation because of the rarity, beyond instances of vertical transmission, of multicase family infections. Studies of host genetic susceptibility to HTV-I are also confounded by differences in virulence of the infecting viral strain.

SUMMARY OF THE INVENTION To circumvent these limitations, Applicants established an in vitro system to address the genetic control of cellular susceptibility to HIV-I using cell lines from multigeneration families (S, 9).

In particular, the present invention provides for a method for predicting susceptibility to infection with HTV and especially HIV-I virus in a subject comprising determining the presence in said subject of a specific genetic marker on chromosome 8q24.3. The use of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus for the manufacture of a medicament for the treatment and/or the prevention of AIDS is also provided. Other objects and advantages will become apparent to those skilled in the art from a review of the ensuing detailed description, which proceeds with reference to the following illustrative drawings, and the attendant claims.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Study flowchart

LBL= lymphoblastoid B cell lines; VSV-lentivirus-GFP= Vesicular Stomatitis Virus G protein-pseudotyped HIV-I -based lentivirus; CEPH= Centre d'Etude du Polymorphisme Humain; SNP= single nucleotide polymorphism.

Figure 2. Expression and heritability of the lentivirus susceptibility trait in CEPH families.

Panel A, heritability estimate (H²) for eight study traits (% of positive cells and mean fluorescence intensity, MFI), and for the EBV copy number (** PO.001, *** PO.0001). Panel B, representation of inter-individual (black dots), and inter-family (red bar=median value for each family) differences in percentage of GFP-positive cells after transduction with a VSV-lentivirus-GFP of 198 lymphoblastoid B-cell lines from 15 CEPH pedigrees.

Figure 3. Genome scan and fine mapping of a lentivirus susceptibility locus, and in vitro validation of the candidate SNP marker. Panel A, linkage analysis with 15 families and 2600 markers identifies a quantitative trait locus (QTL) on HSA8q24.3. The highest multipoint LOD score of 2.89, p=1.3E-04 (marker rsl398296) was significant at genome-wide level as determined by permutation analysis (95% significance threshold of 2.83, dotted line). Panel B, association analysis in 56 independent individuals, using 521 SNPs from the HapMap project centered 3Mb around the initial QTL, identifies marker rs2572886G>A (p= 1.8E-5). The association remained significant after correction for multiple testing by Bonferroni (dashed line) or permutation analysis (dotted line). Panel C, the candidate marker is associated with a significant 40% increase in susceptibility to the VSV-lentivirus-GFP. Panel D, rs2572886A is associated with a significant 57% increase in susceptibility of CD4⁺ T-cells from healthy blood donors to replicating HTV-I.

Figure 4. Association and size-effect of the rs2572886A with HIV-I disease progression in a human cohort in the absence of therapy. Panel A, pattern of viral load in infected individuals with known date of infection (incident cohort); each gray point represents a single CD4⁺ T-cell determination; the red line (carriers of rs2572886A), and the black line (individuals with the common alleles) are estimated by mixed effect models. Panel B, pattern of CD4⁺ T-cell depletion in the incident cohort. Panel C, pattern of viral load in the full study population (incident and prevalent cohorts). Homozygous individuals for the minor allele variant are represented in orange. Panel D, pattern of CD4⁺ T-cell depletion in the full study population. Panel E, size effect on CD4⁺ T-cell depletion associated with the rs2572886A marker in comparison with the effect associated with CCR5 D 32 heterozygosity in the incident cohort. Panel F, allelic frequencies of CCR5D32 (black bar) and rs2572886A (grey bar) over 8 years of follow-up period in the incident cohort is suggestive of allele enrichment and depletion, respectively. Depletion represents loss of individuals due to death, loss to follow up, or initiation of treatment.

Figure 5: Validation of the B-cell model to study post-entry HTV-I susceptibility. CD4⁺ T-cells and B-cells from same healthy blood donors were transduced with the VSV-, lentivirus-GFP. Linear regression of one representative experiment for the percentage of GFP positive cells is shown. Each point represents the mean of triplicate values.

Figure 6: Chromosomal localization of rs2572886. The SNP is localized in an intergenic region containing genes belonging to the Ly-

6/neurotoxin family. Figure shows images generated through the UCSC genome browser and Haploview software. Figure 7: Genome scan and fine mapping of CD39 expression (MFI trait). Panel A: Results of linkage analysis with 15 families. A single locus on HSAl 0q23 (rs766083) is significant after correction by permutation analysis (N=500). Panel B, Results of association analysis in 56 independent individuals using SNPs from the HapMap project. All SNPs in a 700kb region surrounding the CD39 gene were used. Rs numbers next to peaks indicate significant SNPs after correction for multiple testing

DETAILED DESCRIPTION OF THE INVENTION

Advances in large-scale analysis of human genomic variability provide unprecedented opportunities to study the genetic basis of susceptibility to infectious agents. Applicants report the use of an in vitro system for the identification of a locus on HSA8q24.3 that determines susceptibility to HTV-I. This locus was mapped through quantitative linkage analysis, and confirmed by two independent association studies. SNP rs2572886, associated with cellular susceptibility to HTV-I, was also found to be associated with accelerated disease progression in a cohort of HTV-I infected subjects. Genetic analysis of in vitro cellular phenotypes provides an effective means to discover susceptibility loci to infectious agents.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions, will control, hi addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.

As used herein, the following definitions are supplied in order to facilitate the understanding of the present invention. The term "comprise" is generally used in the sense of include, that is to say permitting the presence of one or more features or components.

As used herein, the terms "protein", "polypeptide", "polypeptidic", "peptide" and "peptidic" are used interchangeably herein to designate a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.

For present purposes, an LY-6 superfamily gene is considered as one which codes for an LY6 domain-containing polypeptide. Examples of genes included in the LY-6 superfamily include the following:LY6G5B,

LY6G5C,LY6G6C, LY6G6D, LY6G6E, CD59,uPAR,SP10, SLURP-I, E48,RIG-E, PSCA, ThB,TSA-l/Sca2, and all LY-6 genes (such as LY-6A to I etc.).

For brevity an LY-6 superfamily gene will be referred to hereafter as a"LY-6 gene" and the term"LY-6 gene" should therefore be construed accordingly unless the context dictates otherwise.

The present invention provides a method for predicting susceptibility to infection with HTV and especially HTV-I virus in a subject comprising determining the presence in said subject of a specific genetic marker on chromosome 8q24.3. By "predicting susceptibility" it is intended diagnosing a predisposition or a resistance to HTV and especially to HIV-I virus in a subject.

It is meant by "HTV" or "HTV viruses", HTV-I or HTV-2 and all the various strains of HTV viruses which are involved in the development of ADDS.

The terms "subject" or "patient" are well-recognized in the art, and, are used interchangeably herein to refer to a mammal, including dog, cat, rat, mouse, monkey, cow, horse, goat, sheep, pig, camel, and, most preferably, a human. In some embodiments, the subject is a subject in need of treatment. However, in other embodiments, the subject can be a normal subject, e. g., a subject having no known or diagnosed HTV infection. Alternatively, the subject has a known, diagnosed, or suspected HTV infection. The present invention also provides a method for predicting AIDS progression in an HIV preferably HIV-I infected subject comprising determining the presence in said HIV-I infected subject of a specific genetic marker on chromosome 8q24.3. The method can be used as a prognostic tool for predicting susceptibility to HIV infection in a subject.

According to the invention, this specific genetic marker on chromosome 8q24.3 is located in the Leukocyte Antigen (Ly-6) gene locus and consists on rs2572886A allele (GCTGGAATGTCTGTGGAAAGCACCACCTTGCTGATTCTGCCGCAGAGGC) or rs2572886G allele (GCTGGAATGTCTGTGGAAAGCACCGCCTTGCTGATTCTGCCGCAGAGGC).

Surprisingly it has been shown that the rs2572886A allele as defined above is associated with greater HTV viral load, rapid immunosuppression progression and/or faster AIDS disease progression, whereas the rs2572886G allele is associated with lower HTV viral load, low immunosuppression progression and/or slower AIDS disease progression.

Another object of the invention is also the use of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus in the manufacture of a medicament for the treatment and/or the prevention of AIDS. Preferably, the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is selected from the group comprising LY6K, SLURPl , LYPD2, LYNXl / SLURP2, LY6D, GML, LY6E, and LY6H. Most preferably, protein encoded by the Leukocyte Antigen (Ly-6) gene locus is a "SLURP-I related protein", preferably SLURP 1 or LYNXl / SLURP2. Even more preferably, the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is SLURP l. Preferably, the medicament comprising an effective amount of SLURP-I is administered to the subject by a method selected from the group consisting of orally, intravenously, intraperitoneally, intranasally, and intramuscularly.

It is understood that the suitable dosage of the medicament according to the present invention will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any and the nature of the effect desired. "Treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. Hence, the mammal to be treated herein may have been diagnosed as having the disorder or may be predisposed or susceptible to the disorder.

"Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, monkeys etc. Preferably, the mammal is human.

The medicament of the invention will generally be used in an amount to achieve the intended purpose. For use to treat or prevent an AIDS disorder, the medicament is administered or applied in a therapeutically effective amount.

A "therapeutically effective amount" is an amount effective to ameliorate, treat or prevent the symptoms, diseases or disorders in a mammal, or prolong the survival of the subject being treated.

For systemic administration, a therapeutically effective amount or dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC50 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Initial doses can also be estimated from in vivo data, e.g. animal models, using techniques that are well known in the art. One ordinarily skill in the art could readily optimise administration to humans based on animal data and will, of course, depend on the subject being treated, on the subject's weight, the severity of the disorder, the manner of administration and the judgement of the prescribing physician. The treatment usually comprises a multiple administration of the medicament, usually in intervals of several hours, days or weeks. The pharmaceutically effective amount of a dosage unit of the medicament usually is in the range of 0.001 ng to 100 μg per kg of body weight of the patient to be treated. Alternatively, or additionally, it will become apparent that the medicament according to the invention may be administered alone or in combination with other treatments, therapeutics or agents, either simultaneously or sequentially dependent upon the condition to be treated.

A further object of the invention is to provide a method for treating and/or preventing AIDS in an HIV preferably HIV-I infected subject comprising the step of modulating the expression of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus.

In accordance with the invention, the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is selected from the group comprising LY6K, SLURPl, LYPD2, LYNXl / SLURP2, LY6D, GML, LY6E, and LY6H. More preferably, the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is SLURP 1 or LYNXl / SLURP2.

Even more preferably, the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is SLURP l.

According to one embodiment of the invention, the step of modulating includes increasing the expression of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus by biological or pharmaceutical intervention, or by exogenous provision of the protein.

"Biological intervention" implicates any intervention that acts on expression by using biological mediators up to gene therapy, pharmaceutical would just refer to molecules that interact with one or more steps defining the expression levels. These interacting molecules maybe for example antibodies, agonists, antagonists, drugs or ligands of "SLURP-I related protein" or other proteins of the LY6 family.

According to another embodiment of the invention, the step of modulating includes decreasing the expression of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus. Decreasing the expression of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus may for example be carried out by RNA interference, or by pharmaceutical intervention or any other technique known to the skilled in the art.

Another object of the invention is to provide a method for predicting ADDS progression in an HIV preferably HIV-I infected subject comprising: a) determining the amount of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus, preferably SLURP 1, in a biological sample of said HIV-I infected subject and, b) comparing said amount with the amount of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus, preferably SLURP 1, in a biological sample of a control subject, whereby an amount of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus, preferably SLURP 1, in step a) greater than the amount of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus, preferably SLURP 1, in step b) predicts slower ADDS disease progression.

The specific genetic marker of the invention may be in the form of an isolated nucleic acid molecule and may be prepared by any conventional means, such as cloning of restriction digest fragments containing relevant portions of a LY-6 gene or mammalian homologue thereof, by PCR or de novo synthesis in vitro or any other known method.

"A purified and isolated nucleic acid sequence" refers to the state in which the nucleic acid molecule is free or substantially free of material with which it is naturally associated such as other polypeptides or nucleic acids with which it is found in its natural environment, or the environment in which it is prepared (e. g. cell culture) when such preparation is by recombinant nucleic acid technology practised in vitro or in vivo. The term "nucleic acid" is intended to refer either to DNA or to RNA.

The proteins encoded by the Leukocyte Antigen (Ly-6) gene locus and preferably SLURP 1 (i.e. a"SLURP-l related protein"), also comprise polypeptides that are functionally equivalent to SLURP-I and are highly homologous to the amino acid sequence of the polypeptides. "Highly homologous" normally refers to sequence identity, at the amino acid level, of at least 50% or higher, preferably 75% or higher, more preferably 85% or higher, and most preferably 95% or higher. The degree of homology of one amino acid sequence or nucleotide sequence to another can be determined by following the algorithm BLAST by Karlin and Altschl (Proc. Natl. Acad. Sci. USA, 90: 5873-5877, 1993). Programs such as BLASTN and BLASTX were developed based on this algorithm (Altschul et al. J. MoI. Biol.215: 403-410, 1990). To analyze a nucleotide sequence according to BLASTN, based on BLAST, the parameters are set as score= 100 and word length= 12, for example. On the other hand, parameters used for the analysis of amino acid sequences by BLASTX based on BLAST include, for example, score= 50 and word length= 3. The default parameters of each program are used when using BLAST and Gapped BLAST programs. Specific techniques for such analysis are known in the art (http://www.ncbi.nlm.nih.gov.).

As used herein a" SLURP-I related protein" is a protein that displays structural homology to SLURP-I or a mature form of SLURP-I. In one embodiment, a SLURP-I related protein is about 75% homologous/identical to SLURP-I or a mature form of SLURP-I. In other embodiments, a SLURP-I related protein is about 80% homologous/identical; about 85% homologous/identical; preferably about 90%liomologous/identical; more preferably about

95% homologous/identical or most preferably about 99%homologous/identical. In a preferred embodiment, a SLURP-I related protein functional homologous to SLURP-I or a mature form of SLURP-I. A SLURP-I related protein can include but is not limited to members of the secreted Ly-6/uPAR family (e. g., Lynx-1 Isoform A, Lynx-1 Isoform B (SLURP-2), RGTR- 430, etc.).

Homology/Identity is typically measured using sequence analysis software (e. g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705). Similar amino acid sequences are aligned to obtain the maximum degree of homology (i. e., identity).

A "native sequence" SLURP-I or SLURP-I related proteins is one which has the same amino acid sequence as a polypeptide derived from nature. Such native sequence polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. Thus, a native sequence polypeptide can have the amino acid sequence of naturally occurring human polypeptide, murine polypeptide, or polypeptide from any other mammalian species.

Biological active fragments of SLURP-I or SLURP-I related proteins are also encompassed by the present invention. "Fragments" refer to sequences sharing at least 40% amino acids in length with the respective sequence of the substrate active site. These sequences can be used as long as they exhibit the same properties as the native sequence from which they derive. Preferably these sequences share more than 70%, preferably more than 80%, in particular more than 90% amino acids in length with the respective sequence the substrate active site. These fragments can be prepared by a variety of methods and techniques known in the art such as for example chemical synthesis.

The term "variants" refer to SLURP-I or SLURP-I related proteins having amino acid sequences that differ to some extent from a native sequence polypeptide, that is amino acid sequences that vary from the native sequence by conservative amino acid substitutions, whereby one or more amino acids are substituted by another with same characteristics and conformational roles. The amino acid sequence variants possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence of the native amino acid sequence. Conservative amino acid substitutions are herein defined as exchanges within one of the following five groups:

I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, GIy π. Polar, positively charged residues: His, Arg, Lys m. Polar, negatively charged residues: and their amides: Asp, Asn, GIu, GIn IV. Large, aromatic residues: Phe, Tyr, Trp

V. Large, aliphatic, nonpolar residues: Met, Leu, He, VaI, Cys.

Furthermore, since an inherent problem with native peptides (in L-form) is the degradation by natural proteases, the peptide of the invention may be prepared in order to include D-forms and/or "retro-inverso isomers" of the peptide. Preferably, retro-inverso isomers of short parts, variants or combinations of the peptide of the invention are prepared.

By "retro-inverso isomer" is meant an isomer of a linear peptide in which the direction of the sequence is reversed and the chirality of each amino acid residue is inverted; thus, there can be no end-group complementarity.

A higher biological activity is predicted for the retro-inverso containing peptide when compared to the non-retro-inverso containing analogue owing to protection from degradation by native proteinases. Furthermore they have been shown to exhibit an increased stability and lower immunogenicity [SeIa M. and Zisman E., (1997) Different roles of D-amino acids in immune phenomena- FASEB J. 11, 449]. Retro-inverso peptides are prepared for peptides of known sequence as described for example in SeIa and Zisman, (1997).

Also encompassed by the present invention are modifications of SLURP-I or SLURP-I related proteins (which do not normally alter primary sequence), including in vivo or in vitro chemical derivitization of peptides, e.g., acetylation or carboxylation. Also included are modifications of glycosylation, e. g., those made by modifying the glycosylation patterns of a peptide during its synthesis and processing or in further processing steps, e. g., by exposing the peptide to enzymes which affect glycosylation e. g. mammalian glycosylating or deglycosylating enzymes. Also included are sequences which have phosphorylated amino acid residues, e. g., phosphotyrosine, phosphoserine, or phosphothreonine.

The term "antibody" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i. e. , molecules that contain an antigen binding site that specifically binds (imrnunoreacts with) an antigen. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab, Fab and F (ab) 2 fragments, and an Fab expression library, hi general, an antibody molecule obtained from humans relates to any of the classes IgG, IgM, IgA, IgE and IgD, which differ from one another by the nature of the heavy chain present in the molecule. Certain classes have subclasses as well, such as IgGI, IgG2, and others. Furthermore, in humans, the light chain may be a kappa chain or a lambda chain. Reference herein to antibodies includes a reference to all such classes, subclasses and types of human antibody species.

An isolated SLURP-I protein, SLURP-I related protein, or SLURP-I peptide mimetic of the invention can serve as an antigen, or a portion or fragment thereof, and additionally can be used as an immunogen to generate antibodies that immunospecifically bind the antigen, using standard techniques for polyclonal and monoclonal antibody preparation. The full-length protein can be used or, alternatively, the invention provides antigenic peptide fragments of the antigen for use as immunogens. An antigenic peptide fragment comprises at least 6 amino acid residues of the amino acid sequence of the full length protein, and encompasses an epitope thereof such that an antibody raised against the peptide forms a specific immune complex with the full length protein or with any fragment that contains the epitope. By epitope, reference is made to an antigenic determinant of a polypeptide.

Various procedures known within the art may be used for the production of polyclonal or monoclonal antibodies directed against SLURP-I related protein of the invention, or against derivatives, fragments, analogs homologs or orthologs thereof (See forexample. Antibodies : A Laboratory Manual, Harlow E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY, incorporated herein by reference).

The term "monoclonal antibody" (MAb) or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one molecular species of antibody molecule consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity determining regions (CDRs) of the monoclonal antibody are identical in all the molecules of the population. MAbs thus contain an antigen binding site capable of immunoreacting with a particular epitope of the antigen characterized by a unique binding affinity for it. Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256: 495 (1975). hi a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes can be immunized in vitro. The monoclonal antibodies can also be made by recombinant DNA methods, such as those described in U. S. Patent No. 4,816, 567.

As used herein the term agonist refers to a ligand that activates an intracellular response when it binds to a receptor.

As used herein the term antagonist is a ligand which competitively binds to a receptor at the same site as an agonist, but does not activate an intracellular response initiated by a receptor.

It is another embodiment of the invention to provide a kit for treating or preventing AIDS in a subject, said kit comprising the medicament of the present invention, optionally with reagents and/or instructions for use. Generally, the Kit comprises a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is the medicament of the present invention. The label or package insert indicates that the composition is used for treating the condition of choice, such as AIDS. In one embodiment, the label or package inserts indicates that the composition comprising the medicament of the present invention can be used to treat AIDS as described above.

Alternatively, or additionally, the Kit may further comprise a second (or third) container comprising a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.

Advances in large-scale analysis of human genomic variability provide unprecedented opportunities to study the genetic basis of susceptibility to HTV-I. Applicants report on the use of an in vitro system for the identification of susceptibility loci using whole genome linkage and association analyses.

Individuals do not have the same degree of susceptibility to infection with HIV-I, the AIDS virus. There is considerable interest in identifying the genetic clues that contribute to these differences because it would greatly contribute to understanding how infection takes places, with potential applications in the fields of diagnostics, therapeutics and vaccine.

According to a preferred embodiment of the invention, Applicants have identified (i) a genomic region involved in susceptibility to HIV and to HTV-derived lentiviral vectors (used in human gene therapy), (ii) a genetic marker that identifies individuals at risk for greater progression of the HIV disease (as measured by greater levels of virus in plasma), and rapidly progressing immunosuppression (as measured by levels of CD4 T cells in blood), and (iii) a family of genes with members that modify human susceptibility to infection.

Identification of the genomic region: The region identified in this patent application is placed in the human chromosome 8, cytogenic band q24.3, and carries the gene/genetic determinant of the observed effect on HTV and lentiviral susceptibility. This region, and the determinant herein is marked by a human single nucleotide polymorphism rs2572886. http://www.ncbi.nlm.nih. Rov/entrez/query.fcgi?CMD=search&DB=snp

Identification of the genetic marker: The marker identified in this patent application, rs2572886 (context sequence:

GCTGGAATGTCTGTGGAAAGCACC[AZG]CCTTGCTGATTCTGCCGCAGAGGC), is associated with the following biological effects:

1. The "A" allele is linked to greater susceptibility of human B cells (lymphoblastoid cell lines) to HIV-I -based lentiviral vectors.

2. The "A" allele is linked to greater susceptibility of human T cells to HIV-I in vitro infection. 3. Among HIV-I -infected individuals, the "A" allele is associated with up to 1 log greater levels of viremia (levels of virus in the blood of patients). 4. Among HIV-I -infected individuals, the "A" allele is associated with a greater loss of CD4 T cells in blood, the main marker of progressive disease, the main predictor of the need for treatment, and the strongest predictor of AIDS and death. 5. The size-effect is comparable to that of the human marker CCR5 delta32 in heterozygous state.

The "A" allele is found approximately 15% of Europeans, in 30% of Africans and in up to 40% of Asians, and is thus considered as a "common" variant.

Identification of the gene candidate: The marker identified in the invention, rs2572886, is located in a region that contains multiple members of the LY6 gene family. These are poorly characterized proteins that have, with one exception, never been linked to human disease, and none of these genes/proteins ever associated with HIV or other viral diseases. Among these, SLURPl emerged as the most likely candidate gene/protein responsible for the observed differences in HIV susceptibility.

Industrial Application:

(A)rs2572886: application for laboratory diagnostics tools aimed at identifying individuals at risk for accelerated progression of HTV disease. This marker will be included in a multimarker panel that includes other recognized predictive genetic makers. (B) SLURP 1 : the biological activity of this protein in modulating cellular susceptibility to HTV indicates a potential use of this molecule, or of the blockade of this molecule, or of the mechanisms that mediate the effects of this molecule in the treatment of HTV infection and disease.

As indicated above, Applicants established an in vitro system to address the genetic control of cellular susceptibility to HTV-I using cell lines from multigeneration families (8, P). Applicants used families from the Centre d'Etude du Polymorphisme Humain (CEPH) resource (up to four grandparents and an average of 8 children per family), consisting of EBV- immortalized lymphoblastoid B cell lines (LBL). CEPH LBL cell lines have been extensively genotyped, and the data are publicly available (http://snp.cshl.org/linkage maps/). CEPH LBL cell lines were previously used to identify genomic loci influencing sodium-lithium counter transport (10), natural variation in gene expression (11-14), transcriptional response to ionizing radiation (15), and susceptibility to chemotherapy (16). Applicants showed that CEPH LBL cell lines could allow the genome- wide investigation of inter-individual variation of cellular susceptibility to infection with an isogenic virus, under standardized conditions and a controlled environment. Further Applicants designed the study to progress through consecutive steps: from the identification of candidate markers associated with cellular susceptibility to HTV-I and HTV-I -derived lentiviruses in vitro, to their validation in vivo, in HTV-I infected humans (Figure 1).

Since B-cells are not a natural target of HTV-I, Applicants successfully established the conditions for efficient transduction of lymphoblasts with a VSV.G (Vesicular Stomatitis Virus G protein)-pseudotyped HIV-I -based lentivirus (VSV-lentivirus-GFP) (see Example 1). Applicants assessed to what extent immortalized B-cells reflect the behaviour of CD4⁺ T-cells by transducing purified CD4⁺ T-cells and EBV-immortalized B-cells from 11 Caucasian healthy blood donors, with the same VSV-lentivirus-GFP. Using the GFP transgene expression as a test for permissiveness to lentiviral infection, Applicants noted a significant correlation (²=0.56, 0.007) between the level of transduction of CD4⁺ T-cells and B-cells for the same individual (see Figure 5). Thus, Applicants concluded that transduction of B-cells can capture a significant proportion of inter-individual variation of post-entry events in the HIV-I life cycle (reverse transcription, integration, transcription and translation). Additional validation of the assay established the intra- and inter-day reproducibility of the transduction phenotype in CEPH LBL cells, and ruled out an influence of potential confounders such as EBV copies per cell and the level of expression of the EBV transforming protein LMPl (data not shown).

To monitor heritability (H²), i.e. the proportion of variance attributable to genetic factors) of intra-familial variability in the experimental system, Applicants next scored various traits in 5 CEPH pedigrees (76 individuals). These were traits of lentiviral cell permissiveness, cellular control of EBV copy number, expression of the EBV LMPl oncogene, and expression of 6 cellular proteins (CDl Ia, CD19, CD21, CD23, CD39, CD54). The vast majority of the traits investigated, with the notable exception of the EBV copy number, were under significant genetic control, with H² values ranging from 0.43 to 1 (Figure 2A). These values are in the same range as heritability estimates for the genetic control of gene expression variation (7 T).

hi view of these significant heritability results, Applicants extended the analyses to 15 CEPH pedigrees (198 individuals) for two traits of lentiviral cellular permissiveness (percentage of positive cells and mean fluorescence intensity, MFI). Applicants selected as additional study phenotypes unrelated to HTV susceptibility, the expression of the endogenous cell surface marker CD39 (EBV receptor), and of the EBV-encoded LMPl protein (see Example 1).

Applicants observed intra- and inter-family differences in susceptibility to VSV-lentivirus- GFP transduction (Figure 2B) as indicated by a 9-fold difference in percentage of transduced cells (6 to 56 %), and a 26-fold difference in MFI (3.2 to 83.3 arbitrary units). To identify genomic loci that contribute to the variation of the cellular permissiveness to lentivirus, Applicants performed a genome-wide linkage analysis using 2600 SNP markers (see Example 1). A region on HSA8q24 showed significant linkage with the VSV-lentiviral-GFP cellular permissiveness (percentage of GFP-positive cells) (Figure 3A). The highest multi-point LOD score of 2.89, p=1.3E-04 (marker rsl398296) was significant at genome-wide level as determined by permutation analysis (95% significance threshold of 2.83, N=500).

In order to independently confirm and fine-map the linkage analysis result, Applicants assayed LBL cells from 56 unrelated CEPH individuals that have been genotyped at a high density in the frame of the HapMap project (see Example 1) (J8). The association analysis was performed using 521 tag SNPs in a 3Mb region centered around the initial linkage assignment. A single SNP rs2572886G>A was significantly associated with the percentage of cells transduced with the VSV-lentivirus-GFP (p= 1.8E-5) and this association remained significant after correction for multiple testing by Bonferroni or permutation analysis (N=IOOOO) (Figure 3B). Allele A of marker rs2572886 is associated with a 40% increase in susceptibility to the VSV-lentivirus-GFP in LBL cells from unrelated individuals, p=0.001 (Figure 3C). Similar steps were taken for the secondary study phenotypes unrelated to lentiviral cellular susceptibility, which led to the precise identification of a region involved in cw-regulation of CD39 expression (see Figure 6). In contrast, no locus was identified affecting LMP expression, suggesting a complex control by multiple genes.

As studies were all made on B-cells, Applicants next assessed the potential role of the HSA8q24.3 locus as a susceptibility factor for HIV-I infection of CD4⁺ T-cells. Applicants genotyped SNP rs2572886 in a collection of purified CD4⁺ T-cells obtained from 128 Caucasian healthy blood donors. CD4⁺ T-cells were infected with a replicating HTV-I . A significant association was again obtained for SNP rs2572886 and cellular susceptibility to HTV-I on this independent sample, using a biological system that more closely resembles the in vivo situation. Consistent with the results of transduction of B-cells with a HTV-I based lentivirus, CD4⁺ T-cells of carriers of the A allele were 57% more susceptible to infectious HTV- 1 virus than CD4⁺ T-cells of non-carriers, as assessed in a 7-day replication kinetics analysis (Figure 3D) (see Example 1). Since the previous results were obtained from in vitro assays, Applicants set out to assess the potential association of rs2572886G>A with disease progression in HIV-I infected individuals. The rs2572886A allele has a heterozygous frequency of 15% in Europeans, 30% in Africans, and up to 40% in Asians. Applicants genotyped 805 individuals recruited in the frame of the genetic project of the Swiss HIV Cohort Study (www.shcs.ch) who provided informed consent. These patients contributed consecutive CD4⁺ T-cell data (n=4999 measurements) and viremia (n=1926 measurements) over an average follow-up period of 7 years in the absence of anti-retroviral drug treatment (see Example 1). The rs2572886A allele was consistently associated with greater viral load, and faster progression of immunosuppression, as defined by the slope of CD4⁺ T-cells depletion over time. These effects were present in the subgroup of 259 individuals with precise data of seroconversion (incident cohort, Figure 4A and B), as well as in the whole study population (incident and prevalent cohort, Figure 4C and D). Analyses limited to the evaluation of only Caucasian participants (n=701), and of individuals contributing only to the prevalent cohort (n=549) confirmed the observations. Noteworthy, the size of the effect in heterozygous individuals was comparable (and contrary) to that of the well known protective CCR5 Δ32 allele (Figure 4E). Individuals homozygous for the minor allele variant exhibited as a group a faster disease progression (Figure 4C and D). There was a significative trend for rs2572886A allele dppHJnrHn tV nnhnrt.-nvgr-S ypinrπ fniimv-np .pedoH4hat.mi1xnrRd.ihp pnrir.hmertt nfflflKS. Λ 32 allele (Figure 4F).

In summary, Applicant surprisingly identified, using a multistep procedure involving unbiased whole-genome linkage scan followed by association studies, a novel locus on HS A8q24 that influences human susceptibility to HIV-I. Although the initial findings were based on transduction of transformed B lymphoblastoid cells with a HIV-I -based lentivirus, subsequent experiments on infection of primary CD4⁺ T-cells from donors with replicating HIV-I confirmed the initial observations of a significant genetic association of the rs2572886 SNP with susceptibility. More importantly, the association was also observed in vivo in a cohort of seropositive individuals for whom carriers of the rs2572886A allele show a significantly accelerated disease progression. To Applicant's knowledge, this is the first time that a QTL initially mapped by in vitro approaches, is also shown relevant in a clinical setting. The rs2572886 SNP is located in an intergenic region on the telomeric end of chromosome 8q. It is flanked on both sides by genes of the Ly-6/neurotoxin family (LYNXl and GML on the centromeric and telomeric sides respectively, (see Figure 7).

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications without departing from the spirit or essential characteristics thereof. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features. The present disclosure is therefore to be considered as in all aspects illustrated and not restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the meaning and range of equivalency are intended to be embraced therein.

Various references are cited throughout this Specification, each of which is incorporated herein by reference in its entirety.

The foregoing description will be more fully understood with reference to the following Examples. Such Examples, are, however, exemplary of methods of practising the present invention and are not intended to limit the scope of the invention.

EXAMPLES

Example 1:

Material and methods

Cell culture

CEPH cell lines

EBV-transformed B-cell lines from the CEPH collection (Centre d'Etude du Polymorphisme Humain) were obtained through the Coriell Institute for Medical Research (http://locus.umdnj.edu/nigms/ceph/ceph.html). Cells were cultivated in RPMI

1640/Glutamax-I medium (Invitrogen) supplemented with 15% Fetal Calf Serum (FCS, Inotech), subsequently named R15. They were maintained by replacing half medium 2 times a week. Pedigrees studied were numbers 102, 884, 1328, 1331, 1332, 1333, 1334, 1340, 1341, 1345, 1346, 1347, 1362, 1408, 13292. CD4⁺ T-cell isolation and B cell immortalization

Cells from 11 White healthy blood donors (HBD) were used to isolate CD4⁺ T cells by using anti-CD4 magnetic beads (Miltenyi Biotech). Cells were cultured in RPMIl 640/Glutamax-I medium supplemented with 20% FCS, 20U/ml human interleukin-2 (IL-2, Roche) and 50 Dg/ml gentamicin (Invitrogen) following stimulation with phytohemagglutinin (PHA) at 2 mg/ml for 2 days (i). The CD4 negative cell fraction was exposed to EBV containing supernatant (produced by B95-8 cell line according to current protocols (2).

Lentiviral production and transduction

Lentiviruses were produced by cotransfecting the Gag-Pol construct (pCMV._R8.92), the Rev expression plasmid (pRSVRev), the VSV-G protein envelope construct (pMD.G), and the transgene: the GFP gene placed under the control CMV (p WPTS-GFP) promoter (from D. Trono, EPFL, Lausanne, see www.tronolab.epfl.ch for vector details). Viral production was carried out with 293T cells.

Transduction of CEPH cells and of the B cells of HBD, was performed by spinoculation of 0.5 x 10⁴ cells with lentivirus-containing standardized supernatant, 3h, 150Og, 22°C in 96 wells plates. After 72h, cells were harvested, washed and fixed with Cellfix (Becton Dickinson). Expression of GFP protein was monitored by FACS as described above with mock transduced cells as control. This was performed twice in triplicate at one week interval.

HIV infection

HBD CD4⁺ T cells (10⁶ cells) were infected with NL4-3BaL virus (1,000 pg of ρ24 antigen) in a 1-ml final volume for 2 h at 37°C in 5% CO₂. Cells were washed and cultured in R-20 for 7 days. Virus-containing supernatant was harvested, and p24 antigen production was monitored by an Enzyme Linked Immunosorbent Assay (ELISA) (Abbott).

Phenotyping

For cell surface molecule staining, 10⁵ CEPH cells were washed, resuspended in PBS/0.5% BSA (Sigma) and incubated with primary monoclonal antibodies (mAb) or isotypes, 15 min, room temperature (RT). Primary mAb were : anti-CDlla (Dako, MHM24), -CD 19 (Dako, HD37), -CD21 (Dako, 1F8), -CD23 (Dako, MHM6), -CD39 (Serotec, Al), -CD54 (Dako, 6.5B5), negative control mouse IgGlFITC (Dako, X0927), all used at 1/50, except CD19 used at 1/20. For intracellular staining, CEPH cells were washed, resuspended in cytofix/cytoperm solution (Becton Dickinson) for 20 min at 4°C. After 2 washes with permwash, cells were suspended in permwash with primary anti-LMPl (1/50, S 12, a gift from Dr S. Rothenberger) or negative control antibody mouse IgG2a (1/50, Dako) for 15 min, RT. After washes, cells were incubated in permwash with secondary anti-mouse PE (1/30, Dako). After wash, cells were fixed with CellFix and analyzed using a FACSCalibur system for 10,000 events. Positive events were defined as a fluorescence level superior to that of isotypic control.

Determination of EBV copy number was carried out by Real-time PCR by using specific probes as described (3).

Heritability, linkage, simulations and associations studies

Heritability calculations (H2r) were performed using the 'polygenicscreen' command from the SOLAR software (4). SNP genotyping data, consisting of 2688 autosomal SNPs were downloaded from the SNP Consortium database (http://snp.cshl.org/ linkage_maps) (5).

Multipoint linkage with the SNP map was performed using Merlin (<5) with the -VC option, after Mendelian inconsistencies (PEDCHECK) (7) and unlikely genotypes (PEDWIPE) (6) were removed. To calculate the empirical significance of the linkage results, we performed 500 simulations for each quantitative trait using the -simulate command from Merlin with different seed numbers. We extracted the highest result from each simulation to build significance distributions. All simulations were performed using a cluster of 32 HP/Intel Itanium 2 based servers at the Vital-IT Center (http://www.vital-it.ch/).

Association analysis of quantitative phenotypes (% of GFP positive cells and /MFI of CD39), and corrections for multiple testing were performed using the PLDSfK software (http://pngu.mgh.harvard.edu/~purcell/plink/anal.shtml). Genotypes were downloaded from the HapMap project URL (http;//www.hapmap.org/cgi-perl/gbrowse/gbrowse/hapmap), HapMap public release no. 19. Cohort analysis

The data were analysed longitudinally by modelling the CD4 T cell count and HTV-I RNA load trajectories over time for different genotype groups. We recruited patients with a known date of infection (incident cases), and individuals who are already HTV-seropositive by the time they entered the study (prevalent cases). For the latter, an estimate of the unknown date of infection (1O)(Il) was done by jointly modelling the link between time since infection, the CD4 T cell time path and the drop-out process based on a shared random parameter model approach (12)(13). The CD4 T cell difference from baseline was modelled using mixed models, and the time since infection, as well as the time to early termination was modelled using Accelerated Failure Time Frailty models (AFTF). Using the estimated density of time since infection, the date of infection was estimated by mean conditional imputation, hi a second stage, the analysis of the markers' trajectories was conducted using population- averaged marginal modelling (14). A multivariate distribution was fitted to the data using score-like methods (generalized estimating equations). To limit the impact of frailty selection we focused on the first eight years since infection. The analyses were repeated considering in turn only the incident, prevalent, and both cohorts. Sub-analyses were also performed considering the Caucasian group only. The allelic frequency over time was assessed annually, and nonparametric trend test was used to compare the proportions of genotypes. All statistical analyses were conducted using SAS version 9.1 for Windows, as well as STATA 9.2 .

Example 2:

Material and methods: B lymphoblastoid cell lines (LBLs, 198 individuals, 15 CEPH multigeneration pedigrees) were transduced with VSV-lentivirus-GFP. Trait data (% of GFP positive cells and MFF) was used for genome scan linkage analysis (2600 SNP markers). Linkage was confirmed by transduction of LBLs from 56 independent HapMap individuals in a genome association analysis using 521 tag SNPs on a 3Mb region centered around the initial linkage assignment. Candidate markers were assessed for association with CD4 T cell permissiveness in cells from 128 healthy blood donors. Association of a candidate marker with disease progression in vivo was investigated in a HIV-I -infected human cohort of 805 individuals.

Results: The heritability of susceptibility to VSV-lentivirus-GFP in vitro was 0.53 and 0.43 for %GFP⁺ cells and MFI, respectively. Linkage analysis identified a locus on chromosome 8q24.3 (LOD=2.89, p=2E-04). Association analysis using LBLs from unrelated individuals identified SNP rs2572886G>A to be associated with the %GFP trait (ρ= 1.8E-5). Allele A of marker rs2572886 is associated with 40% increase in susceptibility to the VSV-lentivirus-GFP in LBL cells (p=0.001), and 57% increase in susceptibility to HIV-I in CD4 T cells (p=0.019). Allele A was associated with greater viral load, and faster progression of immunosuppression in the HTV-I -infected cohort. Conclusions: Applicants identified, using a multistep procedure involving unbiased whole- genome linkage scan followed by association studies, a novel locus on chromosome 8 that influences human susceptibility to HIV-I . This is the first time that a quantitative trait locus initially mapped by in vitro approaches, is also shown relevant in a clinical setting.

Reference List

L A. Telenti, D. B. Goldstein, Nat Rev Microbiol 4, 9 (2006).

2. S. J. O'Brien, G. W. Nelson, Nat. Genet. 36, 565 (2004).

3. G. Bleiber et al, J Virol 79, 12674 (2005).

4. A. R. Welton et al, J. Virol. 79, 11517 (2005).

5. K. E. Bennett et al., Genetics 170, 185 (2005).

6. C. Picard, J. L. Casanova, L. Abel, Curr. Opin. Immunol. (2006).

7. S. E. Antonarakis, J. S. Beckmann, Nat. Rev. Genet. 7, 277 (2006).

8. H. M. Cann et α/., Science 296, 261 (2002).

9. J. Dausset et al, Genomics 6, 575 (1990).

10. N. J. Schork et al, Hypertension 40, 619 (2002).

11. V. G. Cheung et al, Nat. Genet. 33, 422 (2003).

12. M. Morley et al. , Nature 430, 743 (2004).

13. S. A. Monks et al, Am. J. Hum. Genet. 75, 1094 (2004).

14. V. G. Cheung et al, Nature 437, 1365 (2005).

15. K. Y. Jen, V. G. Cheung, Genome Res. 13, 2092 (2003).

16. J. W. Watters, A. Kraja, M. A. Meucci, M. A. Province, H. L. McLeod, Proc. Natl. Acad. ScL U. S. A 101, 11809 (2004).

17. S. Deutsch et al, Hum. MoI. Genet. 14, 3741 (2005).

18. D. Altshuler et al, Nature 437, 1299 (2005). Reference List of Example 1

1. A. Ciuffi et al. , J Virol 78, 10747 (2004).

2. W. E. BIddison, J. E. Bonifacio, M. Dasso, J. B. Harford, J. Lippincott-Schwartz, K. M. Yamada, Eds. (John Wiley & Sons, Inc., New York, 1999) ,chap. 2.4.

3. H. G. Niesters et al., J. CHn. Microbiol. 38, 712 (2000).

4. L. Almasy, J. Blangero, Am. J. Hum. Genet. 62, 1198 (1998).

5. T. C. Matise et al, Am. J. Hum. Genet. 73, 271 (2003).

6. G. R. Abecasis, S. S. Cherny, W. O. Cookson, L. R. Cardon, Nat. Genet. 30, 97 (2002).

7. J. R. O'Connell, D. E. Weeks, Am. J. Hum. Genet. 63, 259 (1998).

8. B. Basrak, C. A. Klaassen, M. Beekman, N. G. Martin, D. I. Boomsma, Behav. Genet. 34, 161 (2004).

9. P. H. Westfall, S. S. Young, Resampling-based multiple testing (Wiley-Interscience, New York, 1993).

10. A. Munoz et al., Stat. Med. 11, 939 (1992).

11. R. B. Geskus, Stat. Med. 20, 795 (2001).

12. E. F. Vonesh, T. Greene, M. D. Schluchter, Stat. Med. 25, 143 (2006).

13. G. Touloumi, S. J. Pocock, A. G. Babiker, J. H. Darbyshire, Stat. Med. 18, 1215 (1999).

14. P. J. Diggle, Analysis of longitudinal data (Oxford University Press, ed. 2nd edition, 2002).

Claims

1. A method for predicting susceptibility to infection with HIV- 1 virus in a subject comprising determining the presence in said subject of a specific genetic marker on chromosome 8q24.3.

2. A method for predicting AIDS progression in an HIV-I infected subject comprising determining the presence in said HIV-I infected subject of a specific genetic marker on chromosome 8q24.3.

3. The method according to claims 1 or 2, wherein the specific genetic marker on chromosome 8q24.3 is located in the Leukocyte Antigen (Ly-6) gene locus.

4. The method according to claim 3, wherein the specific genetic marker is rs2572886A allele (GCTGGAATGTCTGTGGAAAGCACCACCTTGCTGATTCTGCCGCAGAGGC) or rs2572886G allele (GCTGGAATGTCTGTGGAAAGCACCGCCTTGCTGATTCTGCCGCAGAGGC).

5. The method according to claim 4, wherein the rs2572886A allele is associated with greater HIV viral load, rapid immunosuppression progression and/or faster AIDS disease progression.

6. The method according to claim 4, wherein the rs2572886G allele is associated with lower HIV viral load, low immunosuppression progression and/or slower AIDS disease progression.

7. Use of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus in the manufacture of a medicament for the treatment and/or the prevention of AIDS.

8. The use according to claim 7, wherein the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is selected from the group comprising LY6K, SLURPl, LYPD2, LYNXl / SLURP2, LY6D, GML, LY6E, and LY6H.

9. The use according to claim 8, wherein the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is SLURP 1.

10. A method for treating and/or preventing AIDS in an HTV-I infected subject comprising the step of modulating the expression of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus.

11. The method according to claim 10, wherein the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is selected from the group comprising LY6K, SLURPl, LYPD2, LYNXl / SLURP2, LY6D, GML, LY6E, and LY6H.

12. The method according to claim 11, wherein the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is SLURP 1 or LYNXl / SLURP2.

13. The method according to claim 12, wherein the protein encoded by the Leukocyte Antigen (Ly-6) gene locus is SLURP 1.

14. The method of any of claims 10 to 13, wherein the step of modulating includes increasing the expression of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus by biological or pharmaceutical intervention, or by exogenous provision of the protein.

15. The method of any of claims 10 to 13 , wherein the step of modulating includes decreasing the expression of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus.

16. The method of claim 15, wherein decreasing the expression of a protein encoded by the Leukocyte Antigen (Ly-6) gene locus is carried out by RNA interference, or by pharmaceutical intervention.

17. A method for predicting AIDS progression in an HIV-I infected subject comprising

a) determining the amount of SLURP 1 in a biological sample of said HTV-I infected subject and,

b) comparing said amount with the amount of SLURP 1 in a biological sample of a control subject,

whereby an amount of SLURP 1 in step a) greater than the amount of SLURP 1 in step b) predicts slower AIDS disease progression.