WO2008103040A1 - Détermination de caractéristiques de qualité dans des récoltes en agriculture et horticulture - Google Patents

Détermination de caractéristiques de qualité dans des récoltes en agriculture et horticulture Download PDF

Info

Publication number
WO2008103040A1
WO2008103040A1 PCT/NL2008/050097 NL2008050097W WO2008103040A1 WO 2008103040 A1 WO2008103040 A1 WO 2008103040A1 NL 2008050097 W NL2008050097 W NL 2008050097W WO 2008103040 A1 WO2008103040 A1 WO 2008103040A1
Authority
WO
WIPO (PCT)
Prior art keywords
specific
agricultural
harvest
quality feature
time
Prior art date
Application number
PCT/NL2008/050097
Other languages
English (en)
Inventor
Anne Douwe De Boer
Michaël Johannes Marcus EBSKAMP
Joost Johannes Theodorus Gierkink
Ivo Laros
Original Assignee
Expressive Research B.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=38515414&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2008103040(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to AU2008217791A priority Critical patent/AU2008217791B2/en
Priority to PL08712623T priority patent/PL2134877T3/pl
Priority to EP08712623.1A priority patent/EP2134877B1/fr
Priority to CN200880012753A priority patent/CN101680028A/zh
Priority to ES08712623T priority patent/ES2420836T3/es
Application filed by Expressive Research B.V. filed Critical Expressive Research B.V.
Priority to US12/527,888 priority patent/US8498819B2/en
Priority to NZ579197A priority patent/NZ579197A/xx
Priority to CA002678804A priority patent/CA2678804A1/fr
Priority to BRPI0807589-1A2A priority patent/BRPI0807589A2/pt
Publication of WO2008103040A1 publication Critical patent/WO2008103040A1/fr
Priority to IL200516A priority patent/IL200516A0/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention relates to the determination of markers for quality features and, linked to this, determining the optimal harvest time and/or the optimal postharvest path of agricultural and horticultural products by means of molecular, biological techniques. Determining the quality of fresh agricultural and horticultural products becomes ever more important for producers, trade and consumers. Awareness of the importance of quality increases perceptibly. Stringent requirements are set with respect to freshness, exterior features, odor and flavor of the edible product. In order to guarantee the quality as well as possible, trade has introduced so-called "tracking and tracing" systems in the production chain. In order to meet these more stringent requirements, the postharvest path is optimized. As a result, transport and storage conditions change constantly. Testing systems allowing objective determination of the quality features (quality parameters) are therefore an absolute necessity for determining quality, pronouncing expectations on future quality or improving quality.
  • Quality is a combination of hard (well-measurable) and soft (more difficult to measure and often apparently subjective) quality factors.
  • Soft factors such as extent of damage, taste, smell or aroma, condition and health and content of disorders, can sometimes be simply determined subjectively, but are often difficult to quantify.
  • Hard factors such as color, acidity (pH), firmness, sugar content, size or length and weight, can often be properly determined quantitatively.
  • Some quality factors such as dormancy status (depth of rest) or stage of development are hard only if they can be measured quantitatively on the basis of, for instance, molecular markers which are determinative of a specific stage or a specific status. Soft factors are useful only if a quantitative scale can be linked to them.
  • a (semiquantitative scale for the quality value of that parameter is then obtained by determining a relative value with respect to the references.
  • Free market processes then determine, both for soft and for hard quality parameters, what range of values is acceptable for that specific quality parameter and that specific agricultural or horticultural product.
  • Product quality is determined mostly by more than one quality parameter and often by a great many. It is not necessarily so that at a particular moment in time, or after a particular postharvest treatment, the values of the different quality parameters are all in the optimal range determined for that product. An optimal taste, for instance, need not go hand in hand with an optimal weight or optimal color. Often, the total product quality is a compromise of all values of the quality factors. Product quality moreover depends on the desired market or on the time of year. A product may be traded locally so that other quality factors are relevant than when the product is stored or transported. Also, the range considered optimal for a quality parameter may differ. Per quality parameter, however, a range of values can be indicated which may be considered optimal for that specific situation.
  • the postharvest path has a great influence on the different quality parameters.
  • the postharvest path can be very diverse, depending on the type of agricultural or horticultural product, the location of production and/or the location of the market. It may furthermore be so that the agricultural or horticultural product is harvested during a particular time of the year while it is sold at other times during the year, therefore, the time duration of the postharvest path varies too.
  • all kinds of storage may be involved, varying from storage at room temperature, storage at reduced temperature and sometimes even deepfreezing. Storage or keeping may involve modified/controlled atmosphere storage/packaging, inhibitors can be added, such as substances that counteract the action of certain plant hormones.
  • the optimal time of harvesting an agricultural or horticultural product strongly depends on the postharvest path and the quality parameter being considered.
  • the optimal harvest window (the period of time during which the harvested product yields the most optimal values for a particular quality parameter) in relation to a quality parameter therefore depends on the postharvest path that will be chosen and the criteria set by the market. So, looking at total product quality or at a specific quality parameter, there is no such thing as an optimal harvest window for all situations.
  • the optimal harvest window should therefore be determined from one situation to the next and also from one product (cultivar or variety) to the next (cultivar or variety). For quality control it is therefore vital that the most important quality parameters after the postharvest path can be predicted at the time of harvest or during the postharvest path. Then, on the basis of this prediction, it can be determined what is the optimal harvest window for a specific agricultural or horticultural product at a given time for a given situation.
  • this moment does not necessarily coincide with the optimal moment for commercial quality parameters such as, for instance, size of the fruit, desired sweetness and color. If for these commercial reasons a later moment of picking is preferred, this has direct consequences for keeping quality and keeping duration.
  • the moment of picking is presently determined by mainly commercial quality parameters. After fruit picking, it generally takes some time before the fruit is ripe for sale, i.e., can be consumed by the consumer. A large part of this time is required for transport to a location where the fruit is processed (e.g. packaged) and for transport from that location to the locations of sale, for instance the auction hall, and from there to the retail trader.
  • the proper harvest time will therefore depend on the commercial parameters and the required postharvest time required for processing and transporting the fruit.
  • the condition of the plant size, affection by disease
  • the climatologic conditions during the development of the fruit temperature, amount of sunlight
  • the conditions of cultivation for instance extent of fertilization
  • an optimal harvest time applicable to all situations can never be given.
  • determining the optimal harvest time is of great importance for the grower in connection with the planning and deployment of personnel. Since in some cases not the postharvest path but the previous history of the fruit is responsible for the development of disorders during or after storage, it is of great importance to be able to measure those parameters objectively.
  • Ripening of fruit is determined by the breakdown of chlorophyll and the accumulation of pigments, softening through changes in texture mainly due to breakdown of cell walls, changes in the accumulation of different sugars and organic acids, of which the latter mainly determine the taste, and production of volatile substances that provide the aroma.
  • a fruit is assessed to be "ripe” if it is at the stage where it has reached a sufficient development, so that after harvest and subsequent treatment, the quality is at least minimally acceptable for the eventual consumer (Reid, M.S., 1992, In: Peaches, Plums and Nectarines: Growing and Handling for Fresh Market., LaRue, J.H. and Johnson, R.S. (eds.), Univ. CaUf. Dept. Agricult. Nat. Resourc.
  • the bulbs are lifted in the Netherlands in spring at the time when the depth of dormancy is considered optimal. If harvesting is unduly delayed, the soil will become unduly wet (through rain), so that the risk of fungi increases strongly and the machines cannot be fielded anymore. It is very important to determine precisely what the depth of dormancy is at the time of harvest. The harvest window is determined by the moment when dormancy is maximal and actually has only an end depending on the weather conditions. The quality parameter that is to be determined at the time of harvest in this case is the depth of dormancy. Optimal dormancy ensures a specific bulb size so that maximum length and thickness of the flower stem can be obtained after the postharvest path.
  • the quality parameter length and thickness of the flower stem depends on the depth of dormancy at harvest time; the optimal moment and, associated therewith, the best possible values for quality is achieved if the depth of dormancy is maximal. At present, the moment of browning of the fleece on the outside of the bulb is used as indicator that the depth of dormancy is maximal, but in many cases this appears to be unreliable.
  • the postharvest path for tulip bulbs consists in storage at higher temperature until the growing point in the bulb has shifted from the vegetative phase to the generative phase. Then, the bulbs are stored at lower temperature until the cold-dependent break of dormancy has been reached completely. Finally, planting of the bulb in potting soil and growth (stretching of the flower stem followed by flowering) takes place.
  • Molecular tests are also desired for determining when the bulb has sustained sufficient cold to break dormancy. This is the moment when planting can take place. Insufficient break of dormancy through too short a cold period also yields a poorer quality.
  • the quality parameter of the maximum length the flower stem can reach is important here too. Here too, a shorter cold period once more results in a lesser length of the flower stem.
  • the quality parameter to be determined in the final path of postharvest is the extent of dormancy break.
  • the eventual quality parameter of maximum length (and thickness) of the flower stem in tulip is therefore dependent on several quality parameters during the postharvest path, the first being the depth of dormancy during harvest, then the complete transition of the growing point in the bulb from vegetative to generative and finally the complete break of dormancy through a period of reduced temperature.
  • Comparable problems for which molecular markers are required occur in other bulbous and tuberous crops, such as lilies, daffodils, hyacinths, freesias, onions, garlic and amaryllis.
  • the harvesting moment with respect to bud ripening is of importance for determining the important quality parameter "length of vase life".
  • Molecular markers during harvest and especially markers involved in the aging of the flower and whose extent of gene expression or protein concentration correlates with the length of the vase life, are good candidates for use in a test for the expected length of vase life.
  • the degree of stress influences the length of vase life.
  • cut flowers including tulip, rose, alstroemeria, iris, lily, Dendranthema (chrysanthemum), gerbera, carnation, freesia, Cymbidium, and Gypsophila, it is important to predict an expectation of the vase life with molecular markers.
  • Leaf aging is directly related to the degree of leaf yellowing.
  • harvesting is not the same as harvesting for instance fruits, unless this happens through striking of cuttings, hut harvesting is characterized by the removal of the plant from, for instance, the greenhouse and transport to, for instance, the auction.
  • the ripening phase and stress both have a negative effect on the quality of the cucumber.
  • One of the (negative) quality factors for cucumber is yellowing of the cucumber.
  • such an expectation of the quality is of very great importance, for instance for lettuce, endive, leek, types of cabbage such as broccoli, cauliflower, Chinese cabbage, red cabbage and other types of cabbage, and chicory.
  • types of cabbage such as broccoli, cauliflower, Chinese cabbage, red cabbage and other types of cabbage, and chicory.
  • the composition of the substances produced in the grape at a particular time is of great importance for the quality of the product (wine, port wine, champagne and the like).
  • the quality parameter of taste of, for instance, port wine can be quantified via, for instance, a taste panel. Correlation of taste with the level of molecular markers at the moment of harvesting, or during the postharvest path, is important to recognize the quality of the end product already at an early stage. This also holds for other crops, such as herbs and spices, specific types of berries, for instance olives and juniper berries, and other agricultural or horticultural products where the presence of taste- determinative components can be determined via molecular markers so that the taste quality of the eventual product can be predicted.
  • the invention relates to a method needed to identify and isolate molecular markers, genes or proteins, for which the value of the gene activity or the protein concentration, respectively, at a particular moment during harvest or during the postharvest path correlates with a specific quality parameter at a specific moment, and the method for predicting after measurement of the value of this marker during the harvest or during the postharvest path the value of the quality parameter during the harvest, the postharvest path or at the end of the postharvest path, or the expectation for a specific situation.
  • Fig. 1 Course of ripening over time with pear cv. Bon Chretien in five orchards.
  • an average value for the totality of the used markers ( ⁇ xyl, PG and peroxidase 424/87) is plotted against time in days.
  • Fig. 2 a. Correlation of gene expression of marker 1 (PGl) during harvest and the hardness on the market for pear cv. Bon Chretien, b. Correlation of gene expression marker 6 (424/87) after short storage and hardness on the market.
  • the hardness at the end of the storage (the pressure in N/m 2 required for pressing-in the fruit) and on the y-axis, logarithmically, the level of expression of the marker.
  • the vertical line indicates the marginal value of the hardness still acceptable for the intended market.
  • Fig. 3. a. Correlation of gene expression marker 6 ( ⁇ xyl) during harvest and hardness on the market for pear cv. Forelle. b. Correlation of gene expression marker 1 (PGl) after short storage and hardness on the market. On the x-axis is indicated the hardness at the end of the storage and on the y-axis, logarithmically, the level of expression of the marker.
  • Fig. 4 Course of ripening over time with apple cv. Granny Smith in five orchards.
  • an average value for the totality of the used markers ( ⁇ xyl and PG) is plotted against time in days.
  • Fig. 5 a Correlation of gene expression ⁇ xyl during harvest and hardness on the market for apple cv. Granny Smith
  • b Correlation of gene expression ⁇ xyl after short storage and hardness on the market. On the x-axis is indicated the hardness at the end of storage and on the y-axis, logarithmically, the level of expression of the marker.
  • Fig. 6. Course of ripening over time with apple cv. Golden Delicious in five orchards.
  • an average value for the totality of the used markers ( ⁇ xyl and PG) is plotted against time in days.
  • Fig. 7. Correlation of gene expression marker M8 (actin) after short storage and hardness on the market. On the x-axis is indicated the hardness at the end of storage and on the y-axis, logarithmically, the level of expression of the marker. The vertical line indicates the marginal value of the hardness still acceptable for the intended market.
  • Fig. 8. Apple cultivar Kanzi was sampled each week during season 2006 and 2007. On the x-axis are the number of days relative to the optimal harvesting moment (determined with physiological parameters). On the y- axis is indicated the level of expression of beta-Xylosidase.
  • Fig. 9. Apple cv. Kanzi flesh markers during harvest versus firmness at the end of storage (EOS). The expression of the marker is plotted against the firmness of the apple in kilograms. In panel A for marker PG, in panel B for marker beta-xylosidase.
  • Fig. 10 Pear cv Conference flesh markers during harvest versus firmness at the end of storage (EOS). The expression of the marker is plotted against the hardness of the pear in kilograms. In panel A for marker PG, in panel B for marker beta-xylosidase.
  • Fig. 11 Expression (on the y-axis) of GAST in tulip in relation to the time of lifting. On the x-axis are indicated the number of days from the optimal time of lifting. The pattern of expression of GAST in 4 years cv Apeldoorn and cv Prominence is plotted.
  • Fig. 12 Quality marker for vase life in rose. Expression (on the y- axis) of the GDSL-motif lipase in rose with a vase life of 5.7 days and a vase life of 8.0 days. The expression of the marker is lower in the roses of good keeping quality than in the roses of poor keeping quality. Harvest is the moment directly after cutting, storage is at 4°C on water, for 1 day and for 4 days. Detailed description of the invention
  • the invention is explained in detail for determination of the expectation (or prediction) of the ripening and/or the moment of harvest of fruit, in particular apple and pear.
  • the general technology is also useful for determining markers for quality features and, linked to this, determining the optimal time of harvesting of agricultural and horticultural products other than fruit.
  • Ripening of fruit is a process whereby chlorophyll is degraded and pigments start forming, while the fruit loses its hardness, whereby sugars are formed and organic acids, and whereby volatile aromatic substances are formed. These activities necessitate certain biochemical processes in the cells of the fruit being switched on or switched off.
  • One of the most studied changes in the metabolism is the production and the effects of ethylene, which plays a part mainly in climacteric fruit (for instance tomato, melon, apple, avocado, kiwi and banana).
  • ethylene is a prerequisite for ripening because it acts like a hormone that can activate transcription factors which, in turn, influence gene expression in the cell (so-called ethylene signaling route).
  • ⁇ -xylosidase ⁇ xyl
  • polygalacturonidase I and II PGI and PGII
  • putative cell wall peroxidase 424/87 87
  • Xyloglucan endotransglycosylase XET
  • actin marker M8 expansin and glucanases such as endo- ⁇ -l,4-glucanase, NADP-dependent D- sorbitol-6-phosphate dehydrogenase and/or alpha amylase.
  • the essence of the invention is first to develop a calibration line for each variety, whereby the expression of the above-mentioned genes (with respect to the ripeness of fruit) or other genes (with respect to other quality parameters mentioned hereinabove) is followed over the course of the ripening process. It can be determined here which of the above-mentioned genes have the best correlation with a quality feature after this path, in other words, which genes will be best determinative of the expectation with respect to the value of this quality feature. It appears that during ripening - in any case with some of the tested fruit varieties — as shown in the Examples, at a given moment, different genes yield the best correlation with, in this case, the quality feature hardness.
  • determining an expression profile of genes is used as is customary in the field of technology and relates to a method for measuring the transcriptional status (mRNA) or the translational status (protein) of one or more genes in a cell.
  • mRNA transcriptional status
  • protein translational status
  • available standard protocols can be used. In a number of cases, these will require small modifications if the tissue has a very thick cell wall or contains very many sugars. These protocols and modifications are part of the skilled person's knowledge.
  • an "expression profile” comprises one or more values that relate to a measurement of the relative presence of a gene expression product. Such values comprise measurements of RNA levels or protein concentrations. Therefore, the expression profile can comprise values that represent the measurement of the transcriptional status or the translational status of the gene. With respect to this, reference is made to U.S. Pat. Nos. 6,040,138, 5,800,992, 6,020,135, 6,344,316 and 6,033,860.
  • the transcriptional status of a sample comprises the identity and the relative occurrence of the RNAs, in particular mRNAs, present in the sample.
  • a sufficient number of genes are measured for determining the transcriptional status of the sample.
  • the transcriptional status can also be suitably determined by measuring the presence of transcript via any of the existing gene expression technologies.
  • the translational status comprises the identity and the relative occurrence of the constituent proteins in the sample.
  • a number of proteins sufficient for determining the translational status of the sample will suffice.
  • the transcriptional status and the translational status are often correlated.
  • Each value in the expression profiles, as determined and measured in the present invention is a measurement that represents the absolute or relative expression of a gene.
  • the expression levels of these genes can be determined via any method known in the field for determining the level of an RNA or a protein in a sample.
  • SAGE Serial Analysis of Gene Expression
  • TALEST Tandem Array Ligation of Expressed Sequence Tags
  • cDNA AFLP amplified fragment length polymorphism
  • micro-arrays can foe a DNA array, an oligonucleotide array or, in general terms, a nucleic acid array.
  • the skilled person will be able to obtain self-designed arrays and associated array reading equipment from specialized suppliers (for instance Affymetric Corp., Santa Clara, CA, USA). For monitoring a smaller number of transcripts, use can be made of:
  • Northern analysis this is one of the standard techniques for detection and quantification of mRNA levels. With this technique, the size of the mRNA and any alternative splicing and multigene families can be detected. With reverse transcription polymerase chain reaction (RT-PCR) analysis, mRNA molecules can be detected with high sensitivity because exponential amplification of the transcripts takes place, this technique is also called quantitative PCR. This technique is particularly suitable for highly accurate quantification of mRNA transcripts. Since with this technique very large numbers of samples can be analyzed, and this technique can also be automated (Applied Biosystems 7900HT system Foster City, USA), it is at present preferred for analyzing transcripts.
  • RT-PCR reverse transcription polymerase chain reaction
  • primers refers to DNA strands that can start the synthesis of DNA.
  • DNA polymerase cannot de novo synthesize DNA without primers: it can only lengthen an existing DNA strand in a reaction in which the complementary strand is used as template for dictating the sequential order of the nucleotide chain to be composed.
  • Primers serve for providing the DNA polymerase with a starting point for the amplification reaction. Consequently, primers are generally short nucleotide chains (oligonucleotides) with a length of approximately 10 to approximately 50 nucleotides.
  • primers are complementary to the gene sequence to be amplified and will therefore, presented in single-strand form to single-strand DNA or RNA, form duplex nucleotide chains with the target sequence by hybridization.
  • exact complementary nucleotide chains are required, but it appears that a sufficient hybridization is also effected if not all nucleotides are complementary, so-called 'mismatches'.
  • the capacity of primers to hybridize with the target sequence has also to do with the reaction conditions in which the hybridization takes place.
  • DNA amplification will be used to indicate the in vitro synthesis of double-strand DNA molecules with the aid of PCR or a comparable amplification system.
  • the amplifications required for the present invention can utilize a variety of amplification methods, such as the Polymerase Chain Reaction (PCR; Mullis 1987, U.S. Pat. No.
  • an amplification reaction can be carried out under conditions of reduced stringency (in other words, a PCR reaction using an annealing temperature of 38°C, or in the presence of 3.5 mM MgC12).
  • reduced stringency in other words, a PCR reaction using an annealing temperature of 38°C, or in the presence of 3.5 mM MgC12.
  • the skilled person will be able to select the proper stringency conditions.
  • a primer for a particular target sequence can be usable in determinations in several types of organisms. This is because different organisms, in particular different species and even different varieties within one species, often exhibit differences in the amino acid sequences of their proteins and/or in the nucleotide sequences of the genes that code for these proteins. By presently allowing small differences, one and the same primer can be used for the determination in several organisms. In the Examples, it is shown, for instance, that the primers are eminently suitable for determining marker genes and/or 'house-keeping genes' in different varieties within one species (for instance apple) and even for different species (apple and pear).
  • Relative transcription levels are calculated in relation to suitable controls, which are present in the sample.
  • Such controls are for instance constitutively expressed genes, such as, for instance, particular 'housekeeping 1 enzymes.
  • constitutive markers phosphoglycerate kinase (PGK, EC 2.7.2.3) or elongation factor l ⁇ (eFl ⁇ ), see also the Examples.
  • expression profiles can be determined on the basis of protein profiles.
  • techniques will be used with which very many protein profiles can be examined simultaneously.
  • An example thereof is gel electrophoresis.
  • proteins are first separated on the basis of their molecular weight.
  • a second separation can take place for a second dimension (2D) based on the isoelectric point of the proteins (pH gradient).
  • 2D isoelectric point of the proteins
  • the amino acid sequence of differentially expressed proteins can be determined with the aid of mass spectrography.
  • Another technique for examining many proteins simultaneously is the use of the so-called protein arrays (Ciphergen Biosystems, Fremont, CA, USA), whereby the amount of a great many different proteins and protein peptides can be quantified.
  • the amino acid sequence of the proteins can be determined.
  • the values in the expression profile are obtained by measuring the concentration of the protein products of the marker genes.
  • the concentration of these protein products can be determined through the use of, for instance, specific antibodies for these protein products.
  • antibody as used herein, relates to an immunoglobulin molecule or immunologically active part thereof, i.e. an antigen-binding part.
  • immunologically active parts of immunoglobulin molecules are, for instance, F(ab) and F(ab')2 fragments, which can be generated by treating the antibody with an enzyme such as pepsin.
  • the antibody can be a polyclonal, monoclonal, recombinant and for instance a chimeric or "single -chain" antibody. Detection of the gene product is facilitated by coupling the antibody to a detectable substance (i.e. labeling the antibody). Examples of detectable substances are inter alia various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials and radioactive materials.
  • suitable enzymes are inter alia horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase and acetyl choline esterase; examples of suitable prosthetic groups are inter alia streptavidin, or avidin and biotin; examples of suitable fluorescent materials are inter alia umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansylchloride and phycoerythrin; an example of a luminescent material is inter alia luminol; examples of bioluminescent materials are inter alia luciferase, luciferin and aequorin; and examples of suitable radioactive materials are inter alia 125 1, 131 I, 35 S and 3 H.
  • a calibration line can be made on which the expression of markers (mRNA or protein) can be plotted against the quality feature. This can be done prior to, during or after harvest. On the basis of the correlation of the markers with the feature, it is determined for a particular period of time which marker(s) correlates most (and hence is most reliable as a predictor).
  • Quality features that may be considered are, for instance: hardness of fruit, dormancy break in bulbous crops and vase life in cut flowers and other parameters mentioned in the introduction. It is of course important to keep the conditions before and after harvest as equal as possible to the conditions as will be used later.
  • a calibration line made with storage of fruit at 4°C will not be the same as the calibration line of fruit stored at 2O 0 C or room temperature.
  • a calibration line made at 4 0 C can be used for predicting the expected ripening of fruit at other temperatures because the measured expression indicates the extent of ripening. Inaccuracy is then caused in that it cannot be derived from the calibration line for how long storage under those other conditions is still needed (because the speed of ripening is different).
  • a calibration line that is specific for a particular situation is therefore preferred.
  • the calibration line should further indicate when it is expected that a product will meet a given quality criterion.
  • this negative quality parameter (which depends directly on the age of the leaf) can be predicted by markers involved in the process of leaf aging, which correlate with the extent of leaf yellowing, optionally in combination with markers with a higher expression in older leaves than in younger leaves and which correlate with the extent of leaf yellowing.
  • the quality parameter of "yellowing" in cucumber can be predicted in a manner comparable to that with pot plants by molecular markers during the harvest or during the postharvest path.
  • the taste can be given a quality value that is reproducible, the taste can be predicted during the harvest or the postharvest path by using a combination of markers involved in the biosynthesis of taste components and whose gene expression correlates with the degree of taste.
  • the present invention of determining markers of the ripeness and time of harvest and predicting the expected quality features is also applicable to all kinds of fruit for which the time of harvest and the duration of after-ripening are important factors for the consumability and the economic conditions regarding the making available of the fruit (transport, storage).
  • the invention may therefore be suitably used for the following kinds of fruit: citrus fruits such as orange, mandarin, lemon and minneola, melon, tomato, peach, plum, grape, currant, gooseberry, blackberry, raspberry, cherry, pineapple, mango, kiwi, litchi, banana, paprika, and avocado, including all varieties and cultivars thereof .
  • the invention is applicable to all agricultural or horticultural crops whose quality is for a large part determined by the time of harvest and the postharvest path.
  • crops that meet this criterion are the cut flowers, ornamental pot plants, bulbous plants and cucumbers already mentioned in the introduction, but further also virtually all other kinds of vegetables and grain, such as, for instance, lettuce, tomato, potato, alfalfa, asparagus, tapioca, yam, all kinds of cabbage (cauliflower, curly kale, Brussels sprouts, savoy cabbage, conical cabbage, and the like), chicory, (baby) carrots, winter carrot, pulses, wheat, maize, rice, oats, barley and plants which are used as herb, e.g.
  • the invention is applicable to crops that are not consumed as such but are used for the production of commercially important products, such as, for instance, fruits of the oil palm, olives, sugarcane, sugar beet, sunflowers, soybeans, coffee beans, cocoa beans, wood-producing plants, and all crops as mentioned on the website of the Food and Agriculture Organization (FAO) of the United Nations (http ://www .fao.org/ en http://faostat.fao.org/)
  • FEO Food and Agriculture Organization
  • Markers can be tested in an application lab (off-site) or on site in a simple (lab) environment.
  • samples In sending samples to an application lab, various possibilities exist.
  • a first possibility is for the samples to be brought fully intact to the application lab. This can be done, for instance, with (intact) fruit. As long as the transport conditions are not extreme (temperature differences, pressure on samples, etc.), transport will not affect the outcome of the tests.
  • the samples Upon arrival at the application lab, the samples need to be fixed as soon as possible, for instance by freezing in liquid nitrogen, or processed immediately for further analysis. In case of large numbers of samples, sampling, extraction and detection may be robotized.
  • the second possibility is testing samples in situ.
  • the number of steps and the complexity of the operations will have to be limited to allow the test to be performed by less trained persons.
  • the sample will have to be taken. In some cases, this may involve the whole product, but in most cases this will involve a part of the product. In the case of a portion of the product, this portion needs to be representative of the whole product. Thus, for instance a part of the flesh or a part of the leaf or the flower may be opted for. Thus, in case of fruit, a piece of skin or a cube of flesh may be taken to perform the test on. If a test is to relate to the quality of a whole batch of the respective product, a representative random sample needs to be taken from the batch.
  • the size of the random sample in relation to the size of the batch determines reliability. For determining the random sample size that is needed to realize a particular reliability, statistic calculation methods can be taken from specialist literature. Then, based on the random sample, a mixed sample can be made or various tests may be performed on each product sample. Individual determination of each sample then also enables determination of the spread in the batch. After this, the material will have to be fixed and extracted. This can be done by grinding, pressing or disruption of the cell wall in combination with chemicals (e.g. buffers), which ensure that the markers in the sample are not broken down. This may for instance involve FTA paper (Whatman International Ltd., England) but may also involve buffers with proteinase or RNAse inhibitors.
  • chemicals e.g. buffers
  • RNA markers generally other materials will be needed than for RNA markers. In some cases, first a purification of the markers will have to be done, in other cases direct detection of the markers will be possible. Highly suitable for rapid detection of proteins are lateral flow tests, which are directed against the proteins to be detected using antibodies (GenScript Corp. Piscataway, NJ, US; BioGenes GmbH Berlin, Germany). These tests can be easily made (Whatman International Ltd., England) and this technology is already in wide commercial use, for instance in the pregnancy tests obtainable by the consumer.
  • kits for detecting and predicting the expected quality features in fruit for instance the hardness of fruit, or predicting the expected harvest window or determining the suitable time of picking the fruit.
  • a kit will be specific for a particular variety of fruit and include means for the quantitative detection of the genes, pre-determined for that variety of fruit, that are predictive of the expected value of the quality feature, together with calibration lines of the expression pattern of those corresponding genes for that particular fruit variety, so that the measured expression pattern can be compared with the calibration lines and on the basis thereof a prediction can be made of the expected remaining ripening time and hence also a prediction can be made for the expected time of picking.
  • These calibration lines may also be included in an automated system, so that automatically the values that are generated by the measurement of the expression profile are plotted on these calibration lines and, as outcome, the prediction of the expected value of the quality feature is given.
  • This whole process including the measurement of the expression profile itself, can take place in an automated system.
  • This automated system then comprises the following elements: a) means for the measurement of the expression of a number of genes important for the determination of e.g.
  • ⁇ -xylosidase ⁇ xyl
  • polygalacturonidase I and II PGI and PGII
  • peroxidase 424/87 87
  • Xyloglucan endotransglycosylase XET
  • expansin and glucanases such as endo- ⁇ -l,4-glucanase, NADP-dependent D-sorbitol-6-phosphate dehydrogenase, alpha amylase
  • b) means for the measurement of the expression of control genes such as for instance house-keeping enzymes, such as phosphoglycerate kinase (PGK) or elongation factor lalpha (eFl ⁇ ) or other genes suitable therefor, such as described for instance in Nicot et al., J.
  • house-keeping enzymes such as phosphoglycerate kinase (PGK) or elongation factor lalpha (eFl ⁇ ) or other genes suitable therefor, such as described for instance in Nicot et al
  • c) means for determining the (relative) expression profile of the genes mentioned under (a); d) one or more calibration lines that represent the correlation of the expression profiles of one or more of the genes mentioned under a) and the hardness/ripening of the one or more fruit varieties; and e) means for interpreting the measured expression profiles of the one or more fruit varieties in relation to the associated calibration line(s) and on the basis thereof giving an indication about the ripeness of the one or more fruit varieties, which indication also involves an indication of the time that is needed until complete ripening and/or until the optimal time of harvest.
  • a test kit may be developed for predicting or determining the value of a specific quality feature for a specific agricultural or horticultural product.
  • the following markers must be available: minimally two markers, with preferably one of the two being a constitutive marker (with which the absolute expression can be derived).
  • the relation between the marker(s) and the feature is laid down in a model (calibration line).
  • This model describes the different expression levels of markers in time.
  • the model can be used inter alia in a computer program to correlate the determined expression levels to the quality/feature of the sample.
  • the quantification of the mRNA (gene expression) levels can take place with for instance quantitative PCR (Applied Biosystems, US).
  • the quantification of proteins can take place using antibodies in for instance a lateral flow immunoassay.
  • the measured data can then be entered (automatically or otherwise) in the computer model, whereupon the result of the test is generated. This result may then be displayed electronically or otherwise.
  • the invention also comprises a number of markers such as they have been found in the experiments described hereinbelow. This involves especially the marker M8, which is of importance in determining the hardness of fruit; the marker GAST (gibberellic acid stimulated transcript), which is of importance in determining the optimal time of lifting bulbs; and the marker GDSL-motif lipase, which is of importance in determining the vase life of cut flowers. As shown in the Examples, it is possible to use only a part of the genetic information of these markers for demonstrating the presence. The fact is that it is sufficient if primers against these marker target sequences can be composed, so that the marker can be amplified and demonstrated.
  • the invention accordingly comprises the marker sequences M8, GAST and GDSL motif lipase with a nucleotide sequence as indicated in the Examples and in the sequence listing (M8: SEQ ID NO: 13 and 14; GAST: SEQ ID NO: 21 and 22; GDSL-motif lipase: SEQ ID NO: 27 and 28, in which in each case the first represents the nucleotide sequence and the second the amino acid sequence).
  • M8 SEQ ID NO: 13 and 14
  • GAST SEQ ID NO: 21 and 22
  • GDSL-motif lipase SEQ ID NO: 27 and 28, in which in each case the first represents the nucleotide sequence and the second the amino acid sequence.
  • Both the nucleotide sequence and the protein sequence can, as described above, serve as marker.
  • sequences being identical to the sequences of SEQ ID NO: 14, 22 and 28, respectively, for more than 70%, preferably more than 80%, more preferably more than 90%, more preferably more than 95% and more preferably more than 98%.
  • identical sequence is usually expressed as a percentage and relates to the percentage of amino acid residues or nucleotides that are identical between two sequences if they are arranged optimally next to each other.
  • Also part of the invention is the use of the markers M8, GAST and GDSL-motif lipase for the determination of quality parameters in plants. More specifically, the use of M8 resides in the determination of the ripeness of fruit, in particular apples and/or pears, the use of GAST in the determination of the optimal time of lifting bulbs, in particular tulip, and the use of MDSL-motif lipase in the determination of the vase life of cut flowers, in particular rose.
  • the fragments as shown in the sequence listing can be used, or even, in turn, fragments thereof, but also the whole genes and/or proteins such as they occur by nature in the respective species can be used.
  • antibody further relates to antigen-binding forms of antibodies (e.g. Fab, F(ab)2).
  • antibody generally relates to a polypeptide that is substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof that specifically recognize an antigen and bind to it.
  • the different antibody fragments can be defined in terms of the parts of an intact antibody, the skilled person will realize that such fragments can also be synthesized de novo, either chemically or via recombinant DNA methodology.
  • antibody also comprises antibody fragments such as single chain Fv, also chimeric antibodies (i.e. antibodies that comprise constant and variable regions of different species), humanized antibodies (i.e. those antibodies comprising a CDR (complementarity determining region) not of human origin) and hetero- conjugated antibodies (e.g. bispecific antibodies).
  • chimeric antibodies i.e. antibodies that comprise constant and variable regions of different species
  • humanized antibodies i.e. those antibodies comprising a CDR (complementarity determining region) not of human origin
  • hetero- conjugated antibodies e.g. bispecific antibodies
  • the firmness of the fruit was determined.
  • other physiological parameters were determined, such as: color, starch content, sugar content and malic acid concentration.
  • Granny Smith (apple) is harvested early during ripening and does not ripen strongly (remains reasonably hard). Forelle is also harvested early but ripens strongly. If the pears are not harvested early, they fall off the tree because they are too heavy. Golden Delicious and Bon Chretien are harvested later in the ripening path and so ripen further on the tree.
  • texture markers betaxylosidase ( ⁇ xyl), polygalacturonase I (PGl), and putative Cell Wall peroxidase 424/87 (87) are relevant.
  • ⁇ xyl betaxylosidase
  • PGl polygalacturonase I
  • 87 putative Cell Wall peroxidase 424/87
  • Figure 1 shows that ripening in the different orchards starts at different moments. Especially the orchards Bo Radyn are ahead of the others. Later ripening may also be caused by the use of particular inhibitors such as e.g. Retain (an ethylene inhibitor).
  • Retain an ethylene inhibitor
  • the activities of all three markers have been combined, but this is not strictly necessary.
  • each of the above-mentioned markers is a good measure.
  • the values of the markers have each time been corrected by comparing them with the activity of a constitutive marker (phosphoglucerate kinase (PGK) or elongation factor 1 alpha (eFla).
  • PGK phosphoglucerate kinase
  • eFla elongation factor 1 alpha
  • the expected hardness upon arrival in the marketing area can be predicted at the moment of harvest, but also after the first storage, depending on the postharvest treatment, by determining the values of the texture markers during harvest or after the storage and comparing them with a calibration line.
  • the calibration line naturally differs depending on the treatment (e.g. refrigeration temperature, treatment with ethylene inhibitor and the like). It appears that there is an order in the effectiveness of the texture marker, depending on the moment in the ripening path. Early in the ripening path, ⁇ xyl is important, then PGl and then 424/87.
  • the ripening stage can be determined via a combination of texture markers.
  • what is involved is the combination of ⁇ xyl and PGl since in Granny Smith ripening proceeds slowly (see Fig. 4).
  • the expected hardness in the marketing area can especially be predicted via the value of the gene activity of the marker ⁇ xyl both during harvest and following brief storage. This is because ripening (and especially softening) in Granny Smith proceeds only very slowly (see Fig. 5). In apple cv. Golden Delicious, the situation is similar again (see Fig. 6).
  • This marker M8 has the following sequence (SEQ ID NO: 13): gtacatgttcaccactactgctgaacgggaaattgtccgtgatatgaaggagaagcttgcatatgttgctctggactatgagcaa gaacttgagactgccaagagcagctcttcagttgagaagaactatgagcttccccgatggccaagtcatcacaattggagctgag agattccggtgcccagaagtcctctttcaaccatctcttattggaatggaagctgctggcattcatgagactacttacaactctatc atgaagtgtgat
  • the course of the combined measuring values of the markers for the cultivars 'Prominence' and 'Apeldoorn' is represented in Fig. 11. From three weeks before the optimal time of harvest up to the optimal time of harvest that was determined in flowering tests, the course of the markers, plotted logarithmically against time, exhibits a virtually linear and reproducible pattern. The value of the marker was correlated with the value for the parameter of the flowering quality to determine at which value of the marker the optimal time of lifting was reached. For a particular cultivar, the linear course of the markers is identical; among the cultivars there is a difference in linear course. By combining measuring values from different years, per cultivar a reliable calibration line can be determined. On the basis of this calibration line, it is possible to predict the optimal time of lifting in a new season on the basis of only 1 or 2 measurements of samples that were taken in the field between 2 weeks and the expected time of lifting.
  • the marker GAST has the following nucleotide sequence (SEQ ID NO.-21):
  • the expression of the GAST marker becomes properly measurable from 3 weeks before the time of harvest. Prior to this point in time no reliable value for this marker can be obtained. From three weeks before harvest, expression increases exponentially and at the optimal time of harvest reaches a value that is the same in the three measured cultivars. After the optimal moment of harvest, this marker obtains a constant value.
  • the other markers, EIF4a and EFIA are constitutive genes whose expression does not vary at any of the measured times before, during and after harvest of tulip bulbs. The average values of these markers are used for normalization to allow comparison of measured series.
  • the gene found to be useful for this purpose is a GDSL-motif lipase in combination with a constitutive marker, in this case elongation factor l ⁇ , see Fig. 12. Also when the roses are stored at 4°C, the difference in vase life remains measurable. The values found are consistent between different cultivars and between different years of harvest. This marker was validated with RT-PCR. Use was made of the following primer sets to test all samples:
  • the GDSL-motiflipase has the followingsequence (the encoding reverse complementary strand is represented in SEQ ID NO:27): gtactacaatactactaaataccgtattatcatattgccactccatggtggaagtagaacatc cactgtagaaagcaaatgaagacttacctccagaatgcaattctaaacaacctaataagtaataactat acttagttgggcacaaacaaatatagtagctggggataaagccatatatcaacctatctaaagtgatagg aacctagatttataataatttttatgcectagctttcatatattaattgaaggaaattaaggaactggg tcaggacacgtttgactatgtaatcagagatgatctggttttgcttctctgtgggatggaaggaggg
  • the marker has the highest homology score with a possible GDSL- motif lipase/hydrolase from Arabidopsis (At2g04570). In Arabidopsis this gene is specifically expressed in buds and stomata.
  • PG phosphoglucerate kinase
  • eFla elongation factor 1 alpha
  • the expected hardness upon leaving the cold store after months of storage can be predicted at the moment of harvest, depending on the postharvest treatment, by determining the values of the texture markers after storage and comparing them with a calibration line.
  • the calibration line naturally differs depending on the treatment (e.g. refrigeration temperature, treatment with ethylene inhibitor and the like).
  • Figs. 9 and 10 clearly show that the hardness after storage of apple and pear has a clear relation with the value of these texture markers at the time of harvest. This holds again for both PG and ⁇ xyl.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention porte sur un procédé pour prédire la valeur attendue des caractéristiques de qualité dans un produit de l'agriculture et de l'horticulture, et sur un procédé pour prédire le temps optimal attendu de récolte par comparaison des paramètres d'expression au moment avant la récolte ou pendant le trajet de post-récolte de gènes et/ou de protéines apparentés à de telles caractéristiques de qualité pour ce produit de l'agriculture et de l'agriculture, avec une ou des lignes d'étalonnage prédéterminées. L'invention porte également sur les marqueurs M8, GAST et lipase à motif GDSL et sur leurs utilisations, ainsi que sur les anticorps dirigés contre ceux-ci.
PCT/NL2008/050097 2007-02-20 2008-02-20 Détermination de caractéristiques de qualité dans des récoltes en agriculture et horticulture WO2008103040A1 (fr)

Priority Applications (10)

Application Number Priority Date Filing Date Title
BRPI0807589-1A2A BRPI0807589A2 (pt) 2007-02-20 2008-02-20 Métodos para determinar marcadores genéticos ou de proteína/enzimáticos, para prognosticar o valor esperado de um traço de qualidade específico para um produto agrícola ou de horticultura, para prognosticar o valor esperado da qualidade com respeito a um traço de qualidade específico para um produto agrícola ou de horticultura, e para determinar o ponto de partida no tempo e o ponto final no tempo do tempo de colheita ótimo de um produto agrícola ou de horticultura, usos de marcador e lipase de motivo gdsl, e, anticorpo.
PL08712623T PL2134877T3 (pl) 2007-02-20 2008-02-20 Oznaczanie cech jakościowych w plonach rolnych i ogrodniczych
EP08712623.1A EP2134877B1 (fr) 2007-02-20 2008-02-20 Détermination de caractéristiques de qualité dans des récoltes en agriculture et horticulture
CN200880012753A CN101680028A (zh) 2007-02-20 2008-02-20 农作物和园艺作物品质特征的确定
ES08712623T ES2420836T3 (es) 2007-02-20 2008-02-20 Determinación de las características de calidad en cultivos agrícolas y hortícolas
AU2008217791A AU2008217791B2 (en) 2007-02-20 2008-02-20 Determination of quality features in agricultural and horticultural crops
US12/527,888 US8498819B2 (en) 2007-02-20 2008-02-20 Determination of quality features in agricultural and horticultural crops
NZ579197A NZ579197A (en) 2007-02-20 2008-02-20 Determination of quality features in agricultural and horticultural crops
CA002678804A CA2678804A1 (fr) 2007-02-20 2008-02-20 Determination de caracteristiques de qualite dans des recoltes en agriculture et horticulture
IL200516A IL200516A0 (en) 2007-02-20 2009-08-20 Determination of quality features in agricultural and horticultural crops

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
NL1033431 2007-02-20
NL1033431A NL1033431C2 (nl) 2007-02-20 2007-02-20 Bepaling van kwaliteitskenmerken bij land- of tuinbouwproducten.

Publications (1)

Publication Number Publication Date
WO2008103040A1 true WO2008103040A1 (fr) 2008-08-28

Family

ID=38515414

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2008/050097 WO2008103040A1 (fr) 2007-02-20 2008-02-20 Détermination de caractéristiques de qualité dans des récoltes en agriculture et horticulture

Country Status (15)

Country Link
US (1) US8498819B2 (fr)
EP (1) EP2134877B1 (fr)
CN (1) CN101680028A (fr)
AR (1) AR065409A1 (fr)
AU (1) AU2008217791B2 (fr)
BR (1) BRPI0807589A2 (fr)
CA (1) CA2678804A1 (fr)
ES (1) ES2420836T3 (fr)
IL (1) IL200516A0 (fr)
NL (1) NL1033431C2 (fr)
NZ (1) NZ579197A (fr)
PL (1) PL2134877T3 (fr)
RU (1) RU2009134951A (fr)
WO (1) WO2008103040A1 (fr)
ZA (1) ZA200905929B (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015000983A1 (fr) * 2013-07-04 2015-01-08 Stichting Dienst Landbouwkundig Onderzoek Procédé de détermination de la durée de vie en vase ou de l'historique de stockage d'une ou plusieurs fleurs coupées par dosage de la concentration de xylose ou de l'expression /l'activité de la bêta-xylosidase
CN104774917A (zh) * 2014-12-30 2015-07-15 甘肃省农业科学院蔬菜研究所 一种甜瓜低化瓜率种质的筛选方法及其所用pcr引物

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130185104A1 (en) * 2010-10-05 2013-07-18 Maris Klavins System and method of providing agricultural pedigree for agricultural products throughout production and distribution and use of the same for communication, real time decision making, predictive modeling, risk sharing and sustainable agriculture
US10977748B2 (en) * 2015-09-24 2021-04-13 International Business Machines Corporation Predictive analytics for event mapping
EP3937633A1 (fr) * 2019-03-11 2022-01-19 National Institute of Plant Genome Research Procédé d'extension de la durée de conservation de produits agricoles
CN110904081B (zh) * 2019-11-20 2021-07-30 江苏省中国科学院植物研究所 一种內切葡聚糖酶RuEG6及其编码基因与应用
EP4364575A1 (fr) * 2022-11-03 2024-05-08 Nature's Pride Procédé, dispositif et installation pour la maturation de fruits climatériques
CN117330207A (zh) * 2023-09-14 2024-01-02 华中农业大学 一种基于对仿真果实测量温度校正的猕猴桃果心温度的测定方法

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
EP0320308A2 (fr) 1987-12-11 1989-06-14 Abbott Laboratories Procédé pour détecter une séquence cible d'acide nucléique
US5270184A (en) 1991-11-19 1993-12-14 Becton, Dickinson And Company Nucleic acid target generation
US5455166A (en) 1991-01-31 1995-10-03 Becton, Dickinson And Company Strand displacement amplification
US5719028A (en) 1992-12-07 1998-02-17 Third Wave Technologies Inc. Cleavase fragment length polymorphism
US5871921A (en) 1994-02-16 1999-02-16 Landegren; Ulf Circularizing nucleic acid probe able to interlock with a target sequence through catenation
US5942391A (en) 1994-06-22 1999-08-24 Mount Sinai School Of Medicine Nucleic acid amplification method: ramification-extension amplification method (RAM)
WO2002016613A2 (fr) * 2000-08-22 2002-02-28 Instituto De Ciencia Aplicada E Tecnologia (Icat) Genes de poires codant la $g(b)-galactosidase, la pectine methylesterase, la polygalacturonase, des expansines et leur utilisation
WO2008018791A1 (fr) * 2006-08-07 2008-02-14 Agrotechnology And Food Innovations B.V. Diagnostics de qualité basés sur la génomique pour prédire un adoucissement à froid pendant le stockage lors du traitement de pommes de terre

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2407559A3 (fr) * 2006-08-07 2012-03-21 Nsure Holding B.V. Diagnostic de qualité à base de génomique pour produits agricoles frais

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202B1 (fr) 1985-03-28 1990-11-27 Cetus Corp
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (fr) 1986-01-30 1990-11-27 Cetus Corp
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
EP0320308A2 (fr) 1987-12-11 1989-06-14 Abbott Laboratories Procédé pour détecter une séquence cible d'acide nucléique
US5455166A (en) 1991-01-31 1995-10-03 Becton, Dickinson And Company Strand displacement amplification
US5270184A (en) 1991-11-19 1993-12-14 Becton, Dickinson And Company Nucleic acid target generation
US5719028A (en) 1992-12-07 1998-02-17 Third Wave Technologies Inc. Cleavase fragment length polymorphism
US5871921A (en) 1994-02-16 1999-02-16 Landegren; Ulf Circularizing nucleic acid probe able to interlock with a target sequence through catenation
US5942391A (en) 1994-06-22 1999-08-24 Mount Sinai School Of Medicine Nucleic acid amplification method: ramification-extension amplification method (RAM)
WO2002016613A2 (fr) * 2000-08-22 2002-02-28 Instituto De Ciencia Aplicada E Tecnologia (Icat) Genes de poires codant la $g(b)-galactosidase, la pectine methylesterase, la polygalacturonase, des expansines et leur utilisation
WO2008018791A1 (fr) * 2006-08-07 2008-02-14 Agrotechnology And Food Innovations B.V. Diagnostics de qualité basés sur la génomique pour prédire un adoucissement à froid pendant le stockage lors du traitement de pommes de terre

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., J. MOL. BIOL, vol. 215, no. 3, 1990, pages 403 - 10
BARANY, PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 189 - 193
CRISOTO, C.H., POSTHARVEST NEWS AND INF., vol. 5, no. 6, 1994, pages 65N - 68N
DATABASE EMBL [online] 9 March 2005 (2005-03-09), "Pyrus communis PcACT mRNA for actin, partial cds.", XP002482617, retrieved from EBI accession no. EMBL:AB190176 Database accession no. AB190176 *
DATABASE UniProt [online] 12 April 2005 (2005-04-12), "Actin (Fragment). pyrrus communis (pear)", XP002482616, retrieved from EBI accession no. UNIPROT:Q5CCU0 Database accession no. Q5CCU0 *
DATABASE UniProt [online] 28 November 2006 (2006-11-28), "Actin (Fragment). from Rosa hybrid", XP002482615, retrieved from EBI accession no. UNIPROT:A0A7Z5 Database accession no. A0A7Z5 *
DE BENEDETTI, BURCHI, BRUNA, MERCURI AND SCHIVA: "Use of molecular markers to improve cut flowers longevity in carnation", ACTA HORT, 2003, XP008092365 *
GOLDING ET AL., STEWART POSTHARVEST REVIEW, vol. 3, 2005, pages 5
GUATELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 - 1878
KWOH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, pages 1173 - 1177
LIZARDI ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1197
NICOT ET AL., J. EXP. BOTANY, vol. 56, 2005, pages 2907 - 2914
NICOT ET AL., JOURNAL OFEXPERIMENTAL BOTANY, vol. 56, 2005, pages 2907 - 2914
OWINO, W.O. ET AL., STEWART POSTHARVEST REVIEW, vol. 3, 2005, pages 5
PARK SUNCHUNG ET AL: "Identification of genes with potential roles in apple fruit development and biochemistry through large-scale statistical analysis of expressed sequence tags", PLANT PHYSIOLOGY (ROCKVILLE), vol. 141, no. 3, July 2006 (2006-07-01), pages 811 - 824, XP002459420, ISSN: 0032-0889 *
PLANT MOLECULAR BIOLOGY REPORTER, vol. 11, no. 2, 1993, pages 113 - 116
REID, M.S.: "Peaches, Plums and nectarines: Growing and Handling for Fresh Market.", 1992, NAT. RESOURC. PUBL. NR. 3331, pages: 21 - 28
VAN WORDRAGEN,BALK, HALL, NIJENHUIS, VAN DEN BROECK, VORST, AND POELMAN: "Applied Genomics - An innovative tool to improve quality in chains", 2003, ACTA HORTICULTURAE, ISBN: 978-90-66059-76-4, XP002459421, 604 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015000983A1 (fr) * 2013-07-04 2015-01-08 Stichting Dienst Landbouwkundig Onderzoek Procédé de détermination de la durée de vie en vase ou de l'historique de stockage d'une ou plusieurs fleurs coupées par dosage de la concentration de xylose ou de l'expression /l'activité de la bêta-xylosidase
CN104774917A (zh) * 2014-12-30 2015-07-15 甘肃省农业科学院蔬菜研究所 一种甜瓜低化瓜率种质的筛选方法及其所用pcr引物

Also Published As

Publication number Publication date
AU2008217791B2 (en) 2013-11-28
US8498819B2 (en) 2013-07-30
PL2134877T3 (pl) 2013-09-30
NL1033431C2 (nl) 2008-08-21
EP2134877B1 (fr) 2013-04-24
CN101680028A (zh) 2010-03-24
AU2008217791A1 (en) 2008-08-28
US20100273155A1 (en) 2010-10-28
BRPI0807589A2 (pt) 2014-07-01
IL200516A0 (en) 2010-04-29
CA2678804A1 (fr) 2008-08-28
ES2420836T3 (es) 2013-08-27
RU2009134951A (ru) 2011-03-27
AR065409A1 (es) 2009-06-03
EP2134877A1 (fr) 2009-12-23
ZA200905929B (en) 2010-05-26
NZ579197A (en) 2012-10-26

Similar Documents

Publication Publication Date Title
AU2008217791B2 (en) Determination of quality features in agricultural and horticultural crops
US20160376667A1 (en) Quality control of agricultural products based on gene expression
Dubos et al. Identification and characterization of water-stress-responsive genes in hydroponically grown maritime pine (Pinus pinaster) seedlings
Weiss et al. Transcriptomic analysis of cold response in tomato fruits identifies dehydrin as a marker of cold stress
Miles et al. Identification of differentially expressed genes in a resistant versus a susceptible blueberry cultivar after infection by Colletotrichum acutatum
Pimentel et al. Isolation of genes differentially expressed during development and ripening of Fragaria chiloensis fruit by suppression subtractive hybridization
Jones et al. Gene discovery and microarray analysis of cacao (Theobroma cacao L.) varieties
Xu et al. Transcriptome analysis reveals a regulation of ethylene-induced post-harvest senescence in pear fruit
Waters et al. The ripening wine grape berry skin transcriptome
Favre et al. Maturity biomarkers predicting storage performance of early-harvested yellow-fleshed kiwifruit identified using integrated multi-omics analysis
KR20130082080A (ko) 식물 세포에서 유전자 및 단백질의 야생형 발현을 변경시키는 조성물을 확인하는 방법
JP5652778B2 (ja) 青果物の鮮度評価方法および鮮度評価用プライマーセット
RU2756130C2 (ru) Способ селекции генотипов земляники садовой на содержание антоцианов с помощью молекулярных маркеров
Busatto et al. Peach ripening transcriptomics unveils new and unexpected targets for the improvement of drupe quality
Keller-Przybyłkowicz et al. Changes in gene expression profile during fruit development determine fruit quality.
Zhang et al. Genome-wide isolation and expression analysis of vacuolar processing enzyme (VPE) gene family in four apple cultivars with different storability
Bump Fruit and Flavor Development in Vanilla planifolia
Cukrov Molecular characterization of fruit responses to low oxygen
Ezura Genetic engineering of melon (Cucumis melo L.)
Manganaris et al. A preliminary transcriptomic approach to elucidate post harvest ripening of plum fruit
Lin Transcript profiling as a method to study fruit maturation, tree-ripening, and the role of “tree factor” in ‘Gala’and ‘Fuji’apples
Bonghi et al. EFFECT OF COOL STORAGE DURATION ON RIPENING INITIATION OF'ANGELYS®'PEAR FRUIT
Bonghi et al. A preliminary transcriptomic approach to elucidate post harvest ripening of plum fruit
Buchanan Genetic determinants of texture in strawberry fruits
De Laethauwer Molecular approach of pre-harvest sprouting in Triticale

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880012753.7

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08712623

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 200516

Country of ref document: IL

Ref document number: 2678804

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 579197

Country of ref document: NZ

Ref document number: 2008217791

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2008217791

Country of ref document: AU

Date of ref document: 20080220

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 5530/CHENP/2009

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2009134951

Country of ref document: RU

Ref document number: 2008712623

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12527888

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0807589

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20090820