WO2008103428A2

WO2008103428A2 - Demannosylated hiv-1 gp120 envelope gylcoproteins, compositions thereof and methods relating thereto

Info

Publication number: WO2008103428A2
Application number: PCT/US2008/002325
Authority: WO
Inventors: Meimei Shan; William C. Olson; Paul J Maddon; Sofija Andjelic; Sai Prasad N. Iyer; John P. Moore; Rogier Sanders
Original assignee: Progenics Pharmaceuticals, Inc.; Cornell Research Foundation, Inc.
Priority date: 2007-02-23
Filing date: 2008-02-22
Publication date: 2008-08-28
Also published as: WO2008103428A3

Abstract

This invention provides a composition comprising a demannosylated HIV-I gpl2O envelope glycoprotein and a pharmaceutically acceptable carrier. This invention also provides a composition comprising a trimer which comprises three demannosylated gpl20 envelope glycoproteins. This invention also provides a vaccine comprising the compositions described herein. Finally, this invention provides methods of using the compositions of the invention.

Description

DEMANNOSYLATED HIV-I GP120 ENVELOPE GLYCOPROTEINS. COMPOSITIONS THEREOF. AND METHODS RELATING THERETO

This invention was made with support under United States Government Grant Nos. AI 30030 and AI 36082 from the National Institutes of Health, Department of Health and Human Services. Accordingly, the United States Government has certain rights in the subject invention.

Throughout this application, certain publications are referenced. Full citations for these publications may be found immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention relates.

BACKGROUND OF THE INVENTION

One approach to a vaccine against human immunodeficiency virus type 1 (HIV-I) is the use of the viral envelope (Env) glycoproteins as immunogens to induce neutralizing antibodies (NAbs)

[Burton (2004); Pantophlet (2006); Zwick (2005)]. Usually, the Env glycoproteins are presented as adjuvanted, soluble proteins after production in vitro as recombinant proteins, but they can also be expressed in vivo from delivery systems based on DNA or live recombinant viruses (e.g., poxvirus or adenovirus vectors) [McMichael (2006)]. Different configurations of Env glycoproteins have been studied as vaccine antigens, initially the surface glycoprotein gpl20, more recently, soluble oligomeric gpl40 proteins based broadly on the native gpl20-gp41 complex

[Burton (2004); Pantophlet (2006); Zwick (2005)].

Irrespective of how HIV-I Env glycoproteins have been presented and in whatever configuration, the induction of broadly active NAbs has proven problematic [Burton (2004)]. One problem is the evolution of the native Env complex into a configuration that limits the exposure of the few neutralization sites that are present. One possible solution is to further understand the structure of the complex, then to engineer antigens that are better able to present relevant NAb epitopes to the immune system [Burton (2004)] .

Although antibody responses to HIV-I Env can clearly be induced in infected or vaccinated humans and animals, these proteins are not particularly immunogenic. Thus gpl20 or gpl40 proteins are typically administered at 100-500ug per dose, and the binding antibody titers raised against them can be highly variable; some humans and animals respond fairly well, others only poorly [Connor (1998); Flynn (2005); Gilbert (2005); Graham (1998); Grundner (2004)]. Moreover, the anύ-Env antibody titers decay rather rapidly (half-lives are typically in the range 30- 50 days), necessitating frequent boosting. Few directly comparative studies have ever been performed, but the limited information available supports the contention that Env is an unusually problematic immunogen [Wright (2004)]. The immune responses to HIV-I Env vaccine antigens are T_H2-polarized to an extent that is unusual even for a soluble protein [Daly (2005); Gorse (1999)]. The same T_H2 bias can also be observed during HIV-I infection, although this is a much more complex situation [Abbas (2005); Martinez (2005); Ngo-Giang-Huong (2001)]. The nature of the immune response to gpl20 may be attributable to the fundamental properties of this unusual protein. One feature that distinguishes gpl20 from many other vaccine antigens is its biological activity. Specifically, gpl20 can bind to several cell surface receptors: CD4, CCR5, CXCR4 and several mannose C-type lectin receptors (MCLR) including but not limited to DC-SIGN [Pantophlet (2006)]. One consequence of gpl20 binding to such receptors in vitro is the transduction of intracellular signals that can have many different, but generally adverse, effects on the various target cells. Although the concentrations of gpl20 used to elicit such signals (ug/ml range) are often grossly in excess of what could be present during HIV- 1 infection [Klasse (2004)], they are compatible with what is used for immunization (several hundred ug of protein delivered in a few ml into a localized tissue site) [Connor (1998); Flynn (2005); Gilbert (2005); Graham (1998); Grundner (2004)]. ^'

SUMMARY OF THE INVENTION

This invention provides a composition comprising a demannosylated HIV-I gpl20 envelope glycoprotein and a pharmaceutically acceptable carrier. According to this invention, the composition may be a pharmaceutially acceptable composition comprising a carrier, diluent, or excipient.

This invention also provides a composition comprising (a) a trimeric complex, each monomelic unit of the complex comprising a modified form of gpl20 of an HIV-I envelope polypeptide and a modified form of an ectodomain of gp41 of the HIV-I envelope polypeptide, wherein the modified gpl20 polypeptide is demannosylated and the modified gpl20 and the modified gp41 ectodomain are bound to each other by at least one intermolecular disulfide bond between a cysteine (C) residue introduced into the modified gpl20 and a cysteine (C) residue introduced into the modified gp41 ectodomain, which stabilizes the otherwise noncovalent gpl20-gp41 ectodomain interaction, and (b) a pharmaceutically acceptable carrier. This invention also comprises a composition which comprises a complex of a modified form of gρl20 of an HIV-I envelope polypeptide and a modified form of an ectodomain of gp41 of the HIV-I envelope polypeptide, wherein the modified gpl20 polypeptide is demannosylated and comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 492 in an unmodified gpl20 polypeptide, and the modified gp41 ectodomain comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 596 in an unmodified gp41 ectodomain; the amino acid positions being numbered by reference to the HIV-I isolate HrV-l_JR. _FL; and wherein the modified gpl20 and the modified gp41 ectodomain are joined together by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain. This invention further provides a composition comprising a trimer which comprises a noncovalently bound oligomer of three identical compositions of the invention, and a pharmaceutically acceptable carrier.

This invention further provides a composition which comprises a modified gpl40 envelope polypeptide of an HIV-I isolate, wherein a first portion of the gpl40 polypeptide corresponds to a modified gpl20 polypeptide and a second portion of the gpl40 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gpl20 polypeptide is demannosylated and comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 492 in unmodified gpl20 protein and wherem the modified gp41 ectodomain compnses a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 596 in unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-lj_R._FL; and further wherein the modified gp41 ectodomain compnses a proline (P) residue which replaces a non-proline residue at amino acid position 559 in the unmodified gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HIV-I _HXB2> wherein the modified gpl20 and the modified gp41 ectodomain are joined together by a disulfide bond that stabilizes the otherwise noncovalent interaction of gp 120 and the gp41 ectodomain.

This invention further provides a composition comprising a trimer which compnses a noncovalently bound oligomer of three identical modified gpl40 polypeptides of the invention. This invention further provides a protein compnsing a first polypeptide which compnses consecutive amino acids encoding a modified gpl20 of an HIV-I isolate, which modified gpl20 is demannosylated and comprises a first cysteine (C) residue introduced by a mutation, and a second polypeptide which comprises consecutive amino acids encoding a modified gp41 ectodomain of the HIV-I isolate, which modified gp41 ectodomain compnses a second cysteine (C) residue introduced by a mutation, wherein (i) the modified gp41 polypeptide further comprises at least one amino acid in its N-terminal helix that replaces an amino acid in unmodified gp41 at one or more positions selected from the group consisting of 583, 580, 576, 573, 569, 566, 562, 590, 587, 555, 552, 548, 545 and 559, the amino acid positions being numbered by reference to the HIV-I isolate HΓV-1 _HXB2 and (ii) the first and second polypeptides are bound to one another by a disulfide bond between the first cysteine (C) and the second cysteine (C). This invention also provides a stable HIV-I pre-fusion envelope glycoprotein trimeric complex comprising as a monomelic unit the protein of the invention.

This invention also provides a composition comprising the trimeric complex of the invention and a pharmaceutically acceptable earner.

This invention compnses a method of eliciting an immune response against HIV-I in a subject compnsing administering to the subject any of the compositions of the invention in an amount effective to elicit the immune response against HFV-I in the subject.

This invention also provides a method of generating a high titer antibody response against HIV-I in a subject, compnsing administenng to the subject any of the compositions of the invention in an amount effective to generate the high titer antibody response against HIV-I in the subject. This invention provides a method of preventing a subject from becoming infected with HIV-I, comprising administering to the subject any ofthe compositions of the invention in an amount effective to prevent the subject from becoming infected with HIV-I .

This invention also provides a method for reducing the likelihood of a subject becoming infected with HIV-I, compπsing administering to the subject any of the compositions ofthe invention in an amount effective to reduce the likelihood ofthe subject becoming infected with HIV-I

This invention provides a method of preventing or reducing the likelihood of an immunosuppressive immune response in a subject infected by HIV-I, which comprises administering to the subject a pharmaceutically acceptable composition compπsing demannosylated HIV-I gp 120 in an amount effective to prevent or reduce the immunosuppressive immune response in the subject

This invention also provides a method of increasing a T_H1 -based immune response in a subject following exposure to HIV-I, which comprises administering to the subject a pharmaceutically acceptable composition compπsing demannosylated HIV-I gpl20 glycoprotein in an amount effective to increase the T_H1 -based immune response in the subject. This invention further provides a method of preventing or reducing binding of gpl20 envelope glycoprotein to a Type-C mannose receptor (MCR) on a monocyte-deπved dendπtic cell (MDDC) in a subject infected by HIV-I and thereby circumventing production of immunosuppressive levels of interleukin-10 (IL-IO) by the MDDC, which method compπses administeπng to the subject a pharmaceutically acceptable composition compnsing demannosylated HIV-I gpl20 glycoprotein in an amount effective to prevent or reduce the binding of the demannosylated gpl20 to the MCR of the MDDC, thereby circumventing the production of immunosuppressive IL-10 levels by the MDDC in the subject.

This invention also provides a method of preventing or reducing the likelihood of an induction of immunosuppressive interleukin-10 cytokine production by monocyte-deπved dendπtic cells (MDDC) in a subject exposed to HIV-I, which compπses administeπng to the subject a pharmaceutically acceptable composition compπsing demannosylated gpl20 glycoprotein in an amount effective to prevent or reduce the induction of immunosuppressive interleukin-10 cytokine production by the MDDC in the subject This invention provides a vaccine which compπses a therapeutically or prophylactically effective amount of any of the compositions descπbed herein

BRIEF DESCRIPTION OF THE FIGURES

Figure IA-C: Flow-cytometπc analysis of surface markers on PBMC, monocytes and MDDC.

A. The top panel shows forward and side scatter plots of PBMC isolated from a healthy blood donor The lower population of cells has the characteπstics of live lymphocytes (47 3% of all cells), the upper population corresponds to monocytes (11.5%). The middle forward-side scatter plot shows the puπty (81 6%) of the monocytes after positive selection with anti-CD 14- conjugated beads. The lower diagram depicts double cell-surface staining with antibodies to CD4 and CD 14; -99% of the cells were CD 14+.

B. The monocytes shown in A were cultured for 6 days with GM-CSF and IL-4. The two columns of scatter plots show the cell-surface expression (y-axis) of HLA-DR, CD86, CD83 and CD80 (left-hand panels), and of DC-SIGN, CD206 and DEC-205 (right-hand panels), on CDl Ic* MDDC (x-axis).

C. CDHc+ cells were cultured for 6 days with GM-CSF and IL-4. The mean values (± SEM) for the proportions of cells from n donors that express CD 14, HLA-DR, CD80, CD83 and CD86 (n=9); DC-SIGN (π=8); or DEC-205, CD206 and CD25 (n=4) are shown.

Figure 2A-D:

HIV-I gpl20 induces IL-10 secretion from MDDC in a donor-, concentration- and time-dependent manner.

A. MDDC from 60 individual human donors were cultured in GM-CSF + IL-4 for 6 days and then incubated for 24 or 48h with or without 3|ig/ml of gpl20. IL-10 production was measured by

ELISA. Cells from only a subset of donors secreted EL-IO at detectable levels but the median response to gpl20 treatment was significantly higher than from control cells, both at 24h and 48h (p < 0.0001). Bars represent median values.

B. The secretion of IL-10 from MDDC after 24h is depicted as a function of the gpl20 concentration. The data points show mean values ± SD (the error bars lie within the symbols) of duplicate ELISA determinations. Left: The three curves represent the responses of MDDC from three different donors to JR-FL gpl20. Right: the four curves show the responses of MDDC from four different donors to LAI gpl20.

C. Top panel: The IL-10 concentrations in the cultures are shown on the y-axis as a function of time after addition of JR-FL gpl20 (3u.g/ml). The data points show mean values ± SD (the error bars lie within the symbols) of duplicate ELISA determinations. The three curves represent the responses from three different donors. Bottom panel: The ethidium bromide-stained agarose gel shows gpl20-stimulated EL-IO mRNA expression in MDDC. Untreated MDDC were negative for IL-10 mRNA. MDDC stimulated with TNIL+LPS (lOng/ml) serve as a positive control. The (3- actin band (315bp) confirms that mRNA recovery was consistent at the different time points.

D. iMDDC from a day-6 culture were left untreated, or were exposed to gpl20 or TNTL+LPS+CD40L, for 16h before intracellular detection of IL-4, IL-10, IL-12p70 and IFN-y by flow-cytometry. The bars in the diagrams represent the percentage of cytokine+ cells among the CDlIc+ iMDDC from three donors: Left panel: untreated iMDDC; middle panel: iMDDC treated with JR-FL gpl20 (3ug/ml); right panel: iMDDC stimulated with TNIL+LPS+CD40L.

Figure 3A-D:

The induction of IL-10 secretion by gpl20 is mannose-dependent.

A. The bars represent IL-10 production from MDDC on day 6 after 24h (black bars) or 48h (white bars) of treatment with JR-FL gpl20 (3 fig/ml). The reagents listed on the horizontal axis were incubated with gpl20 or iMDDC for Ih prior to addition of gpl20 to the cells (see Methods for the inhibitor concentrations tested). The bars represent the mean value ± SEM for data derived from five different donors. The various reagents were also tested in the absence of gpl20 and found not to stimulate IL-10 production (data not shown), with the exception of mannan.

B. The binding of mAbs bl2 and 2Gl 2 or the CD4-IgG2 protein to mock-treated M-gpl20 (squares) and cc-(l-2,3,6) mannosidase-treated D-gpl20 (circles) was compared in a gpl20-capture ELISA. The binding of DC-SIGN-Fc to the same gpl20 proteins was tested by ELISA. The Ca2+- and mannose-dependent binding of DC-SIGN-Fc to gpl20 was inhibited by EGTA and by the anti- DC-SIGN mAb, AZN-Dl (M-gpl20 black bar; D-gpl20 white bar).

C. Left panel: A Blue-native gel shows the reduction in gpl20 m.wt. after treatment with a-(l- 2,3,6) mannosidase. Right panel: Western blotting with anti-gpl20 serum ARP3119 confirms the m.wt reduction, blotting with mAb 2Gl 2 shows that its mannose-dependent epitope has been removed from gρI20. (M, m.wt markers; Enz only, no gpl20 present). D. The experimental design was the same as in panel A. The gpl20 proteins (or influenza HA, or TNTL+LPS+CD40L) tested are listed on the x-axis. The bars represent the mean values ± SEM for data derived from five different donors.

Figure 4: gpl20 impairs iMDDC maturation via interaction with an MCLR(s).

The maturation status of MDDC was evaluated after treatment for 48h with 3p.g/ml of JR-FL gpl20 (white bars), M-gpl20 (black bars) or D-gpl20 (striped bars). The average fold-change in MFI values for the cell-surface expression of CD80, CD83, CD86, HLA-DR, DC-SIGN, DEC-205 and CD206 on CDlIc+ cells is depicted (mean values from four donors ± SD). Top panel: the gpl20s have no effect on iMDDC maturation in the absence of other stimuli. MFI values were normalized to those for untreated iMDDC. Bottom panel: iMDDC were induced to mature on day 6 by adding TNIL+LPS in the presence of the various gpl20 proteins. MFI values were normalized to those for cells treated with only TNIL+LPS.

Figure 5A-B:

Treatment with gρl20 inhibits MDDC-induced T-cell proliferation

A. iMDDC were treated as specified on the x-axis: TNIL+LPS with or without M-gpl20, D- gpl20 or influenza HA were present on days 6-8. From day 8 onwards, the various sets of MDDC were co-cultured with CFSE-labeled CD4+ T cells before determination of the extent of the allogeneic mixed T lymphocyte reaction on day 13. The percentages of CFSE-negative cells (% CFSE dilution) are plotted on the y-axis. The bars represent the mean values ± SD for the relative proliferation of CD4+ T-cells from fifteen donors (except for influenza HA; ten donors) tested in fifteen independent experiments. Relative proliferation was calculated by first subtracting the background value for CFSE-negative cells obtained using unstimulated iMDDC (9.95% + 0.70%, n=15), then normalizing against the percentage of CFSE-negative cells obtained when TNIL+LPS- stimulated MDDC were used (46.4% ± 1.54% n=15). The superantigen SEB served as a positive control for CD4+ T cell stimulation in the absence of any MDDC; CFSE dilution in response to SEB was 130% ± 2.9% (n=15) of that to TNIL+LPS+CD40L. B. Extracellular cytokine levels were measured at the end of the MDDC-T cell co-culture (day 13). The bars represent the mean values ± SEM from five different donors. Top panel, IL-IO; bottom panel, IL-12p70.

Figure 6A-B: MDDC matured in the presence of gpl20 can prime T_reg cells.

A. IL-4 (checkered bar), IL-6 (black bar), IL-10 (striped bar) and IL-12p70 (white bar) concentrations in co-cultures of MDDC and naive, CD4+CD45RA+ T-cells were measured by ELISA after 12 days of co-culture. The mean values ± SD for three donors are shown. The iMDDC were treated as described on the x-axis: untreated (control iMDDC); gpl20; TNIL+LPS; gpl20+TNIL+LPS. All agents were present from days 6-8.

B. Purified naive, CD4+CD45RA+ T-cells were co-cultured for 12 days with MDDC that had been pre-treated as indicated above each graph (analogously to panel A). The frequency of CD4+CD25+FOXP3+ Treg cells was then assessed by cell-surface staining for CD4 and CD25, followed by intracellular staining for FOXP3. CTLA-4 and GITR cell surface expression was also measured. The bars represent the percentage of CD4+CD25+ double-positive cells that were also FOXP3+ (white bar), CTLA-4+ (striped bar) or GITR+ (black bar), and are mean values + SEM from two different donors.

Figure 7: Analysis of purified KNHl 144 SOSIP R6 gpl40 trimer and gpl20 monomer.

Purified KNHl 144 gpl20 monomer (left panel, gp!20) and SOSIP R6 gpl40 trimer were analyzed by reducing (left panel, SOSIP R6, Red) and non-reducing SDS-PAGE (left panel, SOSIP R6, NR). Proteins were visualized by Coomassie G-250 stain. Purified trimer was also analyzed via ARP3119 western blot on non-reducing SDS-PAGE to examine presence of SDS-insoluble aggregates (middle panel, Anti-Env blot). The numbers on the left represent the migratory positions of the molecular weight standard proteins. The right panel shows BN-PAGE analysis of purified trimer, either untreated or treated with Tween® 20 (SOSIPR6, -/+ lanes) and purified gpl20 monomer in absence or presence of Tween® 20 treatment (gp!20, -/+ lanes). Arrows indicate high molecular weight (HMW) aggregate, trimer and gpl20 monomer species. M stands for the 669k thyroglobulin and 440k ferritin molecular weight protein standards.

Figures 8A-D:

Tween® 20 conversion experiments.

A. Dose response: Purified KNHl 144 SOSIP R6 gpl40 trimer was incubated with 0 (no detergent control), or 0.1, 0.05, 0.01, 0.001, or 0.0001% Tween® 20 and analyzed by BN-PAGE and Coomassie G-250 stain. Arrows point to HMW aggregate and trimer species. M stands for the 669k thyreoglobulin and 440k ferritin molecular weight protein standards.

B. Time course: Purified KMiI 144 SOSIP R6 gpl40 trimer was incubated with Tween® 20 for 5 min (left panel) or 10 min (right panel). Trimer was either untreated (- lane) or Tween® 20 treated (+ lane). Arrows indicate trimer and HMW aggregate bands.

C. Temperature effect: Purified KNHl 144 SOSIP R6 gpl40 trimer was either untreated (- lane) or treated with Tween® 20 at on ice (0), room temperature (RT) or 37⁰C. Reactions were analyzed by BN-PAGE and Coomassie G-250 stain. Arrows indicate HMW aggregate and trimer proteins.

D. Tween® 20 effect on HMW aggregate and dimer fractions: A preparation composed predominantly of HMW aggregate ( > 80%) was untreated (left panel, - lane), or incubated with Tween® 20 (left panel, + lane), and analyzed by BN-PAGE and Coomassie G-250 stain. Solid arrows indicate HMW aggregate and trimer proteins. Preparations composed of HMW aggregate, dimers and monomers were untreated (right panel, - lane) or incubated with Tween® 20 (right panel, + lane) and analyzed by BN-PAGE and Coomassie G-250 stain. Arrows on the right hand side point to aggregate, trimer, dimer and monomer species.

Figure 9: Size Exchange Chromatography (SEC) analysis of KNHl 144 SOSIP R6 gpl40 trimer.

KNHl 144 SOSIP R6 gpl40 trimer was resolved on a Superdex 200 10/300 GL column in TN-500 buffer containing 0.05% Tween® 20 (TNT-500). The A₂so protein profile of the run is shown in the middle panel. Fractions B7-C3 from the run were analyzed by BN-PAGE, followed by silver stain (bottom panel). Arrows to the side of the BN-PAGE image point to the trimer. The vertical arrow in the BN-PAGE indicates the peak signal of the trimer in fraction B 12. The arrow in the middle chromatograph corresponds to fraction B 12.

Figures 10A-B:

Effect of Tween® 20 treatment on KNHl 144 SOSIP R6 HMW aggregate antigenicity. A. Lectin ELISA of untreated and Tween® 20 treated KNHl 144 SOSIP R6 HMW aggregate: Untreated or Tween® 20-treated HMW aggregate were bound to GNA lectin coated ELISA plates and probed with 2Gl 2, b6, bl2, CD4-IgG2, and HIVIg. The panels represent their respective binding curves. Antibody affinity to the untreated HMW aggregate is represented by the curve having diamond lines. Affinity to the Tween® 20 treated HMW aggregate is represented by curve having square lines. The Y-axis represents the colorimetric signal at OD492 and the X-axis represents antibody concentration in [ug/ml].

B. Lectin ELISA of untreated and Tween® 20-treated KNH 1144 SOSIP R6 gpl40 trimer: Untreated or Tween® 20 treated trimer (containing 10-15% HMW aggregate) were bound to GNA lectin coated ELISA plates and probed with 2G12, b6, bl2, and CD4-IgG2. The panels represent their respective binding curves. Antibody affinity to the untreated trimer is represented by the curve having diamond lines. Affinity to the Tween® 20 treated trimer is represented by the curve having square lines. The Y-axis represents the colorimetric signal at OD492 and the X-axis represents antibody concentration in [ug/ml].

Figure 11:

Effect of Tween® 20 treatment on KNH 1144 SOSIP R6 gpl40 trimer binding to DEAE anion exchange column.

Purified KNHl 144 SOSIP R6 gpl40 trimer, spiked with alpha-2 macroglobulin (a₂M) contaminant, was either untreated or treated with Tween® 20. Following treatment, sample was applied over an anion exchange column (DEAE HiTrap FF 1 ml column) (Load). Flow through (FT) fractions were collected and the column was washed (Wash). The column was eluted (Elution) and fractions were analyzed over BN-PAGE, followed by Coomassie G-250 stain. The top panel shows fractions analyzed from the untreated control trimer DEAE application. The bottom panel shows fractions analyzed from the Tween® 20 treated trimer DEAE application. Arrows point to trimer and a₂M contaminant proteins. M stands for the 669k thyroglobulin and 440k ferritin molecular weight protein standards. Asterisks highlight the fraction where the trimer is found.

Figure 12:

Negative stain electron micrographs of KNHl 144 SOSIP R6 gpl40 trimers.

KNHl 144 SOSIP R6 gpl40 trimers were analyzed by negative stain electron microscopy. A gallery of 19 selected trimeric proteins in deeper stain is shown. Bar = 50 run.

Figure 13:

SEC analysis of KNHl 144 gpl20 monomer: KNHl 144 gpl20 monomer was resolved on a Superdex 200 10/300 GL column in TN-500 buffer. The top chromatograph shows its A₂₈₀ protein profile of the run. As a control, JR-FL gpl20 monomer was resolved in a similar manner and its A_2So protein profile is displayed in the bottom chromatograph. The observed retention times for both monomers and their apparent calculated molecular weights are indicated.

Figure 14:

Tween® 20 effect on a₂M: Purified a₂M was incubated with Tween® 20 (+ lane) or waa untreated (- lane). Reactions were analyzed by BN-PAGE and Coomassie stain. Arrow indicates a₂M band.

Figure 15:

Mannosylated vs. De-mannosylated gpl20 mice immunization studies: Sera gpl20 binding titer results for Bleed 2. Figure 16:

Mannosylated vs. De-mannosylated gpl20 mice immunization studies: Sera gpl20 binding titer results for Bleed 3.

Figures 17A-17D:

HIV-I gpl20 Induces IL-IO Secretion from MDDCs in a Donor- and Concentration-Dependent Manner

(A) MDDCs from different human donors were cultured in GM-CSF + IL-4 for 6 d and then incubated for 24 h (n = 71 donors) with or without JR-FL gpl20 (3 μg/ml) before measurement of IL-10 production by ELISA. The fold-increases in IL-10 production after gpl20 treatment compared with untreated cells are depicted on they-axis. Another set of MDDC from each donor was stimulated for 24 h with TNIL + LPS (±CD40L), instead of gpl20. The corresponding fold- increase in IL-10 secretion compared with untreated cells is also plotted.

(B) MDDCs from 1 1 pedigreed donors were cultured and stimulated with gpl20 or TNIL + LPS, as in (A), twice within a 3-mo interval. IL-10 production was measured 24 h after stimulation.

Black bars represent the first assay on each donor, white bars the second.

(C) The secretion of IL-10 from iMDDCs after 24 h is depicted as a function of the gpl20 concentration. The data points show mean values ± SD (the error bars lie within the symbols) of duplicate ELISA determinations. Each curve represents data derived from a single donor, the same symbol representing the same donor in each panel. Left: Three different donors, JR-FL gpl20. Middle: Four different donors, LAI gρl20. Right: Three different donors, KNHl 144 gpl20 (the square symbol is overlaid by the circle symbol).(D) iMDDCs from five donors were treated with JR-FL gpl20 (3 μg/ml), LAI gpl2O (10 μg/ml), KNHl 144 gpl20 (10 μg/ml), or TNIL + LPS before measurement of IL-10 production at 24 h. (For additional explanation, see doi:10.1371/journal.ppat.0030169.g001, which contents are hereby incorporated by reference into this application.)

Figure 18:

The Induction of IL-10 Secretion by gpl20 Is Mannose-Dependent (A) The bars represent IL-10 production from MDDCs on day 6 after 24 h (black bars) of treatment with JR-FL gpi 20 (3 μg/ml). The reagents listed on the horizontal axis were incubated with gpl20 or iMDDCs for 1 h prior to addition of gpl20 to the cells (see Materials and Methods for the inhibitorconcentrations tested). The bars represent the mean value ± SEM for data derived from five different, gpl20-responsive donors. The upper and lower panels show data derived from different experiments. The various reagents were also tested in the absence of gpl20 and found not to stimulate IL-10 production (<25 pg/ml), with the exception of mannan (see lower panel). (B) The reactivities of mAbs bl2 and 2Gl 2, the CD4-lgG2 protein, or DC-SIGN-Fc with mock- treated JR-FL M-gpl20 (squares) and α-( 1-2,3,6) mannosidase-treated JR-FL D-gpi 20 (circles) were compared using ELISAs. In the fifth panel, the binding of DC-SIGN-Fc to JR-FL gpi 20 was inhibited by the Ca2+-chelator EGTA and the anti-DC-SIGN mAb, AZN-Dl (M-gpl20 black bar; D-gpl20 white bar).

(C).Left panel: A reducing SDS-PAGE gel shows the reduction in JR-FL gpl20 m.wt. caused by treatment with α-(l-2,3,6) mannosidase. Right panel: western blotting with anti-gpl20 serum ARP3119 confirms the m.wt reduction, and blotting with mAb 2Gl 2 shows that its mannose- dependent epitope has been removed from gp!20. (M = m.wt markers; enzyme only = no gpl20 present).

(D) The experimental design was the same as in (A). The gpi 20 proteins (or influenza HA or TNIL + LPS + CD40L) tested are listed on the x-axis. The bars represent the mean values ± SEM for data derived from five different donors (black bars, EL-IO production after 24 h; white bars, after 48 h). For additional explanation see doi:10.1371/journal.ppat.0030169.g002, which contents are hereby incorporated by reference into this application.

Figure 19: Involvement of the ERKl/2 and p38 MAP Kinase Signaling Pathways in the Induction of IL-10 and IL-12p70 by gpl20 and TNIL + LPS

(A) Day-6 MDDCs were incubated with or without JR-FL M-gpl20 or D-gpl20 (3 μg/ml), or with TNIL + LPS, for 10 min before pERKl/2 (upper panel) and p-p38 levels (lower panel) were measured by ELISA (black bars). The white bars show the effects of adding the pERKl/2 inhibitor UO126 (5 μM) or the p38 inhibitor SB 203580 (10 μM) 1 h before the gpl20s or TNIL + LPS. The bars represent the mean values ± SEM for data derived from four different donors.

(B) The experimental design was based on that used for (A), except that the iMDDCs were incubated with or without UO126 or SB 203580 for 1 h prior to the addition of M-gpl20 or TNIL + LPS + CD40L and continued incubation for 24 h. IL-IO (upper panel) or IL-12p70 (lower panel) production was measured by ELISA after 24 h. The bars represent the mean values ± SEM for data derived from five different donors, which were not the same as the ones used in (A). For additional explanation see doi:10.1371/journal.ppat.0030169.g003, which contents are hereby incorporated by reference into this application.

Figure 20:

Gp 120 Impairs iMDDC Maturation via Interaction with an MCLR(s)

The maturation status of MDDCs was evaluated after treatment for 48 h (days 6-8) with TNTL + LPS + CD40L ± 3 μg/ml of JR-FL M-gpl20 or D-gpl20. The cell surface expression of CD80, CD83, CD86, DC-SIGN, and MR on CDl lc+ cells was measured by flow cytometry as described in doi:10.1371/journal.ppat.0030169.g001, which contents are hereby incorporated by reference into this application.

(A) The histograms show expression of the surface markers on MDDCs from one donor whose expression marker response to gpl20 was of average magnitude. The grey shaded profiles depict the use of isotype control mAbs, the other profiles were derived using the various specific test mAbs. The black curves represent control MDDCs; red curves, MDDCs treated with TNIL + LPS+ CD40L; blue curves, TNIL + LPS+ CD40L +D-gpi20; green curves, TNTL + LPS + CD40L + M-gpl20.

(B) The average fold-changes (for 14 or 15 donors) in MFI values for MDDC cell-surface marker expression are depicted. The background MFIs obtained with the respective isotype controls were subtracted from MFIs for all conditions. Then the ratios of MFI for presence of gpl20 over the MFI for absence of gpl20 were calculated. For each marker, the MFI value derived from MDDC matured with TNIL + LPS+ CD40L alone is thus defined as 1.0 (log ratio = 0). The means of the 10-logarithms of the ratios for all donors were calculated. The mean log MFI ratio ± SD for cells also treated with either M-gpl20 (black bars) or D-gpl20 (white bars) are plotted relative to this baseline value corresponding to TNIL + LPS + CD40L alone. For additional explanation see doi: 10.1371/journal.ppat.0030169.g004, which contents are hereby incorporated by reference into this application.

Figure 21:

Treatment with gpl20 Inhibits MDDC-lnduced T Cell Proliferation

(A) Day-6 MDDCs were incubated for 48 h with or without TNIL + LPS and/or JR-FL M-gpl20, D-gpl20, or influenza HA as specified on the x-axis. The MDDCs were then co-cultured for 5 d with CFSE-labeled CD4+T cells before determination of the extent of the allogeneic mixed T lymphocyte reaction on day 13. Relative CD4+ T cell proliferation was calculated by first subtracting the background value for CFSE-negative cells obtained using unstimulated iMDDCs (9.95% ± 0.70%, n = 15) from the value obtained when the MDDCs were stimulated with TNIL + LPS (46.4% ± 1.54%, n = 15). The net value was defined as 100% and used for normalization. The bars represent the mean values ± SD for data derived from 15 donors (except for influenza HA; ten donors) tested in 15 independent experiments. The superantigen SEB served as a positive control for CD4+ T cell stimulation in the absence of any MDDCs; CFSE dilution in response to SEB was 130% ± 2.9% (n = 15) of that seen with TNIL + LPS.

(B) The extent of T cell proliferation in co-cultures (as in A) containing iMDDCs exposed to M- gpl20 + TNIL + LPS + CD40L is plotted as a function of the IL-10 response of the iMDDCs to M-gpl20 after 24 h. There was no correlation for iMDDCs from 15 donors (r = 0.0008).

(C) In a subset of the experiments shown in (A), extracellular cytokine levels were measured at the end of the MDDC-T cell co-culture (i.e., on day 13). The bars represent the mean values ± SEM from five different donors. Upper panel, IL-10; lower panel, IL-12p70. For additional explanation see doi:10.1371/journal.ppat.0030169.g005, which contents are hereby incorporated by reference into this application.

Figure 22:

ELISA results showing that demannosylated gpl20 (D-gpl20) as immunogen, or non- demannosylated gpl20 plus an anti-IL-10 receptor antibody as immunogen, both both yielded a higher immune response compared with controls (non-demannosylated gpl20 or non- demannosylated gpl20 plus an isotype-matched antibody, respectively)

Figure 23: ELISA results showing D-gpl20 as an immunogen yielded a sustained higher titer immune response in vivo compared with non-demannosylated gpl20 ("M-gpl20")-

Figure 24:

ELISA results showing a more balanced THl vs. TH2 T-cell subtype response in animals immunized with D-gp 120 versus mice immunized with M-gp 120 control.

Figure 25:

Dosage and timeline of mouse immunization schedule.

Figures 26A and B: A high quality KNHl 144 SOSIP .R6 trimer product was purified. A. Only a single band was observed in the BN-PAGE analysis. B. SDS-PAGE analysis demonstrated that there was no uncleaved gpl40 in the product.

Figure 27: A high purity trimer product was obtained compared with other purification methods.

Figure 28:

Antigenic analysis of de-mannosylated gpl20 as determined by ELISA

Figure 29: gp 120-binding total IgG antibodies in mouse sera as determined by ELISA

Figure 30: gpl 20-binding IgGl antibodies in mouse sera (Th2) as determined by ELISA

Figure 31: gpl 20-binding IgG2a antibodies in mouse sera (ThI ) as determined by ELISA

Figure 32: De-mannosylation increases immunization-induced gpl 20-specific IFNγ production. DETAILED DESCRIPTION OF THE INVENTION

As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below The following standard abbreviations are used throughout the specification to indicate specific amino acids: A=ala=alanine; R=arg=arginine; N=asn=asparagine, D=asp=aspartic acid; C=cys=cysteine; Q=gln=glutamine; E=glu=glutamic acid; G=gly=glycine; H=his=histidine,

L=leu=leucine; K=lys=lysine; M=met=methionine, F=phe=phenylalamne; P=pro=prohne; S=ser=seπne, T=thr=threonine, W=trp=tryptophan, Y=tyr=tyrosine, V=val=valine; B=asx=asparagine or aspartic acid; Z=glx=glutamine or glutamic acid

"HIV" refers to the human immunodeficiency virus. HFV includes, without limitation, HIV-I. HIV may be either of the two known types of HIV, i e., HIV-I or HFV-2. The HIV-I virus may represent any of the known subtypes or clades of the virus (e g , Classes A, B, C, D, E, F, G, H and J) or outlying subtype (Group O).

HIV-Ij_{R FL} is a strain that was originally isolated from the brain tissue of an AIDS patient taken at autopsy and co-cultured with lectin-activated normal human PBMCs (ODBπen, 1990). HTV-_{UR FL} is known to utilize CCR5 as a fusion coreceptor and has the ability to replicate in phytohemagglutinin (PHA)-stimulated PBMCs and blood-derived macrophages but does not replicate efficiently in most immortalized T cell lines. HIV-I _DHi₂₃ is a clone of a virus originally isolated from the peπpheral mononuclear cells (PBMCs) of a pateint with AIDS (Shibata, 1995) HIV-I_{0H 123} is known to utilize both CCR5 and CXCR4 as fusion coreceptors and has the ability to replicate in PHA-stimulated PBMCs, blood-deπved macrophages and immortalized T cell lines HFV-lcu_n i is a cloned virus originally isolated from the peπpheral blood mononuclear cells of a hemophilia B patient with AIDS (Takeuchi, 1987) HTV-l_Gun i is known to utilize both CCR5 and CXCR4 as fusion coreceptors and has the ability to replicate in PHA-stimulated PBMCs, blood- deπved macrophages and immortalized T cell lines. HIV-I g₉₆ is a cloned virus oπginally isolated from a patient with AIDS (Collman, 1992). HIV-I₈₉₆ is known to utilize both CCR5 and CXCR4 as fusion coreceptors and has the ability to replicate in PHA-stimulated PBMCs, blood-deπved macrophages and immortalized T cell lines. HIV-I _HXB2 IS a TCLA virus that is known to utilize CXCR4 as a fusion coreceptor and has the ability to replicate in PHA-stimulated PBMCs and immortalized T cell lines but not blood denved macrophages

"gpl40 envelope" refers to a protein having two disulfide-hnked polypeptide chains, the first chain compπsing the amino acid sequence of the HIV gpl20 glycoprotein and the second chain compπsing the amino acid sequence of the water-soluble portion of HFV gp41 glycoprotein ("gp41 portion") HIV gpl40 protein includes, without limitation, proteins wherein the gp41 portion comprises a point mutation such as I571P. gpl40 envelope comprising such mutation is encompassed by the terms "HIV SOS gpl40", as well as "HIV gpl40 monomer" or "SOSIP gpl40".

"gpl20" is a glycoprotein expressed on the surface of HIV-I envelope. gpl20 and gp41 together comprise gpl40. As used herein, gpl20 includes, without limitation, naturally occurring gpl20 or modified gpl20, either of which may or may nott be demannosilated, and portions thereof.

As used herein, a "demannosylated gpl20" is a gp 120 which has been treated with a mannosidase to remove at least one saccharide monomer of the mannose present on the gpl20. Mannosidases are a group of enzymes which catalyses the hydrolysis of mannose residues in mannosides.

"gp41" includes, without limitation, (a) the entire gp41 polypeptide including the transmembrane and cytoplasmic domains; (b) gp41 ectodomain (gp41_ECτ_O); (c) gp41 modified by deletion or insertion of one or more glycosylation sites; (d) gp41 modified so as to eliminate or mask the well- known immunodominant epitope; (e) a gp41 fusion protein; and (f) gp41 labeled with an affinity ligand or other detectable marker. As used herein, "ectodomain" means the extracellular region of a transmembrane protein exclusive of the transmembrane spanning and cytoplasmic regions.

An "A492C mutation" refers to a point mutation of amino acid 492 in the HIV-lj_RFL isolate gpl20 from alanine to cysteine. Because of sequence and sequence numbering variability among different HIV strains and isolates, it will be appreciated that this amino acid may not be at position 492 in all other HIV isolates. For example, in HIV-I KNHl 144 isolate, the corresponding amino acid is A511; in HIV-I _HXB2 the corresponding amino acid is A501 (Genbank Accession No. AAB50262); and in HIV-I _NL4.₃ it is A499 (Genbank Accession No. AAA44992). The amino acid may also be an amino acid other than alanine or cysteine which has similar polarity or charge characteristics, for example. This invention encompasses the replacement of such amino acids by cysteine, as may be readily identified in other HFV isolates by those skilled in the art.

A "T596C mutation" refers to a point mutation of amino acid in HΓV-1_JRFL isolate gp41 ectodomain from threonine to cysteine. Because of sequence and sequence numbering variability among different HIV strains and isolates, one having skill in the art will appreciate that this amino acid will not be at position 617 in all other HFV isolates. For example, in HIV-I KNHl 144 isolate, the corresponding amino acid is T617; in HIV-I _HXB2 the corresponding amino acid is T605 (Genbank Accession No. AAB50262); and in HIV-1_NL4.₃ the corresponding amino acid is T603 (Genbank Accesion No. AAA44992). The amino acid may also be an amino acid other than threonine or cysteine which has similar polarity or charge characteristics, for example. This invention encompasses cysteine mutations in such amino acids, which can be readily identified in other HIV isolates by those skilled in the art. This invention encompasses the replacement of such amino acids by cysteine, as may be readily identified in other HFV isolates by those skilled in the art.

"I559P" refers to a point mutation wherein the isoleucine residue at position 559 of a polypeptide chain is replaced by a proline residue.

"Immunizing" means generating an immune response to an antigen in a subject. This can be accomplished, for example, by administering a primary dose of an antigen, e.g., a vaccine, to a subject, followed after a suitable period of time by one or more subsequent administrations of the antigen or vaccine, so as to generate in the subject an immune response against the antigen or vaccine. A suitable period of time between administrations of the antigen or vaccine may readily be determined by one skilled in the art, and is usually on the order of several weeks to months. Adjuvant may or may not be co-administered.

In accordance with the invention, numerous vector systems for expression of recombinant proteins may be employed. For example, one class of vectors utilizes DNA elements which are derived from ammal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MoMLV), Semliki Forest virus or SV40 virus. Additionally, cells which have stably integrated the DNA into their chromosomes may be selected by introducing one or more markers which allow for the selection of transfected host cells. The marker may provide, for example, prototropy to an auxotrophic host, biocide (e.g., antibiotic) resistance, or resistance to heavy metals such as copper or the like. The selectable marker gene can be either directly linked to the DNA sequences to be expressed, or introduced into the same cell by cotransformation. Additional elements may also be needed for optimal synthesis of mRNA. These elements may include splice signals, as well as transcriptional promoters, enhancers, and termination signals. The cDNA expression vectors incorporating such elements include those described by (Okayama and Berg, 1983).

"Pharmaceutically acceptable carriers, excipients and diluents" are well known to those skilled in the art and include, but are not limited to, 0.01-0 IM and preferably 0.05M phosphate buffer, phosphate-buffered saline (PBS), or 0.9% saline. Additionally, such pharmaceutically acceptable earners may include, but are not limited to, aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers, diluents and excipients include water, alcoholic/aqueous solutions, emulsions or suspensions, saline and buffered media. Parenteral vehicles include sodium chloπde solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils. Intravenous vehicles include fluid and nutπent replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Solid compositions may compπse nontoxic solid earners such as, for example, glucose, sucrose, mannitol, sorbitol, lactose, starch, magnesium stearate, cellulose or cellulose derivatives, sodium carbonate and magnesium carbonate. For administration in an aerosol, such as for pulmonary and/or intranasal delivery, an agent or composition is preferably formulated with a nontoxic surfactant, for example, esters or partial esters of C6 to C22 fatty acids 5 or natural glycerides, and a propellant. Additional carriers such as lecithin may be included to facilitate intranasal delivery. Preservatives and other additives, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases, and the like may also be included with all the above carriers.

10 Adjuvants are formulations and/or additives that are routinely combined with antigens to boost immune responses. Suitable adjuvants for nucleic acid based vaccines include, but are not limited to, saponins, Quil A, imiquimod, resiquimod, interleukin-12 delivered in purified protein or nucleic acid form, short bacterial immunostimulatory nucleotide sequences such as CpG- containing motifs, interleukin-2/Ig fusion proteins delivered in purified protein or nucleic acid

15. form, oil in water micro-emulsions such as MF59, polymeric microparticles, cationic liposomes, monophosphoryl lipid A, immunomodulators such as Ubenimex, and genetically detoxified toxins such as E. coli heat labile toxin and cholera toxin from Vibrio. Such adjuvants and methods of combining adjuvants with antigens are well known to those skilled in the art. 0 Adjuvants suitable for use with protein immunization include, but are not limited to, alum; Freund's incomplete adjuvant (FIA); saponin; Quil A; QS-21; Ribi Detox; monophosphoryl lipid A (MPL) adjuvants such as Enhanzyn™; nonionic block copolymers such as L-121 (Pluronic; Syntex SAF); TiterMax Classic adjuvant (block copolymer, CRL89-41, squalene and microparticulate stabilizer; Sigma-Aldrich); TiterMax Gold Adjuvant (new block copolymer, 5 CRL-8300, squalene and a sorbitan monooleate; Sigma-Aldrich); Ribi adjuvant system using one or more of the following: monophosphoryl lipid A, synthetic trehalose, dicorynomycolate, mycobacterial cell wall skeleton incorporated into squalene and polysorbate-80; Corixa); RC-552 (a small molecule synthetic adjuvant; Corixa); Montanide adjuvants (including Montanide MSl 1 IX, Montanide IMS131x, Montanide IMS221x, Montanide HMS301x, Montanide ISA 26A, 0 Montanide ISA206,Montanide ISA 207, Montanide ISA25, Montanide ISA27, Montanide ISA28, Montanide ISA35, Montanide ISA50V, Montanide ISA563, Montanide ISA70, Montanide ISA 708, Montanide ISA740, Montanide ISA763A, and Montanide ISA773; Seppic Inc., Fairfield, NJ); and N-Acetylmuramyl-L-alanyl-D-isoglutamine hydrate (Sigma-Aldrich). Methods of combining adjuvants with antigens are well known to those skilled in the art. 5

Because current vaccines depend on generating antibody responses to injected antigens, commercially available adjuvants have been developed largely to enhance these antibody responses. To date, the only FDA-approved adjuvant for use with human vaccines is alum. However, although alum helps boost antibody responses to vaccine antigens, it does not enhance T cell immune responses. Thus, adjuvants that are able to boost T cell immune responses after a vaccine is administered are also contemplated for use.

It is also known to those skilled in the art that cytotoxic T lymphocyte and other cellular immune responses are elicited when protein-based immunogens are formulated and administered with appropriate adjuvants, such as ISCOMs and micron-sized polymeric or metal oxide particles.

Certain microbial products also act as adjuvants by activating macrophages, lymphocytes and other cells within the immune system, and thereby stimulating a cascade of cytokines that regulate immune responses. One such adjuvant is monophosphoryl lipid A (MPL) which is a derivative of the gram-negative bacterial lipid A molecule, one of the most potent immunostimulants known.

The Enhanzyn™ adjuvant (Corixa Corporation, Hamilton, MT) consists of MPL, mycobacterial cell wall skeleton and squalene.

Adjuvants may be in particulate form. The antigen may be incorporated into biodegradable particles composed of poly-lactide-co-glycolide (PLG) or similar polymeric material. Such biodegradable particles are known to provide sustained release of the immunogen and thereby stimulate long-lasting immune responses to the immunogen. Other particulate adjuvants include, but are not limited to, micellular particles comprising Quillaia saponins, cholesterol and phospholipids known as immunostimulating complexes (ISCOMs; CSL Limited, Victoria AU), and superparamagnetic particles. Superparamagnetic microbeads include, but are not limited to, μMACS™ Protein G and μMACS™ Protein A microbeads (Miltenyi Biotec), Dynabeads® Protein G and Dynabeads® Protein A (Dynal Biotech). In addition to their adjuvant effect, superparamagnetic particles such as μMACS™ Protein G and Dynabeads® Protein G have the important advantage of enabling immunopurification of proteins.

A "prophylactically effective amount" is any amount of an agent which, when administered to a subject prone to suffer from a disease or disorder, inhibits or prevents the onset of the disorder. The prophylactically effective amount will vary with the subject being treated, the condition to be treated, the agent delivered and the route of delivery. A person of ordinary skill in the art can perform routine titration experiments to determine such an amount. Depending upon the agent delivered, the prophylactically effective amount of agent can be delivered continuously, such as by continuous pump, or at periodic intervals (for example, on one or more separate occasions). Desired time intervals of multiple amounts of a particular agent can be determined without undue experimentation by one skilled in the art.

"Inhibiting" the onset of a disorder means either lessening the likelihood of the disorder's onset, preventing the onset of the disorder entirely, or in some cases, reducing the severity of the disease or disorder after onset. In the preferred embodiment, inhibiting the onset of a disorder means preventing its onset entirely. "Reducing the likelihood of a subject's becoming infected with HIV-I" means reducing the likelihood of the subject's becoming infected with HIV-I by at least two-fold. For example, if a subject has a 1% chance of becoming infected with HIV-I, a two-fold reduction in the likelihood of the subject becoming infected with HIV-I would result in the subject having a 0.5% chance of becoming infected with HIV-I. In the preferred embodiment of this invention, reducing the likelihood of the subject's becoming infected with HIV-I means reducing the likelihood of the subject's becoming infected with the virus by at least ten-fold.

"Subject" means any animal or artificially modified animal. Animals include, but are not limited to, humans, non-human primates, cows, horses, sheep, goats, pigs, dogs, cats, rabbits, ferrets, rodents such as mice, rats and guinea pigs, and birds and fowl, such as chickens and turkeys. Artificially modified animals include, but are not limited to, transgenic animals or SCID mice with human immune systems. In the preferred embodiment, the subject is a human.

"Exposed" to HIV-I means contact or association with HIV-I such that infection could result.

A "therapeutically effective amount" is any amount of an agent which, when administered to a subject afflicted with a disorder against which the agent is effective, causes the subject to be treated. "Treating" a subject afflicted with a disorder shall mean causing the subject to experience a reduction, diminution, remission, suppression, or regression of the disorder and/or its symptoms. In one embodiment, recurrence of the disorder and/or its symptoms is prevented. Most preferably, the subject is cured of the disorder and/or its symptoms.

"HIV-I infected" means the introduction of viral components, virus particles, or viral genetic information into a cell, such as by fusion of cell membrane with HIV-I . The cell may be a cell of a subject, hi the preferred embodiment, the cell is a cell in a human subject. This invention provides a composition comprising a demannosylated HIV-I gpl20 envelope glycoprotein and a pharmaceutically acceptable carrier, excipient or diluent. In one embodiment, the demannosylated glycoprotein is obtainable by treating a naturally occurring HIV-I gpl20 envelope glycoprotein with a mannosidase. hi one embodiment, the mannosidase is α-( 1-2,3)- mannosidase, α-(l-2,3,6)-mannosidase, α-(l-6)-mannosidase, or a combination thereof. In another embodiment, the mannosidase is α-(l-2,3,6)-mannosidase. hi one embodiment, the glycoprotein is present in the composition in an amount effective to stimulate an immune response. In another embodiment, the composition further comprises an adjuvant.

This invention also provides a composition comprising (a) a trimeric complex, each monomelic unit of the complex comprising a modified form of gpl20 of an HIV-I envelope polypeptide and a modified form of an ectodomain of gp41 of the HIV-I envelope polypeptide, wherein the modified gpl20 polypeptide is demannosylated and the modified gpl20 and the modified gp41 ectodomain are bound to each other by at least one intermolecular disulfide bond between a cysteine (C) residue introduced into the modified gpl20 and a cysteine (C) residue introduced into the modified gp41 ectodomain, which stabilizes the otherwise noncovalent gpl20-gp41 ectodomain interaction, and (b) a pharmaceutically acceptable carrier, excipient or diluent.

In one embodiment, the cysteine (C) residue introduced in the modified gpl20 replaces a non- cysteine amino acid in unmodified gpl20 at one or more amino acid positions selected from the group consisting of 35, 39, 44, 482, 484, 486, 488, 489, 490 and 492, said amino acid positions being numbered by reference to the HIV-I isolate HIV-I _JR._FL.

In another embodiment, the cysteine (C) residue introduced in the modified gp41 ectodomain replaces a non-cysteine amino acid in the unmodified gp41 ectodomain at one or more amino acid positions selected from the group consisting of 580, 587, 596, 599 and 600, said amino acid positions being numbered by reference to the HIV-I isolate HIV-I _JR._FL- In another embodiment, the disulfide bond is formed between (i) a cysteine (C) residue introduced in the modified gpl20 at position 492 to replace an alanine (A) residue in unmodified gpl20, and (ii) a cysteine residue introduced in the modified gp41 ectodomain at position 596 to replace a threonine (T) residue in the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _{JR FL}. hi another embodiment, the modified gp41 ectodomain further comprises a proline (P) residue which replaces a non-proline residue at one or more amino acid positions selected from the group consisting of 556, 557, 558, 559, 560, 561, 562, 563, 564, 565 and 566 in the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _H*B2- In yet another embodiment, the modified gp41 ectodomain comprises a proline (P) residue at amino acid position 559, numbered by reference to the HIV-I isolate HIV-I _HXB2- hi one embodiment, the trimeric complex is present in the composition in an amount effective to stimulate an immune response. In another embodiment, the composition further comprises an adjuvant. hi one embodiment, the composition further comprises a non-ionic detergent, hi one embodiment, the non-ionic detergent is a polyethylene type detergent. In another embodiment, the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate or poly(oxyethylene) sorbitan monooleate. In another embodiment, the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate. In yet another embodiment, the non-ionic detergent is present in an amount from 0.01% to 1% by volume of the total volume of the composition.

This invention also comprises a composition which comprises a complex of a modified form of gpl20 of an HIV-I envelope polypeptide and a modified form of an ectodomain of gp41 of the HIV-I envelope polypeptide, wherein the modified gpl20 polypeptide is demannosylated and comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 492 in an unmodified gpl20 polypeptide, and the modified gp41 ectodomain comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 596 in an unmodified gp41 ectodomain; the amino acid positions being numbered by reference to the HIV-I isolate HIV- 1_JR_ _FL; and wherein the modified gpl20 and the modified gp41 ectodomain are joined together by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain.

In one embodiment, the modified gp41 ectodomain further comprises a proline (P) residue which replaces a non-proline residue at one or more amino acid positions selected from the group consisting of 556, 557, 558, 559, 560, 561, 562, 563, 564, 565 and 566 in the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _HXB2- In another embodiment, the modified gp41 ectodomain further comprises a proline (P) residue at amino acid position 559, numbered by reference to the HIV-I isolate HIV-I _HxB2- This invention further provides a composition comprising a trimer which comprises a noncovalently bound oligomer of three identical compositions of the invention, and a pharmaceutically acceptable carrier. -In one embodiment, the trimeric complex is present in the composition in an amount effective to stimulate an immune response. In another embodiment, the composition further comprises an adjuvant. hi one embodiment, the composition further comprises a non-ionic detergent. In one embodiment, the non-ionic detergent is a polyethylene type detergent. In another embodiment, the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate or poly(oxyethylene) sorbitan monooleate. In another embodiment, the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate. In yet another embodiment, the non-ionic detergent is present in an amount from 0.01% to 1% by volume of the total volume of the composition. This invention further provides a composition which comprises a modified gpl40 envelope polypeptide of an HIV-I isolate, wherein a first portion of the gpl40 polypeptide corresponds to a modified gpl20 polypeptide and a second portion of the gpl40 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gpl20 polypeptide is demannosylated and comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 492 in unmodified gpl20 protein and wherein the modified gp41 ectodomain comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 596 in unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HrV-l_JR._FL; and further wherein the modified gp41 ectodomain comprises a proline (P) residue which replaces a non-proline residue at amino acid position 559 in the unmodified gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HIV-I _HXB2> wherein the modified gpl20 and the modified gp41 ectodomain are joined together by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain. In one embodiment, the modified gpl20 polypeptide further comprises a mutated furin recognition sequence. This invention further provides a composition comprising a trimer which comprises a noncovalently bound oligomer of three identical modified gpl40 polypeptides of the invention. In one embodiment, the trimeric complex is present in the composition in an amount effective to stimulate an immune response. In one embodiment, the composition further comprises an adjuvant.

In one embodiment, the composition further comprises a non-ionic detergent. In one embodiment, the non-ionic detergent is a polyethylene type detergent. In another embodiment, the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate or poly(oxyethylene) sorbitan monooleate. In another embodiment, the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate. In yet another embodiment, the non-ionic detergent is present in an amount from 0.01% to 1% by volume of the total volume of the composition.

In one embodiment, the demannosylated gpl20 is produced by a process which comprises treatment with an mannosidase. In one embodiment, the mannosidase is α-(l-2,3)-mannosidase, α-(l -2,3,6)-mannosidase, α-(l-6)-mannosidase, or a combination thereof. In another embodiment, the mannosidase is α-(l-2,3,6)-mannosidase.

In one embodiment, the HIV-I gpl20 glycoprotein is identical to a gp 120 glycoprotein present in an isolate having a HIV-I subtype selected from the group consisting of clades A, B, C, D, E, F, G, H, J and O. In another embodiment, the HIV-I isolate is a clade B subtype. This invention further provides a protein comprising a first polypeptide which comprises consecutive amino acids encoding a modified gpl20 of an HIV-I isolate, which modified gpl20 is demannosylated and comprises a first cysteine (C) residue introduced by a mutation, and a second polypeptide which comprises consecutive amino acids encoding a modified gp41 ectodomain of the HIV-I isolate, which modified gp41 ectodomain comprises a second cysteine (C) residue introduced by a mutation, wherein (i) the modified gp41 polypeptide further comprises at least one amino acid in its N-terminal helix that replaces an amino acid in unmodified gp41 at one or more positions selected from the group consisting of 583, 580, 576, 573, 569, 566, 562, 590, 587, 555, 552, 548, 545 and 559, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _HXB2, and (ii) the first and second polypeptides are bound to one another by a disulfide bond between the first cysteine (C) and the second cysteine (C). In one embodiment, the protein is an immunogen.

In one embodiment, the HIV-I isolate comprises a HIV-I subtype selected from the group consisting of clades A, B, C, D, E, F, G, H, J and O. In another embodiment, the HIV-I isolate is a subtype B clade. In another embodiment, the HIV-I isolate is a subtype A clade. In another embodiment, the HIV-I isolate is a subtype B clade selected from the group consisting of HTV-I _JR_ _FL, HIV-1_DH123( HΓV-1_CUN.,, HrV-l_{89 6}and HIV-1 HXB2.

In one embodiment, the cysteine (C) introduced by the mutation in the first polypeptide replaces one or more amino acids in non-mutated gpl20, the one or more amino acids selected from the group consisting of: valine (V) at position 35; tyrosine (Y) at position 39; tryptophan (W) at position 44; isoleucine (I) at position 482; proline (P) at position 484; glycine (G) at position 486; alanine (A) at position 488; proline (P) at position 489; threonine (T) at position 490; and alanine (A) at position 492; the amino acid positions being numbered by reference to the HIV-I isolate HIV-1_JR._FL.

In another embodiment, the cysteine (C) introduced by the mutation in the second polypeptide replaces one or more amino acids in non-mutated gp41 , the one or more amino acids selected from the group consisting of: aspartic acid (D) at position 580; tryptophan (W) at position 587; threonine (T) at position 596; valine (V) at position 599; and proline (P) at position 600; the amino acid positions being numbered by reference to the HIV-I isolate HIV-lj_R._FL.

In one embodiment, in the N-terminal helix, the modified gp41 polypeptide comprises one or more amino acid replacements selected from: (a) a phenylalanine (F), asparagine (N), proline (P), or glycine (G) amino acid replacing leucine (L) at position 545 in non-mutated gp41 ; (b) a valine (V), leucine (L), histidine (H), serine (S), glycine (G), or arginine (R) amino acid replacing isoleucine (I) at position 548 in non-mutated gp41; (c) a valine (V), phenylalanine (F), asparagine (N), proline (P), glycine (G), or arginine (R) amino acid replacing isoleucine (I) at position 559 in non-mutated gp-41; (d) a valine (V), asparagine (N), threonine (T), or lysine (K) amino acid replacing leucine (L) at position 566 in non-mutated gp-41; (e) a proline (P) or lysine (K) amino acid replacing threonine (T) at position 569 in non-mutated gp-41 ;(f) a leucine (L), phenylalanine (F), tyrosine (Y), glutamine (Q), or asparagine (N) amino acid replacing isoleucine (I) at position 573 in non-mutated gp-41; (g) a valine (V), phenylalanine (F), tyrosine (Y), glutamine (Q), asparagine (N), glycine (G), or lysine (K) amino acid replacing leucine (L) at position 576 in non-mutated gp-41; or (h) a threonine (T) or proline (P) amino acid replacing valine (V) at position 580 in non-mutated gp-41; the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _HXB2- hi one embodiment, in the N-terminal helix, the modified gp41 second polypeptide comprises a proline (P) residue at amino acid position 559. In one embodiment, the first polypeptide further comprises a mutated furin recognition sequence. This invention also provides a stable HIV-I pre-fusion envelope glycoprotein trimeric complex comprising as a monomelic unit the protein of the invention.

This invention also provides a composition comprising the trimeric complex of the invention and a pharmaceutically acceptable carrier.

In one embodiment, the trimeric complex or the composition further comprises a non-ionic detergent. In one embodiment, the non-ionic detergent is a polyethylene type detergent. In another embodiment, the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate or poly(oxyethylene) sorbitan monooleate. In another embodiment, the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate. In yet another embodiment, the non-ionic detergent is present in an amount from 0.01% to 1% by volume. In one embodiment, the demannosylated gpl20 is produced by a process which compπses treatment with a mannosidase. In one embodiment, the mannosidase is Ct-(I -2,3)-mannosidase, α- ( 1 -2,3,6)-mannosidase, α-(l-6)-mannosidase, or a combination thereof. In another embodiment, the mannosidase is α-(l-2,3,6)-mannosidase. This invention compnses a method of eliciting an immune response against HIV-I in a subject compπsing administering to the subject any of the compositions of the invention in an amount effective to elicit the immune response against HIV-I in the subject. In one embodiment, the composition is administered to the subject in a single dose or in multiple doses. This invention also provides a method of generating a high titer antibody response against HIV-I in a subject, compπsing administering to the subject any of the compositions of the invention in an amount effective to generate the high titer antibody response against HIV-I in the subject. This invention provides a method of preventing a subject from becoming infected with HIV-I, comprising administering to the subject any ofthe compositions of the invention in an amount effective to prevent the subject from becoming infected with HIV-I . This invention also provides a method for reducing the likelihood of a subject becoming infected with HIV-I, comprising administering to the subject any of the compositions ofthe invention in an amount effective to reduce the likelihood of the subject becoming infected with HIV-I. In one embodiment, the subject has been exposed to HIV-I This invention provides a method of preventing or reducing the likelihood of an immunosuppressive immune response in a subject infected by HIV-I, which comprises administering to the subject a pharmaceutically acceptable composition comprising demannosylated HIV-I gpl20 in an amount effective to prevent or reduce the immunosuppressive immune response in the subject. This invention also provides a method of increasing a T_H1 -based immune response in a subject following exposure to HIV-I , which comprises administering to the subject a pharmaceutically acceptable composition comprising demannosylated HIV-I gpl20 glycoprotein in an amount effective to increase the T_H1 -based immune response in the subject.

This invention further provides a method of preventing or reducing binding of gpl20 envelope glycoprotein to a Type-C mannose receptor (MCR) on a monocyte-denved dendritic cell (MDDC) in a subject infected by HIV-I and thereby circumventing production of immunosuppressive levels of interleukin-10 (IL-10) by the MDDC, which method comprises administering to the subject a pharmaceutically acceptable composition comprising demannosylated HIV-I gpl20 glycoprotein in an amount effective to prevent or reduce the binding of the demannosylated gpl20 to the MCR of the MDDC, thereby circumventing the production of immunosuppressive IL-10 levels by the MDDC in the subject.

This invention also provides a method of preventing or reducing the likelihood of an induction of immunosuppressive interleukin-10 cytokine production by monocyte-denved dendritic cells (MDDC) in a subject exposed to HIV-I, which compπses administering to the subject a pharmaceutically acceptable composition comprising demannosylated gpl20 glycoprotein in an amount effective to prevent or reduce the induction of immunosuppressive interleukin-10 cytokine production by the MDDC in the subject.

In one embodiment, the demannosylated gpl20 glycoprotein is produced by a process which comprises treatment with a mannosidase. In one embodiment, the mannosidase is α-( 1-2,3)- mannosidase, α-(l-2,3,6)-mannosidase, α-(l-6)-mannosidase, or a combination thereof. In another embodiment, the mannosidase is α-(l-2,3,6)-mannosidase.

In one embodiment, the pharmaceutically acceptable composition further comprises a carrier. In another embodiment, the demannosylated HIV-I gpl20 comprises a modified gpl20 which forms a trimeric complex with a modified HIV-I gp41 ectodomain, wherein each monomelic unit of the complex comprises the modified gpl20 and the modified gp41 ectodomain bound to each other by at least one intermolecular disulfide bond between a cysteine (C) residue introduced by mutation into the modified gpl20 and a cysteine (C) residue introduced by mutation into the modified gp41 ectodomain, which stabilizes the otherwise noncovalent gpl20-gp41 ectodomain interaction. In one embodiment, the disulfide bond is foπned between the cysteine (C) residue in the modified gpl20, which replaces a non-cysteine residue at amino acid position 492 in unmodified gpl20, and the cysteine (C) residue in the modified gp41 ectodomain, which replaces a non-cysteine residue at amino acid position 596 in the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _JR._FL. In another embodiment, the modified gp41 ectodomain comprises a proline (P) residue which replaces a non-proline residue at amino acid position 559 in the unmodified gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HIV-I _HXB2-

In one embodiment, the demannosylated gpl20 is modified to contain a cysteine (C) residue, which replaces a non-cysteine residue, at amino acid position 492 of unmodified gpl20 and forms a complex with a modified gp41 ectodomain which comprises a cysteine (C) residue, which replaces a non-cysteine residue, at amino acid position 596 of unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-lj_R._FL; and wherein the modified gpl20 and the modified gp41 ectodomain are joined together in the complex by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain.

In another embodiment, the modified gp41 further comprises a proline (P) residue which replaces a non-proline residue at amino acid position 559 in the unmodifiede gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HIV-I _HxB2. In one embodiment the demannosylated HIV-I gpl20 is modified to contain a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 492 of unmodified gpl20 and forms a complex with a modified gp41 ectodomain which comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 596 of the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _JR._FL; wherein the modified gp41 ectodomain further comprises a proline (P) residue which replaces a non-prohne residue at amino acid position 559 in the unmodified gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HIV-I _HXB2; and wherein the modified gpl20 and the modified gp41 ectodomain are joined together in the complex by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain.

This invention provides a vaccine which comprises a therapeutically effective amount of any of the compositions descπbed herein. This invention also provides a vaccine which compπses a prophylactically effective amount of any of the compositions descπbed herein. This invention is illustrated in the Expeπmental Details section which follows. This section is set forth to aid in an understanding of the invention but is not intended to, and should not be construed to limit in any way the invention as set forth in the claims which follow thereafter.

EXPERIMENTAL DETAILS I INTRODUCTION To investigate whether some of the restrictions on immune responses to gpl20 have an immunological basis, this study focuses on its interaction with human, monocyte-deπved dendπtic cells (MDDC) in vitro. It is shown herein that a consequence of gpl20 binding to these cells from -50% of donors is the induction of IL-10. Moreover, co-cultivation of the gρl20-treated MDDC with CD4⁺ T-cells impairs their proliferation, reduces IL- 12 expression and induces phenotypic markers consistent with the TH2 and T_reg subsets These responses are also a consequence of the mannose-dependent interaction of gpl20 with an MCLR, although they are not obligatorily linked to IL-10 expression. The various consequences of gpl20-MCLR interactions are prevented by enzymatic removal of gpl20 mannoses, a method that improves the immunogenicity of HIV-I Env proteins and other vaccine-relevant immunogens.

MATERIALS AND METHODS

Recombinant proteins, cytokines and antibodies

Recombinant, CHO-cell expressed monomelic gpl20s from HIV-I JR-FL and LAI were manufactured at Progenies Pharmaceuticals, Inc. (Tarrytown NY), as previously described in Beddows et al. (2006). The concentration of the JR-FL gpl20 stock used in the present experiments was Img/ml, with Endotoxin contamination < 3ELVmI. gpl20 was added to target cells at 3ug/ml (25nM), except when otherwise specified. Insect cell-expressed influenza HA protein (lOOug/ml) was purchased from Protein Sciences Corporation (Meπden, CT) and used at 3ug/ml.

Lipopolysaccharide (LPS) from Salmonella Typhimurium (lmg, Cat No L4641; Sigma, St Louis, MO) was used at 10 and lOOng/ml. CD40L (50ug, Cat No. BMS 308/2; Bristol-Myers Squibb, New York NY) with an Endotoxin level of < O.lng per ug (lEU/ug) was used at lng/ml; TNF-α, IL- 1 β and IFN-y (R&D Systems, Minneapolis, MN) at 5ng/ml, 5ng/ml and 5ug/ml, respectively. The AZN-Dl mAb to DC-SIGN (Beckman Coulter, Fullerton CA, Cat No A07406 ANZ-I), the MR (CD206) mAb Clone 15-2 (Cell Sciences, Canton MA; Cat No. HM 2056) and the DEC-205 mAb MG38 (eBioscience, San Diego CA; Cat No. 14-2059) were each used at 40ug/ml in blocking assays. Inhibition of gpl20-induced IL-10 production MDDC were pre-incubated for Ih at 37°C with the CCR5 inhibitor ADlOl (from Julie Strizki, Schering Plough Research Institute, Kenilworth NJ. [Strizki (2001)]) at lOuM, with the CXCR4 inhibitor AMD3100 (from Gary Bridger, AnorMed Inc., Langley, BC, Canada) at lOuM, or with mannan (Sigma, St. Louis, MO) at 30mg/ml. Alternatively, gpl20 was mixed with sCD4 (from William Olson, Progenies Pharmaceuticals, Inc., Tarrytown NY. [Allaway (1995)]), mAb bl2 (from Dennis Burton, The Scripps Research Institute, LaJoIIa CA. [Roben (1994)]), mAb 2Gl 2 (from Herman Katinger, University of Vienna, Austria [Trokla (1995)]), each at 25ug/ml, or with CV-N (from Robin Shattock (St. George's, London, [Botos (2002)]) at 5ug/ml.

Mannosidase treatment of recombinant gpl20

The mannose residues were removed from JR-FL gpl20 to make demannosylated gpl20 (D-gpl20) as follows. Aliquots of gpl20 (120ug) were incubated for 16-18h at 37°C with no enzyme (mock treatment; M-gpl20) or with α(l-2,3,6)-mannosidase (Jack bean, GKX -5010; 0.14 Units/ul, 25U/mg, 0.1ul/ug gpl20; from ProZyme Inc., San Leandro, CA) in a final volume of 1.2ml, in the presence of protease inhibitors (Roche, Indianapolis, IN). A control incubation of enzyme-only (no gρl20) was also performed. The samples were desalted into half-strength PBS (1/2PBS) using PD- 10 desalting columns (GE Healthcare, Piscataway, NJ) and concentrated to ImI using Vivaspin 30k MWCO 6ml spin concentrators (Vivascience, Edgewood, NY). After addition of 1 volume of 54 PBS, each sample was processed using the Endofree Red 5/1 Endotoxin removal kit (Profos AG, Regensberg, Germany). The final volumes of the D-gpl20 and M-gpl20 preparations after endotoxin removal were ~2ml, with endotoxin levels <8-20EU/mg and gpl20 concentrations 60ug/ml. SDS-PAGE and western blot analyses were performed using mAbs 2Gl 2 and CAl 3 (ARP3119).

ELISA for epl20-binding ligands gpl20 proteins were captured onto ELISA wells via sheep antibody D3724 to the gpl20 C- terminus, and mAb or CD4-IgG2 binding was assessed essentially as described previously [Moore (1994); Poignard (1996)]. For DC-SIGN binding to the captured gpl20, the standard procedure was adapted as follows. The plates were washed three times with TSM (2OmM Tris, 15OmM NaCl, ImM CaCl₂, 2mM MgCl₂), followed by incubation with TSM/1% BSA for 30 minutes. After three washes with TSM, DC-SIGN-Fc (from Tennis Geijtenbeek [Geijtenbeek (2000)]) in TSM was added for 2 h, with or without a prior incubation for 15 minutes with EGTA (1OmM) or mAb AZN- Dl (lOug/ml). The plates were washed 5 times with TSM/0.05% Tween, then bound DC-SIGN-Fc was detected with peroxidase-labeled goat anti-human Fc (1:3000) in TSM/0.05% Tween using standard conditions. Cell culture

Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats (New York Blood Center, NY) by Ficoll density gradient centrifugation. Monocytes were isolated to high purity (>99%) by magnetic cell sorting with anti-CD 14-coated beads according to the manufacturer's recommendations (Cat No. 130-050-201, Miltenyi Biotec, Auburn, CA). The percentage of CD14+ monocytes among the cells sorted from PBMC was determined by flow cytometry and always exceeded 98%. The CD 14^" fraction was frozen and used as the source of T cells for MDDC-T cell co-cultures. The monocytes were subsequently cultured for 6-8 days in complete culture medium (RPMI 1640, GIBCO/Invitrogen) containing ImM sodium pyruvate, 0.1 mM nonessential amino acids, 2mM L-glutamine, 25mM HEPES, 100U/ml penicillin, lOOug/ml Streptomycin (all obtained from GIBCO/Invitrogen, Carlsbad CA), and supplemented with 5% Human AB serum (Sigma, St. Louis MO) (R-5), lOOOU/ml GM-CSF (Leukine, Sargramostim, Berlex, NJ), and lOOOU/ml of recombinant human IL-4 (R&D Systems, Minneapolis MN) at 37°C in an atmosphere containing 5% CO₂. Every 2 days, 400ul of medium were gently removed from each well and replaced by 500ul of fresh medium containing the appropriate cytokines.

MDDC maturation

MDDC were either used without maturation or were differentiated for 24h or 48h with a mixture of inflammatory cytokines: 50ng/ml of TNF-α and lOng/ml of IL-l β (TNIL), and LPS (lOng/ml or 100ng/ml) ± CD40L (lug/ml).

Analysis of MDDC phenotvpe

Surface antigens were analyzed by flow cytometry on days 6 and 8 of culture, before and after treatment of the cells. The cells were first washed twice with PBS containing 0.5% human AB serum, then incubated for 20 min at 4°C with different combinations of mAbs. The following mAbs were from BD Pharmingen: FLTC-conjugated mAbs to CD3 (Clone HIT3a, Cat No. 555339) or HLA DR (Clone G46-6, Cat No. 555811); Per CP-conjugated mAb to CD4 (Clone SK3, Cat No. 347324); PE-conjugated mAbs to CD14 (Clone M5E2, Cat No. 555398), CD80 (Clone L307.4, Cat No. 340294), CD86 (Clone IT2.2, Cat No. 555665) or CD206 (Clone 19.2, Cat No. 555954); APC-conjugated mAb to CDl Ic (Clone S-HCI-3, Cat No. 340544). The following mAbs were from Bioscience: FITC-conjugated mAb to DEC-205 (Clone MG38, Cat No. 12-2-59); PE-conjugated mAb to B7RP-1 (ICOS-L) (Clone MIH 12, Cat No. 12-5889-73). The Clone 120507 mAb (Cat No. FAB 161P) to CD209 (DC-SIGN) was from R&D Systems. Each mAb was diluted so as to optimize the immune-fluorescence signal. After washing three times with cold PBS/human AB serum, fluorescence events were acquired with an LSR II analyzer (BD Pharmingen, LaJoIIa CA), and the data were analyzed using Flowjo (Tristar Inc., Ashland OR).

RT-PCR iMDDC were incubated with and without gpl20 (3ug/ml) for Ih, 3h, 5h, 1Oh, 24h and 48h at 37°C, and analyzed for the expression of IL-IO mRNA by RT-PCR. Total RNA was extracted from IxIO⁶ iMDDC, after various experimental treatments, by using the Absolutely RNA Miniprep Kit (Cat No. 400800, Stratagene, LaJolla CA) according to the manufacturer's manual. The isolated total RNA (2ul) was used for synthesis of cDNA using the Super Script III First-Strand Synthesis System for RT-PCR (Cat No. 18080-051, Invitrogen, Carlsbad CA). Human IL-10 and (3-actin transcripts were amplified using the following primers: IL-10 forward 5'- ATGCCCCAAGCTGAGAACCAAGACCCA-3' (SEQ ID NO:1) and reverse 5'- TCTC AAGGGGCTGGGTCAGCTATCCCA-S' (SEQ ID NO:2). The PCR product is 352bp, and was verified by sequencing. The β-actin primers used were: forward 5'- TCCTGTGGCATCCACGAAACT-3' (SEQ ID NO:3) and reverse 5'- GAAGCATTTGCGGTGGACGA T-3' (SEQ ID NO:4). Their amplification product of 315bp was also verified by sequencing. The annealing temperature for gradient PCR detection of IL-10 transcripts was optimized so as to avoid cross-reaction with IL-4, IL-6, IL-12p35 and IL-12p40.

Cytokine measurements

Cytokine concentrations in culture supernatants were measured by ELISA. Purified monocytes were cultured in RPMI 1640 supplemented with 5% human AB serum, lOOOU/ml GM-CSF and 1 OOOU/ml IL-4 for 6 days in order to produce iMDDC, then washed thoroughly. The cells were aliquoted at various densities from 5xlO⁵ to IxIO⁶ cells/ml into 24-well plates, and then stimulated under the conditions listed in below in the Results section. Cell-free culture supernatants were collected at different time points during culture. IL-4, IL-6, IL-10 and IL-12p70 were measured by ELISA using OptEIA kits from BD Pharmingen as per the manufacturer's protocol. The detection sensitivity for IL-4, IL-10 and IL- 12 was 4pg/ml; for IL-6, it was lOpg/ml.

For analysis of intracellular cytokines, iMDDC from the day 6 culture were washed thoroughly and then stimulated under the conditions listed below in the Results section for 12h or 18h. Brefeldin A (lOug/ml) was included to block protein transport from the endoplasmic reticulum to the Golgi apparatus. Immediately after the incubation period, the cells were aliquoted into 8 to 10 different vials (IxIO⁵ to 2xlO⁵ cells/lOOul) and stained with appropriate combinations of mAbs. The amounts of the various mAbs added to each tube, as appropriate, were: 5ul (1 :50 dilution) of anti-CD 11 c-allophycocyanin (APC; B-ly6, Cat No 559877); 5ul of matched isotype control mouse IgGl-APC (MOPC-21); 5ul of anti-CD83-PE (HB 15a, Cat No. IM2218, Beckman Coulter); 5ul of mouse IgG2b-PE (A-I; Cat No. 731602, Cell Lab), fter gentle mixing, the cells were incubated for 15 min at 4°C in the dark, and then washed twice in 2ml of Washing Buffer (PBS plus 5% human AB serum) by centrifugation at 1200 pm at 4°C. fter discarding the Washing Buffer, the cells were fixed and permeablilized using the Cytofix/Cytoperm solution and DC Perm/Wash solution (BD Pharmingen, LaJolla CA) as recommended by the manufacturer. Various mAbs were then added to detect intracytoplasmic cytokines, as follows: 2ug/ml of anti-IL-4-PE (Clone 8D4-8, Cat No 5554516, BD Pharmingen, LaJolla CA); 2ug/ml of anti-IL-10 (Clone JES3-9D7, Cat No. 554706, BD Pharmingen, LaJoIIa CA); 0.5ug/ml of anti-IL-12p70 (Clone Cl 1.5, Cat. No. 559329, BD Pharmingen, LaJoIIa CA); 5ug/ml of anti-IFN-y (Clone 45-15, Cat No. 130-091-653, Miltenyi Biotec, Auburn CA). Isotype-matched, PE-conjugated mAbs served as negative controls. The fluorescent events were acquired and analyzed as described herein.

T cell proliferation assay

Allogeneic CD4+ T cells were obtained by magnetic beads negative selection, washed twice with PBS; the cells were then incubated with 2.5uM Carboxy-fluorescein diacetate, succinimidyl ester (CFSE) (derived from a 5mM CFSE stock; Molecular Probes, Eugene, OR) for 15 min at room temperature, with gentle agitation every 2-3 min. The reaction was quenched by the addition of an equal volume of RPMI 1640 containing 10% human AB serum followed by incubation for 5 min. The cells were then washed with PBS three times and resuspended at 2x10⁶ cells/ml in complete culture medium before use in experiments. For the mixed T lymphocyte reaction assay, CFSE- labeled or unlabeled allogeneic CD4+T cells were co-cultured with differentially treated MDDC at a 1 : 10 ratio for 5 days. Proliferation of the CFSE-labeled naive T cells was analyzed by flow cytometry. Supernatants were collected from the co-cultures of MDDC with unlabeled allogeneic CD4+ T-cells on day 5, for measurement of cytokine levels by ELISA.

Purification of naive CD4⁺ T cells CD4⁺ T cells were obtained from the CD 14^" fraction by negative selection using a CD4 T-cell Isolation Kit II (Miltenyi Biotec, Auburn, CA). CD45RA⁺ cells were obtained from the purified CD4⁺ T cells by positive selection using CD4⁺CD45RA⁺ microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). The cell population contained >95% CD4⁺CD45RA⁺ cells and <0.5% CD25⁺ cells, as determined by flow cytometry.

DC priming of T cell polarization (T^) in vitro

CD4⁺CD45RA⁺ naive T cells were co-cultured with autologous MDDC at a ratio of 4: 1 (2x10⁴ T cells:5xlθ³ MDDC in 200ul human AB serum R-5 per well, in 96-well flat-bottom plates). The MDDC had been cultured under various experimental conditions before use (see Results section). On day 5, rhIL-2 (lOU/ml) and rhIL-15 (lOug/ml) were added, and the cells were cultured for a further 7 days. Expression of the cell surface markers CTLA4 and GITR was measured by flow cytometry. Supernatants from day- 12 cultures were stored at -80⁰C for subsequent measurement of cytokine levels.

FOXP3 detection by flow cytometry

The major T_reg populations include both naturally occurring CD4⁺CD25⁺FOXP3⁺ T_reg cells, and inducible IL-10- or TGF-6-secreting T_reg cells, termed T_rl [Maloy (2001); Weiner (2001)]. Stimulation of human T cells by immature DC can induce T_rl cells that produce IL-10 but do not express the transcription factor FOXP3 [Cottrez (2004); Roncarolo (2001)]. T_rl cells exert their suppressive effects via IL-IO secretion, whereas FOXP3⁺ T_reg cells require cell-cell contact [Bluestone (2003)]. Because both TNIL+LPS-treated and gpl20-treated MDDC produce IL-10, it is difficult to use this cytokine as a marker to identify T_reg. Moreover, CD25 is not restricted to T_rcg but is also expressed on activated T cells, T effector cells and mMDDC. FOXP3 was therefore chosen as a specific marker for T_reg cells. FOXP3 expression was assessed using a Human Regulatory T Cell Staining Kit (Cat No. 88-8999-40, e-Biosciences, San Diego CA). In brief, MDDC-primed T cells (1x10⁵) were resuspended in lOOul of PBS plus 0.5% human AB serum (Washing Buffer) before addition of 5ul of anti-CD4/25 cocktail (0.25ug FITC-anti-CD4 (clone RM4-5) and 0.03ug APC-anti-CD25 (clone PC61.5)). After thorough mixing, the cells were incubated in the dark for 30 minutes at 4°C, and then washed twice. The washed cell pellets were resuspended in ImI of freshly prepared eBioscience Fixation/Permeabilization Buffer (PB; made by adding 1 part of "Concentrate" into 3 parts of "Dilute"), then briefly vortexed and incubated in the dark for Ih at 4°C. The treated cells were next washed with 2ml of PB before addition of 2ul of normal rat serum to each lOOul sample, followed by a further incubation in the dark, this time for 15 minutes. After this blocking step, the cells were not further washed prior to the addition of 5ul of anti-human Foxp3 (PCHlOl) antibody or 5ul of rat IgG2b isotype control to each sample. After another incubation in the dark at 4°C, for 30 minutes, and two washes with 2ml of PB, the cell pellet was resuspended in 500ul of PB. Fluorescence data were acquired and analyzed as described herein. In some experiments, anti-IL-10 inhibitory antibody (Clone:73009, Cat No. MAB217) and control antibodies (Clone 20166, Cat No. MAB0042) were added. Endotoxin levels were <0.1EU/ug in both antibody preparations, as determined by the LAL method (R&D Systems).

Statistical analysis

IL-10 measurements were subjected to the D'Agostino and Spearman omnibus normality test. The data were not uniformly normal. Hence, differences between gpl20-treated and untreated groups were analyzed by one-tailed Mann-Whitney U test. The α level was set to 0.05. Correlations rather than regression analyses were performed since two measured variables were analyzed (IL-10 secretion and cell proliferation).

RESULTS

Derivation and properties of pure MDDC populations

This study investigated how gpl20 affected MDDC maturation and cytokine secretion, and MDDC-T cell interactions, in view of the key role DC play in antigen capture, processing and presentation. The blood monocytes used to generate MDDC were typically 98-99% pure, as indicated by CDH expression, and <5% of freshly isolated monocytes from any donor expressed CD80, CD83, DC-SIGN or CD206 (Fig.lA,B). After cultivation with GM-CSF and IL-4 for 6 days, a high proportion of the cells expressed CD lie, DC-SIGN, CD206, HLA-DR, CD86 and DEC-205, but few were positive for CDl 4, CD80, CD83 and CD25, a profile typical of immature MDDC (iMDDC) (Fig.lC). During days 6-8, in the absence of any stimulation, the cell-surface levels of these markers remained approximately constant except for CD 14 and CD25, which became undetectable. Hence the iMDDC did not revert to monocytes under these conditions. The iMDDC produced low levels of IL-IO (mean 10 + 1 2pg/ml at 24h, n=60 and 28 ± 3 8pg/ml at 48h, n=52) and no detectable IL-12p70 over a 48h penod starting on day 6.

DC upregulates costimulatory molecules (CD80 and CD86) and maturation markers (e g., CD83) to induce adaptive immune responses effectively [Banchereau (1998); Randolph (1998); Tan (2005); Jeras (2005); Pearce (2006)]. DC maturation can be tnggered by multiple stimuli, including LPS [Jeras (2005)], contact allergens [Pearce (2006)], bacteria and viruses, pro- inflammatory cytokines [Steinman 2002)] and signaling molecules (CD40L) [Caux (1994); Cella (1996)] Mature MDDC (mMDDC) express high levels of CD83, CD86, CD80 and HLA-DR, produce abundant IL-12p70 and stimulate THI responses [Willems (1994)] In this study, LPS ± CD40L combined with TNIL (TNF-a + IL-ip) was used to mature the cells. iMDDC stimulated on day 6 with TNIL+LPS+CD40L produced high levels of both IL-10 (mean 1100 ± 180pg/ml, n=12) and IL-12p70 (mean 235 ± 56pg/ml, n=12) over a 48h penod (see also Fig.2) iMDDC were more efficient than mMDDC at taking up exogenous antigens but less efficient at presenting them. The iMDDC used were pure and of high quality.

HIV-I gpl20 induces MDDC to produce IL-10 in a donor-dependent manner This study aimed to ascertain whether gpl20 induced IL-10 expression in MDDC, in view of the role played by IL-10 in T_H2-polaπzation of responses to gpl2O in immunized mice [Daly (2005)], and the induction of IL-10 by gpl20 in human monocyte/macrophages in vitro [Amegho (1994), Borghi (1995), Gessani (1997), Mellado (1998), Moore (2001)]

iMDDC from a day-6 culture were washed thoroughly to prevent further stimulation with IL-4 and GM-CSF, then incubated for two further days with or without CHO-cell expressed, JR-FL (R5) gpl20 (the 3ug/ml (25nM) concentration was based on titrations in pilot studies) gpl20 triggered significant IL-10 secretion from MDDC from a subset of 60 blood donors Thus, at 24h, gpl20 addition increased IL-10 production by > 10-fold in MDDC from 43% (26/60) of the donors, by 5- 10 fold in 22% (13/60); and by <5-fold in 35% (21/60) At 48h, the corresponding IL-10 increases were >10-fold, 39% (17/44); 5-10 fold, 11% (5/44), <5-fold 50% (22/44) The median IL-10 levels were significantly elevated by gpl20 at both 24h (controls, 6 4pg/ml; gpl20, 66pg/ml) and 48h (controls, 17pg/ml; gpl20, 98pg/ml) (Mann- Whitney U test, one tail, p<0 0001)(Fig.2A)

The IL-10 response to gpl20 by MDDC from responsive donors was concentration-dependent (Fig 2B). At lug/ml, JR-FL gpl20 induced significant but sub-optimal IL-10 production At the optimal concentration (3ug/ml), there was very little cell death, estimated by propidium iodide or 7-amino-actinomycin D stainmg and flow cytometry Higher JR-FL gpl20 concentrations (lOug/ml) were, however, cytotoxic, at least 50% of the MDDC appearing dead after 48h. The dose-response curve for LAI gpl20 was slightly different, IL-IO secretion being highest (with little cell death) at lOug/ml, the highest concentration tested. Extracellular IL-IO levels peaked 24-48h after addition of JR-FL gpl20 (Fig.2C), whereas IL-IO mRNA production could first be detected after 5h, was maximal at ~10h and gradually declined thereafter (Fig.2C). Intracellular cytokine staining was also performed on MDDC treated overnight (i.e., 12-16h) with JR-FL gpl20 (3ug/ml). MDDC were by far the most abundant cytokine-expressing cells present, showing that these cells, not contaminants, are the principal source of the extracellular cytokines (Fig.2D). High levels of IL-IO were induced by gpl20 in MDDC from two of three donors, lesser amounts of EL-4 in all three, with no induction of IL-12p 70 or IFN-y in any donor. In contrast, IL-12p70, IL-10 and IL-4 (but not IFN-y) were all elevated in mMDDC (i.e., iMDDC stimulated with TNIL+LPS+CD40L) (Fig.2D). Therefore, gpl20 induced iMDDC to produce high levels of IL-10 and moderate amounts of IL-4, favoring a T_H2 or an immunosuppressive T_reg type of immune response, whereas the TNIL+LPS+CD40L stimulus also induced IL-12p70 expression, favoring a THO response. TNIL+IFN-y stimulated high-level production of IL-12p70 but no IL-10, a cytokine profile associated with a T_HI response.

HIV-I gpl20 stimulates IL-10 production by MDDC throueh a mannose-dependent interaction To determine which gpl20 receptors on iMDDC were responsible for activating IL-10 expression, either gpl20 or the cells were incubated with ligands that should block known gpl20-receptor interactions (Fig.3A). Neither the bl2 mAb to the CD4-binding site on gpl20 nor sCD4 inhibited IL-10 production, implying that a gpl20-CD4 interaction was not responsible. The small-molecule CCR5 antagonist ADlOl was not inhibitory, ruling out signals transduced via gpl20-CCR5 binding. The CXCR4 antagonist AMD3100 was also inactive against IL-10 induction by gpl20 from the X4 virus, LAI, so CXCR4 is also uninvolved. As expected, AMD3100 did not inhibit the IL-10 response to JR-FL gpl20, nor ADlOl the response to LAI gpl20.

In contrast, when gpl20 was pre-treated with either mAb 2Gl 2 or cyanovirin-N (CV-N), IL-10 induction was strongly inhibited (Fig.3A). Both 2G12 and CV-N bind to mannose moieties on gpl20 N-linked glycans 34"36, implicating an interaction between gpl20 and an MCLR(s) as the critical trigger for IL-10 induction. It was also tested whether soluble mannans antagonized gpl20- dependent IL-10 expression, but found that mannans themselves strongly activated an IL-10 response (Fig.3A). However, combining gpl20 with mannans did not further elevate IL-10 levels, suggesting that both ligands bind to, and saturate, the same MCLR(s). The anti-DC-SIGN mAb AZN-Dl reduced the EL-IO response to gpl20 by -40%. AZN-Dl completely blocked the binding of mannosylated gpl20 to DC-SIGN in an ELISA (Fig.3B), and inhibited DC-SIGN-mediated binding of gpl20 to tonsillar B cells (He et al.). MAbs Clone 15-2 to MR and MG38 to DEC-205 had little effect when added alone, but the combination of all three MCLR mAbs completely abolished the IL-10 response to gpl20 (Fig.3A). Hence DC-SIGN is not the only MCLR involved in gpl20-mediated IL-10 induction. The identification of an MCLR(s) as the cell surface receptor responsible for gpl20-mediated IL- 10 induction aided in devising a method to prevent this response. The mannose moieties can be removed from gpl20 by enzymatic digestion with α-(l-2,3,6)-mannosidase [Sanders (2002)], so demannosylated JR-FL gpl20 (D-gpl20) was made. Blue-native PAGE analysis showed the enzyme-treated gpl20 was slightly smaller than mock-treated gpl20 (M-gpl20; processed without the enzyme) (Fig.3C; compare lanes marked + and -). The successful removal of mannose was verified by showing that D-gpl20 failed to bind either 2Gl 2 or DC-SIGN-Fc, in contrast to M- gpl20 (Fig. 3B). In contrast, both mAb bl2 and CD4-IgG2 bound efficiently to structures associated with the CD4-binding site on D-gpl20 (Fig.3B). Thus, JR-FL gpl20 was efficiently demannosylated without impairing its overall conformation [Sanders (2002); Botos (2002)].

Both untreated gpl20 and M-gpl20 induced substantial IL-10 production (150-300pg/ml) from MDDC from five different donors, whereas D-gpl20 had no such effect. Influenza virus HA did not stimulate IL-10 production, whereas TNIL+LPS activated a strong response (Fig.3D). Hence, an interaction between the mannose moieties on gpl20 and an MCLR(s) can trigger IL-10 production from MDDC from a significant proportion of human donors. The lack of effect of HA compared to gpl20 is consistent with the outcome of comparative immunization studies with these two viral receptor-binding proteins in mice [Daly (2005)].

HIV- 1 gpl20 impairs iMDDC maturation

When added with maturation factors, IL-10 can impair antigen presentation by MDDC, by down- regulating the expression of MHC class II, CD80 and CD86 and by inhibiting CD83 up-regulation [Willems (1994)]. Immunophenotype analyses were used to investigate whether gpl20 affects iMDDC maturation. Neither JR-FL gpl20 nor M-gpl20 induced iMDDC to mature in the absence of TNIL+LPS+CD40L (Fig.4). However, expression of CD80 and CD83 and, to a lesser extent, CD86 was reduced when iMDDC were incubated with gpl20 or M-gpl20 together with TNTL+LPS+CD40L, compared to when the cells were matured with TNIL+LPS+CD40L alone. DC-SIGN expression was 2- to 3-fold greater on MDDC treated with TNTL+LPS+CD40L plus either gpl20 or M-gpl20 than on cells given only TNIL+LPS+CD40L. D-gpl20 did not mimic the effects of gpl20 or M-gpl20 on the expression of CD80, CD83 and DC-SIGN, implicating an MCLR(s) as a mediator of the inhibitory effect of gpl20 on iMDDC maturation (Fig.4). DEC -205 staining increased slightly in response to all three gpl20s, but CD206 expression was unaltered.

The impaired maturation of iMDDC (reduced expression of CD80, CD83, CD86 and increased expression of DC-SIGN) correlated weakly or not at all with IL-10 secretion 24h after gpl20 addition: R²=039 for CD80 fold-decrease vs IL-10 (six donors tested); for CD83 expression vs IL- 10, /^=0.59; for the fold-increase in DC-SIGN expression vs IL-10, R²=0Λ3. The reduction in CD86 expression did not correlate at all with EL-IO, R²=0.0$7. The interaction of gpl20 with an MCLR(s) therefore partially blocked the TNIL+LPS+CD40L-induced maturation of iMDDC that normally leads to increases in CD80 and CD83 expression and a reduction in DC-SIGN expression.

gpl20 inhibits the ability of mMDDC to induce T-cell proliferation

The effects of gpl20 on MDDC maturation were assessed and whether cytokine production would affect their capacity to stimulate the proliferation of allogeneic T cells. To do this, M-gpl20 or D- gpl20 (JR-FL) was added to iMDDC simultaneously with TNIL+LPS+CD40L (i.e., on day 6). Influenza virus HA was used as a negative control antigen, given simultaneously with TNTL+LPS+CD40L. After the iMDDC had been cultured with the various stimuli for 48h, the cells were washed to remove any free gpl20, then negative-selected, CFSE-labeled, allogeneic CD4+ T cells were added (at a ratio of 1 : 10) for a 5-day co-culture (i.e., from days 8-13).

Exposure of the TNIL+LPS-stimulated MDDC to M-gpl20 for 48h reduced subsequent T cell proliferation, measured as the proportion of CFSE-negative cells, by -65%. D-gpl20 was less inhibitory (-30% decrease), little different from the -20% decrease seen with the HA control antigen. MDDC exposed to Env proteins in the absence of TNIL+LPS did not stimulate T-cell proliferation (Fig.SA). MDDC from all 15 donors tested behaved similarly in the T-cell proliferation assay, implying that the IL-IO response might not be relevant (see Fig.2A). Indeed, there was no correlation between IL-10 production on day 8 by the gpl20-treated, TNIL+LPS- stimulated MDDC and their subsequent inhibition of T-cell proliferation (R²=0Λ0). This is not surprising, since both cytokines and any stimulus for their continued secretion were washed out of the MDDC cultures before addition of the T cells. However, IL-10 concentrations in the various co-cultures varied by <5-fold overall on day 13, the highest level (280 ± 45pg/ml) being seen with MDDC exposed to M-gpl20+TNIL+LPS (Fig.5B). IL-10 levels were higher in co-cultures with MDDC that had been stimulated with TNIL+LPS and gpl20 combined than when either stimulus was used alone, suggesting that different pathways might be triggered by the different stimuli. Overall, there was no strong correlation between IL-10 concentrations on day 13 and the extent to which T-cell proliferation was inhibited by M-gpl20 (R²=0.35 for 5 tested donors).

In contrast to IL-10, IL-12p70 varied substantially in the various co-cultures (Fig.5B). IL-12p70 concentrations were very low (<10pg/ml) in co-cultures containing MDDC treated with M-gpl20, D-gpl20 or HA in the absence of TNIL+LPS. When TNIL+LPS was used to mature the MDDC, IL-12p70 concentrations reached 200 ± 22pg/ml. The inclusion of D-gpl20 or HA reduced IL- 12p70 production slightly (~2-fold), but when M-gρl20 was used only baseline levels of IL-12p70 were produced (7.2 ± 1.7pg/ml). IL-4 was also measured, the concentrations ranging from 5- 15pg/ml in the different co-cultures, with no obvious pattern of response detectable. Taken together, the inhibitory effect of gpl20-primed MDDC on the proliferation of naive CD4+ T-cells is associated with elevated IL-10 production combined with reduced expression of IL-12p70. gpl20-treated MDDC prime T^ cells

IL-IO production by DC is known to favor the development of T_H2 and T_reg cell subsets, whereas IL-12 production is required for T_H1 cell development [O'Garra (2004)], ICOS-L and PD-Ll are cell-surface markers defining tolerogenic MDDC (MDDCreg) that can induce the differentiation of naiVe (CD4+CD45RA+) T-helper cells to Treg38'39. After 24h of treatment with TNIL+LPS+CD40L, 44% ± 16% and 38% ± 22% of the MDDC from two donors were ICOS-L⁺ and PD-Ll⁺ respectively. However, after treatment with JR-FL gpl20+TNIL+LPS+CD40L, expression of both markers increased to 77% ± 13% and 86% ± 5.6%, implying that gpl20 promotes the development of MDDC_reg. It was therefore assessed whether maturation of MDDC in the presence of gpl20 promoted the development of FOXP3⁺ T_reg cells in the co-culture system. The cell-surface markers CTLA-4⁺ and GITR⁺ were used to further define T_reg subsets.

Autologous naive T_H cells (CD4⁺CD45RA⁺ T cells) were stimulated for 12 days with MDDC that had previously been matured with TNIL+LPS in the presence or absence of JR-FL gpl20. IL-IO levels were elevated in the co-cultures of T-cells with MDDC that had been exposed to gpl20 during maturation, but the pro-inflammatory cytokine IL-6 and the T_H1 -associated cytokine IL- 12p70 were present at lower levels with no change in the T_H2-associated cytokine EL-4 (Fig.όA; compare gpl20+TNIL+LPS with TNIL+LPS). FOXP3 expression in the MDDC-primed populations of naive CD4⁺ T cells was similar whether the MDDC had been treated with gρl20 alone or with TNIL+LPS alone. However, FOXP3 expression was elevated by two-fold when the priming MDDC had been matured in the presence of both gpl20 and TNIL+LPS (Fig.6B). CTLA- 4 and GITR expression levels were higher on T-cells in the cultures containing MDDC primed with gpl20+TNIL+LPS, compared to TNEL+LPS alone; these markers were also upregulated, to a lesser extent, when gpl20 was used alone (Fig.6B). Since CTLA-4 and GITR define overlapping subpopulations of Treg, these observations suggest that exposure to gpl20 during the maturation process makes MDDC more effective at promoting the development and differentiation of FOXP3-expressing T_reg cells.

Antigenic analysis of D-gpl20

Antigenic analysis of D-gpl20 was determined by ELISA. Equal amounts of different forms of gpl20 were captured on D7324-coated plates ELISA plates. Gp 120 forms captured were CHO- expressed D-gpl20, CHO-expressed M-gpl20, CHO-expressed gpl20 (untreated), and Drosophila cell-expressed D-gpl20 (high mannose). Neutralizing and non-neutralizing monoclonal antibodies were tested for binding to the captured gpl 20. Results are shown in Figure 28.

Assessment of gpl20-binding serum IgG subclasses

To assess gpl20-binding serum IgG subclasses, JRFL gpl20 was captured on D7324-coated

ELISA plates with the exception that for IgG2a, the plates were coated directly with gpl 20. gpl20-binding IgG subclasses in serum were detected with AP-conjugated rabbit anti-mouse IgG, IgGl and IgG2a (Figure 29). IgGl antibodies were associated with Th2 responses (humoral, Figure 30) while IgG2a antibodies were associated with ThI responses (cellular, Figure 31).

Assessment of Exposure of Neo-epitopes

Serum from mice immunized with D-gpl20 in both Alum and Quil-A groups showed higher binding to D7324-bound D-gpl20 compared to gpl20. De-mannosylation appears to allow for exposure of neo-epitopes as well as superior recognition, processing and presentation of neo- epitopes to the immune system. In addition, a fraction of antibodies to D-gpl 20 immunized mice recognized newly exposed epitopes on the silent face.

Measurement of CMI responses

Total CD8+ and CD4+ T-lymphotes splenocytes tested for specific IFNγ secretion in response to gpl20 re-stimulation. In vitro re-stimulation were performed overnight with overlapping peptide pools from consensus Clade B Env sequence. IFNγ production was evident only in splenocytes from mice immunized with Quil A adjuvant. The frequency of IFNγ-secreting cells is expressed as the number of spot forming cells per 300,000 splenocytes. As shown in Figure 32, the strongest IFNγ production was observed in mice immunized with D-gpl20 + Quil A.

DISCUSSION

Exposure to HIV-I gpl20 impairs the maturation of human iMDDC, leading to increased production of IL-10 and reduced levels of IL- 12 in co-cultures with naive T-cells, impairment of T-cell proliferation and the development of T_reg cells. These potentially immunosuppressive effects are a consequence of an interaction between gpl20 and an MCLR(s) and can be prevented by enzymatic removal of the mannose moieties from gpl20 glycans.

The gpl20-treated MDDC from about half the 60 donors studied herein secrete elevated amounts of IL-10, a cytokine generally associated with immunosuppressive responses. Complex host genetic factors influence IL-10 gene regulation, suggesting one area for further exploration [Moore (2001); Lin ((2005); Wilson (2005); Kurzai (2005)]. However, the donor-dependency of gpl20- induced IL-10 expression may have other, non-genetic explanations, an issue we are presently addressing. For example, very low levels of other cell types can affect MDDC phenotype, and the amounts of any such cells present in cultures could be donor-dependent [Nauta (2006)]. Alternatively, a labile intermediate such as nitric oxide might be involved in the signaling cascade [Tan (2005)].

Elevated IL-10 production from gpl20-treated cells in vitro is not a new observation; there are multiple reports of it occurring with monocyte/macrophages [Mellado (1998); Moore (2001); Taoufik (1997)]. However, gpl20-stimulated IL-10 production from MDDC has not been reported previously. Indeed, DCs undergoing continued stimulation with GM-CSF and IL-4 were found not to secrete IL-IO in response to gpl20 [Megiovanni (2004)]. The difference between these observations and the results of this study may lie in the details of how the DCs were isolated and cultured. For example, Megiovanni et al. used fetal bovine serum instead of human AB serum, and exposed their MDDC cultures to GM-CSF and IL-4 for longer than this study; IL-4 has been reported to inhibit IL-IO secretion from DC [Yao (2005)]. Overall, the conditions used by Megiovanni et al. minimize or ablate the gpl20-mediated induction of IL-10 expression. Naive CD4+ T-cells co-cultured with gpl20-treated MDDC proliferate poorly, and some of them express phenotypic markers characteristic of T_reg cells. IL-10 expression by the MDDC is not obligatorily linked to the anti-proliferative and T_reg-inductive responses to gpl20, as the latter were observed with MDDC that did not secrete IL-10 when exposed to gpl20. The mechanistic explanation may lie in the reduced upregulation of co-stimulatory molecules and activation markers such as CD80, CD83 and CD86 when MDDC are matured in the presence of gpl20, irrespective of IL-10 expression. The ablated production of IL-12 in the co-cultures of naive T-cells and gpl20-primed MDDC may also be relevant, particularly in combination with a modest elevation in IL-10 levels.

If broadly similar events to those observed in this study occur during the early stages of gpl20 vaccination, these could contribute to the limited immunogenicity of HIV-I Env proteins. It is also notable that including Env in multi-component HIV/SIV vaccines can sometimes be deleterious to protection [Buge (2003); Strapans (2004)]. During immunization, milligram amounts of gpl20 are delivered in a bolus into tissues, so local concentrations are likely to be rather high, particularly during the earliest, formative stages of the immune response. In a comparative DNA and protein immunization study in mice, the antibody and cytokine responses to gpl20 were strongly T_H2- polarized, whereas responses to HA were T_H1 -biased. Furthermore, the T_H2 bias of the anti-gpl20 response did not occur in IL-10 knock-out mice. Although T-helper phenotypes are more complex in humans than mice, the responses to gpl20, during infection and after vaccination, do appear to be T_H2-biased [Gorse (1999); Abbas ((2005); Martinez (2005); Ngo-Giang-Huong (2001)].

It is also possible that sufficient gpl20 might be present within lymphoid tissues to impair immune responses to HIV-I antigens during natural infection [Klasse (2004); Popovici (2005)]. CD4⁺CD25⁺FOXP3⁺ T_reg cells and IL-IO⁺ cells are induced abnormally quickly in SIV-infected macaques, where they may limit the initial development and/or maintenance of effective immunity [Estes (2006)]. High levels of IL-10, accompanied by a reduction in IL-12, have been observed in plasma during primary HIV-I infection [Norris (2006)].

The varied effects of gpl20 on iMDDC are due to its binding to an MCLR(s) via mannose moieties. Thus, CV-N and the 2G12 mAb each binds to the mannose components of gpl20 glycans, and each inhibited IL-10 induction. In contrast, inhibitors of gpl20 binding to CD4, CCR5 or CXCR4 were ineffective. Moreover, enzymatic removal of the mannose moieties from gpl20 prevented the IL-IO response. Also relevant, gpl20 induces IL-IO expression in immunized mice; gpl20 cannot bind to murine CD4, CCR5 or CXCR4 whereas it does interact with murine DC- SIGN. In contrast, the influenza HA Env protein was found herein not to induce IL-10 expression; HA is not known to bind to any MCLR. Several different MCLRs are known or considered to be binding sites for gpl20 on DC, including DC-SIGN, langerin, the macrophage mannose receptor CD206 and DEC-205 [Turville (2003)]. mAbs to DC -SIGN, CD206 and DEC-205 were individually ineffective (or only partially effective) as inhibitors of IL-10 production, but combining all three mAbs ablated the response. Hence, multiple MCLRs are involved in gpl20-mediated IL-10 induction, and probably in the other immunosuppressive responses. Different MCLR may be involved to different extents on MDDC from different donors, perhaps contributing to donor-dependent variation in the IL-10 response. Different gpl20 proteins may also vary in whether, or how efficiently, they trigger IL-10 release; we noted modest differences in the dose-response curves for JR-FL and LAI gpl20. Although some molecular determinants of how gpl20 interacts with DC-SIGN have been defined [Hong (2002)], this is not so for other MCLRs.

One implication of the results herein is that the retention of high mannose moieties on the Env complex may be yet another defense device HIV-I uses in its battle with host immunity. The presence of mannoses on Env is paradoxical because they might facilitate virion clearance from the blood [Sanders (2002)]. Counter-functions would justify their retention. Other pathogens also use mannose moieties to suppress immune responses, again via binding to MCLRs. For example, the MTb cell wall component ManLAM binds to DC-SIGN at a similar site to gpl20's, induces IL-10 production, impairs DC maturation, and suppresses the host immune response to this pathogen [Geijtenbeek (2003); Nigou (2002)]. Some lactobacilli do much the same [Smits (2005)]. Also, immunizing horses with insect cell-expressed Env proteins, which are enriched for high-mannose moieties, enhances infection post-challenge with EIAV, whereas protective responses were induced using similar Env proteins expressed in mammalian cells [Hammond (1999); Raabe (1998); Wang (1994)]. Insect cell-expressed gpl20 proteins were also comparatively poor immunogens in mice, because of a limited ability to induce T-helper responses [Grundner (2004)]. Although DC-SIGN, and MCLRs in general, are important sentinels for the presence of pathogens, some organisms may be able to subvert at least some of the natural functions of these receptors for their own purposes [Pulendran (2004)]. Of note is that cross-linking DC-SIGN synergizes with TNF-α for IL-10 release and enhances the induction of IL-10 by LPS [Caparros (2006)]. Moreover, engagement of DC-SIGN by specific antibodies induces ERK 1/2 and Akt phosphorylation without concomitant p38MAPK activation. Hence, there is already a molecular explanation for how the interaction of pathogen antigens with DC-SIGN can preferentially evoke T_H2-type immune responses [Caparros (2006)].

What signaling pathways are activated by gpl20 in MDDC to promote IL-10 expression and immunosuppressive responses is not yet known. DC-SIGN in particular may be considered as an unconventional pathogen-recognition receptor (PRR) that drives T_H2 and T_reg responses. Silencing SOCS-I in DC has been shown to reduce the suppressive effect of gpl20 on the production of proinflammatory cytokines in vitro. Mice immunized with gpl20-pulsed, SOCS-I -silenced DC produced higher and more sustained titers of anti-gpl20 antibodies, and T_Hl-polarized cellular responses to gpl20 [Song (2006)]. Conversely, over-expressing SOCS-3 in murine DC increased IL-IO expression, and SOCS-3-transduced DC primed a T_H2-dominant response when co-cultured with CD4+ T cells in vitro.

The high-mannose moieties can be removed from gpl20 by treatment of the protein with a mannosidase enzyme. This strategy improves the immunogenicity of HIV-I Env proteins (e.g., gpl40 trimers). Of course raising higher titers of antibodies and/or reducing the rate of decay of the antibody response will achieve little if those antibodies are non-neutralizing. A general increase in the immunogenicity of Env proteins facilitates the development of otherwise sub-threshold NAb responses, and/or enable lower amounts of Env trimers to be used. Combining the mannose- removal technique with other strategies intended to increase the immunogenicity of NAb epitopes is also possible. Several other vaccine antigens^{^}that are considered to be problematic from the immunogenicity perspective, such as RSV F, RSV G, CMV gB and Ebola GP, are also highly glycosylated and/or can bind to MCLRs [Halary (2002); Lambert (1988); Lin (2003)]. These proteins may also contain high-mannose moieties or other carbohydrate structures that can interact with MCLRs that could be removed enzymatically.

REFERENCES FOR EXPERIMENTAL DETAILS I

1. Burton, D. R. et al. HIV vaccine design and the neutralizing antibody problem. Nat Immunol 5,233-6 (2004).

2. Pantophlet, R. & Burton, D. R. GPl 20: target for neutralizing HIV-I antibodies. Armu Rev Immunol 24, 739-69 (2006).

3. Zwick, M. B. The membrane-proximal external region of HIV-I gp41 : a vaccine target worth exploring. Aids 19, 1725-37 (2005).

4. McMichael, A. J. HIV vaccines. Annu Rev Immunol 24, 227-55 (2006). 5. Connor, R. I. et al. Immunological and virological analyses of persons infected by human immunodeficiency virus type 1 while participating in trials of recombinant gpl20 subunit vaccines. J Virol 72,1552-76 (1998). 6. Flynn, N. M. et al. Placebo-controlled phase 3 trial of a recombinant glycoprotein 120 vaccine to prevent HIV-I infection. J Infect Dis 191, 654-65 (2005). 7. Gilbert, P. B. et al. Correlation between immunologic responses to a recombinant glycoprotein 120 vaccine and incidence of HIV-I infection in a phase 3 HIV-I preventive vaccine trial. J Infect Dis 191, 666-77 (2005). 8. Graham, B. S. et al. Analysis of intercurrent human immunodeficiency virus type 1 infections in phase I and II trials of candidate AIDS vaccines. AIDS Vaccine Evaluation

Group, and the Correlates of HIV Immune Protection Group. J Infect Dis 177,310-9

(1998).

9. Grundner, C. et al. Factors limiting the immunogenicity of HIV-I gpl20 envelope glycoproteins. Virology 330,233-48 (2004).

10. Wright, P. F. et al. Comparison of systemic and mucosal delivery of 2 canarypox virus vaccines expressing either HIV-I genes or the gene for rabies virus G protein. J Infect Dis 189,1221-31 (2004). 1 1. Daly, L. M. et al. Innate IL-IO promotes the induction of Th2 responses with plasmid

DNA expressing HIV gpl20. Vaccine 23, 963-74 (2005). 12. Gorse, G. J. et al. HFV-IMN recombinant glycoprotein 160 vaccine-induced cellular and humoral immunity boosted by HFV-IMN recombinant glycoprotein 120 vaccine. National Institute of Allergy and Infectious Diseases AIDS Vaccine Evaluation Group. AIDS Res Hum Retroviruses 15,115-32 (1999).

13. Abbas, A. et al. Analysis of IGG and IGG4 in HFV-I seropositive patients and correlation with biological and genetic markers. Biomed Pharmacother 59, 38-46 (2005).

14. Martinez, V. et al. Combination of HFV-I -specific CD4 ThI cell responses and IgG2 antibodies is the best predictor for persistence of long-term nonprogression. J Infect Dis 191,2053-63 (2005).

15. Ngo-Giang-Huong, N. et al. HFV type 1-specific IgG2 antibodies: markers of helper T cell type 1 response and prognostic marker of long-term nonprogression. AIDS Res Hum

Retroviruses 17,1435-46 (2001 ).

16. Klasse, P. J. & Moore, J. P. Is there enough gpl 20 in the body fluids of HIV-I - infected individuals to have biologically significant effects? Virology 323,1-8 (2004).

17. Ameglio, F. et al. Recombinant gpl20 induces IL-10 in resting peripheral blood mononuclear cells; correlation with the induction of other cytokines. Clin Exp Immunol

95,455-8 (1994).

18. Borghi, P. et al. Induction of interleukin-10 by human immunodeficiency virus type 1 and its gpl20 protein in human monocytes/macrophages. J Virol 69,1284- 7 (1995).

19. Fantuzzi, L., Purifϊcato, C, Donato, K., Belardelli, F. & Gessani, S. Human immunodeficiency virus type 1 gpl 20 induces abnormal maturation and functional alterations of dendritic cells: a novel mechanism for AIDS pathogenesis. J Virol 78, 9763- 72 (2004).

20. Gessani, S. et al. Induction of cytokines by HFV-I and its gpl20 protein in human peripheral blood monocyte/macrophages and modulation of cytokine response during differentiation. J Leukoc Biol 62,49-53 (1997).

21. Granelli-Piperno, A., Golebiowska, A., Trumpfheller, C, Siegal, F. P. & Steinman, R. M. HFV-I -infected monocyte-derived dendritic cells do not undergo maturation but can elicit IL-10 production and T cell regulation. Proc Natl Acad Sci US A 101 , 7669-74 (2004).

22. Mellado, M. et al. HFV-I envelope protein gpl20 triggers a Th2 response in mice that shifts to ThI in the presence of human growth hormone. Vaccine 16, 11 1 1 -5 (1998).

23. Moore, K. W., de Waal Malefyt, R., Coffinan, R. L. & O'Garra, A. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19, 683-765 (2001).

24. Taoufϊk, Y. et al. Human immunodeficiency virus gpl20 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood 89,2842-8(1997). 25. Banchereau, J. & Steinman, R. M. Dendritic cells and the control of immunity. Nature

392, 245-52 (1998).

26. Randolph, G. J., Beaulieu, S., Lebecque, S., Steinman, R. M. & Muller, W. A. Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking. Science 282,480-3 (1998). 27. Tan, J. K. & O'Neill, H. C. Maturation requirements for dendritic cells in T cell stimulation leading to tolerance versus immunity. J Leukoc Biol 78, 319-24 (2005). 28. Jeras, M., Bergant, M. & Repnik, U. hi vitro preparation and functional assessment of human monocyte-derived dendritic cells-potential antigen-specific modulators of in vivo immune responses. Transpl Immunol 14, 231 -44 (2005). 29. Pearce, E. J., Kane, C. M. & Sun, J. Regulation of dendritic cell function by pathogen- derived molecules plays a key role in dictating the outcome of the adaptive immune response. Chem Immunol Allergy 90, 82-90 (2006). 30. Steinman, R. M. & Pope, M. Exploiting dendritic cells to improve vaccine efficacy. J Clin

Invest 109, 1519-26 (2002). 31. Caux, C. et al. Activation of human dendritic cells through CD40 cross-linking. J ExpMed

180,1263-72(1994).

32. Cella, M. et al. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J Exp Med 184,747-52 (1996).

33 Willems, F. et al. Interleukin-10 inhibits B7 and intercellular adhesion molecule- 1 expression on human monocytes. Eur J Immunol 24,1007-9 (1994).

34 Sanders, R. W. et al. The mannose-dependent epitope for neutralizing antibody 2Gl 2 on human immunodeficiency virus type 1 glycoprotein gpl20. J Virol 76, 7293-305 (2002). 35 Botos, I. et al. Structures of the complexes of a potent anti-HIV protein cyanovirin-N and high mannose oligosaccharides. J Biol Chem 277, 34336-42 (2002).

36 Scanlan, C. N. et al. The broadly neutralizing anti-human immunodeficiency virus type 1 antibody 2G 12 recognizes a cluster of alphal — >2 mannose residues on the outer face of gpl20. J Virol 76, 7306-21 (2002).

37 O'Garra, A. & Vieira, P. Regulatory T cells and mechanisms of immune system control.

Nat Med 10, 801-5 (2004).

38 Collins, M., Ling, V. & Carreno, B. M. The B7 family of immune-regulatory ligands.

Genome Biol 6,223 (2005).

39 Greenwald, R. J.₉ Freeman, G. J. & Sharpe, A. H. The B7 family revisited. Annu Rev

Immunol 23,515-48 (2005). 40. Kurzai, O. et al. Carbohydrate composition of meningococcal lipopolysaccharide modulates the interaction of Neisseria meningitidis with human dendritic cells. Cell

Microbiol 7,1319-34 (2005). 41. Lin, M. T. et al. Genetic variation in the IL-10 pathway modulates severity of acute graft- versus-host disease following hematopoietic cell transplantation: synergism between IL-10 genotype of patient and IL-10 receptor beta genotype of donor. Blood 106, 3995-4001

(2005).

42 Wilson, J. N. et al. Analysis of ILlO haplotypic associations with severe malaria. Genes

Immun 6,462-6 (2005). 43 Nauta, A. J. et al. Donor-derived mesenchymal stem cells are immunogenic in an allogeneic host and stimulate donor graft rejection in a non-myeloablative setting. Blood

(2006).

44 Megiovanni, A. M., Sanchez, F., Gluckman, J. C. & Rosenzwajg, M. Double- stranded

RNA stimulation or CD40 ligation of monocyte-derived dendritic cells as models to study their activation and maturation process. Eur Cytokine Netw 15, 126-34(2004).

45 Yao, Y., Li, W., Kaplan, M. H. & Chang, C. H. Interleukin (IL)-4 inhibits IL-10 to promote IL-12 production by dendritic cells. J Exp Med 201, 1899-903 (2005).

46 Buge, S. L. et al. Gpl20-alum boosting of a Gag-Pol-Env DNA/MVA AIDS vaccine: poorer control of a pathogenic viral challenge. AIDS Res Hum Retroviruses 19,891-900

(2003).

47 Staprans, S, I. et al. Enhanced SFV replication and accelerated progression to AIDS in macaques primed to mount a CD4 T cell response to the SIV envelope protein. Proc Natl

Acad Sci U S A 101,13026-31 (2004).

48 Popovici, S. T. & Schoenmakers, P. J. Fast size-exclusion chromatography — theoretical and practical considerations. J Chromatogr A 1099, 92-102 (2005).

49 Estes, J. D. et al. Premature induction of an immunosuppressive regulatory T cell response during acute simian immunodeficiency virus infection. J Infect Dis 193, 703-12 (2006).

50 Norris, P. J. et al. Elevations in IL-10, TNF-alpha, and IFN-ganimafrom the Earliest Point of HIV Type 1 Infection. AIDS Res Hum Retroviruses 22, 757-62 (2006). 51 Baribaud, F. et al. Functional and antigenic characterization of human, rhesus macaque, pigtailed macaque, and murine DC-SIGN. J Virol 75, 10281-9 (2001).

52 Turville, S., Wilkinson, J., Cameron, P., Dable, J. & Cunningham, A. L. The role of dendritic cell C-type lectin receptors in HIV pathogenesis. J Leukoc Biol 74, 710-8(2003).

53 Hong, P. W. et al. Human immunodeficiency virus envelope (gpl20) binding to DC-SIGN and primary dendritic cells is carbohydrate dependent but does not involve 2Gl 2 or cyanovirin binding sites: implications for structural analyses of gpl20-DC-SIGN binding. J

Virol 76,12855-65 (2002).

54 Geijtenbeek, T. B. et al. Mycobacteria target DC-SIGN to suppress dendritic cell function.

J Exp Med 197,7-17 (2003). 55 Nigou, J. et al. Mycobacterial lipoarabinomannans: modulators of dendritic cell function and the apoptotic response. Microbes Infect 4, 945-53 (2002). 56. Smits, H. H. et al. Selective probiotic bacteria induce IL-10-producing regulatory T cells in vitro by modulating dendritic cell function through dendritic cell- specific intercellular adhesion molecule 3-grabbing nonintegrin. J Allergy Clin Immunol 115,1260-7 (2005).

57. Hammond, S. A., Raabe, M. L., Issel, C. J. & Montelaro, R. C. Evaluation of antibody parameters as potential correlates of protection or enhancement by experimental vaccines to equine infectious anemia virus. Virology 262,416-30 (1999).

58. Raabe, M. L. et al. Immunization with a recombinant envelope protein (rgp90) of EIAV produces a spectrum of vaccine efficacy ranging from lack of clinical disease to severe enhancement Virology 245,151-62 (1998).

59. Wang, S. Z. et al. Enhancement of EIAV replication and disease by immunization with a baculovirus-expressed recombinant envelope surface glycoprotein. Virology 199,247-51

(1994).

60. Pulendran, B. Modulating vaccine responses with dendritic cells and Toll-like receptors.

Immunol Rev 199,227-50 (2004).

61. Caparros, E. et al. DC-SIGN ligation on dendritic cells results in ERK and PI3K activation and modulates cytokine production. Blood 107, 3950-8 (2006). 62. Song, X. T. et al. An alternative and effective HIV vaccination approach based on inhibition of antigen presentation attenuators in dendritic cells. PLoS Med 3, ell (2006).

63. Li, Y., Chu, N., Rostami, A. & Zhang, G. X. Dendritic cells transduced with SOCS-3 exhibit a tolerogenic/DC2 phenotype that directs type 2 Th cell differentiation in vitro and in vivo. J Immunol 177,1679-88 (2006).

64. Halary, F. et al. Human cytomegalovirus binding to DC-SIGN is required for dendritic cell infection and target cell trans-infection. Immunity 17,653-64 (2002).

65. Lambert, D. M. Role of oligosaccharides in the structure and function of respiratory syncytial virus glycoproteins. Virology 164,458-66 (1988).

66. Lin, G. et al. Differential N-linked glycosylation of human immunodeficiency virus and Ebola virus envelope glycoproteins modulates interactions with DC-SIGN and

DC-SIGNR. J Virol 77,1337-46 (2003).

67. Beddows, S. et al. Construction and characterization of soluble, cleaved, and stabilized trimeric Env proteins based on HFV type 1 Env subtype A. AIDS Res Hum Retroviruses

22,569-79 (2006).

68. Strizki, J. M. et al. SCH-C (SCH 351125), an orally bioavailable, small molecule antagonist of the chemokine receptor CCR5, is a potent inhibitor of HIV-I infection in vitro and in vivo. Proc Natl Acad Sci U S A 98, 12718-23 (2001).

69. Donzella, G. A. et al. AMD3100, a small molecule inhibitor of HIV-I entry via the

CXCR4 co-receptor. Nat Med 4, 72-7 (1998).

70. Allaway, G. P. et al. Expression and characterization of CD4-IgG2, a novel heterotetramer that neutralizes primary HFV type 1 isolates. AIDS Res Hum Retroviruses 11 , 533-9 (1995).

71. Roben, P. et al. Recognition properties of a panel of human recombinant Fab fragments to the CD4 binding site of gpl20 that show differing abilities to neutralize human immunodeficiency virus type 1. J Virol 68,4821-8 (1994).

72. Trkola, A. et al. Cross-clade neutralization of primary isolates of human immunodeficiency virus type 1 by human monoclonal antibodies and tetrameric CD4-IgG. J Virol 69, 6609-17 (1995). 73. Moore, J. P. et al. Studies with monoclonal antibodies to the V3 region of HFV-I gpl20 reveal limitations to the utility of solid-phase peptide binding assays. J Acquir Immune Defic Syndr 7,332-9 (1994).

74. Poignard, P., Fouts, T., Naniche, D., Moore, J. P. & Sattentau, Q. J. Neutralizing antibodies to human immunodeficiency virus type-1 gpl20 induce envelope glycoprotein subunit dissociation. J Exp Med 183,473-84 (1996).

75. Geijtenbeek, T. B. et al. Identification of DC-SIGN, a novel dendritic cell-specific ICAM- 3 receptor that supports primary immune responses. Cell 100, 575-85 (2000).

76. Maloy, K. J. & Powrie, F. Regulatory T cells in the control of immune pathology. Nat Immunol 2, 816-22 (2001). 77. Weiner, H. L. Induction and mechanism of action of transforming growth factor-beta- secreting Th3 regulatory cells. Immunol Rev 182,207-14 (2001).

78. Cottrez, F. & Groux, H. Specialization in tolerance: innate CD(4+)CD(25+) versus acquired TRl and TH3 regulatory T cells. Transplantation 77, SI2-5 (2004). 79. Roncarolo, M. G., Bacchetta, R., Bordignon, C, Narula, S. & Levings, M. K. Type 1 T regulatory cells. Immunol Rev 182,68-79 (2001).

80. Bluestone, J. A. & Abbas, A. K. Natural versus adaptive regulatory T cells. Nat Rev Immunol 3, 253-7 (2003).

EXPERIMENTAL DETAILS II

INTRODUCTION

According to the 2005 World Health Organization AIDS epidemic update, there are over 40 million people infected with the HIV⁴ virus worldwide, with close to 5 million newly infected cases just last year (1). Among the hardest hit areas is sub-Saharan Africa, with over 25 million people living with HIV and about 10% dying of AIDS-related illnesses. It has been widely recognized and accepted that prophylactic measures in the form of an HIV vaccine, in addition to therapeutic medicines, need to be implemented to curtail the spread of AIDS globally.

An effective HFV vaccine needs to demonstrate an ability to elicit neutralizing antibodies (NAb) that would be capable of blocking the fusogenic interaction and entry of HTV with the CD4 receptor on CD4⁺ helper T cells, mediated by the cell surface viral env glycoproteins, gpl20 and gp41. Since the genetic polymorphism of the HIV-I gag and env genes are diverse and constantly evolving due to rapid mutation within individuals (2), the NAbs targeting the gpl20 and gp41 envelope proteins on the viral surface need to be capable of blocking the viral interaction with the CD4 receptor and thereby neutralize viruses from a broad range of subtypes, without discrimination.

One logical design of recombinant env vaccine candidates is to base the vaccine sequence on currently existing HIV-I isolates that are prevalent in the infected population. To this end, several oligomeric env proteins from several different subtypes or "clades" have been described, with subtype B sequences serving as a basis for the majority of those that have been reported (3-1 1 , 29, 31). The oligomeric env protein complex on the surface of the virus is comprised of a gpl20-gp41 heterodimer present in a homotrimer configuration (held together via non-covalent interactions), resembling a "spike" structure. These glycoproteins are derived from a gpl60 precursor protein, which undergoes processing and cleavage in the cell to result in gpl20 and gp41 heterodimers that are then targeted to the surface of the HIV viral envelope (12, 13). Fusion of the virus with the CD4⁺ cell membrane and oligomerization of the trimer spike is mediated by the gp41 glycoprotein, which is tethered to the virion surface via its transmembrane domain (12, 13).

It has been reasoned that design of a recombinant vaccine should mimic the native trimer spike of the HIV envelope against which NAbs would naturally be generated. Since the native Env trimer is technically challenging to produce in a recombinant form, modified versions of the trimer that could serve as potential vaccine templates have been reported. One typical modification is truncation of the gp41 transmembrane domain from the precursor gpl60 to yield gpl40 proteins in a soluble form. However, following processing and cleavage, the resulting gpl20 and gp41 ectodomain or gp41_ECTO (lacking the transmembrane domain) have been shown to form unstable associations and tend to dissociate into their respective monomelic subunits (13, 14).

To address these issues, subtype B HFV_JR._FL Env was used as a template and a disulfide bond was introduced between gpl20-gp41_ECτo subunits (SOS gpl40), followed by a further modification to gp4l_ECτo (I559P mutation), which successfully allowed for the expression of stable, cleaved and fully processed oligomeric gpl40 proteins in a trimeric conformation (SOSIP gpl40) (8-11 , 15-17, and WO 2003/022869). While immunization of rabbits performed with the engineered HIV-I _JR._FL SOSIP gpl40 elicited antibodies capable of neutralization, the activity was limited primarily to the homologous strain, with only a modest and limited ability to neutralize across different HIV-I primary isolates (11).

While the SOSIP technology addresses stability and expression, another issue that has limited production and purification of the recombinant trimers has been the spontaneous association of the oligomeric gpl40 proteins into aberrant "aggregate" species (3, 9, 11, 18). These aggregate species, typically identified by their reduced mobility on blue native PAGE (BN-PAGE) and non- reduced SDS-PAGE have been difficult to purify from the SOSIP gpl40 trimer without compromising yield and/or stability of the trimer. Attempts to fully characterize the aggregate have been limited and their true nature remains elusive.

To explore a wider variety of oligomeric env proteins that could elicit higher breadths of cross- neutralization activity and serve as potential vaccine immunogens, a panel of subtype A sequences from HIV-I primary isolates in sub-Saharan Africa were studied (19). The env proteins from these sequences were expressed as SOSIP gpl40 proteins, with a further engineered mutation at the gpl20-gp4lEcτo cleavage site (R6) for enhanced furin cleavage (> 95% efficiency) to yield soluble, stable and fully processed gpl40 trimers. Described herein is the purification and biochemical characterization of KNHl 144 SOSIP R6 gpl40, derived from a contemporary East African subtype A HIV-I primary isolate, using methodologies that improve on currently implemented purification procedures. The purified KNHl 144 SOSIP R6 gpl40 is a trimer based on BN-PAGE and size exclusion chromatography (SEC), hi addition, described herein are novel findings of the effects of non-ionic detergents such as Tween 20 on the KNH 1144 SOSIP R6 aggregates (19). These findings reveal new insights into the nature of the aggregate species. The effects of non-ionic detergent, e.g., Tween® 20, treatment on the antigenic properties of KNHl 144 SOSIP R6 gpl40 aggregates and trimers were examined. Finally, digital imaging based on negative stain electron microscopy was performed and revealed the structure of purified KNHl 144 SOSIP R6 gpl40 as trimeric oligomers. MATERIALS AND METHODS

Subtype A KNHl 144 SOSIP R6 transfection and expression:

The KNHl 144 SOSIP R6 envelope and furin DNA plasmids were as described. For a typical 8 L preparation, HEK 293T cells were seeded in triple flasks at a density of 2.5 x 10⁷ cells/flask and cultured in DMEM/10% FBS/1% pen-strep with 1% L-glutamine 24 hours prior to transfection. On the day of transfection, 270 ug of KNHl 144 SOSIP R6 envelope DNA was mixed with 90 ug of Furin protease DNA plasmid (per flask) in Opti-MEM. Polyethyleneimine (PEI) was added stepwise (2 mg PEI: 1 mg total DNA) and vortexed immediately in between each addition. The PEI/DNA complex solutions were incubated for 20 minutes at room temperature. Complexes were then added to the flasks and incubated for 6 hours at 32°C, 5% CO₂. The cells were then washed with warmed PBS and then incubated in exchange media (DMEM/ 0.05% BSA/1% pen-strep) for 48 hours at 32°C, 5% CO₂. After the 48 hour incubation, the supernatants were collected and a cocktail of protease inhibitors was added to minimize protein degradation. Harvested supernatants were then clarified by filtration through a 0.45um filter and concentrated to 53X.

Expression of KNHl 144 gpl20 monomer has been previously described (1) and typically, 1-2 L of cell culture supernatants from transfected cells were harvested. Supernatants were clarified by filtration and stored at -80⁰C without any concentration prior to purification.

Purification of KNHl 144 SOSIP R6 gpl40 and gpl20:

KNHl 144 SOSIP R6 gpl40 trimer was purified via a four step process starting with an ammonium sulfate precipitation followed by lectin affinity, size exclusion and ion-exchange chromatography. 53X concentrated cell culture supernatant was precipitated with an equal volume of 3.8 M ammonium sulfate to remove contaminant proteins (with the major contaminant being α-2- macroglobulin). The ammonium sulfate was added with constant stirring with a stir bar and then was immediately centrifuged at 4000 rpm, 4°C for 45 minutes. The resulting supernatant was diluted 4-fold with PBS, pH 7.25, and was filtered using a 0.45 um vacuum filter. The sample was then loaded at 0.5-0.8 ml/min onto a Galanthus nivalis (GNA) lectin (Vector Laboratories, Burlingame, CA) column equilibrated with PBS- pH 7.25. Once the load was finished, the column was washed with PBS pH 7.25 until OD₂₈o reached baseline, followed by a second wash with 0.5 M NaCl PBS pH 7.25 at 1 ml/min in order to remove contaminant proteins (mainly BSA). The column was then eluted with 1 M MMP PBS pH 7.25 starting with flowing one half CV through the column at 0.3 ml/min and pausing the purification for a 1 hour incubation in MMP elution buffer. Following the incubation, the flow was restarted at 0.3 ml/min and 0.5-1 ml fractions were collected. All peak fractions were then pooled and concentrated to a final volume of 1 ml using a Vivaspin 100,000 MWCO concentrator (Vivascience, Edgewood, NY) centrifuged at 1000 x g. The concentrated lectin elution was applied over a Superdex 200 SEC column (GE Healthcare, Piscataway, NJ) equilibrated in 20 mM Tris pH 8, 200 mM NaCl (TN-200), injecting 0.5 ml of sample per run and was resolved at 0.4 ml/min, collecting 0.4 ml fractions. The fractions were analyzed by BN-PAGE using a 4-12% Bis-Tris NuPAGE gel (Invitrogen, Carlsbad, CA) (10). All trimer containing fractions were pooled and diluted to 75 mM NaCl with 2OmM Tris pH 8. The diluted SEC pool was then applied over a 1 ml HiTrap DEAE FF column (GE Healthcare), equilibrated in 20 mM Tris pH 8, 75 mM NaCl (TN-75). The diluted SEC pool was loaded at 0.5 ml/min. The column was washed with TN-75 at 1 ml/min until the OD₂₈o reached baseline. The column was then eluted with 20 mM Tris, 300 mM NaCl pH 8 at 1 ml/min, collecting 0.5 ml fractions.

To maximize trimer yield, the flow-through fraction from the DEAE column was re-applied over the column (equilibrated in TN-75) and typically 20-30% or 30-40% more trimer was recovered in this manner. The fractions were analyzed by BN-PAGE and by reducing and non-reducing SDS- PAGE. Western blot analysis on non-reduced SDS-PAGE gel was performed with the ARP3119 monoclonal antibody. The trimer containing fractions were pooled and trimer concentration was determined through densitometry on a reducing SDS-PAGE gel using JR-FL gp 120 as a standard.

KNHl 144 gp 120 monomer:

Unconcentrated cell culture supernatants containing secreted gpl20 monomer were applied directly over a GNA lectin column equilibrated in 20 mM imidazole pH 7.1 at 1-2 ml/min. Following adsorption, the column was washed with a high salt (PBS containing 1 M NaCl, pH 7.1) wash, followed by a low salt (20 mM imidazole pH 7.1) wash. The column was eluted with 1 M MMP in 20 mM imidazole, 0.2 M NaCl pH 7.1. Peak fractions were pooled and diluted with 20 mM imidazole, pH 7.1, thirteen-fold to a final buffer concentration of 20 mM imidazole, pH 7.1, 15 mM NaCl. The diluted GNA elution was applied over 1 ml HiTrap Q Sepharose FF (GE Healthcare) equilibrated in 20 mM imidazole, pH 7.1. Following binding, the column was washed with 20 mM imidazole, pH 7.1, and was eluted with 20 mM imidazole, 0.2 M NaCl, pH 7.1. The Q elutions were pooled and concentrated and applied over a Superdex 200 column equilibrated in PBS in 0.5 ml volumes and resolved at 0.4 ml/min. Peak fractions were analyzed by 4-12% Bis- tris gels (Invitrogen), followed by Coomassie staining. Fractions containing gpl20 were pooled and quantified as described above for the SOSIP R6 gpl40 trimers and stored at -8O⁰C.

Tween® 20 Aggregate "conversion" Experiments:

Tween® 20 Dose effect: 1 ug of purified KNHl 144 SOSIP R6 trimer was incubated with varying concentrations of Tween® 20 (polyoxyethylene sorbitan monolaurate) ranging from 0 to 0.0001 % (v/v) and incubated for 1 hour at room temperature. Following incubation, samples were analyzed by BN-PAGE as described above.

Kinetics of Tween® 20 effect: To ascertain the early kinetics of the Tween® 20 effect on aggregate, 1 ug of purified KNHl 144 SOSIP R6 trimer was incubated with Tween® 20 at a final concentration of 0.05 % (v/v) for 5 minutes and for 10 minutes. A no-detergent control was included separately for each timepoint.

Temperature dependance on Tween® 20 effect: To determine if temperature affected the ability of Tween® 20 to recover trimers from aggregates (i.e., collapse aggregate into trimer), 1 ug of purified KNHl 144 SOSIP R6 trimer was incubated with Tween® 20 to a final concentration of 0.05% (v/v) at 0⁰C (on ice), room temperature (22-23⁰C) at 37°C, or left untreated for 10 minutes. Following the incubation, samples were analyzed by BN-PAGE and Coomassie staining.

Tween® 20 effect on KNHl 144 gp!20: To test if Tween® 20 had a similar effect on KNHl 144 gpl20, 1 ug of purified gpl20 monomer was either untreated or incubated with Tween® 20 at a final concentration of 0.05% for 10 minutes at room temperature. Following the treatment, samples were analyzed by BN-PAGE and Coomassie staining.

Tween® 20 effect on a-2-macroglogulin (a₂M): 0.5 ug of purified α-2-macroglobulin was either untreated or treated with Tween® 20 at a final concentration of 0.05% for 10 minutes at room temperature. Reactions were analyzed via BN-PAGE, followed by Coomassie staining.

Size exclusion chromatography (SEC) analysis:

All runs were performed at 4°C on the AKTA FPLC system (GE Healthcare). Each run was performed at least twice.

Molecular weight standards SEC: A Superdex 200 10/300 GL column was equilibrated in 20 mM Tris pH 8, 0.5 M NaCl (TN-500) and calibrated with the following molecular weight standard proteins: thyroglobulin 669,000 Da; ferritin 440,000 Da; BSA 67,000 Da; and RNAse A 13,700 Da. A standard curve was generated by plotting the observed retention volumes of the standard proteins against the log values of their predicted molecular weights.

KNHl 144 gp!20 SEC analysis: 14 ug of purified KNH1144 gpl20 (either untreated or Tween® 20-treated as described above) was applied over the Superdex 200 column equilibrated in TN-500 and resolved at a flow rate of 0.4 ml/min. As a control, 10-14 ug of JR-FL gpl20 was also analyzed in a similar manner.

KNHl 144 SOSIP R6 gpl40 SEC analysis: 8-10 ug of purified KNHl 144 SOSIP R6 gpl40 was treated with Tween® 20 at a final concentration of 0.05% for 10-30 minutes at room temperature. Treated samples were then applied over the Superdex 200 column equilibrated with TN-500 containing 0.05% Tween® 20 (TNT-500) and resolved at 0.4 ml/min, collecting 0.4 ml fractions. Trimer-containing fractions were then analyzed by BN-PAGE, followed by silver stain. Fractions were also separated by BN-PAGE, followed by Western blot analysis with ARP 3119 antibody. Blue Native PAGE (BN-P AGE) and SDS-PAGE analysis:

All SDS-PAGE analysis (reduced and non-reduced) were performed using 4-12% Bis-Tris NuPage gels (Invitrogen). BN-PAGE analysis was performed as described (10). Silver stain analysis was performed with the SilverQuest kit (Invitrogen). Coomassie G-250 stain was performed using either the SimplyBlue SafeStain or Easy-to-Use Coomassie⁰⁰ G-250 Stain (Invitrogen).

Antigenicity Experiments - Lectin ELISA:

Human mAbs b6 (32), bl2 (33) and 2G12 (26), HIVIg (39) were obtained from Dr. Dennis Burton (The Scripps Research Institute, La Jolla, CA) or Dr. Herman Katinger (University of Natural Resources and Applied Life Sciences, Austria, Vienna). For the lectin based ELISA, anti-Env antibodies 2G12, b6, bl2 and HIVIg were used. In addition, the CD4-IgG2 antibody conjugate PRO 542 (38) was also used.

ELISA plates were coated overnight at 4°C with lentil lectin powder from Lens culinaris (L9267, Sigma) at 10 ug/ml concentration. Plates were washed with PBS twice and blocked with

SuperBlock (Pierce) (warmed to RT). Excess blocking agent was washed off with PBS. SEC fractions containing HMW aggregate were either untreated or treated with 0.05% Tween® 20 (v/v, final concentration) for 30 minutes at room temperature (RT) and were added at 0.3 ug/ml (diluted in PBS) and bound to the plates (via the lectin) for 4 hours at RT. Following binding, plates were washed 4 times with PBS and incubated with primary anti-Env antibodies starting at 10 ug/ml in

PBS/5% milk. 4x serial dilutions were performed and incubations were performed for 3 hours at

RT. Following antibody incubation, plates were washed 6 times and goat anti-human IgG (H+L) alkaline phosphatase conjugate secondary antibody (Jackson ImmunoResearch) was added at

1/4000 concentration in PBS/5% milk. Plates were washed 4 times and ELISAs were developed using the Ampak detection system (Dako Cytomation, Carpinteria, CA) as per the manufacturer's instructions.

DEAE anion exchange chromatography of Tween® 20-treated KNHl 144 SOSIP R6 gpl40 trimers: Purified KNHl 144 SOSIP R6 gpl40 trimers, treated either with or without 0.05% Tween® 20 (final), containing a₂M contaminant in TN-75 buffer was applied over 1 ml DEAE HiTrap FF column (equilibrated in TN-75) at 0.25 ml/min at RT and flow-through (FT) fractions were collected. Following sample loading, the column was washed with TN-75 at 0.5 ml/min and wash fractions were collected. Finally, the column was eluted with TN-300 and equal amounts from each fraction were analyzed via BN-PAGE, followed by coomassie G-250 stain.

Electron microscopy:

EM analysis of the SOSEP trimers was performed by negative stain as previously described (34,

35). Because this technique is incompatible with detergent, 20 μl of the original sample (0.5 mg/ml in TN-300) was dialyzed against BSB (0.1 M H₃BO₃, 0.025 M Na₂B₄O₇, 0.075 M NaCl, pH 8.3) and subsequently depleted of detergent using the Mini Detergent-OUT™ detergent removal kit (Calbiochem, La Jolla, CA) as described by the manufacturer. Two microliters of the resulting protein solution, diluted in 200 μl BSB, was affixed to carbon support membrane, stained with 1% uranyl formate, and mounted on 600 mesh copper grids for analysis. EMs were recorded at XlOO₁OOO at 100 kV on a JOEL JEM 1200 electron microscope. At least fifty or more trimers were measured and analyzed statistically using Image-Pro Plus software (mediacy.com).

RESULTS Expression and Purification of Trimeric KNHl 144 SOSIP R6 gpl40:

The purification of KNHl 144 SOSIP R6 gpl40 trimers typically involved three chromatography steps: GNA lectin affinity, Superdex 200 size exclusion and DEAE weak anion exchange. While the GNA lectin column was highly efficient in capture of the gpl40 trimer, elution of the protein under even extremely mild conditions, with the competing MMP eluant, caused significant de- stabilization of the trimer and resulted in marked dissociation of the trimer into dimer and monomer species. Superdex 200 SEC of the GNA eluate yielded trimers that were free of monomers, but not of dimers. To resolve trimers away from dimers (and residually co-migrating monomers), a DEAE anion exchange step was incorporated, which led to very efficient separation of dimer from trimer, thereby yielding pure trimers at the end of the purification protocol (Figure 7)

SDS-PAGE analysis under reducing conditions showed that the final preparation was of high purity, with only the gpl20 moeity visible on the reduced gel (Figure 7, left panel, center lane). Common serum contaminants that were detectable by reducing SDS-PAGE were α-2- macroglobulin (a₂M) and BSA, which typically comprised up to ~10% of the final preparation. The non-reduced gel shows intact gpl40 protein on SDS-PAGE (Figure 7, left panel, right lane). In addition, little to no disulfide-linked aggregate (typically revealed as migrating much slower on a non-reducing gel) was detected. This was confirmed by anti-envelope Western blot analysis on the non-reduced gel (Figure 7, Anti-Env blot, middle panel). BN-PAGE analysis of the purified trimer revealed the purified trimer to migrate between the 669k thyroglobulin and 440k ferritin marker proteins (Figure 7, right panel, SOSIP R6). This is consistent with the migration patterns for JR-FL SOSIP gpl40 which has been observed to migrate in the lower range of 669k and 44OkDa (9, 10, 11). An additional slower migrating band, typically classified as high molecular weight (HMW) SOSIP aggregates and comprising about 30% of the preparation, was also detected (Figure 7, right panel, SOSIP R6, - lane). Typical HMW aggregate content ranged from 10 to 40% of the final preparation prior to non-ionic detergent treatment. Treatment of the purified preparation with Tween® 20 at a final concentration of 0.05% converted the HMW aggregate species to trimers, yielding a homogenous trimer preparation (Figure 7, right panel, SOSIP R6, + lane)(19). It should be noted that treatment with Tween® 20 also caused the treated trimer to migrate slightly more rapidly than the untreated trimer (notice faster mobility of trimer in the + lane).

Purification of the monomelic protein yielded a homogenous preparation as evident by a single band when analyzed by reducing SDS-PAGE (Figure 7, left panel, left lane) and Superdex 200 SEC (see Figures 13 and 14). BN-PAGE analysis of the purified monomer, either in the presence or absence of Tween® 20 revealed a single migrating monomelic gpl20 species, devoid of any higher order oligomers, consistent with its purity on SDS-PAGE (Figure 7, right panel, gpl20-/+ lanes/

Since Tween® 20 provided a simple and mild means to obtain homogenous trimers, further characterization of the non-ionic detergent effect was performed. A purified trimer preparation containing ~30% aggregates (e.g., monomer, dimmer and trimer) was treated with Tween® 20 at final concentrations of 0.0001% to 0.1% (v/v) (Figure 8A). The SOSIP R6 aggregates were converted to trimers at concentrations of 0.1% to 0.01% (Figure 8 A, lanes 3-5). No conversion was observed at Tween® 20 concentrations of 0.001 and 0.0001% (Figure 8A, lanes 6 and 7). Close examination of the 0.01% reaction (lane 5) revealed that traces of aggregate were present, thus indicating that 0.01% Tween® 20 is probably the threshold concentration. To study the kinetics of the conversion, trimer preparations containing ~30% aggregate were incubated with Tween® 20 for 0, 5 and 10 minutes prior to analysis by BN-PAGE. As shown in Figure 8B, both the 5 minute and 10 minute incubations completely eliminated the aggregate.

The effect of temperature on aggregate rearrangement was also examined. Aggregate/trimer preparations were incubated with Tween® 20 either at O⁰C (on ice), room temperature (22-23°C), or 37⁰C. As shown in Figure 8C, conversion of aggregate to trimer occurred at all 3 temperatures, indicating that the Tween® 20 effect on aggregate was independent of temperature over this range. Similar results were obtained when Tween® 80 was used instead of Tween® 20.

Similar Tween® 20 treatment of the gpl20 monomer showed that there was no difference observed in its migratory pattern either in the presence or absence of Tween® 20, indicating that Tween® 20 did not affect the gpl20 monomer (Figure 7, right panel, gpl20, -/+ lanes). In some cases, a mild increase in the staining intensity of the gpl20 monomer occurred.

To test if the detergent had a collapsive effect on another large multi-subunit protein, α-2- macroglobulin (α₂M), which is an acidic 726 kDa tetrameric glycoprotein comprised of four identical 185 kDa subunits, was incubated with Tween® 20. No change was observed in the migratory pattern of α₂M in the presence of Tween® 20, although there was a slight increase in the staining intensity of the protein (see Figures 13 and 14). To examine whether Tween® 20 could convert preparations containing predominantly aggregate as the major oligomeric species to resulting trimers, a KNHl 144 SOSIP R6 preparation containing > 80% HMW aggregate was incubated with Tween® 20 and analyzed by BN-PAGE. As shown in Figure 8D, Tween® 20 was effective in converting the aggregate rich fraction to trimer (Figure 8D, left panel). Fractions of less purity containing HMW aggregate, dimers and monomers (Figure 8D, right panel, - lane, each species denoted by arrows), when treated with Tween® 20 also resulted in collapse of HMW aggregate to resulting trimer (Figure 8D, right panel, + lane). However, no effect on dimer or monomer migration was observed (Figure 8D, right panel, + lane, arrows), indicating that the Tween® 20 action was specific to KNHl 144 SOSIP R6 HMW aggregate and trimer. Consistent with previous observations, some increase in monomer staining was observed. Thus, these results indicate that Tween® 20 efficiently converts the KNH 1144 SOSIP HMW aggregate into trimeric form. According to this invention, Tween® 20 efficiently converted into trimers HMW preparations having greater than 10%, (e.g., greater than 10-40%), aggregate. Greater than 95-99%, or 100%, trimers were able to be recovered from Tween® 20- treated HNW aggregates.

SEC Analysis of KNHl 144 gpl20 monomer and SOSIP R6 gpl40 trimer:

Size exclusion chromatography (SEC) analysis was performed as a second means to characterize the molecular sizes of KNHl 144 gpl20 monomer and SOSEP R6 gpl40 trimer proteins. A Superdex 200 size exclusion column was calibrated with thyroglobulin (669 kDa), ferritin (440 kDa), BSA (67 kDa) and RNAse A (13.7 kDa) as molecular weight standards. In addition, monomelic JR-FL gpl20 was also analyzed as a control. KNHl 144 gp 120 and JR-FL gpl20 were each found to migrate at an apparent molecular weight of 210 kDa (see Figures 13 and 14). These values are consistent with those found for JR-FL gpl20 (10).

To further study the oligomeric nature of the KNHl 144 SOSIP R6 gpl40 trimer, final purified preparations were treated with Tween® 20 prior to analysis on Superdex 200 SEC to yield homogenous and unambiguous trimer samples devoid of HMW aggregate. Initial studies showed re-formation of HMW aggregate when treated trimer samples were resolved in non-detergent TN- 500 buffer on the SEC column. The resulting mixed trimer-aggregate fractions, presumably reformed upon separation of the Tween® 20 from the gpl40 oligomers in non-detergent buffer, was considered unsuitable for SEC analysis due to its heterogeneous nature.

In order to maintain homogenous trimers, treated trimer was resolved in the presence of TN-500 containing 0.05% Tween® 20 (TNT-500). As shown in Figure 9, {bottom panel BN-PAGE), the trimer {thick arrow) migrated from fractions BlO through C2, represented in the major peak, with its peak signal at fraction Bl 2 {vertical arrow). The retention time at this fraction corresponds to an apparent calculated molecular weight of ~518 kDa. The reported apparent molecular weight (MW) of JR-FL SOSIP gpl40 trimer calculated via Superdex 200 SEC analysis is -520 kDa (9); and thus, the calculated apparent MW value for KNHl 144 SOSIP R6 gpl40 trimer is consistent with MW values of other SOSIP envelope trimers.

Effect ofTween® 20 Treatment on KNHl 144 SOSIP R6 Antigenicity: Studies of the antigenic properties of unpurified KNHl 144 SOSIP R6 gpl40 (19) showed that it was immunoprecipitated by the neutralizing molecules 2G12, bl2, CD4-IgG2, as well as the non- neutralizing mAb b6. The present experiments further assessed the effect of the Tween® 20 aggregate collapse on the antigenic properties of KNHl 144 SOSIP HMW aggregates to determine if conversion of HMW aggregate into trimer favorably enhanced antigenicity.

SEC fractions containing > 80% KNHl 144 SOSIP R6 HMW aggregate content (as shown in Figure 8D, - lane) were either untreated or Tween® 20 treated (typical reaction is represented in Figure 8D). The antigenicity of the proteins in the presence and absence of Tween® 20 was examined using a lectin based ELISA. These results are shown in Figure 1OA. All the anti-env antibodies and CD4-IgG2, displayed increased binding to the Tween® 20 treated aggregate. The above experiments were performed on Tween® 20 converted trimer, using preparations containing > 80% HMW aggregate.

To demonstrate that Tween® 20 treatment did not unfavorably disrupt the above antibody epitopes on trimers, similar lectin ELISAs were performed using 2G12, b6, bl2 and CD4-IgG2 on SOSIP R6 gpl40 trimers that contained low amounts of HMW aggregate (~ 10-15% content) that were either untreated or treated with Tween® 20. As shown in Figure 1OB, no significant differences were observed in the antigenicity of trimer in presence or absence of Tween® 20. Unfortunately, since the HMW aggregate species is present in very limiting quantities, the Tween® 20 phenomenon was assessed using only the above mentioned mAbs. These results show that Tween® 20 treatment and consequential conversion of HMW aggregate to resulting trimer enhances epitope exposure for Env binding antibodies. Thus, Tween® 20 treatment and presence may offer favorable consequences in the context of KNHl 144 SOSIP R6 gpl40 trimer stability and antibody epitope exposure.

Effect ofTween® 20 Treatment on the Ionic Properties of KNHl 144 SOSIP R6 gpl40 trimer: DEAE anion exchange chromatography was used to examine the effect ofTween® 20 on the ionic properties of SOSIP R6 gpl40 and control proteins. Untreated or Tween® 20 treated KNHl 144 SOSIP R6 gpl40 trimer spiked with a₂M contaminating protein (which is unaffected by Tween® 20 and binds to anion exchange resins) was applied over DEAE anion exchange column (Figure 11 , Load). The column was washed and eluted and fractions were analyzed via BN-PAGE and Coomassie staining as shown in Figure 11.

As expected, untreated SOSEP R6 gpl40 trimer and the a₂M contaminant bound to the DEAE column and were recovered in the elution fraction (Figure 11, Untreated control, top panel, denoted by asterisks). However, upon treatment with Tween® 20 and re-application to the DEAE column, the KNHl 144 SOSIP R6 gpl40 trimer was found in the flow-through (FT) fractions of the column (Figure 11 , Tween® 20 treated, bottom panel, FT, denoted by asterisks), indicating that it did not bind to the DEAE, unlike the untreated trimer. Residual trimer was further recovered in the wash fraction (Figure 11 , Wash). In contrast, the a₂M contaminant, which was used as the internal control, bound to the DEAE column and was recovered in the elution, indicating that it was unaffected by the presence of Tween® 20 (Figure 11 , Tween® 20 treated, bottom panel, Elution).

hi other similar experiments, in which BSA, another acidic protein was substituted as the contaminant, similar results were obtained. This indicates that Tween® 20 treatment may exert its action on KNHl 144 SOSIP R6 HMW aggregate and trimer through a combination of hydrophobic interactions that possibly involve perturbations in inter- and/or intra-subunit charge-charge interactions, as examined by DEAE anion exchange chromatography.

Electron Microscopy and Digital Imaging of KNHl 144 SOSIP R6 gpl40 trimers: Electron microscopy was performed on purified SOSIP R6 preparations employing negative stain EM analysis. The results, shown in Figure 12, reveal that the majority of the observed structures displayed a regular compact morphology with approximate three-fold symmetry. This tri-lobed configuration is most apparent in preparations with deeper stain (Figure 12; panel of trimers) that are less subject to the flattening that can occur in thinner staining preparations.

hi order to calculate diameters of the trimers, 70 spikes in the shallow stain samples were scored and a diameter of 13.5 ± 1.73 nm was calculated. Seventy eight (78) trimers from the deep stain were scored and resulted in a diameter of 11.6 nm ± 1.75 nm. The shallow stain preparation likely gives a slight overestimation of the size and the deep stain preparation gives a slightly underestimated size. Therefore, the true size is likely to be 12.6 ± 1.74 nm and in line with authentic Env spikes measured in situ on both negatively stained, as well as unstained, cryo-EM preparations of SIV (36). Thus the biophysical EM analysis of KNHl 144 SOSIP R6 gpl40 is in good agreement with the above biochemical data and confirms the oligomeric status of the purified

KNHl 144 env complex as being trimeric.

DISCUSSION hi the context of identifying and pursuing a variety of HIV-I ϋwv-based protein vaccines, described herein is the purification and characterizion of a novel subtype A KNH 1144 trimeric envelope spike protein and its properties. Several novel insights were gained as a result of these studies, which revealed the biochemical effects of Tween® 20 on the oligomeric conformations of the KNHl 144 SOSIP R6 proteins. Until the present invention, only one subtype B envelope, HIV- 1 JR-FL has been manipulated to a purified form to mimic as closely as possible the native trimeric structure of the HTV-I viral surface envelope complex via the SOSIP technology (8-11, 15-17). The present invention provides another clade, clade A KNHl 144, for which the SOSIP technology results in purified trimeric envelopes that are stable, soluble, and fully cleaved.

The purification process implemented according to the present invention for the KNHl 144 SOSIP trimers provides a marked improvement over that utilized for JR-FL SOSIP gpl40 trimers. For the KNHl 144 SOSIP, the GNA lectin column provided a significant enrichment of gpl40 proteins, but elution off the column significantly destabilized the gpl40 trimers, resulting in a compromise of trimer fidelity on the column. As a result, significant dissociation of the trimer to resulting dimer and monomer was noticed. This destabilization could be brought about from Galanthus Nivalis lectin binding to αl-3 and αl-6 mannose linkages on the gpl40 high mannose chains, which are internal linkages and not terminal linkages (20). During elution, the affinity of the lectin for the mannan is likely much higher than the intersubunit protein-protein affinities of the 3 gpl20- gp4l_Ecτo monomers contributing to trimer formation, resulting in destabilization and dissociation into component dimers and monomers. To alleviate some measure of the destabilization that could be caused due to resulting sheer stresses during elution, a one hour incubation in MMP eluting buffer was included. So while a highly enriching step, the lectin affinity column also decreased the final yield of trimer significantly, due to its dissociation during the elution phase.

The next step in the purification, Superdex 200 SEC, while somewhat efficient in resolving away monomer, was not very effective in resolution of dimer from trimer. The incorporation of a DEAE weak anion exchange chromatography step was very efficient in resolving dimer (and residual monomer) away from trimer, resulting in trimeric KNHl 144 SOSIP R6 gpl40 of high purity. Notably, binding (and retention) of the trimer occurred under a relatively polar environment (vis-ά- vis ion exchange) at 75 mM NaCl, while dimer and monomer flowed through the DEAE column under these conditions.

It is relevant to extrapolate from its behavior on anion exchange chromatography that the nature of the KNHl 144 SOSIP R6 gl40 trimer is that of an acidic protein, which would be contrary to its predicted basic isoelectric point (pi) of 8.73 calculated for the protein backbone. However, the likely presence of the predicted acidic sialylated complex oligosaccharide chains on the gpl40 (21,

22) would contribute to a decrease in the overall charge of the glycoprotein and thus confer on it properties of an acidic protein. Indeed, analysis of purified KNHl 144 SOSIP R6 gpl40 trimers on isoelectric focusing gels reveal it to migrate at a pi range of 5.9 to 6.1, consistent with the above observations.

The purified trimer was shown to contain variable amounts of HMW aggregate (Figure 7, right panel, BN-PAGE), which could not be attributed to being formed at any one particular step of the purification, although one possibility might be at the lectin elution step. As mentioned before, one of the key improvements made in this purification protocol is absence of SDS-insoluble aggregates in the final prep, which are formed by abberantly formed disulfide bonds and are visualized by their slow migration on a non-reduced SDS-PAGE. As detected by Coomassie staining and confirmed by anti-envelope Western blot, little to no SDS-insoluble aggregates were observed (Figure 7, left and middle panels, Non-Red SDS-PAGE and Anti-Env blot). This is in contrast to what was observed with JR-FL SOSIP gpl40 (R6 and non-R6 versions), where SDS-insoluble aggregates comprised a significant percentage of the final preparations (9, 10, 11).

Based on observations regarding non-ionic detergent treatments of KNHl 144 SOSIP R6 gp140 tπmers (19), Tween® 20 was used to address the co-puπfying HMW aggregate present in the final tπmer preparations. Tween® 20 was chosen because initial observations had shown that Tween® 20 treatment was mild and did not result m any detectable monomer formation, unlike treatment with the other non-iomc detergents NP-40 and Tπton X-IOO, where dimers and monomers were observed upon treatment (19). Tween® 20 treatment of the final purified KNHl 144 SOSIP R6 trimer preparation was highly reproducible and resulted in the "conversion" of the HMW aggregate species, as shown in Figure 7 {right panel, BN-PAGE). Since this resulted in a single, homogenous, oligomeric species of KNH 1144 SOSIP R6 gpl40 tπmers, the final step was routinely incorporated in the preparations. Further analysis using reduced SDS-PAGE gels showed that the purified trimer was fully cleaved, with practically undetectable uncleaved protein (as visualized by both Coomassie staining and Western blot analysis) (Figure 7, left panel, Red SDS-PAGE). The initial purifications were performed using a non-R6 version of KNHl 144 SOSIP gpl40, which resulted in ~40-50% of uncleaved protein in the final preparation, prompting the development of the R6 version. This also represents another improvement over JR-FL SOSIP R6 gpl40 tnmers, where cleavage of gpl20-gp41_Ecτo was not as efficient (9, 11).

In order to expand the initial Tween® 20 observations to the stability of HMW aggregates, a variety of experiments were performed to characteπze the effect of Tween® 20 and to better understand its mechanism of action. As shown in Figure 8, the effect of Tween® 20 is dose dependent, time dependent and temperature independent within the parameters that were examined. Its effect is remarkably specific to KNHl 144 SOSIP R6 HMW aggregate and trimers and has no effect on gpl20 monomers, or KNHl 144 SOSIP R6 dimers. In addition, other similar large, macromolecular, acidic proteins such as a₂M are not affected by the detergent. Initially, the hypothesis was that the Tween® 20 specifically interacted with points of gpl20-gp41_ECTo intersubunit contact within the HMW aggregate, presumably in a hydrophobic manner. In this context, the HMW aggregate would have to be compnsed of some multiple of trimer (most likely a dimer of tπmers), since detergent treatment specifically results in a "rearrangement" to a trimeric configuration. The specificity of this reaction can further be defined by the observation that dimenc KNHl 144 SOSIP R6 gpl40 proteins are unaffected and do not undergo the collapse (Figure 8D). In addition, Tween® 20 treatment would also seem to cause the trimer to assume a more compact configuration, as evident by its slightly more rapid mobility on BN-PAGE (Figure 7).

While the anti-flocculatory effects of non-ionic detergents on aggregates of macromolecular proteins such as antibodies (immunoglobulins, for example) are well known and documented, the mechanisms of their actions have been realized to be largely by pre-emption of unfavorable hydrophobic interactions by detergent intercalation. Tween® 20, however, would seem to exert its action in a somewhat paradoxical mechanism, since treatment of the KNH 1144 SOSIP R6 gpl40 trimer with the detergent renders it unable to interact with anion exchange resins such as DEAE (Figure 11, bottom panel, Tween® 20 treated), indicating that the overall charge of the trimer was being affected by the detergent.

Since the nature of non-ionic detergents is exactly that, i.e., non-ionic, it is difficult to realize how an uncharged molecule such as Tween® 20 would affect the charge status of a large, macromolecular oligomer such as the KNHl 144 SOSIP R6 trimer. Furthermore, this effect is highly specific to the trimer, as other such large, highly charged (acidic) oligomeric proteins such as a₂M and even smaller ones such as BSA are unaffected by the detergent. One hypothesis that has emerged from this invention is that perhaps the Tween® 20 was "coating" the trimer in a manner that may cause perturbations in its conformation, resulting in its "compactness". These perturbations would be of a subtle nature which involve the various points of contact between the individual component gpl40 monomers, causing disruption and destabilization of interactions that favor the HMW aggregate conformation. A consequence of these perturbations would be "shielding" of ionic charges that would normally be exposed (and contribute to binding to ion exchange resins). It is reasonable to speculate that perhaps the charges that are "shielded" are those on the sialic acid residues of the complex carbohydrate chains, since these would be most likely to be highly exposed at the surface (21, 22). Tween® 20 and Tween® 80 are polyoxyethylene sorbitan esters of fatty acids and thus may likely interact with the sialic acids, causing a charge "neutralization" effect. The involvement of the sialic acid residues can be investigated by mild sialidase treatment (21, 22) and removal of these residues, followed by Tween® 20 treatment, followed by monitoring of binding on ion exchange resins.

To further biochemically characterize the purified KNH 1144 monomelic and trimeric envelope proteins, size exclusion chromatography analyses were performed in order to ascertain their apparent molecular masses. These were performed on Tween® 20 treated trimers that were devoid of any HMW aggregates and thus consisted of only one homogeneously oligomeric species, i.e., the trimer, and therefore would yield unambiguous results. The retention times of the KNHl 144 SOSIP R6 gpl40 trimer resulted in a calculated apparent molecular weight of -518 kDa. This is consistent with the reported calculated apparent molecular weight of 520 kDa for the other SOSIP gpl40 trimer, JR-FL SOSIP gpl40 (9). The predicted molecular weight for a trimer such as KNHl 144 (and JR-FL) would be -420 kDa (3 x 140 kDa monomers). Thus, similar to JR-FL SOSEP gpl40, the KNHl 144 SOSIP R6 gpl40 trimer also exhibits an abberant migration on SEC, presumably due to interactions of its N-linked glycans with the dextran- (agarose polymer) based matrix of Superdex 200, resulting in a higher than expected apparent molecular mass. In addition, envelope proteins have been shown to be non-globular in shape (10, 23, 24); therefore, gel filtration may not be optimal for determination of their precise molecular masses. This also extends to the KΝH1144 gpl20 monomer as well. Values of -210 kDa were obtained for KNHl 144 gpl20 and the control JR-FL gpl20 (see Figures 13 and 14). The reported value for JR- FL gpl20 is 200 kDa (10); accordingly, the obtained values are well within the expected range (given that molecular weight determination via SEC is not extremely accurate, unlike other methodologies such as mass spectrometry). Thus, gpl20, whose predicted molecular weight ranges from ~95 to ~ 120 kDa, results in an abberant migratory pattern on SEC, presumably due to its glycan interactions with the sizing column matrix. It should be noted that unlike the KNHl 144 SOSIP R6 gpl40 trimer, migration of KNHl 144 gp 120 (and JR-FL gpl20) were not affected by the presence or absence of Tween® 20, consistent with the initial BN-PAGE observations (Figure 7, right panel, gpl20).

While it would seem that the presence of Tween® 20 for KNHl 144 SOSIP R6 gpl40 proteins would be advantageous, possible Tween® 20 effects on the antigenicity of the HMW aggregate and trimer were examined. Effects on antigenicity was examined by performing lectin ELISAs with the NAbs 2G12, bl2, HIVIg, the CD4-IgG2 antibody conjugate PRO 542, as well as the non- neutralizing mAb b6, to gain information on neutralizing/non-neutralizing epitope exposure and accessibility. It was reasoned that trimer preparations containing 10-30% HMW aggregate may not undergo significant enough changes that would be detectable in a non-quantitative assay such as IPs, i.e., subtle changes (20-30% changes) may go undetected in such an assay due to sensititivity. However, samples representing extremes may undergo significantly high changes that should be detectable in an assay format such as ELISA. Therefore, SEC fractions that contained > 80% HMW aggregate were used, which would reflect one extreme prior to Tween® 20 treatment and the resulting trimer, which would reflect the other extreme post treatment. A representative reaction of this is illustrated in Figure 8D.

As shown in Figure 1OA, significant epitope exposures were observed upon Tween® 20 rearrangement of the HMW aggregate to trimer, and these changes were noticed for all of the anti- env agents. These changes indeed were not as apparent in trimer preparations that were predominantly trimer, with low aggregate content (10-15%) (Figure 10B). Thus the treated, purified trimer displays antigenic properties similar to that which was previously observed with crude, unpurifϊed trimer supematants, i.e., binding to 2G12, b6, bl2 and PRO 542 (19). In the context of HIVIg, which is a low neutralizing polyclonal human antisera directed against gpl20 hypervariable loop (39), it can be inferred that this epitope is accessible on the surface of the HMW aggregate, based on its ability to bind the antibody in absence of Tween® 20. Consistent with the other anti-Env agents examined here, HFVIg epitope exposure also significantly increased on the rearranged trimer, upon treatment with Tween® 20. The likely explanation to these increases in epitope exposure is that "disruption/rearrangement" of the aggregate and its subsequent conversion to trimer unshields the above mentioned surfaces and thus, upon conversion, these surfaces are now exposed on their individual trimers and are accessible to the antibodies. From the context of a single HMW aggregate which is likely to be a multimer of trimers, only a small portion of these epitopes are accessible, most probably due to steric hindrance from adjacently "clumped" SOSIP R6 trimers/oligomers. When the single HMW aggregate is then Tween® 20 converted to resulting trimers, antibody epitopes are now exposed on every one of the resulting individual component trimers, resulting in an increase in antibody accessibility and binding. Thus Tween® 20 treatment and its conversion of the aggregate to trimer do not seem to have detrimental effects on antigenicity and may be favorable to the structural properties of the KNHl 144 SOSIP R6 gpl40 proteins.

Analysis of KNHl 144 SOSIP R6 gpl40 proteins by negative stain EM further confirmed the biochemical observations that these gpl40 proteins were indeed trimeric in nature (Figure 12). A distinguishing feature of the KNH 1144 SOSIP R6 construct, in comparison to other similar constructs of trimerized gpl20 and gpl40, is its compact nature. Most other constructs show either predominantly loosely associated subunits or a mix of loosely and tightly associated subunits (5, 18, 37). The observation that the KNHl 144 SOSIP R6 trimer is compact is associated with anti-Env antibody epitope availability. EM on Tween®-treated trimer which has favorable anti-Env epitope exposure was performed. It is somewhat incongruous from a purely steric standpoint that a "compact" trimer would also have improved epitope exposure, a consequence expected from a "loose" or "elongated" structure. Immunoelectron microscopy analyses with the above mentioned antibodies will further address the exposure of epitopes on trimeric forms.

The present invention expands the panel of trimeric HTV-I envelope proteins that may be used as protein-based HIV-I vaccine candidates or serve as a template for future design of Env based protein vaccine candidates, using the SOSIP technology. Immunological studies in rabbits with JR-FL SOS IP R6 gpl40 trimers, while effective in eliciting NAbs, were limited in their breadth of neutralization of primary HIV-I isolates (11). Factors associated with the biochemical nature of the JR-FL SOSrP gpl40 and other oligomeric Env proteins that are thought to limit their observed immunological response in animals, such as inefficient furin cleavage of the gpl20-gp41_ECτo cleavage site giving rise to heterogenous trimers (containing both cleaved and uncleaved trimers), presence of SDS-insoluble aggregates and presence of undesirable gpl40 oligomers such as dimers and monomers (5, 6, 9, 10, 11, 27-30) have been issues needing resolution.

The description of the KNHl 144 SOSIP R6 gpl40 trimers of the present invention addresses most of these issues. Furthermore, the description of the Tween® 20 affects on coverting HMW aggregates to trimeric forms further expands on current knowledge of the aggregate species in HIV-I biology. Of significance, it was shown for the first time, that oligomeric Env protein complexes designed using the SOSIP technology platform are indeed trimeric from EM images and that the trimers are of a similar diameter as native spikes on the HIV-I virion (36). Expansion of the panel of potential HIV-I SOSIP protein vaccine candidates by development of a clade A envelope according to this invention now allows for immunological evaluation of the KNHl 144 SOSIP R6 gpl40 trimer in small animals, for example. Such evaluations will assist in determining the efficacy of KNH 1144 SOSIP R6 gpl40 trimers as immunogens capable of eliciting broadly neutralizing immune responses directed against HIV-I .

REFERENCES FOR EXPERIMENTAL DETAILS II

1. UNAIDS: AIDS Epidemic Update: December 2005, ISBN 92 9 173439 X.

2. Kijak, G. H., and McCutchan, F. E. (2005) Curr Infect Dis Rep. 7, 480-488. 3. Jeffs, S. A., Goriup, S., Kebble, B., Crane, D., Bolgiano, B., Sattentau, Q., Jones, S., and

Holmes, H. (2004) Vaccine. 22, 1032-1046. 4. Srivastava, I. K., Stamatatos, L., Legg, H., Kan, E., Fong, A., Coates, S. R., Leung, L.,

Wininger, M., Donnelly, J. J., Ulmer, J. B., and Barnett, S. W. (2002) J Virol. 76, 2835-

2847. 5. Srivastava, I. K., Stamatatos, L., Kan, E., Vajdy, M., Lian, Y., Hilt, S., Martin, L., Vita,

C, Zhu, P., Roux, K. H., Vojtech, L., Montefiori, D. C, Donnelly, J., Ulmer, J. B., and

Barnett, S. W. (2003) J Virol. 77, 11244-11259. 6. Yang, X., Florin, L., Farzan, M., Kolchinsky, P., Kwong, P. D., Sodroski, J., and Wyatt, R.

(2000) J Virol. 74, 4746-4754. 7. Grundner, C, Li, Y., Louder, M., Mascola, J., Yang, X., Sodroski, J., and Wyatt R. (2005)

Virology 331, 33-46.

8. Binley, J. M., Sanders, R. W., Clas, B., Schuelke, N., Master, A., Guo, Y., Kajumo, F., Anselma, D. J., Maddon, P. J., Olson, W. C, and Moore, J. P. (2000) J Virol. 74, 627-643.

9. Sanders, R. W., Vesanen, M., Schuelke, N., Master, A., Schiffner, L., Kalyanaraman, R., Berkhout, B., Maddon, P. J., Olson, W. C, Lu, M., and Moore, J. P. (2002; J Virol. 76,

8875-8889.

10. Schulke, N., Vesanen, M. S., Sanders, R. W., Zhu, P., Lu, M., Anselma, D. J., Villa, A. R., Parren, P. W., Binley, J. M., Roux, K. H., Maddon, P. J., Moore, J. P., and Olson, W. C.

(2002) J Virol. 76, 7760-7776. 11. Beddows, S., Schulke, N., Kirschner, M., Barnes, K., Franti, M., Michael, E., Ketas, T., Sanders, R. W., Maddon, P. J., Olson, W. C, and Moore, J. P. (2005) J Virol. 79, 8812- 8827.

12. Emini, E. A. and Koff, W. C. (2004) Science 304, 1913-1914.

13. Poignard, P., Saphire, E. O., Parren, P. W., and Burton, D. R. (2001) Annu Rev Immunol. 19, 253-274.

14. Wyatt, R., and Sodroski, J. (1998) Science 280, 1884-1888.

15. Sanders, R. W., Schiffner, L., Master, A., Kajumo, F., Guo, Y., Dragic, T., Moore, J. P., and Binley, J. M. (2000) J Virol. 74, 5091-5100.

16. Binley, J. M., Sanders, R. W., Master, A., Cayanan, C. S., Wiley, C. L., Schiffner, L., Travis, B., Kuhmann, S., Burton, D. R., Hu, S. L., Olson, W. C, and Moore, J. P. (2002) J

Virol. 76, 2606-2616.

17. Binley, J. M., Cayanan, C. S., Wiley, C, Schulke, N., Olson, W. C, and Burton, D. R.

(2003) J Virol. 11, 5678-5684.

18. Pancera, M., Lebowitz, J., Schon, A., Zhu, P., Freire, E., Kwong, P. D., Roux, K. H., Sodroski, J., and Wyatt, R. (2005) J Virol. 79, 9954-9969.

19. Beddows, S., Kirschner, M., Campbell-Gardener, L., Franti, M., Dey, A, K., Iyer, S, N., Paluch, M., Master, A., Overbaugh, J., VanCott, T., Olson, W. C, and Moore, J. P. (2006) AIDS Res Hum Retroviruses (in press).

20. Botos, L, and Wlodawer, A. (2005) Prog Biophys MoI Biol. 88, 233-282.

21. Scanlan, C. N., Pantophlet, R., Wormald, M. R., Ollmann, Saphire, E., Stanfield, R., Wilson, I. A., Katinger, H., Dwek, R. A., Rudd, P. M., and Burton, D. R. (2002) J Virol. 76, 7306-7321.

22. Sanders, R. W., Venturi, M., Schiffher, L., Kalyanaraman, R., Katinger, H., Lloyd, K. O., Kwong, P. D., and Moore, J. P. (2002) J Virol. 76, 7293-7305.

23. Center, R. J., Earl, P. L., Lebowitz, J., Schuck, P., and Moss, B. (2000) J Virol. 74, 4448- 4455. 24. Center, R. J., Schuck, P., Leapman, R. D., Arthur, L. O., Earl, P. L., Moss, B., and

Lebowitz, J. (2001) Proc Natl Acad Sci USA. 98, 14877-14882. 25. Trkola, A., Pomales, A. B., Yuan, H., Korber, B., Maddon, P. J., Allaway, G. P.,

Katinger,H., Barbas, C. F. 3rd, Burton, D. R., Ho, D. D., and Moore, J. P. (1995) J Virol.

69, 6609-6617. 26. Trkola, A., Purtscher, M., Muster, T., Ballaun, C, Buchacher, A., Sullivan, N., Srinivasan,

K., Sodroski, J., Moore, J. P., and Katinger, H. ( 1996) J Virol. 70, 1100- 1108.

27. Center, R. J., Lebowitz, J., Leapman, R. D., and Moss, B. (2004) J Virol. 78, 2265-2276.

28. Chakrabarti, B. K., Kong, W. P., Wu, B. Y., Yang, Z. Y., Friborg, J., Ling, X., King, S. R., Montefiori, D. C, and Nabel, G. J. (2002) J Virol. 76, 5357-5368. 29. Zhang, C. W., Chishti, Y., Hussey, R. E., and Reinherz, E. L. (2001) J Biol Chem. 276, 39577-39585.

30. Yang, X., Lee, J., Mahony, E. M., Kwong, P. D., Wyatt, R., and Sodroski, J. (2002) J Virol. 76, 4634-4642.

31. Lian, Y., Srivastava, I., Gomez-Roman, V. R., Zur Megede, J., Sun, Y., Kan, E., Hilt, S., Engelbrecht, S., Himathongkham, S., Luciw, P. A., Otten, G., Ulmer, J. B., Donnelly, J. J.,

Rabussay, D., Montefiori, D., van Rensburg, E. J., and Barnett, S. W. (2005) J Virol. 79, 13338-13349.

32. Roben, P., Moore, J. P., Thali, M., Sodroski, J., Barbas, C. F. 3rd., and Burton, D. R. (1994) J Virol. 68, 4821-4828. 33. Burton, D. R., Pyati, J., Koduri, R., Sharp, S. J., Thornton, G. B., Parren, P. W. H. L, Sawyer, L. S. W., Hendry, R. M., Dunlop, N., Nara, P. L., Lamacchia, M., Garratty, G., Stiehm, E. R., Bryson, Y. J., Cao, Y., Moore, J. P., Ho, D. D., and Barbas, C. F. 3rd. (1994) Science 266, 1024-1027. 34. Roux, K. H. (1989) Methods Enzymol. 178, 130-144. 35. Roux, K. H. (1996) Methods 10, 247-256.

36. Zhu, P., Chertova, E., Bess, J., Jr., Lifson, J. D., Arthur, L. O., Liu, J., Taylor, K. A., and Roux, K. H. (2003) Proc Natl Acad Sci USA. 100, 15812-15817.

37. Qiao, Z. S., Kim, M., Reinhold, B., Montefiori, D., Wang, J. H., and Reinherz, E. L. (2005) J Biol Chem. 280, 23138-23146. 38. Olson, W. C, and Maddon, P. J. (2003) Curr Drug Targets Infect Disord. 3, 255-262.

39. Cummins, L. M., Weinhold, K. J., Matthews, T. J., Langlois, A. J., Perno, C. F., Condie, R. M., and Allain, J. P. (1991) Blood 77, 1111-1117.

EXPERIMENTAL DETAILS III

Purification of SOSIP Env Trimers:

An efficient purification process was developed to purify SOSIP Env trimers and to increase the yield of trimers. This process is exemplified by using a preparation, e.g., a cell culture fluid containing KNHl 144.R6 SOSIP proteins, to purify KNHl 144.R6 SOSIP trimers.

hi this process, concentrated cell culture fluid (CCF) preparation containing KNHl 144 SOSIP.R6 gpl40 trimers, dimers and monomers was subjected to ammonium sulfate precipitation at 4°C to remove contaminant proteins, e.g. macroglobulin. The resulting supernatant was applied to a lectin (Galanthus Nivalis Lectin (GNL) Vector Laboratories Burlingame, CA) chromatography column (e.g., GEHC (GE Healthcare XK), at 4°C. A linear gradient elution was used and bound proteins were eluted to PBS, pH 7.25, 1. 0 M methyl-a-D-mannopyranoside (MMP) in ten column volumes (CV) followed by 5 CV at 100% PBS, pH 7.25 +1.0 M MMP. Fraction size was 0.5 CV and about 30 fractions were collected. Macroglobulin and monomer eluted first and were essentially removed from the trimer product. Column fractions were analyzed by gel electrophoresis (BN-PAGE) and the fractions enriched in trimer were pooled based on the gel analysis.

The trimer-containing eluted fractions from the lectin chromatography column were applied to a first DEAE sepharose column (DEAE 1 ) in the absence of Tween 20®. A 5-ml HiTrap DEAE FF sepharose column (GE Healthcare/Amersham Biosciences Piscataway, NJ) was used in this step. The DEAE 1 chromatography was performed at room temperature. The column equilibration buffer comprised 20 mM Tris, 0.075 M NaCl, pH 8.0, and the column equilibration flow rate was 10 ml/min. The column loading and elution flow rate was 2.5 ml/min with a fraction size of 2.5 ml. The high flow rate allowed this step to be completed in a short amount of time. The KNH 1144. R6 gpl40 trimer product was eluted from DEAE 1 in several fractions through a linear gradient to 20 mM Tris, 0.3 M NaCl, pH 8.0 in ten column volumes (10 CV). KNHl 144 SOSIP.R6 gpl40 monomers and dimers were removed in the flow through and wash step using 20 mM Tris, 75 mM NaCl (pH 7.5) at room temperature.

A second Hi-Trap DEAE FF sepharose column (DEAE 2) was equilibrated with buffer containing Tween 20® (20 mM Tris, 75 mM NaCl, 0.05% Tween, pH 8.0). The DEAE 2 chromatography was also performed at room temperature. The DEAE 1 elution fractions containing KNHl 144 SOSIP.R6 trimers in buffer also containing Tween 20® was applied to the second DEAE column. The KNH 1144 SOSIP.R6 trimer product was obtained in the flow-though and in the wash pool, since KNHl 144 SOSIP. R6 trimer did not bind to the DEAE column in the presence of Tween 20® in the buffer. A suitable range of Tween 20® for purification of the SOSIP.R6 trimers is 0.025% to 1%. 0.05% Tween 20® was used in many purification runs.

In this example, a high quality KNHl 144 SOSIP.R6 trimer product was purified as shown in Figures 25A and 25B. Only a single band was observed in the BN-PAGE analysis (Fig. 25A). SDS-PAGE analysis demonstrated that there was no uncleaved gpl40 in the product (Fig. 25B). A high purity trimer product was obtained using the above-described process compared with other purification methods, as shown in Figures 26. The immunogenicity of the KNH 1144 SOSIP.R6 trimer product was also tested by immunoprecipitation (IP) experiments, e.g., as shown in Figure 13 using ARP 3119 probing antibody (also known as CAl 3) (MRC Centralized Facility for AIDS reagents, NIBSC, UK). 2G12, bl2, b6, and 15e are HIV neutralizing antibodies used in the IP experiment. PRO542 is a CD4-IgG2 heterotetrameric protein. 75 ug KNHl 144 SOSIP.R6 trimer was purified using this purification method from 1 liter (IL) of cell culture fluid (CCF). At least 50ug of trimer product was recovered from IL of CCF using the purification method described in this example. The resulting purified and enriched trimer product was free from aggregates, monomers and dimers. Monomer content was less than 5% based on BN-PAGE/silver stain gel analysis.

EXPERIMENTAL DETAILS IV

The HIV-I envelope glycoprotein gpl20 can signal via several cell surface receptors (CD4, CCR5, CXCR4, C-type lectin receptors) present on various target cells, including dendritic cells. Such interactions may influence how immune responses to gpl20 and other viral antigens develop during the initial phases of an immune response to an Env-containing vaccine or the infecting virus. The interactions of different gpl20 proteins with human, monocyte-derived dendritic cells (MDDC) were studied in vitro, and it was then investigated how the gpl20-exposed MDDC affect the proliferation and polarization of CD4+ T-cells in co-culture assays. Additionally, in studies as described below, mice were immunized with gpl20 proteins modified by demannosylation to prevent a critical receptor interaction identified by the in vitro studies, to see whether this affected the development of immune responses to gpl20.

MATERIALS AND METHODS

Experiments were designed to evaluate the in vivo immunogenicity of demannosylated gpl20 in the presence of two different adjuvants, QuilA or Alhydrogel. For these experiments, the immunogens used included JR-FL gpl20 (lmg/ml), JR-FL gpl20 mock-treated (60μg/ml), demannosylated JR-FL gpl20 (60μg/ml), control α-1, 2,3,6 mannosidase (Prozyme cat# GKX- 5010, San Leandro, CA; at 6μg/ml) and vehicle control (1 :1 WFLDPBS-). The adjuvants used included Quil A (Brenntag Biosector A/S via Accurate Chemical, lmg/ml in DPBS-) or Alhydrogel (Brenntag Biosector A/S Accurate Chemical, 6.5mg Al/ml).

The experimental design to evaluate demannosylated gpl20 as immungen in vivo is shown in Table 1 and was as follows: Five (5) female BALB/c mice per cage (age ~8-9 wks at start of study) were immunized. Pre-bleeds and microchip implants were carried out prior to the start of the study. Bleeds were done prior to animals' receiving the initial dose of immunogen (baseline) and 12-13 days following each dose. All doses of immunogen were formulated at the start of the study and stored at -80⁰C until use. Quil A adjuvant was added during formulation, while Alum adjuvant was added on the day of injection of immunogen. Each animal received either 10μg of Quil A or 250μg of Alhydrogel per dose of immunogen. Each relevant experimental group received 5μg of gpl20 immunogen. Groups 4 and 8 received an amount of mannosidase enzyme (~0.5μg) that corresponded to the amount received by Groups 3 and 7. The injection site was cleansed with a new alcohol pad for each animal immediately prior to injection. Animals were injected using a Becton Dickinson (BD) 3/1 Occ Micro-Fine™ IV Needle Insulin syringes (cat# 328430). Syringes were filled with immunogen (or vehicle) to dose a single animal and were not re-used. The doses were administered subcutaneously (sc) in the groin area (130μl/dose/animal). Immunized animals were placed into a cage with clean bedding following injection.

Table 1

Group Immunogen Adjuvant Week Week Week Week 0 2 4 6

gpl20 Dose l Dose 2 Dose 3 Sacrifice gpl20 mock-treated IQuil A Dose 1 Dose 2 Dose 3 Sacrifice gpl20 mannosidase-treated ;QMX Dose 1 Dose 2 Dose 3 Sacrifice

Mannosidase only QuilJΪ Dose l Dose 2 Dose 3 Sacrifice

Vehicle QuiljAμ:: Dose 1 Dose 2 Dose 3 Sacrifice gpl20 Ahtttu Dose 1 Dose 2 Dose 3 Sacrifice gp!20 mock-treated Dose 1 Dose 2 Dose 3 Sacrifice gpl20 mannosidase-treated ;Atam Dose 1 Dose 2 Dose 3 Sacrifice

Mannosidase only AIitnit Dose l Dose 2 Dose 3 Sacrifice

10 Vehicle kAlumf Dose 1 Dose 2 Dose 3 Sacrifice

The criteria to evaluate responses included serum analysis by gpl20 titer ELISA. Splenocytes 10 were frozen for future analysis.

RESULTS AND DISCUSSION:

JR-FL gpl20 binding induced the expression of the immunosuppressive cytokine IL-10 in MDDC from ~50% of donors, via a mannose C-type lectin receptor(s) (MCLR). The mannose-binding

15 protein cyanovirin-N and MAb 2Gl 2 to a mannose-dependent gpl20 epitope inhibited IL-10 expression, as did enzymatic removal of gpl20 mannose moieties. A combination of MAbs to different MCLRs also completely inhibited the IL-10 response to gpl20, and a MAb to DC-SIGN was, by itself, partially inhibitory. In contrast, inhibitors of signaling via CD4, CCR5 or CXCR4 were ineffective. Exposure to gpl20 inhibited IL- 12 expression in MDDC exposed to maturation

20 stimuli. Gpl20-primed MDDC blocked proliferation of naive T-cells in a MCLR-dependent process, reduced their production of IL- 12, and promoted development of cells with a Treg phenotype. These latter responses were not obligatorily linked to IL-10 expression. Immunization of mice with mannosidase-treated JR-FL gpl20 protein as immunogen in Alum adjuvant led to the induction of anti-gpl20 antibodies at titers higher than those generated by wild-

25 type gpl20 immunogen. (See, e.g., Figures 15 and 16). Analyses of isotype-specific antibody responses and cell-mediated immune responses are performed to correlate results to the in vivo findings. These observations serve to address why vaccine- and infection-induced immune responses to HIV-I Env proteins are polarized towards T_H2 and T_reg pathways, and may help to identify ways to improve the immunogenicity of gpl20 and other highly glycosylated, MCLR- reactive pathogen antigens.

EXPERIMENTAL DETAILS V

One approach to a vaccine against HIV-I is the use of the viral envelope glycoproteins (Env) as immunogens to induce neutralizing antibodies (NAbs) [1-3]. Usually, the Env glycoproteins are presented as adjuvanted, soluble proteins after production in vitro as recombinant proteins, but they can also be expressed in vivo from delivery systems based on DNA or live recombinant viruses (e.g., poxvirus or adenovirus vectors) [4]. Different configurations of Env glycoproteins have been studied as vaccine antigens, initially the surface glycoprotein gpl20; more recently, " soluble oligomeric gpl40 proteins based broadly on the native gpl20-gp41 complex [1-3].

Irrespective of how HIV-I Env glycoproteins have been presented and in whatever configuration, the induction of broadly active NAbs has proven problematic [I]. One generally accepted problem is the evolution of the native Env complex into a configuration that limits the exposure of the few neutralization sites that are present. The potential solution is to further understand the structure of the complex, then to engineer antigens that are better able to present relevant NAb epitopes to the immune system; attempts to do this are in progress in many laboratories worldwide [I]. Here, however, the focus on what is considered to be another factor hindering NAb induction: the limited immunogenicity of HIV-I Env proteins in general.

Although antibody responses to HIV-I Env can clearly be induced in infected or vaccinated humans and animals, these proteins are not particularly immunogenic. Thus, gpl20 or gpl40 proteins are typically administered at 100-500 μg per dose, and the binding antibody titers raised against them can be highly variable; some humans and animals respond fairly well, others only poorly [5-9]. Anti-Env antibody titers also decay rather rapidly (half-lives are typically in the range 30-50 d) and frequent boosting is required to maintain them. Few directly comparative studies have ever been performed, but the limited information available supports the contention that Env is an unusually problematic immunogen compared to most other vaccine antigens [10] (S. Plotkin and B. Graham, personal communication).

The immune responses to HIV-I Env vaccine antigens are T_H2 -polarized to an extent that is unusual even for a soluble protein [11 ,12]. The same T_H2 bias can also be observed during HIV-I infection, although this is a much more complex and controversial situation [13-15]. The nature of the immune response to gpl20 may be attributable to the fundamental properties of this unusual protein. One feature that distinguishes gpl20 from many other vaccine immunogens is its biological activity; gpl20 can bind to several cell surface receptors: CD4, CCR5, CXCR4, and several mannose C-type lectin receptors (MCLR) including but not limited to DC-SIGN [2]. In vitro, one consequence of gpl20 binding to such receptors is the transduction of intracellular signals that can have many different, but generally adverse, effects on the various target cells. Although the gpl20 concentrations used to elicit such signals (μg/ml range) are usually grossly in excess of what could be present in serum during HIV-I infection [16], they are compatible with what is used for immunization (several hundred μg of protein delivered in a few ml into a localized tissue site) [5-9]. It was therefore considered it possible that gpl20 immunization could trigger signals affecting how an immune response develops. For example, one cellular response to gpl20 in vitro is the induction of IL-10, an anti-inflammatory cytokine [17-24]. This study shows what happens when gpl20 interacts with human monocyte-derived dendritic cells (MDDCs) in vitro. The study shows that a consequence of JR-FL gpl20 binding to these cells from ~50% of donors is the induction of EL-IO. Moreover, gpl20-treated MDDCs impair the proliferation of co-cultured CD4⁺ T cells and reduce their expression of IL-12. These responses are also a consequence of the mannose-dependent interaction of gpl20 with an MCLR, although they are not obligatorily linked to IL-10 expression. The various outcomes of gpl20-MCLR interactions are prevented by enzymatic removal of gpl20 mannoses, a method that may improve the immunogenicity of HIV-I Env proteins and some other vaccine-relevant immunogens.

MATERIALS AND METHODS

Recombinant proteins and cytokines

Recombinant, CHO-cell expressed monomelic gpl20s from HIV-I JR-FL, LAI, and KNHl 144 were manufactured at Progenies, as previously described, under GMP conditions [78]. The concentration of the gpl20 stocks was 1 mg/ml, with Endotoxin contamination <3 EU/ml. Gpl20 was added to target cells at 3 μg/ml (25 nM), except when otherwise specified. Insect cell- expressed influenza hemagglutinin (HA) protein (100 μg/ml) was purchased from Protein Sciences Corporation and used at 3 μg/ml (Endotoxin <10 EU/ml, no fungal or bacterial contamination). LPS from Salmonella Typhimurium (1 mg, Sigma) was used at 100 ng/ml. Recombinant soluble CD40L (50 μg, Bristol-Myers Squibb) with an Endotoxin level of < 0.1 ng per μg (1 EU/μg) was used at 1 μg/ml; TNF-α and EL-β (R&D Systems) at 25 ng/ml and 10 ng/ml, respectively.

Inhibition of gpl20-induced IL-10 production iMDDCs were incubated for 1 h at 37 ⁰C with various agents before gpl20 was added. The anti- DC-SIGN mAb AZN-Dl (Beckman Coulter), the isotype control mouse IgGl (Clone 2T8-2F5, Beckman Coulter), the anti-mannose receptor (MR; CD206) mAb Clone 15-2 (Cell Sciences), and the isotype control mouse IgGl, K (Clone MOPC-21, BD Pharmingen) were each used at 40 μg/ml, alone or in combination. The CCR5 inhibitor ADI 01 (from J. Strizki, Schering Plough Research Institute) [79] and the CXCR4 inhibitor AMD3I00 (from G. Bridger, AnorMed Incorporated) [80] were each used at 10 μM. Mannan (Sigma) was added at 30 μg/ml.

Alternatively, gpl20 was mixed with sCD4 (Progenies) [81], mAb bl2 (from D. Burton, Scripps) [82], mAb 2G12 (from H. Katinger, University of Vienna) [83], each at 25 μg/ml, or with cyanovirin-N (CV-N; from R. Shattock, St. George's, London) [26] at 5 μg/ml for 1 h at room temperature on a roller before addition to the cells.

Mannosidase treatment of recombinant gpl20

The mannose residues were removed from JR-FL gpl20 to make demannosylated gpl20 (D-gpl20) as follows [25]. Aliquots of gpl20 (120 μg) were incubated for 16-18 h at 37 °C with no enzyme (mock treatment; M-gpl20) or with α-(l,2,3,6)-mannosidase (Jack Bean, GKX-5010; 25 Units/mg, 0.14 Units/μg gpl20; from ProZyme Incorporated) in a final volume of 1.2 ml, in the presence of protease inhibitors (Roche). A control incubation of enzyme-only (no gpl20) was also performed. The samples were desalted into half-strength PBS (1/2 PBS) using PD-10 desalting columns (GE Healthcare) and concentrated to 1 ml using Vivaspin 30k MWCO 6 ml spin concentrators (Vivascience). After addition of 1 volume of 1/2 PBS, each sample was processed using the Endofree Red 5/1 Endotoxin removal kit (Profos AG). The final volumes of the D-gpl20 and M- gpl20 preparations after endotoxin removal were ~2 ml, with endotoxin levels <8-20 EU/mg and gpl20 concentrations 60 μg/ml. SDS-PAGE and western blot analyses were performed using mAbs 2G12 and CA13 (ARP3119).

ELISA for gpl20-binding ligands gpl20 proteins were captured onto ELISA wells via sheep antibody D3724 to the gpl20 C- terminus, and mAb or CD4-IgG2 binding was assessed essentially as described previously [84]. For DC-SIGN binding to the captured gpl20, the standard procedure was adapted as follows: The plates were washed three times with TSM (20 mM Tris, 150 mM NaCl, 1 mM CaCl₂, 2 mM MgCy, followed by incubation with TSM/1 % BSA for 30 min. After three washes with TSM, DC- SIGN-Fc (a gift from T. Geijtenbeck [85]) in TSM was added for 2 h, with or without a prior incubation for 15 min with EGTA (10 mM) or mAb AZN-Dl (10 μg/ml). The plates were washed five times with TSM/0.05% Tween, then bound DC-SIGN-Fc was detected with peroxidase- labeled goat anti-human Fc (1 :3,000) in TSM/0.05% Tween using standard conditions.

Cell culture

Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats (New York Blood Center or Research Blood Components) by Ficoll density gradient centrifugation. Monocytes were isolated to high purity (>98%) by magnetic cell sorting with anti-CD 14-coated beads according to the manufacturer's recommendations (Miltenyi Biotec). The percentage of CD14⁺ monocytes among the cells sorted from PBMC was determined by flow cytometry and always exceeded 98%. The CD 14^" fraction was frozen and used as the source of T cells for MDDC-T cell co-cultures. The monocytes were subsequently cultured for 6-8 d in complete culture medium (RPMI 1640, GIBCO/Invitrogen) containing 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 2 mM L-glutaminc, 25 mM HEPES, 100 U/ml penicillin, 100 μg/ml Streptomycin (all obtained from GIBCO/Invitrogen), and supplemented with 5% Human AB serum (Sigma) (R-5), 1,000 U/ml GM-CSF (Leukine, Sargramostim), and 1,000 U/ml of recombinant human IL-4 (R&D Systems) at 37 ⁰C in an atmosphere containing 5% CO2. Every 2 d, 400 μl of medium were gently removed from each well and replaced by 500 μl of fresh medium containing the appropriate cytokines.

MDDC maturation iMDDCs were either used without maturation or were differentiated for 24 h or 48 h with TNIL + LPS ± CD40L, a mixture of inflammatory cytokines: 25 μg/ml of TNF-α and 10 μg/ml of IL-β (TNIL), and LPS (10 μg/ml or 100 μg/ml) ± CD40L (1 μg/ml). Because elevated CD83 expression on MDDCs (a response to TNF-α) is necessary but not sufficient for IL- 12 responses [86], CD40L, a strong inducer of IL-12, was included in all experiments in which IL-12p70 was measured. The flow-cytometric analysis of maturation markers is described in Supporting Information.

Reverse transcriptase-PCR iMDDC were incubated with and without gpl20 (3 μg/ml) for various times at 37 ⁰C, and analyzed for the expression of IL-10 mRNA by reverse transcriptase (RT)-PCR. Total RNA was extracted from 1 X 10⁶ iMDDCs by using the Absolutely RNA Miniprep Kit (Stratagene) according to the manufacturer's manual. The isolated total RNA (2 μl) was used for synthesis of cDNA using the Super Script III First-Strand Synthesis System for RT-PCR (Invitrogen). Human IL-10 and β-actin transcripts were amplified using the following primers: IL-10 forward 5'- ATGCCCCAAGCTGAGAACCAAGACCCA-3' (SEQ ID NO:5) and reverse 5'- TCTCAAGGGGCTGG GTCAGCT ATCCCA-3' (SEQ ID NO:6). The PCR product is 352 bp and was verified by sequencing. The β-actin primers used were: forward 5'- TCCTGTGGCATCCACGAAACT-3' (SEQ ID NO:7) and reverse 5'- GAAGCATTTGCGGTGGACGA T-3¹ (SEQ ID NO:8). Their amplification product of 315 bp was also verified by sequencing. The annealing temperature for gradient PCR detection of IL-10 transcripts was optimized so as to avoid cross-reaction with IL-4, IL-6, IL-12p35, and IL-12p40.

Cytokine or chemokine measurements

Purified monocytes were cultured in RPMI 1640 supplemented with 5% human AB scrum, 1,000 U/ml GM-CSF, and 1,000 U/ml IL-4 for 6 d in order to produce iMDDCs, then washed thoroughly. The cells were aliquoted at various densities from 5 X 10⁵ to 1 X 10⁶ cells/ml into 24- well plates, and then stimulated as described in Results. Cytokine IL-10 and IL-12p70 concentrations in cell-free culture supernatants were measured by ELISA using OptEIA kits from BD Pharmingen, as per the manufacturer's protocol. The detection sensitivity for each cytokine was 4 pg/ml. Chemokine CCL17/TARC, CCL22/MDC, CCL19/MIP-3p, and CXCL10/IP10 were measured by ELISA assays using DuoSet ELISA kits from R&D Systems.

MAPK assay

For analysis of MAPK signaling pathways, day-6 iMDDCs were collected, washed three times with warm PBS, and then cultured in a scrum-free medium for at least 24 h before additional stimuli. The cells were then incubated in the presence or absence of gpl20 or TNIL + LPS for various times. Where indicated, an MEK inhibitor (U0126, 5 μM) or a p38 inhibitor (SB 203580, 10 μM) was added to the cultures 1-2 h before gpl20 or TNIL + LPS. The cells were harvested and washed twice with cold PBS, then centrifuged into a pellet, and resuspended in 300 μl of lysis buffer (1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate in PBS) containing PMSE (100 Ug/ml) and a protease inhibitor mixture (500 μg/ml) (Roche Diagnostics). In some experiments, the supernatants were also collected and stored at — 80 °C for later analysis of cytokine content. The total protein concentration of the cell pellets was measured using the bicinchoninic acid assay (Pierce). Samples containing 30 μg of total protein were heated at 100 ⁰C for 5 min in the presence of DTT, then the following assay kits were used according to the manufacturer's instructions (Calbiochem): _P38[TOTAL] ELISA kit; P38[pTpY 180/182] ELISA kit; ERK 1/2 [TOTAL] ELISA kit; ERK1/2 [pTpY 185/187] ELISA kit.

T cell proliferation assay Allogeneic CD4⁺ T cells were obtained by negative selection with magnetic beads and washed twice with PBS (see Supporting Information); the cells were then incubated with 2.5 μM carboxy- fluorescein diacetate, succinimidyl ester (CFSE) (derived from a 5-mM CFSE stock; Molecular Probes) for 15 min at room temperature, with gentle agitation every 2-3 min [87]. The reaction was quenched by the addition of an equal volume of RPMI 1640 containing 10% human AB scrum followed by incubation for 5 min. The cells were then washed with PBS three times and resuspended at 2 XlO⁶ cells/ml in complete culture medium before use in experiments. For the mixed T lymphocyte reaction assay, CFSE-labeled or unlabeled allogeneic CD4⁺ T cells were co- cultured with differentially treated MDDCs at a 1/10 ratio for 5 d. (In preliminary experiments, the DC:T cell ratio was varied over the range 1/10^"2 to 1/10² in 10-fold increments, for both iMDDCs and mMDDCs, the optimal ratio for delecting T cell proliferation after 5 d of co-culture being 1/10.) Proliferation of the CFSE-labeled naive T cells was analyzed by flow cytometry [87]. Supernatants were collected from the co-cultures of MDDs with unlabeled allogeneic CD4⁺ T-cells on day 5, for measurement of cytokine levels by ELISA.

Statistical analysis

IL-10 measurements were subjected to the D'Agostino and Spearman omnibus normality test. The data were not uniformly normal. Hence, differences between groups were analyzed by one-tailed Mann-Whitney U test. The α level was set to 0.05. Correlations rather than regression analyses were performed since we analyzed measured variables (IL-10 secretion, cell surface antigen expression, and cell proliferation).

Additional explanations

The derivation and phenotypic characterization of the iMDDCs and mMDDCs, as well as the purification of CD4⁺ T cells, are further described at doi: 10.1371/journal.ppat.0030169.sg001, which contents are hereby incorporated by reference into this application. The time course of EL-

10 induction and Ab controls for the blocking of gpl20-induced IL-IO secretion is also shown.

Furthermore, the effects of mAbs to DC-SIGN and MR on the expression of MDDC maturation markers are described, and examples of flow cytometric histograms illustrating inhibition of T cell proliferation are provided. The cytokine and chemokine responses of gpl20-treatcd MDDC are also discussed.

RESULTS

HIV-I gpl20 Induces MDDCs to Produce IL-10 The manner in which gpl20 affected MDDC maturation and cytokine secretion, and MDDC-T cell interactions was investigated in view of the key role dendritic cells (DCs) play in antigen capture, processing, and presentation. The study aims to ascertain whether gpl20 induced IL-10 expression in MDDCs, in view of the immunosuppressive effects of IL-10 and its role in T_W2 -polarization of responses to gpl20 in immunized mice [11], and the induction of IL-10 by gpl20 in human monocyte/macrophages in vitro [17,18,20,22,24]. Therefor, MDDCs that were immature at the start of the experiment (iMDDCs) were used to monitor the subsequent maturation process. The effects of gpl20 on MDDC that were simultaneously induced to mature by other stimuli, notably lipopolysaccharide (LPS) were also investigated.

iMDDCs from a day-6 culture were washed thoroughly to prevent further stimulation with IL-4 and GM-CSF, then incubated for two further days with or without CHO-cell expressed, JR-FL (R5) gpl20 (the 3 μg/ml; 25 nM) concentration was based on titrations in pilot studies; see below). In the absence of any stimulus, the cells produced little IL-10 (mean 11 ± 2.5 pg/ml at 24 h, n = 71 and 28 ± 3.8 pg/ml at 48 h, n = 52) and no detectable IL-12p70 over a 48-h period starting on day 6. The addition of JR-FL gpl20 triggered significant IL-10 secretion from MDDCs from a subset of the 71 blood donors (Figure 17A). Thus, 24 h later, EL-IO production was increased by >5-fold in MDDCs from 62% (44/71) donors, with the median increase being 8.5-fold (median control value: 7.5 pg/ml; median + gpl20, 64 pg/ ml). Similar responses were observed at 48 h (median control value: 17 pg/ml; + gpl20, 98 pg/ml). The EL-IO increases triggered by gpl20 were significant at both 24 h and 48 h (Mann- Whitney U test, one tail, p < 0.0001). However, MDDCs from 38% of the donors did not respond to gpl20 (EL-IO increases of <5-fold). Although a subset was unresponsive to gpl20, day-6 iMDDCs from every donor reacted to the classic TNIL + LPS (+CD40L when EL-12p70 was analyzed) maturation stimulus by producing high levels of both IL-10 (mean 1,639 ± 665 pg/ml, n = 71) and EL-12p70 (mean 235 ± 56 pg/ml, n = 12) over a 48-h period (Figure 17A). The median fold-increase in IL-IO production in response to TNIL + LPS after 24 h was 149-fold, 17.5 times greater than the median response to gpl20. The IL-IO responses to TNIL + LPS and to gpl20 did not correlate (at 24 h, n = 71, / = 0,0007 and at 48 h, n = 12, r² = 0.006, respectively). The time courses of the IL-10 responses to JR-FL gp 120, at both the mRN A and protein levels, and to TNIL + LPS at the mRNA level, may be found at doi: 10.1371/journal.ppat.0030169.sg002, which contents are hereby incorporated by reference into this application.

The donor-dependent variation in the IL-10 response to gpl20 could be explained by genetic or epigenetic factors. As a first step to determining which applied, experiments were performed on

MDDCs from 11 repeat donors, at two time points, one month apart. An IL-10 response to gpl20 was observed in MDDCs from four of the 11 donors at both time points, whereas there was no response at either time point from cells of the other seven donors (Figure 17B). The consistency of the response pattern is more suggestive of a genetic or a constant epigenetic determinant than of a variable epigenetic factor such as, for example, an inter-current infection.

IL-10 secretion by MDDCs from responsive donors was dependent on the concentration and the identity of the gpl20 protein used (Figure 17C). The optimal response to JR-FL gpl20 occurred at 3 μg/ml, whereas the dose-response curve for LAI gpl20 was slightly different, IL-10 secretion being greatest at 10 μg/ml, the highest concentration tested. However, when MDDCs from the same donors were exposed to gpl20 from the subtype A virus KNHl 144, there was no IL-10 response (Figure 17C). Furthermore, when MDDCs from five donors were tested comparatively, the same three that responded to JR-FL gpl20 also did so to LAI gpl20, and to similar extents, whereas MDDCs from all five donors responded to TNIL + LPS by producing high levels of IL-10 (Figure 17D). Hence both viral and host genetics may influence whether MDDCs produce IL-10 after exposure to gpl20. The viability of iMDDCs and mature MDDCs (mMDDCs) exposed for 48 h to the three different gpl20s was determined by staining with 7 amino-actinomycin D. Spontaneous cell death in cultures from different donors varied from 2%-3% in iMDDCs and 3%-12% in mMDDCs. The additional death of iMDDCS or mMDDCS measured in the presence of up to 10 ug/ml of JR-FL gpl20, with or without demannosylation (see below), was <7%; for LAI gpl20, it was <5% at up to 20 μg/ ml; for KNHl 144 gpl20 it was <5% at up to 10 μg/ml.

The JR-FL, LAI, and KNHl 144 proteins used in Figure 17C were all manufactured under good manufacturing process conditions and were essentially LPS-free. Several additional gpl20 proteins of different genotypes were also tested and expressed in different cell types (including insect cells) obtained from commercial sources and academic collaborators. In general, the degree of LPS contamination in these preparations was too high for the results to be interpretable, since LPS is itself a highly efficient inducer of IL- 10 from MDDCs (Figure 17). HΓV-1 gpl20 Stimulates IL-IO Production by MDDCs through a Mannose-Dependent Interaction To determine which gpl20 receptors on iMDDCs were responsible for activating IL-10 expression, either gpl20 or the cells with ligands that should block known gpl20-receptor interactions were incubated (Figures 18A). Additional explanation of the effect of anti-MR and anti-DC-SIGN monoclonal antibodies may be found at doi:10.1371/journal.ppat.0030169.sg003, which contents are hereby incorporated by reference into this application, and doi:10.1371/journal.ppat.0030169.sg004, which contents are also incorporated by reference into this application.

Neither the bl2 mAb to the CD4-binding site on gpl20 nor sCD4 inhibited IL-10 production, implying that a gpl20-CD4 interaction was not responsible. The small-molecule CCR5 antagonist ADlOl was not inhibitory, ruling out signals transduced via gpl20-CCR5 binding (See doi:10.1371/journal.ppat.0030169.sg004, which contents are hereby incorporated by reference into this application). The CXCR4 antagonist AMD3100 was inactive against IL-10 induction by gpl20 from the X4 virus, LAI, so CXCR4 is also uninvolved. As expected, AMD3100 did not inhibit the IL-10 response to JR-FL gpl20, or ADlOl the response to LAI gpl20 (See doi:10.1371/journal.ppat.0030169.sg003, which contents are hereby incorporated by reference into this application). In contrast, when gpl20 was pre-treated with either mAb 2G12 or CV-N, IL-10 induction was strongly inhibited (Figure 18A). Both 2Gl 2 and CV-N bind to mannose moieties on gpl20 N-linked glycans [25-27], implicating an interaction between gpl20 and an MCLR(s) as the critical trigger for IL-10 induction. It was also tested whether soluble mannans antagonized gpl20- dependent IL-10 expression, but found that mannans themselves strongly activated an IL-10 response (Figure 18A). However, combining gpl20 with mannans did not further elevate IL-10 levels, suggesting that both of these mannose-containing ligands bind to, and saturate, the same MCLR(s). To explore which MCLR(s) might be involved, mAbs specific to DC-SIGN and the mannose receptor (MR) were used. The anti-DC-SIGN mAb AZN-Dl completely blocks the binding of mannosylated gpl20 to DC-SIGN in an ELISA (Figure 18B). Two mAbs to DC-SIGN, including AZN-Dl and mAb Clone 19 to the MR, can each reduce the binding of gpl20 to a subset of tonsillar B cells [28]. When the anti-DC-SIGN and anti-MR mAbs AZN-Dl and Clone 15-2 were each pre-incubated with iMDDCs, AZN-Dl partially (-50%) reduced gpl20-mediated IL-10 induction whereas Clone 15-2 was not inhibitory; adding the two mAbs together completely abolished the IL-10 response (Figure 18A). An anti-CD4 mAb was not inhibitory by itself at 24 h and did not affect the actions of the anti-MCLR mAbs when combined with them, although it did cause partial (45% +/- SD 29%) inhibition at 48 h (Figure 18A). Other than mannan, the various mAbs and ligands described above did not induce IL-10 expression or block LPS-induced IL-10 expression (Figures 18A, see also doi:10.1371/journal.ppat.0030169.sg004, which contents are hereby incorporated by reference into this application). The same concentrations (40 μg/ml) of different murine isotype control antibodies, alone and in combination, were also without effect (See doi:10.1371/journal.ppat.0030169.sg004, which contents are hereby incorporated by reference into this application).

The above experiments imply that MCLRs, particularly but probably not only DC-SIGN, are the gpl20 receptors that trigger the IL-IO response. If so, the high mannose residues on gpl20 glycans are likely to be the cognate ligands. To prove this, the mannose moieties were removed from gpl20 by enzymatic digestion with α-(l,2,3,6)-mannosidase [25]. Reducing SDS-PAGE gel analysis showed the demannosylated JR-FL gpl20 (D-gp 120) was slightly smaller than mock-treated gpl20 (M-gpl20; processed without the enzyme) and had lost its 2Gl 2 epitope (Figure 18C; compare lanes marked + and — ). The successful removal of mannose was verified by showing that D-gpl20 failed to bind either 2G12 or DC-SIGN-Fc in ELISAs, in contrast to M-gpl20 (Figure 18B). However, both mAb b 12 and CD4-IgG2 bound efficiently to structures associated with the CD4- binding site on D-gpl20 (Figure 18B), showing that JR-FL gpl20 was efficiently demannosylated without impairing its overall conformation [25,27]. Hence the role of the high mannose glycans in the IL-10 response could now be directly.

M-gpl20 induced substantial IL-10 production (150-300 pg/ml) from MDDCs from five different donors, whereas D-gpl20 had no such effect. Influenza virus HA did not stimulate IL-10 production, whereas TNIL + LPS activated a strong response (Figure 18D). An interaction between the mannose moieties on gpl20 and an MCLR(s) can therefore trigger IL-10 production from MDDCs from a significant proportion of human donors. The lack of effect of HA, which does not bind to DC-SIGN, compared to gpl20 is consistent with the outcome of comparative immunization studies with these two viral receptor-binding glycoproteins in mice [H].

The blocking effect of the anti-DC-SIGN and anti-MR mAb combination implicated these MCLRs as likely mediators of the IL-10 response to gpl20 (Figure 18A). Because this response is donor- dependent (Figure 17A), DC-SIGN and MR expression on day-6 iMDDCs (the time of addition of gpl20) from nine donors were measured, as well as the expression of CD80, CD83, and CD86. DC-SIGN levels varied by 18-fold among these nine donors, MR by 3.3-fold (in studies of other sets of donors, it was found that the expression levels of both these receptors can vary by about an order of magnitude; unpublished data). The IL-10 response to JR-FL gpl20 correlated with the level of DC-SIGN expression on day 6 (n = 9, r² = 0.52, p = 0.028) but not with MR expression (n = 9, r = 0.19, p = 0.25). Moreover, there were no correlations between LL-IO production and the expression of CD80 (n = 9, r² = 0.052,/> = 0.59), CD83 (n = 9, r² = 0.33,/> = 0.14), or CD86 (n = 9, r² = 0.27, jb = 0.19). Thus, of the five correlations with IL-10 production that were performed, the only substantial one was with DC-SIGN expression.

HIV-I gpl20 Induces IL-10 Production via the ERK Signaling Pathway

It was next sought to identify which signaling pathway(s) was involved in the upregulation of IL-

10 expression after the gpl20-MCLR interaction. The focus was on the ERK1/2 and p38 MAP kinase pathways [29], because ERK 1/2 phosphorylation and activation promotes IL-IO production and inhibits IL-12 production by DC [30], whereas inhibition of ERK 1/2 activation has the opposite effects [31]. Conversely, p38 mediates the induction of IL-12p70 expression by LPS [29], Furthermore, DC-SIGN ligation by antibodies can lead to ERK1/2 phosphorylation [32]. It was observed that TNIL + LPS strongly activated the phosphorylation of both ERK 1/2 and p38 within 5 min, effects that persisted for 30-60 min (Figure 19A). A lesser, but still significant, level of ERK1/2 activation occurred after 5-10 min in MDDCs treated with M-gpl20, ERK1/2 phosphorylation levels then declining back to baseline after 30 min. However, there was no detectable phosphorylation of p38 in response to M-gpl20 at any time point (Figure 19A). D- gpl20, in contrast, failed to activate the phosphorylation of either ERK1/2 or p38 (Figure 19A), implying that the gpl20-MCLR interaction leads to the specific, albeit transient, activation of the ERK 1/2 signaling pathway. In the same experiment, M-gpl20, but not D-gpl20, induced modest levels of IL-IO production, whereas TNIL + LPS + CD40L activated a much greater IL-10 response (Figure 19B), observations in proportion to the levels of ERK 1/2 activation induced bythe different stimuli (Figure 19A).

Signaling inhibitors were used to determine whether there is a link between ERK1/2 activation and IL-10 production. MDDCs were treated with 5 μM UO 126 (an ERK 1/2 inhibitor) or 10 uM SB 203580 (a p38 MAP kinase inhibitor) for 1-2 h, then IL-10 and IL-12p70 production in response to JR-FL M-gpl20 or TNIL + LPS + CD40L were measured 24 h later. U0126 inhibited ERKl/2 phosphorylation by -60% (Figure 19A), and the same compound reduced the IL-10 responses to both M-gpl20 (by 70%) and TNIL + LPS + CD40L (by -90%) (Figure 19B). SB 203580 had a negligible effect on M-gpl20-stimulated IL-10 production but did inhibit the IL-10 response to TNIL + LPS by 70% (Figure 19B).

In view of the reciprocal effects of the ERKl/2 pathway on IL-10 and IL-12 production by DCs [30,31], the IL-12p70 responses to M-gpl20 and to TNIL + LPS was also measured. M-gpl20 triggered a very slight increase in IL-12p70 expression. In contrast, TNIL + LPS activated a substantial IL-12p70 response that was completely blocked by SB 203580 but potentiated (4.7- fold) by UO 126, a pattern consistent with a previous report [31]. Neither inhibitor, by itself, activated IL-10 or DL-12p 70 production (Figure 19B).

Together, the use of signaling inhibitors implies that ERKl/ 2 activation is required for IL-10 production by MDDCs in response to either M-gpl20 or TNIL + LPS.

HPV-I gpl20 Impairs iMDDC Maturation

Immunophenotypic analyses were used to investigate whether gpl20 affects iMDDC maturation. Neither M-gpl20 nor D-gpl20 induced iMDDCs to mature in the absence of TNIL + LPS + CD40L; the cell-surface expression of no maturation marker changed by more than 1.5-fold (unpublished data). However, expression of CD80 was reduced by 3-fold, CD83 by 7-fold, and CD86 by 2-fold when iMDDCs were incubated with M-gpl20 together with TNIL + LPS + CD40L, compared with when the cells were matured with TNIL + LPS + CD40L alone. DC-SIGN expression was 2- to 3-fold greater on MDDCs treated with TNIL + LPS + CD40L plus M-gpl20 than on cells receiving only TNIL + LPS + CD40L, but MR expression was unchanged. D-gpl20 did not mimic the effects of M-gpl20 on the expression of CD80, CD83, CD86, and DC-SIGN, implicating an MCLR(s) as a mediator of these effects of gpl20 (Figure 20). Furthermore, gpl20 impaired the maturation of iMDDCs from both IL-10-responding and non-responding donors. The reduced expression of CD80, CD83, CD86, and the increased expression of DC-SIGN did not correlate with IL-10 secretion 48 h after gpl20 addition among the 15 donors tested, of which nine were IL-10 responders, six non-responders. There were no correlations: r² = 0.05 for CD80 fold- decrease versus IL-10; r = 0.02 for CD83 fold-decrease versus IL-10; r² = 0.00004 for the fold- increase in DC-SIGN expression versus IL-10. The reduction in CD86 expression also did not correlate with IL-10, r = 0.00003.

The interaction of gpl20 with an MCLR(s) therefore partially blocks the TNIL + LPS -I- CD40L- induced maturation of iMDDCs that normally leads to increases in CD80, CD83, and CD86 expression and a reduction in DC-SIGN expression. These events occur irrespective of whether the gpl20-treated cells produce IL-10.

HIV-I gpl20 Inhibits the Ability of mMDDCs to Induce T Cell Proliferation

Whether the effects of gpl20 on MDDC maturation (and cytokine production) would affect their ability to stimulate the proliferation of allogenic T cells was explored next. To do this, M-gpl20 or D-gpl20 (JR-FL) was added to iMDDCs simultaneously with TNIL + LPS (i.e., on day 6 from the start of the MDDC culture). Influenza virus HA was used as a control antigen, also given simultaneously with TNIL + LPS. After the iMDDCs had been cultured with the various stimuli for 48 h, the cells were washed to remove any free gpl20 or HA, then negatively selected for CD8, CD 14, CD 16, CD 19, CD36, CD56, CD 123, TCRγ/δ, and CD235α. CFSE-labeled, allogeneic CD4⁺ T cells were then added (the ratio of 1/10 was optimized for detection of T cell proliferation) for a 5-d co-culture (i.e., from days 8-13 from the start of the MDDC culture). T cell proliferation was measured as the proportion of CFSE-negative cells. Flow-cytometric histograms supporting the data presented herein may be found at doi: 10.1371/journal.ppat.0030169.sg005, which contents are hereby incorporated by reference into this application.

MDDCs treated with gpl20 in the absence of TNIL + LPS did not stimulate T cell proliferation (Figure 21A). However, exposing the TNIL + LPS-stimulated MDDCs to M-gpl20 for 24-48 h reduced their ability to stimulate T cell proliferation by ~65%. D-gpl20 was less inhibitory, the ~30% decrease being little different from the ~20% decrease seen with the HA control antigen. M- gpl20 depressed proliferation significantly more than did D-gpl20 (one-tailed Mann-Whitney U test, n=\b,p< 0.0001). MDDCs from all 15 donors tested (ten IL-10 responders, five non- responders) behaved similarly in the T cell proliferation assay; the relative proliferation of CD4⁺ T cells in co-cultures with M-gpl20 + TNIL + LPS-treated MDDCs varied in a narrow range (60%- 85% reduction in proliferation) over a broad range of IL-IO responses (0-420 pg/ml) (Figure 21B). Overall, there was no correlation between IL-10 levels in the cultures of the gpl20-treated, TML + LPS-stimulated MDDCs on day 8 and the inhibition of subsequent T cell proliferation (% CFSE dilution versus EL-IO, ? ~ 0.0008). The lack of effect of EL-IO is not surprising because both cytokines and any stimulus for their continued secretion are washed out of the MDDC cultures before the T cells are added. However, the principal point is that, as with maturation marker expression, the MDDC phenotype is adversely affected by gpl20 treatment, whether or not the cells have an immediate EL-IO response. It was also found that JR-FL and KNHl 144 gpl20s each caused a -70% reduction in the capacity of LPS + TNIL-stimulated MDDCs from four donors to induce T cell proliferation (similarly to what is shown for JR-FL gpl20 in Figure 21A, unpublished data). Since KNHl 144 gpl20 does not induce EL-IO secretion from MDDCs (Figure 17C), this experiment corroborates the finding that the anti-proliferative effect is independent of IL-10 from MDDCs (Figure 21B). It also confirms that KNHl 144 gp 120 is biologically active in the MDDC system despite its inability to induce IL-10 expression.

The concentrations of both EL- 10 and EL-12p70 in the various MDDC-T-cell co-cultures were measured on day 13 (Figure 21C). IL-10 concentrations varied by <5-fold overall, the co-cultures with MDDCs exposed to M-gpl20 + TNEL + LPS containing the highest level (280 ± 45 pg/ml). The IL-10 response to M-gpl20 + TNIL + LPS was significantly higher than to D-gpl20 + TNEL + LPS (one-tailed Mann- Whitney U test, n = 5, p = 0.028). EL-12p70 concentrations varied much more substantially. They were very low (<10 pg/ml) in co-cultures containing MDDCs treated with M-gpl20, D-gpl20, or HA in the absence of TNEL + LPS. When TNIL + LPS was used to mature the MDDCs, EL-12p70 concentrations reached 200 ± 22 pg/ml. The inclusion of D-gpl20 or HA caused a modest (~2-fold) reduction, but when M-gpl20 was used only baseline levels of IL- 12p70 were produced (7.2 ± 1.7 pg/ml). The IL-12p70 response to M-gpl20 + TNIL + LPS was significantly lower than to D-gpl20+ TNEL +LPS (one-tailed Mann- Whitney U test, n = 5, p = 0.0040). Thus, compared to the use of TNEL + LPS alone, exposure of the MDDCs also to M- gpl20 caused a 76-fold increase in the IL-10/EL-12p70 ratio in the co-cultures, whereas the use of D-gpl20 and HA caused only 2.4- and 1.3-fold increases, respectively. Moreover, the pattern of IL-12p70 responses in the various co-cultures (Figure 21C, lower panel) was similar to the pattern of T cell proliferation in the same cultures (Figure 21A). IL-4 was also measured, the concentrations ranging from 5-15 pg/ml in the different co-cultures, with no obvious pattern of response detectable.

In conclusion, MDDCs matured in the presence of gpl20 are functionally impaired, irrespective of whether they secrete EL-IO soon after gpl20 binds to MCLRs. DISCUSSION

Exposure to HIV-I gpl20s can impair the maturation of human iMDDCs, triggering cells from some donors to secrete IL-IO, a cytokine generally associated with immunosuppressive responses [23]. Irrespective of whether they secrete IL-10, the gpl20-treated MDDCs mature inefficiently in response to conventional stimuli, and their abilities to stimulate the proliferation of T cells in co- cultures are impaired. The latter defect could be due to their reduced expression of CD80, CD83, and CD86 and hence a weakening of the co-stimulatory interactions with T cells that drive the latter's proliferation. The reduction in IL-12p70 levels (and a substantial increase in the IL-10/IL- 12p70 ratio) in the co-cultures may also be relevant [33].

These various effects are a consequence of an interaction between the mannose components of gpl20 glycans and an MCLR(s), in that the enzymatic removal of mannoses from gpl20 reduced or prevented their occurrence. The IL-10 response to gpl20 using various blocking ligands was also assessed. Thus, CV-N and the 2Gl 2 mAb bind to gpl20 mannoses, and each inhibited IL-10 induction, whereas inhibitors of gpl20 binding to CD4, CCR5, or CXCR4 were ineffective. Furthermore, mannan, another MCLR ligand, activated IL-10 expression. Also relevant is that gpl20 induces IL-10 expression in immunized mice [H]: Gpl20 cannot bind to murine CD4, CCR5, or CXCR4, or to the murine MCLR with the greatest sequence similarity to human DC- SIGN [34]. However, five murine DC -SIGN homologues have been described [35], so it is possible that some of them do bind gpl20. The influenza HA Env protein does not induce IL-10 expression either in the immunized mice or in our own in vitro experiments; HA binds the MR [36] but not DC-SIGN or DC-SIGNR [37].

Several different MCLRs are known or potential binding sites for gpl20 on DC, including DC- SIGN, langerin, and the MR [38]. It was found that mAbs to DC-SIGN and the MR together completely ablated the IL-10 response to gpl20, while the anti-DC-SIGN mAb was partially inhibitory by itself. Furthermore, there was a correlation between the extent of IL- 10 production and the level of DC-SIGN expression on the MDDCs. Together, these observations strongly suggest a role for DC-SIGN binding in the IL-10 response to gpl20 but other MCLRs, particularly the MR, also seem likely to be involved.

M-gpl20, but not its demannosylated derivative, activated ERKl /2 phosphorylation, and the ERK1/2 inhibitor U0126 inhibited the IL-10 response to M-gpl20. These findings imply that the gpl20-MCLR interaction triggers the ERK 1/2 signaling pathway and that this is necessary for activation of IL-10 expression. Whether the same pathway mediates the other MDDC responses to gpl20 remains to be determined.

This conclusion is consistent with earlier reports on the role of the ERK1/2/MAP kinase pathways in the IL-10 response when DCs are activated by other stimuli, including TLR ligands and DC- SIGN-specific antibodies [30-32]. The binding of pathogens, including HΓV-1 , to DC-SIGN has also been shown to activate the Raf-1-acetylation-dependent signaling pathway [39]. The gpl20- treated MDDC from about half the 71 donors were studied secreted elevated amounts of IL-IO, and the response pattern was consistent when 11 donors were re-tested a month later. Hence, genetic or other invariable factors and not, for example, an inter-current infection seem most likely to determine whether a donor's MDDCs respond to gpl20 in this way, or not. Complex host genetic factors influence IL-IO gene regulation [23,40-42]. The genetics of MCLR expression is also relevant; different MCLRs are be involved to different extents on MDDCs from different donors. DC-SIGN expression varies considerably in rectal tissue samples from different individuals and has been associated with local increases in the IL-10/IL-12 ratio [33]. Nonetheless, the IL-10 response to gpl20 is only one marker for the adverse effect of this ligand on MDDCs; whether or not a donor's cells secreted IL-10 in response to gpl20, they were functionally impaired, matured poorly, and were unable to efficiently stimulate T cell proliferation.

It was also observed that both the concentration and the identity of the gpl20 protein influenced the IL-10 response. Two of the three tested gpl20s ORFL and LAI) triggered IL-10 release from

MDDCs of responsive donors, whereas gpl20 from KNHl 144 did not. There are subtle differences between the gpl20s in exactly how they interact with one or more MCLR, and that the IL-10 response is particularly sensitive to a specific facet of these interactions. Differences in how diverse HIV-I virions and gpl20 proteins interact with DC-SIGN have been reported, although the variations in gpI20 structure that affect the interaction have still to be fully defined [43] (M.

Jansson, personal communication). A sequence alignment of the JR-FL, LAI, and KNHl 144 gpl20 proteins, with emphasis on the positions of N-linked glycans, suggests a number of potentially relevant differences. Such sequence alignment may be found at doi:

10.1371 /journal. ppat.0030169.sg006, which contents are hereby incorporated by reference into this application.

Since understanding the molecular basis for the lack of IL-10 induction might help in the design of new Env-based immunogens, mutagenesis studies that focus on the N-linked glycans of JR-FL and KNHl 144 could be informative, as might the use of additional gpl20s that vary in sequence and that are expressed in cell types that lead to differences in glycosylation patterns. It is important, however, that any such reagents be highly purified free of the LPS contaminants that are common in most commercial gpl20 preparations and in some others made under non-GMP conditions. The same constraints apply to the use of inactivated HIV-I virions.

Several earlier studies have shown that gpl20 and inactivated HIV-I virions can have complex effects on MDDCs and their interactions with T cells and on cytokine secretion by both cell types in vitro. Thus, compared to LPS, R5, and X4 gpl20s both stimulated much less IL-12 production from MDDCs, but without IL-10 release [19]. As observed, gpl20-treatment impaired MDDC maturation in response to classical stimuli, reducing their ability to stimulate T cells, but unlike our results, CD80, CD83, and CD86 were up-regulated on the gpl20-treated cells [19]. In another study, exposure of MDDCs to X4 gpl20 up-regulated CD80 and CD86 and down-regulated MR, with increased secretion of IL-IO, IL-12, IL-18, and TNF-α [47]. Various surface markers were also up-regulated on HIV-I -infected MDDCs, associated with an inability of the cells to secrete IL-12 in response to CD40L [48]. The receptor interactions of gpl20 most responsible for its various biological effects were not determined in these vaπous studies. Gpl20 is also known to stimulate IL-10 release from monocyte/macrophages in vitro [17,18,20,22,24]. There is one report that MDDCs undergoing continued stimulation with GM-CSF and IL-4 did not secrete IL-JO in response to gpl20, although differences in the experimental conditions are probably responsible, and the donor- and gpl20-dependent variation now described may also be relevant [49].

HIV-I BaL and a specific DC-SIGN mAb have recently been shown to activate Rho-GTPase- dependent signals via DC-SIGN that favor the formation of DC-T-cell synapses and HIV-I infection of the T cells [50]. The same signaling events also induced the ATF3 transcription factor that suppressed TLR-response genes, attenuating the LPS responses of the cells by reducing IL- 12p70 secretion and down-modulating CD86 and HLA-DR. Thus, as observed with gpl20, the anti-DC-SIGN mAb induced a semi-immature state in the MDDCs, which failed to stimulate T cell proliferation effectively [50]. Indeed, the binding of an antibody to DC-SIGN was previously found to activate Erk-1/2 but not p38 [32], similar to what was observed with gpl20. Cross-linking the MR via a specific mAb can have a broadly similar effect on the MDDC phenotype [51]. It will be worth studying whether the downstream signals activated by the MCLR MAbs are also tnggered by gpI20. Of further note is that an allergenic glycoprotein from peanuts also induces ERK1/2 signaling in MDDCs via DC-SIGN, but up-regulates MHC and co-stimulatory molecules and thereby increases the ability of the MDDCs to activate T cell proliferation [52]. Thus, there may be considerable subtleties to how different glycoproteins and mAbs bind to DC-SIGN and other MCLRs on the MDDC surface, and the intracellular consequences of these interactions. Most mAbs to DC-SIGN or the MR do not induce transmembrane signals, but some do [50,51]; likewise, some gpl20s induce IL-IO expression, others do not. One relevant point may relate to how an MCLR hgand is mannosylated: adding O-linked mannoses to ovalbumin increases lympho-proliferation in mixed BMDC-T-cell cultures while N-hnked mannoses have the opposite effect, and mannosylated ovalbumin impaired IL-12p70 secretion [53]. Most mannose residues on gpl20 are N-hnked [54], but the relative amounts of N- and O-linked moieties could vary between strains and influence the overall signaling patterns that are activated. Other pathogens also use mannose moieties to suppress immune responses, again via binding to MCLRs. For example, the M.Tb cell wall component ManLAM binds to DC-SIGN at a similar site to gpl20's, induces IL-10 production, impairs DC maturation, and suppresses the host immune response to this pathogen [55,56]. Some lactobacilli do much the same, although without the involvement of mannose residues [57]. Although DC-SIGN, and MCLRs in general, are important sentinels for the presence of pathogens, some organisms may be able to subvert at least some of the natural functions of these receptors for their own purposes [58]. DC-SIGN, in particular, may be considered as an unconventional PRR (pattern recognition receptor) that drives T_H2 and T_reg responses [32,58]. Silencing SOCS-I in DC has been shown to reduce the suppressive effect of gpl20 on the production of pro-inflammatory cytokines in vitro [59]. Mice immunized with gpl20-pulsed, SOCS-I -silenced DC produced higher and more sustained titers of anti-gpl20 antibodies, and T_H1 -polarized cellular responses to gpl20 [59]. Conversely, over-expressing SOCS-3 in murine DC increased IL-IO expression, and SOCS- 3-transduced DC primed a T_H2-dominant response when co-cultured with CD4⁺ T cells in vitro [60]. Perhaps these observations are linked mechanistically to ours?

Caution must always be taken when extrapolating from cell culture systems to the more complex environment of tissues in vivo where the DC phenotype differs from the MDDCs used here and where gpl20 concentrations are hard to estimate [16,61]. DCs and T cells isolated from HIV-I- infected persons can have aberrant phenotypes that are broadly similar to those of the gpl20- exposed studied in vitro [62]. In particular, elevated numbers of tolerogenic semi-mature DCs, and FOXP3⁺ CD4⁺ regulatory T cells, have been observed in lymph nodes of HIV-I -infected people [63]. Moreover, high levels of IL-IO, accompanied by a reduction in IL-12, can be found in plasma during primary HIV-I infection [64]. IL-IO can have a substantial effect on the course of viral infections [65]. Thus, blocking IL-IO signaling by antibodies to its receptor promotes the clearance of lymphocytic choriomenigitis virus and prevents the establishment of a persistent infection [66,67]. Perhaps similar events are involved in persistent infection by HIV-I? Thus it is possible that, during primary infection, env-gene products could help suppress the development of anti- HIV-I immune responses at this critical time, particularly as virion-associated gpl20 is more efficient than free gpl20 at inducing various signaling events [68], If so, the retention of high mannose moieties on the Env complex would be yet another defense HIV-I uses in its battle with host immunity. The presence of mannoses on Env is paradoxical because they might facilitate virion clearance from the blood [25]: Counter-functions would justify their retention.

These results may help understand the outcome of immunizing with Env-based antigens, and perhaps why different individuals respond to these vaccines with Ab titers that can vary over a several-log range [5-9]. When milligram amounts of gpl20 are delivered in a bolus into tissues, local concentrations are likely to be high enough to affect the performance of various immune system cells, including DCs, during the earliest, formative stages of the immune response [16]. In a comparative DNA and protein immunization study in mice, the antibody and cytokine responses to gpl20 were strongly T_H2-poIarized, whereas responses to HA were T_H1 -biased. Furthermore, the T_H2 bias of the anti-gpl20 response did not occur in IL-10 knock-out mice [H]. Although T-helper phenotypes are more complex in humans than mice, the responses to gpl20, during infection and after vaccination, do appear to be T_H2 -biased [12-15]. Including Env in multi-component HΓV/SIV vaccines can sometimes be deleterious to protection [69,70]. Also, immunizing horses with insect cell-expressed Env proteins (which are enriched for high-mannose moieties) from Equine Infectious Anemia Virus (EIAV) enhanced post-immunization infection with EIAV, whereas EIAV Env proteins expressed in mammalian cells induced protective responses [71 -73]. Insect cell-expressed gpl20 proteins were also comparatively poor immunogens in mice, because of a limited ability to induce T-helper responses [9].

Any vaccine-related, adverse influences of the high-mannose moieties on gpl20 glycans could be overcome by treating gpl20 with a mannosidase enzyme. This strategy improves the immunogenicity of HIV-I Env proteins. Deleting a subset of N-linked glycans altered the IgG isotype profile of the antibody response to the HCV El protein in immunized mice and improved its immunogenicity overall [74]. Of course, raising higher titers of antibodies and/or reducing the rate of decay of the antibody response to HIV-I Env will achieve little if those antibodies are non- neutralizing. The general increase in the immunogenicity of Env proteins can facilitate the development of otherwise sub-threshold NAb responses, and/or enable lower amounts of Env trimers to be used. Combining the mannose-removal technique with other strategies intended to increase the immunogenicity of NAb epitopes are also possible. Several other vaccine antigens that are considered to be problematic from the immunogenicity perspective, such as RSV F, RSV G, CMV gB, and Ebola GP, are also highly glycosylated and/or can bind to MCLRs (S. Plotkin and B. Graham, personal communication) [75-77]. Whether these proteins might also contain high- mannose moieties or other carbohydrate structures that can interact with MCLRs that could be removed enzymatically should be considered.

REFERENCES FOR EXPERIMENTAL DETAILS V

1. Burton DR, Desrosiers RC, Doms RW, Koff WC, Kwong PD, et al. (2004) HIV vaccine design and the neutralizing antibody problem. Nat Immunol 5: 233-236.

2. Pamophlet R, Burton DR (2006) GP120: target for neutralizing HIV-I antibodies. Annu Rev Immunol 24: 739-769.

3. Zwick MB (2005) The membrane-proximal external region of HIV-I gp41 : a vaccine target worth exploring. Aids 19: 1725-1737.

4. McMichael AJ (200fi) HIV vaccines. Annu Rev Immunol 24: 227-255.

5. Connor RI, Korber BT, Graham BS, Hahn BH, Ho DD, et al. (1998) Immunological and virological analyses of persons infected by human immunodeficiency virus type 1 while participating in trials of recombinant gpl20 subunit vaccines. J Virol 72: 1552-1576.

6. Flynn NM, Forthal DN, Harro CD, Judson FN, Mayer KH, et al. (2005) Placebo-controlled phase 3 trial of a recombinant glycoprotein 120 vaccineto prevent HIV-I infection. J Infect Dis 191 : 654-665. 7. Gilbert PB, Peterson ML, Follmann D, Hudgens MG, Francis DP, et al. (2005) Correlation between immunologic responses to a recombinant glycoprotein 120 vaccine and incidence of HIV-I infection in a phase 3 HIV-I preventive vaccine trial. J Infect Dis 191 :

666-677.

8. Graham BS, McElrath MJ, Connor RI, Schwartz. DH, Gorse GJ, et al. (1998) Analysis of intercurrent human immunodeficiency virus type 1 infections in phase I and II trials of candidate AIDS vaccines. AIDS Vaccine Evaluation Group and the Correlates of HIV Immune Protection Group. ] Infect Dis 177: 310-319. 9. Grundner C, Pancera M, Kang JM, Koch M, Sodroski J, et al. (2004) Factors limiting the immunogenicity of HIV-I gpl20 envelope glycoproteins. Virology 330: 233-248.

10. Wright PF, Mestecky J, McElath MJ, Keefer MC, Gorse GJ, et al. (2004) Comparison of systemic and mucosal delivery of 2 canarypox virus vaccines expressing either HIV-I genes or the gene for rabies virus G protein. J Infecl Dis 189: 1221 - 1231.

11. Daly LM, Johnson PA, Donnelly G. Nicolson C, Robertson J, et al. (2005) Innate IL-10 promotes the induction of Th2 responses with plasmid DNA expressing HIV gpl20. Vaccine 23: 963-974.

12. Gorse G], Corey L, Patel GB, Mandava M, Hsieh RH, et al. (1999) HIV-IMN recombinant glycoprotein 160 vaccine-induced cellular and humoral immunity boosted by HFV-

IMN recombinant glycoprotein 120 vaccine. National Institute of Allergy and Infectious Diseases AIDS Vaccine Evaluation Group. AIDS Res Hum Retroviruses 15: 115-132.

13. Abbas A, Vasilescu A, Do H, Hendel H, Maachi M, et al. (2005) Analysis of IGG and IGG4 in HIV-I seropositive patients and correlation with biological and genetic markers. Biomed Pharmacother 59: 38-46.

14. Martinez V, Coslagliola D, Bonduellc O, N'go N, Schnurigcr A, et al. (2005) Combination of HIV-I -specific CD4 ThI cell responses and IgG2 antibodies is the best predictor for persistence of long-term nonprogression. J Infect Dis 191 : 2053-2063. 15. Ngo-Giang-Huong N, Candotti D, Goubar A, Autran B, Maynart M, et al. (2001) HIV type 1 -specific IgG2 antibodies: markers of helper T cell type I response and prognostic marker of long-term nonprogression. AIDS Res Hum Retroviruses 17: 1435-1446.

16. Klasse PJ, Moore JP (2004) Is there enough gpl20 in the body fluids of HIV-I -infected individuals to have biologically significant effects? Virology 323:1-8. 17. Ameglio F, Capobianchi MR, Castilletti C, Cordiali Fei P, Fais S, et al. (1994) Recombinant gpl20 induces IL-10 in resting peripheral blood mono-nuclear cells; correlation with the induction of other cytokines. Clin Exp Immunol 95: 455-458.

18. Borghi P, Fantuzzi L, Varano B, Gessani S, Puddu P, et al. (1995) Induction of interleukin- 10 by human immunodeficiency virus type 1 and its gpl20 protein in human monocytes/macrophages. J Virol 69: 1284-1287.

19. Fantuzzi L, Purificato C, Donato K, Bclardelli F, Gessani S (2004) Human immunodeficiency virus type 1 gpl20 induces abnormal maturation and functional alterations of dendritic cells: a novel mechanism for AIDS pathogenesis. J Virol 78: 9763- 9772. 20. Gessani S, Borghi P, Fantuzzi L, Varano B, Conli L, el al. (1997) Induction of cytokines by HIV-I and its gpl20 protein in human peripheral blood monocyte/macrophages and modulation of cytokine response during differentiation. J Leukoc Biol 62: 49-53.

21. Granelli-Piperno A, Golebiowska A, Trump fheller C, Siegal FP, Steinman RM (2004) HIV- 1 -infected monocyte-derived dendritic cells do not under go maturation but can elicit IL-10 production and T cell regulation. Proc Natl Acad Sci U S A 101 : 1669-161 A.

22. Mellado M, Llorente M, Rodriguez-Frade JM, Lucas P, Martinez C, et al. (1998) HIV-I envelope protein gpl20 triggers a Th2 response in mice that shifts to ThI in the presence of human growth hormone. Vaccine 16: 1111-1115.

23. Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A (2001) Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19: 683-765.

24. Taoufik Y, Lantz O, Wallon C, Charles A, Dussaix E, et al. (1997) Human immunodeficiency virus gpl20 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood 89: 2842-2848.

25. Sanders RW, Venturi M, Schifmer L, Kalyanaraman R, Katinger H, et al.(2002) The mannose-dependent epitope for neutralizing antibody 2Gl 2 on human immunodeficiency virus type I glycoprotein gpl20. J. Virol 76:7293-7305.

26. Botos I. O'Keefe BR, Shenoy SR, Cartner LK, Ratner DM, el al. (2002)Structures of the complexes of a potent anti-HIV protein cyanovirin-N and high mannose oligosaccharides. J. Biol Chem 277: 34336-34342. 27. Scanlan CN, Pantophlet R, Wormald MR, Ollmann Saphire F., Stanfield R, et al. (2002) The broadly neutralizing anti-human immunodeficiency virus type 1 antibody 2Gl 2 recognizes a cluster of alphal->2 man nose residues on the outer face of gpl20. J. Virol 76: 7306-7321. 28. He B. Qiao X, Klasse PJ, Chiu A, Chadbum A, et al. (2006) HIV-I envelope triggers polyclonal Ig class switch recombination through a CD40-independent mechanism involving BAFF and C-type lectin receptors. JImmunol 176: 3931-3941.

29. Dong C, Davis RJ, Flavell RA (2002) MAP kinases in the immune response. Annu Rev Immunol 20: 55-72.

30. Yi AK, YoonJG, Yeo SJ. Hong SC, English BK, et al. (2002) Role of mitogen-activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role of extracellular signal-regulated kinase in the negative feedback loop of the CpG DNA- mcdiated ThI response. J Immunol 168: 4711-4720. 31. Puig-Kroger A, Relloso M, Fernandez-Capetillo O, Zubiaga A, Silva A, et al. (2001) Extracellular signal-regulated protein kinase signaling pathway negatively regulates the phenotypic and functional maturation of mono-cyle-derived human dendritic cells. Blood 98: 2175-2182.

32. Caparros E, Munoz P, Sierra-Filardi E, Serrano-Gomez D, Puig-Kroger A, etal. (2006) DC- SIGN ligation on dendritic cells results in ERK and PI3K activation and modulates cytokine production. Blood 107: 3950-3958.

33. Gurney KB, Elliott J, Nassanian H, Song C, Soillcux E, et al. (2005) Binding and transfer of human immunodeficiency virus by DC-SIGN+ cells in human rectal mucosa. J Virol 79: 5762-5773.

34. Gramberg T, Caminschi I, Wegele A, Hofmann H, Pohlmann S (2006) Evidence that multiple defects in murine DC-SIGN inhibit a functional interaction with pathogens.

Virology 345: 482-491.

35. Park CG, Takahara K, Umemolo E, Yashima Y, Malsubara K, et al. (2001) Five mouse homologues of the human dendritic cell C-type lectin, DC-SIGN. InI Immunol 13: 1283-

1290.

36. Reading PC, Miller JL, Anders EM (2000) Involvement of the mannose receptor in infection of macrophages by influenza virus. J Virol 74: 5190-5197.

37. Thielens NM, Tacnet-Delorme P, Arlaud GJ (2002) Interaction of CIq and mannan-binding lectin with viruses. Immunobiology 205: 563-574.

38. Turvill2 S, Wilkinson J, Cameron P. Dable J. Cunningham AL (2003) The role of dendritic cell C-type lectin receptors in HIV pathogenesis. J Leukoc Biol 74: 710-718.

39. Gringhuis SI, den Dunnen J, Litjens M, van HeI Hof B, van Kooyk Y, et al. (2007) C-type lectin DC-SIGN modulates Toll-like receptor signaling via Raf-1 kinase-dependent acetylation of transcription factor NF-kappaB. Immunity 26: 605-616.

40. Kurzai O. Schmitl C, Claus H, Vogel U, Frosch M, el al. (2005) Carbohydrate composition of meningococcal lipopolysaccharide modulates the interaction of Neisseria meningitidis with human dendritic cells. Cell Microbiol 7: 1319-1334.

41. Lin MT, Storer B, Martin PJ, Tseng LH, Grogan B, el al. (2005) Genetic variation in the EL-

10 pathway modulates severity of acute graft- versus-host disease following hematopoietic cell transplantation: synergism between IL-10 genotype of patient and IL-10 receptor beta genotype of donor. Blood 106: 3995-4001.

42. Wilson JN, Rockett K, Jallow M, Pinder M, Sisay-Joof F, el al. (2005) Analysis of ELIO haplotypic associations with severe malaria. Genes Immun 6: 462 -4KS.

43. Nabalov AA, van Mnntfort T, Geijlenbeek TB, Pollakis G, Paxton WA (2006) Interaction of HEV-I with dendritic cell-specific intercellular adhesion molecule-3 -grabbing nonintegrin-expressing cells is influenced by gpl20 envelope modifications associated with disease progression. Febs J 273: 4944-4958.

44. Beignon AS, McKenna K, Skoberne M, Manches O, DaSilva I, et al. (2005) Endocytosis of

HEV-I activates plasmacytoid dendritic cells via Toll-like receptor-viral RNA interactions. J

Clin Invest 115: 3265-3275.

45. Meier A, Alter G, Frahm N, Sidhu H, Li B, et al. (2007) MyD88-dependent immune activation mediated by human immunodeficiency virus type 1 -encoded toll-like receptor ligands.J Virol 81 : 8180-8191.

46. Kawai T, Akira S (2006) Innate immune recognition of viral infection. Nat Immunol 7: 131-

137.

47. Williams MA, Trout R, Spcctor SA (2002) HEV-I gpl20 modulates the immunological function and expression of accessory and co-stimulatory molecules of monocyte-derived dendritic cells. J Hematother Stem Cell Res 11:829-847. 48. Smed-Sorensen A, Lore K, Walther-Jallow L, Andersson J, Spetz AL (2004) HIV-I- infected dendritic cells up-regulate cell surface markers but fail to produce IL- 12 p70 in response to CD40 ligand stimulation. Blood 104: 2810-2817.

49. Megiovanni AM, Sanchez F, Gluckman JC, Rosenzwajg M (2004) Double-stranded RNA stimulation or CD40 ligation of monocyte-derived dendritic cells as models to study their activation and maturation process. Eur Cytokine NeIw 15: 126-134.

50. Hodges A, Sharrocks K, Edelmann M, Baban D, Moris A, et al. (2007) Activation of the lectin DC-SIGN induces an immature dendritic cell phenotype triggering Rho-GTPasc activity required for HIV-I replication. NaI Immunol 8: 569-577.

51. Chieppa M, Bianchi G, Doni A, Del Prete A, Sironi M, et al. (2003) Cross-linking of the mannose receptor on monocyte-derived dendritic cells activates an anti-inflammatory immunosuppressive program. J Immunol 171 : 4552-4560.

52. Shreffler WG, Castro RR, Kucuk ZY, Charlop-Powers Z, Grishina G, et al. (2006) The major glycoprotein allergen from Arachis hypogaca, Ara h 1, is aligand of dendritic cell- specific ICAM-grabbing noninlegrin and acts as a Th2 adjuvant in vitro. J Immunol 177: 3677-3685.

53. Luong M, Lam JS, Chen J, Levitz SM (2007) Effects of fungal N- and O-linked mannosylation on the immunogenicity of model vaccines. Vaccine 25: 4340-4344.

54. Leonard CK, Spellman MW, Riddle L, Harris RJ, Thomas JN, et al. (1990) Assignment of intrachain disulfide bonds and characterization of potentialglycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gpl20) expressed in Chinese hamster ovary cells. J Biol Chem 265: 10373-10382.

55. Geijtenbcck TB, Van Vliet SJ, Koppel EA, Sanchez-Hernandez M, Vandenbroucke-Grauls CM, et al. (2003) Mycobacteria target DC-SIGN to suppress dendritic cell function. J Exp Med 197: 7-17.

56. Nigou J, Gilleron M, Rojas M, Garcia LF, Thurnher M, et al. (2002) Mycobacterial lipoarabinomannans: modulators of dendritic cell function and the apoptolic response. Microbes Infect 4: 945-953.

57. Smits HH, Engering A, van der Kleij D, de Jong EC, Schipper K, et al. (2005) Selective probiotic bacteria induce IL-10-producing regulatory T cells in vitro by modulating dendritic cell function through dendritic cell-specific intercellular adhesion molecule 3- grabbing nonintegrin. J Allergy Clin Immunol 1 15: 1260-1267.

58. Pulendran B (2004) Modulating vaccine responses with dendritic cells and Toll-like receptors. Immunol Rev 199: 227-250.

59. Song XT, Evel-Kabler K, Rollins L, Aldrich M, Gao F, et al. (2006) An alternative and effective HTV vaccination approach based on inhibition of antigen presentation attenuators in dendritic cells. PLoS Med 3: el l . doi: 10.1371/journal.pmed.0030011

60. Li Y, Chu N, Rostami A, Zhang GX (2006) Dendritic cells transduced with SOCS-3 exhibit a lolerogcnic/DC2 phenotype that directs type 2 Th cell differentiation in vitro and in vivoJ Immunol 177: 1679-1688.

61. Popovic M, Tenner-Racz K, Pelser C, Stellbrink HJ, van Lunzen J, et al. (2005) Persistence of HIV-I structural proteins and glycoproteins in lymphnodes of patients under highly active antiretroviral therapy. Proc Natl Acad Sci U S A 102: 14807-14812.

62. Chougnet C, Gessani S (2006) Role of gpl20 in dendritic cell dysfunction in HIV infection. J Leukoc Biol 80: 994-1000.

63. Kralhwohl MD, Schacker TW, Anderson JL (2006) Abnormal presence of semimature dendritic cells that induce regulatory T cells in HIV-infected subjects. J Infect Dis 193: 494- 504.

64. Norris PJ, Pappalardo BL, Cusler B, Spoils G, Hecht FM, el al. (2006) Elevations in IL-10, TNF-alpha, and IFN-gammafrom the Earliest Point of HIV Type 1 Infection. AIDS Res

Hum Retroviruses 22: 757-762.

65. Klenerman P, Ludewig B (2006) Virus scores a perfect 10. NaI Med 12: 1246-1248.

66. Ejrnaes M, Filippi CM, Martinic MM, Ling EM, Togher LM, et al. (2006) Resolution of a chronic viral infection after interlcukin-10 receptor blockade. J Exp Med 203: 2461- 2472.

67. Brooks DG, Trifilo MJ, Edelmann KH, Teyton L, McCavern DB, et al. (2006) Interleukin- 10 determines viral clearance or persistence in vivo. Nat Med 12: 1301 -1309.

68. Melar M, Ott DE, Hope TJ (2007) Physiological levels or virion-associated human immunodeficiency virus type 1 envelope induce coreceptor-dependent calcium flux. J Virol 81: 1773-1785.

69. Buge SL, Ma HL, Amara RR, Wyalt LS, Earl PL, et al. (2003) Cpl20-alum boosting of a Gag-Pol-Env DNA/MVA AIDS vaccine: poorer control of a pathogenic viral challenge. AIDS Res Hum Retroviruses 19: 891 -900.

70. Staprans SI, Barry AP, Silvestri G, Safrit JT, Kozyr N, el al. (2004) Enhanced SIV replication and accelerated progression to AIDS in macaques primed to mount a CD4 T cell response to the SIV envelope protein. Proc Natl Acad Sci U S A 101 : 13026-13031.

71. Hammond SA, Raabe ML, Issel CJ, Montclaro RC (1999) Evaluation or antibody parameters as potential correlates of protection or enhancement by experimental vaccines to equine infectious anemia virus. Virology 262:416-430.

72. Raabe ML, Issel CJ. Cook SJ, Cook RF, Woodson B, et al. (1998) Immunization with a recombinant envelope protein (rgp90) of EIAV produces a spectrum of vaccine efficacy ranging from lack of clinical disease to severe enhancement. Virology 245: 151-162.

73. Wang SZ, Rushlow KE, Issel CJ, Cook RF, Cook SJ, et al. (1994) Enhancement of EIAV replication and disease by immunization with a baculovirus- expresscd recombinant envelope surface glycoprotein. Virology 199: 247-251.

74. Liu M, Chen H, Luo F, Li P, Pan Q, ct al. (2007) Deletion of N-glycosylation sites of hepatitis C virus envelope protein El enhances specific cellular and humoral immune responses. Vaccine 25: 6572-6580.

75. Halary F, Amara A, Lortat-Jacob H, Messerle M, Delaunay T, et al. (2002) Human cytomegalovirus binding to DC-SIGN is required for dendritic cell infection and target cell trans-infection. Immunity 17: 653-664.

76. Lambert DM (1988) Role of oligosaccharides in the structure and function of respiratory syncytial virus glycoproteins. Virology 164: 458-466.

77. Lin G, Simmons G, Pohlmann S, Baribaud F, Ni H, et al. (2003) Differential N-linked glycosylation of human immunodeficiency virus and Ebola virus envelope glycoproteins modulates interactions with DC-SIGN and DC-SIGNR.J Virol 77: 1337-1346.

78. Beddows S, Kirschner M, Campbell-Gardener L, Franli M, Dey AK, et al. (2006) Construction and characterization of soluble, cleaved, and stabilized trimeric Env proteins based on HIV type 1 Env subtype A. AIDS Res Hum Retroviruses 22: 569-579.

79. Trkola A, Kuhmann SE, Strizki JM, Maxwell E, Ketas T, et al. (2002) HIV-I escape from a small molecule, CCR5-specific entry inhibitor does not involve CXCR4 use. Proc Natl Acad Sci U S A 99: 395-400.

80. Donzella GA, Schols D, Lin SW, Este JA, Nagashima KA, et al. (1998) AMD3100, a small molecule inhibitor of HIV-I entry via the CXCR4 co-receptor. NaI Med 4: 72-77.

81. Allaway GP, Davis-Bruno KL, Beaudry GA, Garcia EB, Wong EL, et al. (1995) Expression and characterization of CD4-IgG2, a novel heterotetramer that neutralizes primary HIV type 1 isolates. AIDS Res Hum Retroviruses 11 : 533-539. 82. Roben P, Moore JP, Thali M, Sodroski J, Barbas CF III, et al. (1994) Recognition properties of a panel of human recombinant Fab fragments to the CD4 binding site of gpl20 that show differing abilities to neutralize human immunodeficiency virus type 1. J Virol 68: 4821-4828. 83. Trkola A, Purtseher M, Muster T, Ballaun C, Buchacher A, et al. (1996) Human monoclonal antibody 2Gl 2 defines a distinctive neutralization epitope on the gpl20 glycoprotein of human immunodeficiency virus type l.J Virol 70: 1100-1108.

84. Moore JP, McCutchan FE, Poon SW, Mascola J, Liu J, et al. (1994) Exploration of antigenic variation in gpl20 from clades A through F of human immunodeficiency virus type 1 by using monoclonal antibodies. J Virol 68: 8350-8364.

85. Geijtenbeek TB, Torensma R, van Vliet SJ, van Duijnhoven GC, Adema GJ, et al. (2000) Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100: 575-585.

86. Mosca PJ, Hobeika AC, Clay TM, Nair SK, Thomas EK, et al. (2000) A subset of human monocyte-derived dendritic cells expresses high levels of interleukin- 12 in response to combined CD40 ligand and interferon-gamma treatment. Blood 96: 3499-3504.

87. Lyons AB (2000) Analyzing cell division in vivo and in vitro using flow cytometric measurement of CFSE dye dilution. J Immunol Methods 243:147-154. EXPERIMENTAL DETAILS VI

As discussed above, treatment of human MDDCs with JR-FL gpl20 in vitro induces the expression of IL-IO in a donor-dependent manner and impairs their maturation, compromising their ability to stimulate proliferation of CD4+ T-cells in a co-culture system. These two effects of gpl20 are not directly linked, but both are triggered by an interaction between the mannose moieties of gpl20 glycans and MCLRs on the MDDC surface, including but not limited to DC- SIGN. Consequently, enzymatic digestion of gpl20 with a mannosidase prevents or reduces these immunosuppressive effects. It was also evaluated whether mannosidase-treated JR-FL gpl20 (D- gpl20) is more immunogenic than control gpl20 (M-gpl20) by immunizing mice with the two proteins, in Alum adjuvant. In addition, other mice with an anti-IL-10 receptor MAb (or an isotype control MAb) were treated before immunizing with M-gpl20.

MATERIALS AND METHODS

This study was designed to determine how demannosylated-gpl20 immunogenicity in the presence of two different adjuvants, QuilA or Alhydrogel, compares with wild-type gpl20 administered in animals pre-treated with a control or anti-mouse CD210 (IL-IOR) mAb.

Immunogens: JR-FL gpl20 (lot# 23; at lmg/ml); JR-FL gpl20 mock treated (at 55.3 μg/ml from 8/27/07); demannosylated JR-FL gpl20 (at 65.5 μg/ml from 8/27/07); and α-1, 2,3,6 mannosidase (Prozyme cat# GKX-5010, San Leandro, CA; at 6μg/ml).

Antibodies: Purified NA/LE rat anti-mouse CD210 (IL-10R; BD Biosciences clone#lB1.3a; lot# 91643; 0.2μm filtered; endotoxin level is <0.01ng/μg of protein; at lmg/ml from Sept-07); and Purified NA/LE rat IgG, isotype (BD Biosciences clone#R3-34; lot# 91644; 0.2μm filtered; endotoxin level is <0.01ng/μg of protein; at lmg/ml from Sept-07)

Adjuvants: Quil A (Brenntag Biosector A/S via Accurate Chemical, lmg/ml in DPBS-); and Alhydrogel (Brenntag Biosector A/S Accurate Chemical, 6.5mg Al/ml)

Five female C57BL/6 mice (age ~8-9 wks at start of study) housed per cage. He mice were pre- bleed and implanted with microchips prior to start of study. Bleeding was performed prior to initial dose (baseline), on study days 7, 13, 21 , and 35 (terminal bleed). All doses are formulated at the start of the study and stored at -80⁰C until use. Quil A is added during formulation while Alum is added to the immunogen on the morning of the injection. Each group of mice received 5μg of relevant gpl20 on study day 0 and 14. Each group also received either lOμg of Quil A or 250μg Alhydrogel per dose. Selected groups received 500μg of either anti-mouse CD210 (IL-IOR) or matched isotype antibody on study day -1 or 13. Gpl20 doses were administered s.c. (groin; 130μl/dose/animal). Antibody doses were administered i.p. (abdomen; 0.5ml/dose/animal). Table 2 below details the study design. A dosage timeline is shown is Figure 25.

SD: study day

RESULTS

Mannosidase-treated JR-FL gpl20 (D-gpl20) was found to be more immunogenic than control 10 gpl20 (M-gpl20). The anti-gpl20 titers in the D-gpl20 recipients were ~25-fold greater than seen with M-gpl20, and a similar differential was seen between the mice that received the anti-IL-10 receptor MAb and the isotype control (Figure 22). Results show that using an anti-IL-10 receptor Ab also increases anti-gpl20 titers (Figure 23) and suggest that CMI responses were greater in the D-gpl20 recipients. Moreover, the IgG subclass profile in the D-gpl20 recipients was more 15 Thl/Th2 balanced than the Th2 -polarized response to M-gpl20 (Figure 24). These findings show that the gpl20 mannose moieties are biologically active in vivo, and likely act to suppress acquired immune responses to this vaccine-relevant antigen via an interaction with the innate immune system.

Claims

What is claimed is:

I . A composition comprising a demannosylated HIV-I gpl20 envelope glycoprotein and a pharmaceutically acceptable carrier.

5 2. The composition of claim 1 , wherein the demannosylated glycoprotein is obtainable by treating a naturally occurring HIV-I gpl20 envelope glycoprotein with a mannosidase.

3. The composition of claim 2, wherein the mannosidase is α-(l-2,3)-mannosidase, α-(l- 2,3,6)-mannosidase, α-(l-6)-mannosidase, or a combination thereof.

4. The composition of claim 3, wherein the mannosidase is α-(l -2,3,6)-mannosidase.

10 5. The composition of any one of claims 1-4, wherein the glycoprotein is present in the composition in an amount effective to stimulate an immune response.

6. The composition of any one of claims 1 -5, further comprising an adjuvant.

7. A composition comprising (a) a trimeric complex, each monomelic unit of the complex comprising a modified form of gpl20 of an HIV-I envelope polypeptide and a modified

15 form of an ectodomain of gp41 of the HIV-I envelope polypeptide, wherein the modified gpl20 polypeptide is demannosylated and the modified gpl20 and the modified gp41 ectodomain are bound to each other by at least one intermolecular disulfide bond between a cysteine (C) residue introduced into the modified gpl20 and a cysteine (C) residue introduced into the modified gp41 ectodomain, which stabilizes the otherwise noncovalent

20 gpl20-gp41 ectodomain interaction, and (b) a pharmaceutically acceptable carrier.

8. The composition of claim 7, wherein the cysteine (C) residue introduced in the modified gpl20 replaces a non-cysteine amino acid in unmodified gpl20 at one or more amino acid positions selected from the group consisting of 35, 39, 44, 482, 484, 486, 488, 489, 490 and 492, said amino acid positions being numbered by reference to the HIV-I isolate HFV-

25 1_JR._FL.

9. The composition of claim 7, wherein the cysteine (C) residue introduced in the modified gp41 ectodomain replaces a non-cysteine amino acid in the unmodified gp41 ectodomain at one or more amino acid positions selected from the group consisting of 580, 587, 596, 599 and 600, said amino acid positions being numbered by reference to the HIV-I isolate

30 HΓV-I_JR._FL.

10. The composition of claim 7, wherein the disulfide bond is formed between (i) a cysteine (C) residue introduced in the modified gpl20 at position 492 to replace an alanine (A) residue in unmodified gpl20, and (ii) a cysteine residue introduced in the modified gp41 ectodomain at position 596 to replace a threonine (T) residue in the unmodified gp41

35 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate

HΓV-I_JR._FL.

I I . The composition of claim 9, wherein the modified gp41 ectodomain further comprises a proline (P) residue which replaces a non-proline residue at one or more amino acid positions selected from the group consisting of 556, 557, 558, 559, 560, 561, 562, 563, 564, 565 and 566 in the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _H*_B2-

12. The composition of claim 11, wherein the modified gp41 ectodomain comprises a proline (P) residue at amino acid position 559, numbered by reference to the HIV-I isolate HIV- 1 H_*B2-

13. The composition of any one of claims 7-12, wherein the trimeric complex is present in the composition in an amount effective to stimulate an immune response.

14. The composition of any one of claims 7-13, further comprising an adjuvant.

15. The composition of any one of claims 7-14, further comprising a non-ionic detergent. 16. The composition of claim 15, wherein the non-ionic detergent is a polyethylene type detergent.

17. The composition of claim 16, wherein the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate or poly(oxyethylene) sorbitan monooleate.

18. The composition of claim 17, wherein the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate.

19. The composition of claim 15, wherein the non-ionic detergent is present in an amount from 0.01% to 1% by volume of the total volume of the composition.

20. A composition which comprises a complex of a modified form of gpl20 of an HIV-I envelope polypeptide and a modified form of an ectodomain of gp41 of the HIV-I envelope polypeptide, wherein the modified gpl20 polypeptide is demannosylated and comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 492 in an unmodified gpl20 polypeptide, and the modified gp41 ectodomain comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 596 in an unmodified gp41 ectodomain; the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _JR._FL; and wherein the modified gρl20 and the modified gp41 ectodomain are joined together by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain.

21. The composition of claim 20, wherein the modified gp41 ectodomain further comprises a proline (P) residue which replaces a non-proline residue at one or more amino acid positions selected from the group consisting of 556, 557, 558, 559, 560, 561, 562, 563,

564, 565 and 566 in the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _HXB2-

22. The composition of claim 21 , wherein the modified gp41 ectodomain further comprises a proline (P) residue at amino acid position 559, numbered by reference to the HIV-I isolate HΓV-I _HXB2-

23. A composition comprising a trimer which comprises a noncovalently bound oligomer of three identical complexes according to claim 20, and a pharmaceutically acceptable carrier.

24. The composition of claim 23, wherein the trimer is present in the composition in an amount effective to stimulate an immune response.

25. The composition of any one of claims 20-24, further comprising an adjuvant.

26. The composition of claim 23, further comprising a non-ionic detergent.

27. The composition of claim 26, wherein the non-ionic detergent is a polyethylene type detergent.

28. The composition of claim 27, wherein the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate or poly(oxyethylene) sorbitan monooleate.

29. The composition of claim 28, wherein the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate. 30. The composition of claim 26, wherein the non-ionic detergent is present in an amount of from 0.01% to 1% by volume of the total volume of the composition.

31. A composition which comprises a modified gpl40 envelope polypeptide of an HIV-I isolate, wherein a first portion of the gpl40 polypeptide corresponds to a modified gpl20 polypeptide and a second portion of the gpl40 polypeptide corresponds to a modified gp41 ectodomain polypeptide, wherein the modified gpl20 polypeptide is demannosylated and comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 492 in unmodified gpl20 protein and wherein the modified gρ41 ectodomain comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 596 in unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HrV-lj_R._FL; and further wherein the modified gp41 ectodomain comprises a proline (P) residue which replaces a non-proline residue at amino acid position 559 in the unmodified gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HIV-I _HXB2, wherein the modified gpl20 and the modified gp41 ectodomain are joined together by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain.

32. The composition of claim 31 , wherein the modified gp 120 polypeptide further comprises a mutated furin recognition sequence.

33. A composition comprising a trimer which comprises a noncovalently bound oligomer of three identical modified gpl40 polypeptides of claim 31. 34. The composition of claim 33, wherein the trimer is present in the composition in an amount effective to stimulate an immune response.

35. The composition of any one of claims 31 -34, further comprising an adjuvant.

36. The composition of claim 33, further comprising a non-ionic detergent.

37. The composition of claim 36, wherein the non-ionic detergent is a polyethylene type detergent.

38. The composition of claim 37, wherein the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate or poly(oxyethylene) sorbitan monooleate.

39. The composition of claim 38, wherein the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate.

40. The composition of claim 36, wherein the non-ionic detergent is present in an amount of from 0.01% to 1% by volume of the total volume of the composition.

41. The composition of any one of claims 1, 7-12, 20-23, 31 , or 33, wherein the demannosylated gpl20 is produced by a process which comprises treatment with a mannosidase.

42. The composition of claim 41, wherein the mannosidase is α-(l-2,3)-mannosidase, α-(l- 2,3,6)-mannosidase, α-(l-6)-mannosidase, or a combination thereof.

43. The composition of claim 42, wherein the mannosidase is α-(l-2,3,6)-mannosidase.

44. The composition of any one of claims 1, 7-12, 20-23, 31, or 33, wherein the HIV-I gpl 20 glycoprotein is identical to a gpl20 glycoprotein present in an isolate having a HIV-I subtype selected from the group consisting of clades A, B, C, D, E, F, G, H, J and O.

45. The composition of claim 44, wherein the HIV-I isolate is a clade B subtype.

46. A protein comprising a first polypeptide which comprises consecutive amino acids encoding a modified gpl20 of an HIV-I isolate, which modified gpl20 is demannosylated and comprises a first cysteine (C) residue introduced by a mutation, and a second polypeptide which comprises consecutive amino acids encoding a modified gp41 ectodomain of the HIV-I isolate, which modified gp41 ectodomain comprises a second cysteine (C) residue introduced by a mutation, wherein (i) the modified gp41 polypeptide further comprises at least one amino acid in its N-terminal helix that replaces an amino acid in unmodified gp41 at one or more positions selected from the group consisting of

583, 580, 576, 573, 569, 566, 562, 590, 587, 555, 552, 548, 545 and 559, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _HXB2. and (ii) the first and second polypeptides are bound to one another by a disulfide bond between the first cysteine (C) and the second cysteine (C). 47. The protein of claim 46, wherein the HIV-I isolate comprises a HIV-I subtype selected from the group consisting of clades A, B, C, D, E, F, G, H, J and O.

48. The protein of claim 47, wherein the HIV-I isolate is a subtype B clade.

49. The protein of claim 47, wherein the HIV-I isolate is a subtype A clade.

50. The protein of claim 48, wherein the HIV-I isolate is a subtype B clade selected from the group consisting of HrV-l_JR._FL, HIV-I₀H₁₂₃, HΓV-1_GUN.,, HIV-l₈₉.₆ and HΓV-1 _HXB₂-

51. The protein of claim 46, wherein the cysteine (C) introduced by the mutation in the first polypeptide replaces one or more amino acids in non-mutated gpl20, the one or more amino acids selected from the group consisting of: valine (V) at position 35; tyrosine (Y) at position 39; tryptophan (W) at position 44; isoleucine (I) at position 482; proline (P) at position 484; glycine (G) at position 486; alanine (A) at position 488; proline (P) at position 489; threonine (T) at position 490; and alanine (A) at position 492; the amino acid positions being numbered by reference to the HIV-I isolate HrV-l_JR._FL.

52. The protein of claim 46, wherein the cysteine (C) introduced by the mutation in the second polypeptide replaces one or more amino acids in non-mutated gp41, the one or more amino acids selected from the group consisting of: aspartic acid (D) at position 580; tryptophan (W) at position 587; threonine (T) at position 596; valine (V) at position 599; and proline (P) at position 600; the amino acid positions being numbered by reference to the HrV-1 isolate fflV-l_JR._FL. 53. The protein of claim 46, wherein, in the N-terminal helix, the modified gp41 polypeptide comprises one or more amino acid replacements selected from:

(a) a phenylalanine (F), asparagine (N), proline (P), or glycine (G) amino acid replacing leucine (L) at position 545 in non-mutated gp41 ;

(b) a valine (V), leucine (L), histidine (H), serine (S), glycine (G), or arginine (R) amino acid replacing isoleucine (I) at position 548 in non-mutated gp41 ;

(c) a valine (V), phenylalanine (F), asparagine (N), proline (P), glycine (G), or arginine (R) amino acid replacing isoleucine (I) at position 559 in non-mutated gp-41 ;

(d) a valine (V), asparagine (N), threonine (T), or lysine (K) amino acid replacing leucine (L) at position 566 in non-mutated gp-41; (e) a proline (P) or lysine (K) amino acid replacing threonine (T) at position 569 in non-mutated gp-41 ;

(f) a leucine (L), phenylalanine (F), tyrosine (Y), glutamine (Q), or asparagine (N) amino acid replacing isoleucine (I) at position 573 in non-mutated gp-41 ;

(g) a valine (V), phenylalanine (F), tyrosine (Y), glutamine (Q), asparagine (N), glycine (G), or lysine (K) amino acid replacing leucine (L) at position 576 in non-mutated gp-41 ; or

(h) a threonine (T) or proline (P) amino acid replacing valine (V) at position 580 in non-mutated gp-41 ; the amino acid positions being numbered by reference to the HIV-I isolate HΓV-1 _HXB2- 54. The protein of claim 53, wherein the modified gp41 second polypeptide comprises a proline (P) residue at amino acid position 559 in its N-terminal helix.

55. The protein of claim 46, wherein the first polypeptide further comprises a mutated furin recognition sequence.

56. A stable HIV-I pre-fusion envelope glycoprotein trimeric complex comprising as a monomelic unit the protein of any one of claims 46-55.

57. A composition comprising the trimeric complex of claim 56 and a pharmaceutically acceptable carrier.

58. The composition of claim 57, further comprising a non-ionic detergent.

59. The composition of claim 58, wherein the non-ionic detergent is a polyethylene type detergent.

60. The composition of claim 59, wherein the polyethylene type detergent is poly(oxyethylene) sorbitan monolaureate or poly(oxyethylene) sorbitan monooleate.

61. The composition of claim 60, wherein the poly(oxyethylene) sorbitan monolaureate is poly(oxyethylene) (20) sorbitan monolaureate.

62. The composition of claim 58, wherein the non-ionic detergent is present in an amount of from 0.01% to 1% by volume.

63. The protein of claim 46, wherein the demannosylated gpl20 is produced by a process which comprises treatment with a mannosidase. 64. The protein of claim 63, wherein the mannosidase is α-(l-2,3)-mannosidase, α-(l-2,3,6)- mannosidase, α-(l -6)-mannosidase, or a combination thereof.

65. The protein of claim 64, wherein the mannosidase is α-(l-2,3,6)-mannosidase.

66. A method of eliciting an immune response against HIV-I in a subject comprising administering to the subject the composition of any one of claims 1 , 7-12, 20-23, 31, or 33 in an amount effective to elicit the immune response against HIV-I in the subject.

67. The method of claim 66, wherein the composition is administered to the subject in a single dose or in multiple doses.

68. A method of generating a high titer antibody response against HIV-I in a subject, comprising administering to the subject the composition of any one of claims 1 , 7-12, 20- 23, 31, or 33 in an amount effective to generate the high titer antibody response against

HIV-I in the subject.

69. A method of preventing a subject from becoming infected with HIV-I , comprising administering to the subject the composition of any one of claims 1, 7-12, 20-23, 31 , or 33 in an amount effective to prevent the subject from becoming infected with HIV-I . 70. A method for reducing the likelihood of a subject becoming infected with HIV-I, comprising administering to the subject the composition of any one of claims 1, 7-13, 20- 23, 31 , or 33 in an amount effective to reduce the likelihood of the subject becoming infected with HIV-I . 71 The method of claim 70, wherein the subject has been exposed to HTV-I . 72 A method of preventing or reducing the likelihood of an immunosuppressive immune response in a subject infected by HIV-I , which comprises administering to the subject a pharmaceutically acceptable composition comprising demannosylated HIV-I gpl20 in an amount effective to prevent or reduce the immunosuppressive immune response in the subject. 73. A method of increasing a T_H1 -based immune response in a subject following exposure to

HIV-I, which comprises administering to the subject a pharmaceutically acceptable composition comprising demannosylated HIV-I gpl20 glycoprotein in an amount effective to increase the T_H1 -based immune response m the subject.

74. A method of preventing or reducing binding of gpl20 envelope glycoprotein to a Type-C mannose receptor (MCR) on a monocyte-deπved dendπtic cell (MDDC) in a subject infected by HIV-I and thereby circumventing production of immunosuppressive levels of interleukin-10 (IL-10) by the MDDC, which method comprises administering to the subject a pharmaceutically acceptable composition compπsing demannosylated HIV-I gpl20 glycoprotein in an amount effective to prevent or reduce the binding of the demannosylated gpl20 to the MCR of the MDDC, thereby circumventing the production of immunosuppressive IL-IO levels by the MDDC in the subject.

75. A method of preventing or reducing the likelihood of an induction of immunosuppressive interleukin-10 cytokine production by monocyte-derived dendritic cells (MDDC) in a subject exposed to HIV-I, which comprises administering to the subject a pharmaceutically acceptable composition comprising demannosylated gpl20 glycoprotein in an amount effective to prevent or reduce the induction of immunosuppressive interleukin-10 cytokine production by the MDDC in the subject.

76. The method of any one of claims 72-75, wherein the demannosylated gpl20 glycoprotein is produced by a process which comprises treatment with a mannosidase.

77. The method of claim 76, wherein the mannosidase is α-(l-2,3)-mannosidase, α-(l -2,3,6)- mannosidase, α-(l-6)-mannosidase, or a combination thereof.

78. The method of claim 77, wherein the mannosidase is α-(l-2,3,6)-mannosidase.

79. The method of any one of claims 72-75, wherein the pharmaceutically acceptable composition further comprises a carrier.

80. The method of any one of claims 72-75, wherein the demannosylated HIV-I gpl20 comprises a modified gpl20 which forms a trimeric complex with a modified HIV-I gp41 ectodomain, wherein each monomelic unit of the complex comprises the modified gpl20 and the modified gp41 ectodomain bound to each other by at least one intermolecular disulfide bond between a cysteine (C) residue introduced by mutation into the modified gpl20 and a cysteine (C) residue introduced by mutation into the modified gρ41 ectodomain, which stabilizes the otherwise noncovalent gpl20-gp41 ectodomain interaction.

81. The method of claim 80, wherein the disulfide bond is formed between the cysteine (C) residue in the modified gpl20, which replaces a non-cysteine residue at amino acid position 492 in unmodified gpl20, and the cysteine (C) residue in the modified gp41 ectodomain, which replaces a non-cysteine residue at amino acid position 596 in the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV- 1 isolate HIV- 1_JR._FL. 82. The method of claim 81, further wherein the modified gp41 ectodomain comprises a proline (P) residue which replaces a non-proline residue at amino acid position 559 in the unmodified gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HΓV-1 _HXB2.

83. The method of any one of claims 72-75, wherein the demannosylated gpl20 is modified to contain a cysteine (C) residue, which replaces a non-cysteine residue, at amino acid position 492 of unmodified gpl20 and forms a complex with a modified gp41 ectodomain which comprises a cysteine (C) residue, which replaces a non-cysteine residue, at amino acid position 596 of unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-I _JR._FL; and wherein the modified gpl20 and the modified gp41 ectodomain are joined together in the complex by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain.

84. The method of claim 83, wherein the modified gp41 further comprises a proline (P) residue which replaces a non-proline residue at amino acid position 559 in the unmodifiede gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HΓV-1 _HXB2-

85. The method of any one of claims 72-75, wherein the demannosylated HIV-I gpl20 is modified to contain a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 492 of unmodified gpl20 and forms a complex with a modified gp41 ectodomain which comprises a cysteine (C) residue which replaces a non-cysteine residue at amino acid position 596 of the unmodified gp41 ectodomain, the amino acid positions being numbered by reference to the HIV-I isolate HIV-1_JR._FL; wherein the modified gp41 ectodomain further comprises a proline (P) residue which replaces a non-proline residue at amino acid position 559 in the unmodified gp41 ectodomain, the amino acid numbering being by reference to the HIV-I isolate HΓV-1 _HXB2; and wherein the modified gpl20 and the modified gp41 ectodomain are joined together in the complex by a disulfide bond that stabilizes the otherwise noncovalent interaction of gpl20 and the gp41 ectodomain.

86. A method of eliciting an immune response against HIV-I in a subject comprising administering to the subject the composition of claim 57 in an amount effective to elicit the immune response against HIV-I in the subject.

87. The method of claim 86, wherein the composition is administered to the subject in a single dose or in multiple doses.

88. A method of generating a high titer antibody response against HIV-I in a subject, comprising administering to the subject the composition of claim 57 in an amount effective to generate the high titer antibody response against HIV-I in the subject.

89. A method of preventing a subject from becoming infected with HIV-I, comprising administering to the subject the composition of claim 57 in an amount effective to prevent the subject from becoming infected with HIV-I .

90. A method for reducing the likelihood of a subject becoming infected with HIV-I, comprising administering to the subject the composition of claim 57, in an amount effective to reduce the likelihood of the subject becoming infected with HIV-I.

91. The method of claim 90, wherein the subject has been exposed to HIV-I .

92. A method of preventing or reducing the likelihood of an immunosuppressive immune response in a subject infected by HIV-I, which comprises administering to the subject the composition of claim 57 in an amount effective to prevent or reduce the immunosuppressive immune response in the subject.

93. A method of increasing a T_H1 -based immune response in a subject following exposure to HIV-I, which comprises administering to the subject the composition of claim 57 in an amount effective to increase the T_H1 -based immune response in the subject.

94. A method of preventing or reducing binding of gpl20 envelope glycoprotein to a Type-C mannose receptor (MCR) on a monocyte-derived dendritic cell (MDDC) in a subject infected by HIV-I and thereby circumventing production of immunosuppressive levels of interleukin-10 (IL-IO) by the MDDC, which method comprises administering to the subject the composition of claim 57 in an amount effective to prevent or reduce the binding of the demannosylated gpl20 to the MCR of the MDDC, thereby circumventing the production of immunosuppressive IL-10 levels by the MDDC in the subject.

95. A method of preventing or reducing the likelihood of an induction of immunosuppressive interleukin-10 cytokine production by monocyte-derived dendritic cells (MDDC) in a subject exposed to HIV-I, which comprises administering to the subject the composition of claim 57 in an amount effective to prevent or reduce the induction of immunosuppressive interleukin-10 cytokine production by the MDDC in the subject.

96. A vaccine which comprises a therapeutically effective amount of the composition of any one of claims 1, 7-12, 20-23, 31, or 33. 97. A vaccine which comprises a therapeutically effective amount of the composition of claim 57.

98. A vaccine which comprises a prophylactically effective amount of the composition of any one of claims 1, 7-13, 20-23, 31, or 33.

99. A vaccine which comprises a prophylactically effective amount of the composition of claim 57.