WO2008102198A1 - Laglidadg homing endonuclease variants having novel substrate specificity and use thereof - Google Patents
Laglidadg homing endonuclease variants having novel substrate specificity and use thereof Download PDFInfo
- Publication number
- WO2008102198A1 WO2008102198A1 PCT/IB2007/001527 IB2007001527W WO2008102198A1 WO 2008102198 A1 WO2008102198 A1 WO 2008102198A1 IB 2007001527 W IB2007001527 W IB 2007001527W WO 2008102198 A1 WO2008102198 A1 WO 2008102198A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- positions
- variant
- dna
- anyone
- crel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
- A61P39/04—Chelating agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
Definitions
- the invention relates to a method for engineering LAGLIDADG homing endonuclease variants having novel substrate specificity.
- the invention relates also to a variant obtainable by said method, to a vector encoding said variant, to a cell, an animal or a plant modified by said vector and to the use of said homing endonuclease variant and derived products for genetic engineering, genome therapy and antiviral therapy.
- Meganucleases are by definition sequence-specific endonucleases with large (12-45 bp) cleavage sites that can deliver DNA double-strand breaks (DSBs) at specific loci in living cells (EMS, A. and Dujon B., Nucleic Acids Res., 1992, 20, 5625-5631). Meganucleases have been used to stimulate homologous recombination in the vicinity of their target sequences in cultured cells and plants (Rouet et al, MoI. Cell. Biol, 1994, 14, 8096-8106; Choulika et al, MoI. Cell. Biol., 1995, 15, 1968-1973; Donoho et al, MoI. Cell.
- meganuclease-induced recombination has long been limited by the repertoire of natural meganucleases, and the major limitation of the current technology is the requirement for the prior introduction of a meganuclease cleavage site in the locus of interest.
- the engineering of redesigned meganucleases cleaving chosen targets is under intense investigation.
- Such proteins could be used to cleave genuine chromosomal sequences and open new perspectives for genome engineering in wide range of applications.
- meganucleases could be used to knock-out endogenous genes or knock-in exogenous sequences in the chromosome.
- Zinc-Finger DNA binding domains of Cys2-His2 type Zinc-Finger Proteins were fused with the catalytic domain of the Fokl endonuclease, to induce recombination in various cell types: mammalian cultured cells including human lymphoid cells, plants and insects (Smith et al, Nucleic Acids Res, 1999, 27, 674-81; Pabo et al, Annu. Rev.
- meganucleases are essentially represented by homing endonucleases (HEs), a family of endonucleases encoded by mobile genetic elements, whose function is to initiate DNA double-strand break (DSB)-induced recombination events in a process referred to as homing (Chevalier, B. S. and Stoddard, B.L., Nucleic Acids Res., 2001, 29, 3757-3774; Kostriken et al, Cell; 1983, 35, 167-174; Jacquier, A. and Dujon, B., Cell, 1985, 41, 383-394).
- HEs Several hundreds of HEs have been identified in bacteria, eukaryotes, and archea (Chevalier, B. S. and Stoddard, BX. , Nucleic Acids Res., 2001, 29, 3757-3774); however the probability of finding a HE cleavage site in a chosen gene is very low.
- HEs Given their biological function and their exceptional cleavage properties in terms of efficacy and specificity, HEs provide ideal scaffolds to derive novel endonucleases for genome engineering. Furthermore, in addition to their extraordinar specificity, homing endonuclease have shown to be less toxic than ZFPs, probably because of better specificity (Alwin et al, MoI. Ther., 2005, 12, 610-617; Porteus, M.H. and Baltimore, D., Science, 2003, 300, 763; Porteus, M.H. and Carroll, D., Nat. BiotechnoL, 2005, 23, 967-973), two features that become essential when engaging into therapeutic applications.
- LAGLIDADG refers to the only sequence actually conserved throughout the family, and is found in one or (more often) two copies in the protein. Proteins with a single motif, such as ⁇ -Crel (Wang et al, Nucleic Acids Res., 1997, 25, 3767-3776) form homodimers and cleave palindromic or pseudo-palindromic DNA sequences, whereas the larger, double motif proteins, such as l-Scel (Jacquier, A.
- LAGLIDADG proteins have been crystallized with or without bound DNA, showing a very striking core structure conservation that contrasts with the lack of similarity at the primary sequence level (Heath et al, Nature Struct. Biol., 1997, 4, 468-476; Duan et al, Cell, 1997, 89, 555-564; Silva et al, J. MoI.
- LAGLIDADG ⁇ -helices On either side of the LAGLIDADG ⁇ -helices, a four stranded ⁇ -sheet, forming a saddle on the DNA helix major groove, provides a DNA binding interface that drives the interaction of the protein with a half site of the target DNA sequence (Chevalier et al, Nat. Struct. Biol, 2001, 8, 312-316; Jurica et al, MoI. Cell, 1998, 2, 469-476).
- the catalytic site is central, formed with contributions from helices of both monomers.
- the two LAGLIDADG ⁇ -helices play also an essential role in the dimerization interface.
- this region allows also the engineering of homing endonucleases which are less toxic.
- the invention relates to a method for engineering a LAGLIDADG homing endonuclease variant having novel substrate specificity, comprising at least the following steps:
- step (a) the mutation of at least one amino acid residue of the final C- terminal loop of a parent LAGLIDADG homing endonuclease, with the exclusion of the threonine 140 (Tl 40) of 1-OeI, and (b) the selection and/or screening of the variants from step (a) having a pattern of cleaved DNA targets that is different from that of the parent LAGLIDADG homing endonuclease.
- - hydrophobic amino acid refers to leucine (L), valine (V), isoleucine (I), alanine (A), methionine (M), phenylalanine (F), tryptophane (W) and tyrosine (Y).
- nucleosides are designated as follows: one-letter code is used for designating the base of a nucleoside: a is adenine, t is thymine, c is cytosine, and g is guanine.
- r represents g or a (purine nucleotides)
- k represents g or t
- s represents g or c
- w represents a or t
- m represents a or c
- y repre- sents t or c pyrimidine nucleotides
- d represents g, a or t
- v represents g, a or c
- b represents g, t or c
- h represents a, t or c
- n represents g, a, t or c.
- parent LAGLIDADG hominfi endonuclease is intended a wild- type LAGLIDADG homing endonuclease or a functional variant thereof. Said parent
- LAGLIDADG homing endonuclease may be a monomer, a dimer (homodimer or heterodimer) comprising two LAGLIDADG homing endonuclease core domains which are associated in a functional endonuclease able to cleave a double-stranded DNA target of 22 to 24 bp.
- - by "homodimeric LAGLIDADG homing endonuclease” is intended a wild-type homodimeric LAGLIDADG homing endonuclease having a single LAGLIDADG motif and cleaving palindromic DNA target sequences, such as l-Crel or I-Mr ⁇ l or a functional variant thereof.
- LAGLIDADG homing endonuclease variant or “variant” is intended a protein obtained by replacing at least one amino acid of a LAGLIDADG homing endonuclease sequence, with a different amino acid.
- - by “functional variant” is intended a LAGLIDADG homing endonuclease variant which is able to cleave a DNA target, preferably a new DNA target which is not cleaved by a wild-type LAGLIDADG homing endonuclease .
- such variants have amino acid variation at positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target.
- homose variant with novel specificity is intended a variant having a pattern of cleaved targets (cleavage profile) different from that of the parent homing endonuclease.
- the variants may cleave less targets (restricted profile) or more targets than the parent homing endonuclease.
- the variant is able to cleave at least one target that is not cleaved by the parent homing endonuclease.
- novel specificity refers to the specificity of the variant towards the nucleotides of the DNA target sequence.
- I-Crel is intended the wild-type ⁇ -Crel having the sequence SWISSPROT P05725 or pdb accession code Ig9y.
- domain or “core domain” is intended the “LAGLIDADG homing endonuclease core domain” which is the characteristic ⁇ i ⁇ ] ⁇ 2 ⁇ 2 ⁇ 3 ⁇ 4 ⁇ c 3 fold of the homing endonucleases of the LAGLIDADG family, corresponding to a sequence of about one hundred amino acid residues.
- Said domain comprises four beta-strands ( ⁇ i, ⁇ 2; ⁇ 3 , ⁇ 4 ) folded in an antiparallel beta-sheet which interacts with one half of the DNA target.
- This domain is able to associate with another LAGLIDADG homing endonuclease core domain which interacts with the other half of the DNA target to form a functional endonuclease able to cleave said DNA target.
- the LAGLIDADG homing endonuclease core domain corresponds to the residues 6 to 94.
- two such domains are found in the sequence of the endonuclease; for example in l-Dmol (194 amino acids), the first domain (residues 7 to 99) and the second domain (residues 104 to 194) are separated by a short linker (residues 100 to 103).
- - by "subdomain" is intended the region of a LAGLIDADG homing endonuclease core domain which interacts with a distinct part of a homing endonuclease DNA target half-site.
- Two different subdomains behave independently and the mutation in one subdomain does not alter the binding and cleavage properties of the other subdomain. Therefore, two subdomains bind distinct part of a homing endonuclease DNA target half-site.
- beta-hairpin is intended two consecutive beta-strands of the antiparallel beta-sheet of a LAGLIDADG homing endonuclease core domain ( ⁇ i ⁇ 2 or, ⁇ 3 ⁇ 4 ) which are connected by a loop or a turn, - by "DNA target”, “DNA target sequence”, “target sequence” ,
- target-site a target
- target a site
- site a site
- recognition site a recognition site
- cleavage site a 22 to 24 bp double- stranded palindromic, partially palindromic (pseudo-palindromic) or non-palindromic polynucleotide sequence that is recognized and cleaved by a LAGLIDADG homing endonuclease.
- These terms refer to a distinct DNA location, preferably a genomic location, at which a double stranded break (cleavage) is to be induced by the endonuclease.
- the DNA target is defined by the 5' to 3' sequence of one strand of the double-stranded polynucleotide.
- the palindromic DNA target sequence cleaved by wild-type I-Oel presented in figure 8 is defined by the sequence 5'- t ⁇ c. i ia.ioa.9a.8a-7C-6g.5t-4C.3g.2t.ia+ic+2g+3a+4C+5g+6tf7t+8t+9tnog+i ia+i2 (SEQ ID NO :1).
- Cleavage of the DNA target occurs at the nucleotides in positions +2 and -2, respectively for the sense and the antisense strand.
- DNA target half-site By “DNA target half-site”, “half cleavage site” or half-site” is intended the portion of the DNA target which is bound by each LAGLIDADG homing endonuclease core domain.
- chimeric DNA targef'or hybrid DNA target is intended the fusion of a different half of two parent meganuclease target sequences.
- at least one half of said target may comprise the combination of nucleotides which are bound by separate subdomains (combined DNA target).
- vector is intended a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- mutation is intended the substitution, the deletion, and/or the addition of one or more nucleotides/amino acids in a nucleic acid/amino acid sequence.
- homologous is intended a sequence with enough identity to another one to lead to a homologous recombination between sequences, more particularly having at least 95 % identity, preferably 97 % identity and more preferably 99 %.
- Identity refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences.
- Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or BLAST which are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default settings.
- - "individual” includes mammals, as well as other vertebrates (e.g., birds, fish and reptiles).
- mammalian species include humans and other primates (e.g., monkeys, chimpanzees), rodents (e.g., rats, mice, guinea pigs) and ruminants (e.g., cows, pigs, horses).
- primates e.g., monkeys, chimpanzees
- rodents e.g., rats, mice, guinea pigs
- ruminants e.g., cows, pigs, horses.
- genetic disease refers to any disease, partially or completely, directly or indirectly, due to an abnormality in one or several genes.
- Said abnormality can be a mutation, an insertion or a deletion.
- Said mutation can be a punctual muta- tion.
- Said abnormality can affect the coding sequence of the gene or its regulatory sequence.
- Said abnormality can affect the structure of the genomic sequence or the structure or stability of the encoded mRNA.
- Said genetic disease can be recessive or dominant.
- Such genetic disease could be, but are not limited to, cystic fibrosis, Huntington's chorea, familial hypercholesterolemia (LDL receptor defect), hepatoblastoma, Wilson's disease, congenital hepatic porphyrias, inherited disorders of hepatic metabolism, Lesch Nyhan syndrome, sickle cell anemia, thalassaemias, xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, Duchenne's muscular dystrophy, and Tay-Sachs disease.
- the amino acids of the final C-terminal loop correspond to positions 137 to 143 in l-Crel amino acid sequence SEQ ID NO: 2 or Swissprot P05725. Knowing the positions of the final C-terminal loop in l-Crel, one skilled in the art can easily deduce the corresponding positions in another homodimeric LAGLIDADG homing endonuclease, using well-known protein structure analyses softwares such as Pymol. For example, for l-Msol, the final C- terminal loop corresponds to positions 143 to 149.
- step (a) comprises the mutation of amino acid residue(s) of the final C-terminal loop that are contacting the phosphate backbone of the parent LAGLIDADG endonuclease DNA cleavage site (wild-type LAGLIDAG endonuclease homing site).
- said residues are involved in binding and cleavage of said DNA cleavage site. More preferably, said residues are in positions 138, 139, 142 or 143, by reference to the numbering of I-Crd amino acid sequence (SEQ ID NO: 2; figure T). Two residues may be mutated in one variant provided that each mutation is in a different pair of residues chosen from the pair of residues in positions 138 and 139 and the pair of residues in positions 142 and 143.
- the mutations which are introduced modify the interaction(s) of said amino acid(s) of the final C-terminal loop with the phosphate backbone of the parent LAGLIDADG endonuclease DNA cleavage site.
- the mutation in step (a) is a substitution of at least one amino acid of said final C-terminal loop, with a different amino acid.
- the residue in position 138 or 139 is substituted by an hydrophobic amino acid to avoid the formation of hydrogen bonds with the phosphate backbone of the DNA cleavage site.
- the residue in position 138 is substituted by an alanine or the residue in position 139 is substituted by a methionine.
- the residue in position 142 or 143 is advantageously substituted by a small amino acid, for example a glycine, to decrease the size of the side chains of these amino acid residues.
- the mutation(s) in step (a) are introduced in either a wild-type LAGLIDADG homing endonuclease or a functional variant thereof.
- the wild-type LAGLIDADG homing endonuclease is advantageously homodimeric. Examples of wild-type homodimeric LAGLIDAG homing endonucleases are presented in Table 1 of Lucas et al, Nucleic Acids Res., 2001, 29, 960-969.
- the wild-type homodimeric LAGLIDADG homing endonuclease may be advantageously selected from the group consisting of : 1-OeI, 1-Ceu ⁇ , 1-Mso ⁇ and l-Cpa ⁇ , preferably I-Crel.
- the functional variant comprises additional mutations outside the final C-terminal loop, preferably in positions of amino acid residues which interact with a DNA target half-site.
- the LAGLIDADG homing endonucleases DNA interacting residues are well-known in the art.
- the residues which are mutated may interact with the DNA backbone or with the nucleotide bases, directly or via a water molecule.
- Preferably said mutations modify the cleavage specificity of the meganuclease and result in a meganuclease with novel specificity, which is able to cleave a DNA target from a gene of interest.
- said mutations are substitutions of one or more amino acids in a first functional subdomain corresponding to that situated from positions 26 to 40 of l-Crel amino acid sequence, that alter the specificity towards the nucleotide in positions ⁇ 8 to 10 of the DNA target, and/or substitutions in a second functional subdomain corresponding to that situated from positions 44 to 77 of l-Crel amino acid sequence, that alter the specificity towards the nucleotide in positions ⁇ 3 to 5 of the DNA target, as described previously (International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et al, J. MoI.
- variant 4 is a or n +4 is t, said variant has an alanine (A) or an asparagine in position 44, and for cleaving a DNA target, wherein n -9 is g or n +9 is c, said variant has advantageously an arginine (R) or a lysine (K) in position 38.
- A alanine
- R arginine
- K a lysine
- the parent LAGLIDADG homing endonuclease is an l-Crel variant having mutations in positions 26 to 40 and 44 to 77 of I-Crel and cleaving a palindromic DNA sequence, wherein at least the nucleotides in positions +3 to +5 and +8 to +10 or -10 to -8 and -5 to -3 of one half of said DNA sequence correspond to the nucleotides in positions +3 to +5 and +8 to +10 or -10 to -8 and -5 to -3 of one half of a DNA target from a gene of interest.
- step (a) are introduced according to standard mutagenesis methods which are well-known in the art and commercially available. They may be advantageously produced by amplifying overlapping fragments comprising the mutated position(s), as defined above, according to well-known overlapping PCR techniques. Libraries of variants having amino acid variation in the final C-terminal loop may be generated according to standard methods.
- Step (a) may comprise the introduction of additional mutations at other positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target, as defined above.
- This step may be performed by generating combinatorial libraries as described in the International PCT Application WO 2004/067736, Arnould et al, J. MoI. Biol., 2006, 355, 443-458 and Smith et al, Nucleic Acids Res., Epub 27 November 2006 and eventually, combining said mutations intramolecularly, by amplifying overlapping fragments comprising each of the mutations, according to well-known overlapping PCR techniques.
- random mutations may also be introduced on the whole variant or in part of the variant, in particular the C-terminal half of the variant (positions 80 to 163 of I-Crel amino acid sequence SEQ ID NO:2) in order to improve the binding and/or cleavage properties of the variant towards a DNA target from a gene of interest.
- the additional mutations (random or site-specific) and the mutation(s) in the final C-terminal loop may be introduced simultaneously or subsequently.
- one or more residues may be inserted at the NH 2 terminus and/or COOH terminus of the variant monomer(s)/domain(s).
- a methionine residue is introduced at the NH 2 terminus
- a tag epipe or polyhistidine sequence
- said tag is useful for the detection and/or the purification of the meganuclease.
- the selection and/or screening in step (b) may be performed by using a cleavage assay in vitro or in vivo, as described in the International PCT Application WO 2004/067736.
- step (b) is performed in vivo, under conditions where the double-strand break in a mutated DNA target sequence which is generated by said variant leads to the activation of a positive selection marker or a reporter gene, or the inactivation of a negative selection marker or a reporter gene, by recombination-mediated repair of said DNA double- strand break.
- the cleavage activity of the variant of the invention may be measured by a direct repeat recombination assay, in yeast or mammalian cells, using a reporter vector, as described in the PCT Application WO 2004/067736; Epinat et al, Nucleic Acids Res., 2003, 31, 2952-2962; Chames et al., Nucleic Acids Res., 2005, 33, el 78, and Arnould et al, J. MoI. Biol., 2006, 355, 443-458.
- the reporter vector comprises two truncated, non-functional copies of a reporter gene (direct repeats) and a chimeric DNA target sequence within the intervening sequence, cloned in a yeast or a mammalian expression vector.
- the DNA target sequence is derived from the parent homing endonuclease cleavage site by replacement of at least one nucleotide by a different nucleotide.
- a panel of palindromic or non- palindromic DNA targets representing the different combinations of the 4 bases (g, a, c, t) at one or more positions of the DNA cleavage site is tested (4 n palindromic targets for n mutated positions).
- variants results in a functional endonuclease which is able to cleave the DNA target sequence. This cleavage induces homologous recombination between the direct repeats, resulting in a functional reporter gene, whose expression can be monitored by appropriate assay.
- step (b) comprises the selection and/or screening of the variants from step (a) which are able to cleave at least one DNA target sequence that is not cleaved by said parent LAGLIDADG homing endonuclease, said DNA target sequence being derived from the parent LAGLIDADG homing endonuclease cleavage site, by the replacement of at least one nucleotide of one half of said cleavage site, with a different nucleotide.
- the parent DNA target may be palindromic, non-palindromic or pseudo-palindromic.
- said DNA target sequence is derived from the I-Crel palindromic site having the sequence SEQ ID NO: 1. More preferably, said DNA target has nucleotide mutation(s) in positions ⁇ 1 to 2, ⁇ 6 to 7, ⁇ 8 to 10 and/or ⁇ 11 to 12, still more preferably in positions ⁇ 1 to 2, ⁇ 6 to 7 and/or ⁇ 11 to 12.
- it comprises a further step (c) of expressing one variant obtained in step (b), so ' as to allow the formation of homodimers. Said homodimers are able to cleave a palindromic or pseudo-palindromic target sequences.
- the assembly of functional heterodimers by co- expression of two different LAGLIDADG endonucleases monomers has been described previously in Arnould et al, J. MoI. Biol., 2006, 355, 443-458; International PCT Applications WO 2006/097853, WO 2006/097854 and WO 2006/097784; Smith et al, Nucleic Acids Res., Epub 27 November 2006.
- two different variants obtained in step (b) are co-expressed.
- Said heterodimers are able to cleave a non- palindromic chimeric target.
- host cells may be modified by one or two recombinant expression vector(s) encoding said variant(s).
- the cells are then cultured under conditions allowing the expression of the variant(s) and the homodimers/heterodimers which are formed are then recovered from the cell culture.
- single-chain chimeric meganucleases may be constructed by the fusion of one variant obtained in step (b) with a homing endonuclease domain/monomer.
- Said domain/monomer may be from a wild-type LAGLIDADG homing endonuclease or a functional variant thereof.
- the two domain(s)/monomer(s) are connected by a peptidic linker.
- the single-chain meganuclease comprises two different variants obtained in step (b); said single-chain meganuclease is able cleave a non-palindromic chimeric target comprising one different half of each variant DNA target.
- the invention relates also to an homodimeric or heterodimeric LAGLIDADG homing endonuclease variant obtainable by the method as defined above, with the exclusion of the homodimeric variants of SEQ ID NO: 3 and 4 and the homodimeric or heterodimeric variants comprising a monomer of SEQ ID NO: 5;
- the LAGLIDADG homing endonuclease variant of the invention is also named as variant, meganuclease variant or meganuclease.
- it is an heterodimer comprising monomers from two different variants obtainable by the method as defined above.
- it is an l-Crel variant having one or two mutations, each one from a different pair of mutations selected from the group consisting of the pair S138A and K139M and the pair K142G and T143G. Examples of such variants include SEQ ID NO: 6 to 9.
- said l-Crel variant is an heterodimer, comprising two monomers, each one further comprising different mutations in positions 26 to 40 and 44 to 77 of l-Crel and being able to cleave a genomic DNA target from a gene of interest.
- the subject-matter of the present invention is also a single-chain chimeric meganuclease derived from the variant as defined above; the single-chain chimeric meganuclease of the invention is also named as single-chain derivative, single-chain meganuclease, single-chain meganuclease derivative or meganuclease.
- the meganuclease of the invention includes both the meganuclease variant and the single-chain meganuclease derivative.
- the subject-matter of the present invention is also a polynucleotide fragment encoding a variant or a single-chain derivative as defined above; said polynucleotide may encode one monomer of an homodimeric or heterodimeric variant, or two domains/monomers of a single-chain derivative.
- the subject-matter of the present invention is also a recombinant vector for the expression of a variant or a single-chain derivative according to the invention.
- the recombinant vector comprises at least one polynucleotide fragment encoding a variant or a single-chain meganuclease, as defined above.
- said vector comprises two different polynucleotide fragments, each encoding one of the monomers of an heterodimeric variant.
- a vector which can be used in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non chromosomal, semi- synthetic or synthetic nucleic acids.
- Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available.
- Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adeno- associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis virus), paramyxovirus (e. g. measles and Sendai), positive strand RNA viruses such as picor- navirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomega- lovirus), and poxvirus (e.
- orthomyxovirus e. g., influenza virus
- rhabdovirus e. g., rabies and vesicular stomatitis virus
- paramyxovirus e. g. measles and Senda
- viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example.
- retroviruses include: avian leukosis- sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
- Preferred vectors include lentiviral vectors, and particularly self inactivacting lentiviral vectors.
- Vectors can comprise selectable markers, for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adenosine deaminase, glutamine synthetase, and hypoxanthine-guanine phosphoribosyl transferase for eukaryotic cell culture; TRPl for S. cerevisiae; tetracycline, rifampicin or ampicillin resistance in E. coli.
- selectable markers for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adenosine deaminase, glut
- said vectors are expression vectors, wherein the sequence(s) encoding the variant/single-chain derivative of the invention is placed under control of appropriate transcriptional and translational control elements to permit production or synthesis of said meganuclease.
- said polynucleotide is comprised in an expression cassette. More particularly, the vector comprises a replication origin, a promoter operatively linked to said encoding polynucleotide, a ribosome-binding site, an RNA-splicing site (when genomic DNA is used), a polyadenylation site and a transcription termination site. It also can comprise an enhancer. Selection of the promoter will depend upon the cell in which the polypeptide is expressed.
- the two polynucleotides encoding each of the monomers are included in one vector which is able to drive the expression of both polynucleotides, simultaneously.
- Suitable promoters include tissue specific and/or inducible promoters. Examples of inducible promoters are: eukaryotic metallothionine promoter which is induced by increased levels of heavy metals, prokaryotic lacZ promoter which is induced in response to isopropyl- ⁇ - D-thiogalacto-pyranoside (IPTG) and eukaryotic heat shock promoter which is induced by increased temperature.
- tissue specific promoters are skeletal muscle creatine kinase, prostate-specific antigen (PSA), ⁇ -antitrypsin protease, human surfactant (SP) A and B proteins, ⁇ -casein and acidic whey protein genes.
- PSA prostate-specific antigen
- SP human surfactant
- a and B proteins ⁇ -casein and acidic whey protein genes.
- said vector includes a targeting DNA construct comprising sequences sharing homologies with the region surrounding the genomic DNA target cleavage site as defined above.
- the vector coding for the meganuclease and the vector comprising the targeting DNA construct are different vectors.
- the targeting DNA construct comprises: a) sequences sharing homologies with the region surrounding the genomic DNA cleavage site as defined above, and b) a sequence to be introduced flanked by sequences as in a).
- homologous sequences of at least 50 bp, preferably more than 100 bp and more preferably more than 200 bp are used.
- shared DNA homologies are located in regions flanking upstream and downstream the site of the break and the DNA sequence to be introduced should be located between the two arms.
- the sequence to be introduced is preferably a sequence which repairs a mutation in the gene of interest (gene correction or recovery of a functional gene), for the purpose of genome therapy.
- it can be any other sequence used to alter the chromosomal DNA in some specific way including a sequence used to modify a specific sequence, to attenuate or activate the endogenous gene of interest, to inactivate or delete the endogenous gene of interest or part thereof, to introduce a mutation into a site of interest or to introduce an exogenous gene or part thereof.
- the invention also concerns a prokaryotic or eukaryotic host cell which is modified by a polynucleotide or a vector as defined above, preferably an expression vector.
- the invention also concerns a non-human transgenic animal or a transgenic plant, characterized in that all or part of their cells are modified by a polynucleotide or a vector as defined above.
- a cell refers to a prokaryotic cell, such as a bacterial cell, or eukaryotic cell, such as an animal, plant or yeast cell.
- the subject-matter of the present invention is further the use of a meganuclease with the exclusion of SEQ ID NO: 5, one or two derived polynucleotide(s), preferably included in expression vector(s), a cell, a transgenic plant, a non-human transgenic mammal, as defined above, for molecular biology, for in vivo or in vitro genetic engineering, and for in vivo or in vitro genome engineering, for non-therapeutic purposes.
- Non therapeutic purposes include for example (i) gene targeting of specific loci in cell packaging lines for protein production, (ii) gene targeting of specific loci in crop plants, for strain improvements and metabolic engineering, (iii) targeted recombination for the removal of markers in genetically modified crop plants, (iv) targeted recombination for the removal of markers in genetically modified microorganism strains (for antibiotic production for example).
- it is for inducing a double-strand break in a site of interest comprising a DNA target sequence, thereby inducing a DNA recombination event, a DNA loss or cell death.
- said double-strand break is for: repairing a specific sequence, modifying a specific sequence, restoring a functional gene in place of a mutated one, attenuating or activating an endogenous gene of interest, introducing a mutation into a site of interest, introducing an exogenous gene or a part thereof, inactivating or detecting an endogenous gene or a part thereof, translocating a chromosomal arm, or leaving the DNA unrepaired and degraded.
- the subject-matter of the present invention is also a method of genetic engineering, characterized in that it comprises a step of double-strand nucleic acid breaking in a site of interest located on a vector comprising a DNA target as defined hereabove, by contacting said vector with a meganuclease as defined above, with the exclusion of SEQ ID NO: 5, thereby inducing an homologous recombination with another vector presenting homology with the sequence surrounding the cleavage site of said meganuclease.
- the subjet-matter of the present invention is also a method of genome engineering, characterized in that it comprises the following steps: 1) double- strand breaking a genomic locus comprising at least one DNA target of a meganuclease as defined above, by contacting said target with said meganuclease, with the exclusion of SEQ ID NO: 5 ; 2) maintaining said broken genomic locus under conditions appropriate for homologous recombination with a targeting DNA construct comprising the sequence to be introduced in said locus, flanked by sequences sharing homologies with the targeted locus.
- the subject-matter of the present invention is also a method of genome engineering, characterized in that it comprises the following steps: 1) double- strand breaking a genomic locus comprising at least one DNA target of a meganuclease as defined above, by contacting said cleavage site with said meganuclease, with the exclusion of SEQ ID NO: 5; 2) maintaining said broken genomic locus under conditions appropriate for homologous recombination with chromosomal DNA sharing homologies to regions surrounding the cleavage site.
- the subject-matter of the present invention is also the use of at least one meganuclease as defined above, with the exclusion of SEQ ID NO: 5, one or two derived polynucleotide(s), preferably included in expression vector(s), as defined above, for the preparation of a medicament for preventing, improving or curing a genetic disease in an individual in need thereof, said medicament being administrated by any means to said individual.
- the subject-matter of the present invention is also a method for preventing, improving or curing a genetic disease in an individual in need thereof, said method comprising the step of administering to said individual a composition comprising at least a meganuclease as defined above, by any means.
- the use of the meganuclease as defined above comprises at least the step of (a) inducing in somatic tissue(s) of the individual a double stranded cleavage at a site of interest of a gene comprising at least one recognition and cleavage site of said meganuclease, and (b) introducing into the individual a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA.
- the targeting DNA is introduced into the individual under conditions appropriate for introduction of the targeting DNA into the site of interest.
- said double-stranded cleavage is induced, either in toto by administration of said meganuclease to an individual, or ex vivo by introduction of said meganuclease into somatic cells removed from an individual and returned into the individual after modification.
- the meganuclease is combined with a targeting DNA construct comprising a sequence which repairs a mutation in the gene flanked by sequences sharing homologies with the regions of the gene surrounding the genomic DNA cleavage site of said meganuclease, as defined above.
- the sequence which repairs the mutation is either a fragment of the gene with the correct sequence or an exon knock-in construct.
- cleavage of the gene occurs in the vicinity of the mutation, preferably, within 500 bp of the mutation.
- the targeting construct comprises a gene fragment which has at least 200 bp of homologous sequence flanking the genomic DNA cleavage site (minimal repair matrix) for repairing the cleavage, and includes the correct sequence of the gene for repairing the mutation. Consequently, the targeting construct for gene correction comprises or consists of the minimal repair matrix; it is preferably from 200 pb to 6000 pb, more preferably from 1000 pb to 2000 pb.
- cleavage of the gene occurs upstream of a mutation.
- said mutation is the first known mutation in the sequence of the gene, so that all the downstream mutations of the gene can be corrected simultaneously.
- the targeting construct comprises the exons downstream of the genomic DNA cleavage site fused in frame (as in the cDNA) and with a polyadenylation site to stop transcription in 3'.
- the sequence to be introduced is flanked by introns or exons sequences surrounding the cleavage site, so as to allow the transcription of the engineered gene (exon knock-in gene) into a mRNA able to code for a functional protein.
- the exon knock-in construct is flanked by sequences upstream and downstream.
- the subject-matter of the present invention is also the use of at least one meganuclease as defined above, with the exclusion of SEQ ID NO: 5, one or or two derived polynucleotide(s), preferably included in expression vector(s), as defined above for the preparation of a medicament for preventing, improving or curing a disease caused by an infectious agent that presents a DNA intermediate, in an individual in need thereof, said medicament being administrated by any means to said individual.
- the subject-matter of the present invention is also a method for preventing, improving or curing a disease caused by an infectious agent that presents a DNA intermediate, in an individual in need thereof, said method comprising at least the step of administering to said individual a composition as defined above, by any means.
- the subject-matter of the present invention is also the use of at least one meganuclease as defined above, one or two polynucleotide(s), preferably included in expression vector(s), as defined above, in vitro, for inhibiting the propagation, inactivating or deleting an infectious agent that presents a DNA intermediate, in biological derived products or products intended for biological uses or for disinfecting an object.
- the subject-matter of the present invention is also a method for decontaminating a product or a material from an infectious agent that presents a DNA intermediate, said method comprising at least the step of contacting a biological derived product, a product intended for biological use or an object, with a composition as defined above, for a time sufficient to inhibit the propagation, inactivate or delete said infectious agent.
- said infectious agent is a virus.
- said virus is an adenovirus (AdI l, Ad21), herpesvirus (HSV, VZV, EBV,
- CMV herpesvirus 6, 7 or 8
- HBV hepadnavirus
- HPV papovavirus
- HTLV retrovirus
- ID NO:5 one or two derived polynucleotide(s), preferably included in expression vector(s), as defined above.
- composition in a preferred embodiment, it comprises a targeting DNA construct comprising the sequence which repairs the site of interest flanked by sequences sharing homologies with the targeted locus as defined above.
- said targeting DNA construct is either included in a recombinant vector or it is included in an expression vector comprising the polynucleotide(s) encoding the meganuclease, as defined in the present invention.
- the subject-matter of the present invention is also products containing at least a meganuclease with the exclusion of SEQ ID NO: 5, or one or two expression vector(s) encoding said meganuclease, and a vector including a targeting W
- the meganuclease and a pharmaceutically acceptable excipient are administered in a therapeutically effective amount.
- Such a combination is said to be administered in a
- terapéuticaally effective amount if the amount administered is physiologically significant.
- An agent is physiologically significant if its presence results in a detectable change in the physiology of the recipient.
- an agent is physiologically significant if its presence results in a decrease in the severity of one or more symptoms of the targeted disease and in a genome correction of the lesion or abnormality.
- the meganuclease is substantially non-immunogenic, i.e., engenders little or no adverse immunological response.
- a variety of methods for ameliorating or eliminating deleterious immunological reactions of this sort can be used in accordance with the invention.
- the meganuclease is substantially free of N-formyl methionine.
- Another way v to avoid unwanted immunological reactions is to conjugate meganucleases to polyethylene glycol (“PEG”) or polypropylene glycol (“PPG”) (preferably of 500 to 20,000 daltons average molecular weight (MW)). Conjugation with PEG or PPG, as described by
- the meganuclease can be used either as a polypeptide or as a polynucleotide construct/vector encoding said polypeptide. It is introduced into cells, in vitro, ex vivo or in vivo, by any convenient means well-known to those in the art, which are appropriate for the particular cell type, alone or in association with either at least an appropriate vehicle or carrier and/or with the targeting DNA. Once in a cell, the meganuclease and if present, the vector comprising targeting
- DNA and/or nucleic acid encoding a meganuclease are imported or translocated by the cell from the cytoplasm to the site of action in the nucleus.
- the meganuclease may be advantageously associated with: liposomes, polyethyleneimine (PEI), and/or membrane translocating peptides (Bonetta, The Engineer, 2002, 16, 38; Ford et ah, Gene Ther., 2001, 8, 1-4 ; Wadia and Dowdy, Curr. Opin. Biotechnol., 2002, 13, 52-56); in the latter case, the sequence of the meganuclease fused with the sequence of a membrane translocating peptide (fusion protein).
- PEI polyethyleneimine
- Vectors comprising targeting DNA and/or nucleic acid encoding a meganuclease can be introduced into a cell by a variety of methods (e.g., injection, direct uptake, projectile bombardment, liposomes, electroporation). Meganucleases can be stably or transiently expressed into cells using expression vectors. Techniques of expression in eukaryotic cells are well known to those in the art. (See Current Protocols in Human Genetics: Chapter 12 "Vectors For Gene Therapy” & Chapter 13 "Delivery Systems for Gene Therapy”). Optionally, it may be preferable to incorporate a nuclear localization signal into the recombinant protein to be sure that it is expressed within the nucleus.
- the uses of the meganuclease and the methods of using said meganucleases according to the present invention include also the use of the polynucleotide ⁇ ), vector(s), cell, transgenic plant or non-human transgenic mammal encoding said meganuclease, as defined above.
- said meganuclease, polynucleotide(s), vector(s), cell, transgenic plant or non-human transgenic mammal are associated with a targeting DNA construct as defined above.
- said vector encoding the monomer(s) of the meganuclease comprises the targeting DNA construct, as defined above.
- the invention concerns also a first method for engineering 1-Crel variants able to cleave a genomic DNA target sequence from a gene of interest, comprising at least the steps of:
- (C 1 ) selecting and/or screening the variants from the first series of step (a ⁇ which are able to cleave a mutant I-Crd site wherein (i) the nucleotide triplet in positions -10 to -8 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions -10 to -8 of said genomic target and (ii) the nucleotide triplet in positions +8 to +10 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said genomic target,
- step (dj) selecting and/or screening the variants from the second series of step (bi) which are able to cleave a mutant VCr el site wherein (i) the nucleotide triplet in positions -5 to -3 of the I-Crel site has been replaced with the nucleotide triplet which is present in positions -5 to -3 of said genomic target and (ii) the nucleotide triplet in positions +3 to +5 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions -5 to -3 of said genomic target,
- step (hj) combining in a single variant, the mutation(s) in positions 26 to 40 and 44 to 77 of two variants from step (e]) and step (fj), to obtain a novel homodimeric l-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said genomic target, (ii) the nucleotide triplet in positions -5 to - 3 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said genomic target, (iii) the nucleotide triplet in positions +8 to +10 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said genomic target and (iv) the nucleotide triplet in positions -10 to -8 is identical to the reverse complementary sequence of the nucleotide triple
- step (ii) introducing in the variants from step (g ⁇ ) and/or (hi), at least one mutation in the final C-terminal loop, preferably a substitution in position 138, 139, 142 or 143 of l-Crel, as defined above,
- the l-Crel variant according to the invention may be obtained by a second method for engineering l-Crel variants able to cleave a genomic DNA target sequence from a gene of interest, comprising at least the steps of: (a 2 ) constructing a first series of l-Crel variants having at least one substitution in a first functional subdomain of the LAGLIDADG core domain situated from positions 26 to 40 of l-Crel and one mutation in the final C-terminal loop, preferably a substitution in position 138, 139, 142 or 143 of l-Crel, as defined above, (b 2 ) constructing a second series of I- OeI variants having at least one substitution in a second functional subdomain of the LAGLIDADG core domain situated from positions 44 to 77 of l-Crel and one mutation in the final
- step (C 2 ) selecting and/or screening the variants from the first series of step (a 2 ) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions -10 to -8 and eventually at least one of the nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 of the l-Crel site have been replaced, respectively with the nucleotide triplet which is present in positions -10 to -8 and the nucleotide doublet which is present in positions -12 to -11, -7 to -6 and/or -2 to -1 of said genomic target (ii) the nucleotide triplet in positions +8 to +10 and eventually at least one of the nucleotide doublet(s) in positions +1 to +2, +6 to +7, and/or +11 to +12 have been replaced with the reverse complementary sequence of respectively, the nucleotide triplet which is present in positions
- step (d 2 ) selecting and/or screening the variants from the second series of step (b 2 ) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions -5 to -3 and eventually at least one of the nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 of the 1-OeI site have been replaced respectively with the nucleotide triplet which is present in positions -5 to -3 and the nucleotide doublet which is present in positions -12 to -11, -7 to -6 and/or -2 to -1 of said genomic target and (ii) the nucleotide triplet in positions +3 to +5 and eventually at least one of the nucleotide doublet(s) in positions +1 to +2, +6 to +7, and/or +11 to +12 have been replaced with the reverse complementary sequence of respectively the nucleotide triplet which is present in positions -5 to
- step (f 2 ) selecting and/or screening the variants from the second series of step (b 2 ) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions +3 to +5, and eventually the nucleotide doublet(s) in positions +1 to +2, +6 to +7, and/or +11 to +12 of the l-Crel site, have been replaced respectively with the nucleotide triplet which is present in positions +3 to +5, and the nucleotide doublet(s) which is present in positions +1 to +2, +6 to +7, and/or +11 to +12 of said genomic target and (ii) the nucleotide triplet in positions -5 to -3, and eventually the nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 have been replaced with the reverse complementary sequence of, respectively the nucleotide triplet which is present in positions +3 to +
- step (h 2 ) combining in a single variant, the mutation(s) in positions 26 to 40, 44 to 77 and in the final C-terminal loop of two variants from step (e 2 ) and step (f 2 ), to obtain a novel homodimeric l-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions +3 to +5 and the nucleotide doublet(s) in positions +1 to +2, +6 to +7, and/or +11 to +12 are identical, respectively to the nucleotide triplet which is present in positions +3 to +5 and the nucleotide doublet(s) in positions +1 to +2, +6 to +7, and/or +11 to +12 of said genomic target, (ii) the nucleotide triplet in positions -5 to -3 and the nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 are identical to the reverse complementary sequence of,
- the I-Crel variant of the invention may be obtained by a third method for engineering ⁇ -Crel variants able to cleave a genomic DNA target sequence from a gene of interest, comprising at least the steps of:
- step (d 3 ) selecting and/or screening the variants from the first series of step (a 3 ) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions -10 to -8 of the I-Oel site has been replaced with the nucleotide triplet which is present in positions -10 to -8 of said genomic target and (ii) the nucleotide triplet in positions +8 to +10 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said genomic target, (e 3 ) selecting and/or screening the variants from the second series of step (b 3 ) which are able to cleave a mutant 1-OeI site wherein (i) the nucleotide triplet in positions -5 to -3 of the l ⁇ Crel site has been replaced with the nucleotide triplet which is present in positions -5 to -3 of said genomic target and (ii) the nucle
- step (g 3 ) selecting and/or screening the variants from the first series of step (a 3 ) which are able to cleave a mutant I-Crel site wherein (i) the nucleotide triplet in positions +8 to +10 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said genomic target and (ii) the nucleotide triplet in positions -10 to -8 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions +8 to +10 of said genomic target,
- step (I1 3 ) selecting and/or screening the variants from the second series of step (b 3 ) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions +3 to +5 of the I-Crel site has been replaced with the nucleotide triplet which is present in positions +3 to +5 of said genomic target and (ii) the nucleotide triplet in positions -5 to -3 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said genomic target,
- step (i 3 ) selecting and/or screening the variants from the third series of step (C 3 ) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide doublet(s) in positions +1 to +2, +6 to +7, and/or +11 to +12 of the l-Crel site has been replaced with the nucleotide doublet(s) which is present in positions +1 to +2, +6 to +7, and/or +11 to +12, respectively, of said genomic target and (ii) the nucleotide doublet(s) in positions -12 to -11, -7 to -6 and/or -2 to -1 has been replaced with the reverse complementary sequence of the nucleotide doublet which is present in positions +1 1 to +12, +6 to +7, and/or +1 to +2, respectively, of said genomic target,
- step (Hi 1 ) selecting and/or screening the heterodimers from step (I 3 ) which are able to cleave said genomic DNA target situated in a gene of interest.
- (J3), and (k 3 ) may comprise the introduction of additional mutations in order to improve the binding and/or cleavage properties of the mutants, particularly at other positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target.
- These steps may be performed by generating a combinatorial library as described in the International PCT Application WO 2004/067736, Arnould et al., 3. MoI. Biol., 2006, 355, 443-458 and Smith et ai., Nucleic Acids Research, Epub 27 November 2006.
- Steps (gi), (g 2 ), (hi), (h 2 ), (ij), 0 * 3 ) and (k 3 ), may further comprise the introduction of random mutations on the whole variant or in a part of the variant, in particular the C-terminal half of the variant (positions 80 to 163). This may be performed by generating random mutagenesis libraries on a pool of variants, according to standard mutagenesis methods which are well-known in the art and commercially available.
- Step (ij) may also comprise the selection and/or screening of the homodimers which are able to cleave a sequence wherein the nucleotide doublet in positions +1 to +2, +6 to +7 and/or +11 to +12 is identical to the nucleotide doublet which is present in positions +1 to +2, +6 to +7 and/or +11 to +12, respectively of said genomic target, and the nucleotide doublet in positions -12 to -11, -7 to -6, and/or -2 to -1 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions +11 to +12, +6 to +7, and/or +1 to +2, respectively of said genomic target.
- the (intramolecular) combination of mutations in steps (gj), (g 2 ), (hi), (h 2 ), (J 3 ) and (Ic 3 ) may be performed by amplifying overlapping fragments comprising each of the two subdomains, according to well-known overlapping PCR techniques, as described for example in Smith et ah, Nucleic Acids Res., Epub 27 November 2006.
- the (intermolecular) combination of the variants in step (J]), (i 2 ) and (I 3 ) is performed by co-expressing one variant from step (gj), (g 2 ) or (J 1 ), (j 3 ) with one variant from step (hi), (h 2 ) or (ii), (k 3 ), respectively, so as to allow the formation of heterodimers.
- host cells may be modified by one or two recombinant expression vector(s) encoding said variant(s). The cells are then cultured under conditions allowing the expression of the variant(s), so that heterodimers are formed in the host cells, as described previously in Arnould et al, J. MoI.
- the selection and/or screening steps may be performed by using a cleavage assay in vitro or in vivo, as defined above. Preferably, it is performed in vivo, under conditions where the double-strand break in the mutated DNA target sequence which is generated by said variant leads to the activation of a positive selection marker or a reporter gene, or the inactivation of a negative selection marker or a reporter gene, by recombination-mediated repair of said DNA double-strand break, as defined above.
- the subject-matter of the present invention is also the use of at least one meganuclease, as defined above, as a scaffold for making other meganucleases.
- at least one meganuclease as defined above
- other rounds of mutagenesis and selection/screening can be performed on the variant, for the purpose of making novel homing endonucleases.
- the subject-matter of the present invention is also a method for decreasing the toxicity of a parent LAGLIDADG homing endonuclease, comprising : the mutation of at least one amino acid of the final C-terminal loop of said parent LAGLIDADG homing endonuclease.
- the parent endonuclease is l-Crel or a functional variant thereof.
- the Kl 39 and/or Tl 43 residues are mutated. More preferably Kl 39 is mutated in an hydrophobic amino acid such as a methionine (K 139M) and/or T 143 is mutated in a small amino acid such as a glycine (Tl 43G).
- Kl 39 and/or Tl 43 residues are mutated. More preferably Kl 39 is mutated in an hydrophobic amino acid such as a methionine (K 139M) and/or T 143 is mutated in a small amino acid such as a glycine
- DNA construct or the sequence encoding the meganuclease variant or single-chain meganuclease derivative as defined in the present invention may be prepared by any method known by the man skilled in the art. For example, they are amplified from a DNA template, by polymerase chain reaction with specific primers. Preferably the codons of the cDNAs encoding the megaunclease variant or single-chain meganuclease derivative are chosen to favour the expression of said proteins in the desired expression system.
- the recombinant vector comprising said polynucleotides may be obtained and introduced in a host cell by the well-known recombinant DNA and genetic engineering techniques.
- the meganuclease variant or single-chain meganuclease derivative as defined in the present the invention are produced by expressing the polypeptide(s) as defined above; preferably said polypeptide(s) are expressed or co-expressed (in the case of the variant only) in a host cell or a transgenic animal/plant modified by one expression vector or two expression vectors (in the case of the variant only), under conditions suitable for the expression or co-expression of the polypeptide(s), and the meganuclease variant or single-chain meganuclease derivative is recovered from the host cell culture or from the transgenic animal/plant.
- the invention further comprises other features which will emerge from the description which follows, which refers to examples illustrating l-Crel meganuclease variants and their uses according to the invention, as well as to the appended drawings in which: - figure 1 represents the superposition of the Ca ribbon representation of the l-Crel and I-Od-DNA structures. DNA has been omitted for clarity.
- -figure 2 represents the sequence alignment of the C-terminal region from members of the l-Crel family (Lucas et ah, Nucleic Acids Res., 2001, 29, 960- 969). The position of the mutated residues in the SKTRKTT motif is indicated with a grey triangle (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi).
- - figure 3 represents a detailed view of S 138, Kl 39, Kl 42 and Tl 43 contacts with the DNA backbone (a) and the comparison of the positions of S 138, Kl 39, Kl 42 and T 143 between the bound and unbound DNA structures (b).
- - figure 4 illustrates the biophysical characterization of the l-Crel C- terminal region mutants, a) Circular dichroism thermal denaturation. b) Monodimensional H-H NMR spectra.
- - figure 5 illustrates dimer formation by the l-Crel C-terminal region mutants, measured by analytical ultracentrifugation. Sedimentation velocity distribution of the I-Crel proteins (1 mg/ml in PBS buffer) at 42,000 rpm and 2O 0 C. Inset, sedimentation equilibrium gradient of I-Crel proteins (4 mg/ml in PBS buffer) at 11,000 rpm and 20 0 C. Open circles represent the experimental data, the two solid lines represent the theoretical gradients of a l-Crel monomer (20,045) and dimer (41,000).
- - figure 6 represents electrophoretic mobility shift assays of the C- terminal truncated, double and single mutants in the presence of Mg 2+ and Ca 2+ .
- - figure 7 is a summary of the gel in vitro cleavage assay of the C- terminal truncated, double and single mutants.
- FIG. 8 illustrates the in vivo cleavage assay used for profiling the single mutants and the 1 ONNNJP DNA target cleavage profile of the single mutants.
- a strain harboring the expression vector encoding a single mutant is mated with a strain harboring a reporter plasmid.
- a LacZ reporter gene is interrupted with an insert containing one of the target sites of interest, flanked by two direct repeats.
- the meganuclease grey oval
- the meganuclease generates a double-strand break at the site of interest, allowing restoration of a functional LacZ gene by single-strand annealing (SSA) between the two flanking direct repeats.
- SSA single-strand annealing
- the functional LacZ gene is visualized by a blue staining, b) DNA targets.
- the C 1221 target (top) is a palindromic target cleaved by 1-Cre ⁇ . All targets used in this study are palindromic targets derived from C 1221 by substitution of six nucleotides in ⁇ 8, ⁇ 9 and ⁇ 10 (SEQ ID NO: 1 and 10 to 16). A few examples are shown (bottom).
- the 10GGG_P target differs from the C 1221 target by the GGG triplet in -10, -9, -8 and CCC in +8, +9 and +10.
- c) Mutant target profiles Each mutant was profiled in yeast on a series of 64 palindromic targets (10NNN_P).
- FIG. 9 illustrates the 5NNNJP DNA target cleavage profile of the single mutants.
- the targets (64) are palindromic targets with variations in positions ⁇
- - figure 10 illustrates the 2NN DNA target cleavage profile of the single mutants.
- the targets (16x16) are non-palindromic targets with variations in positions ⁇ 1 to 2.
- - figure 11 illustrates the 12NN_P DNA target (A) and 7NNJP DNA target (B) cleavage profiles of the single mutants.
- the targets in A (16) and B (16) are palindromic targets with variations in positions ⁇ 11 to 12 and ⁇ 6 to 7, respectively.
- Example 1 Structural differences between the bound and unbound 1-CreI DNA structures
- Crystal was made by hanging-drop vapour-diffusion methods using VDX plates; optimization experiments led to the following conditions for crystallization: 1 ⁇ l protein at 7 mg/ml in 20 mM HEPES pH 7.5 and 1 ⁇ l precipitating buffer containing 20 % PEG 4000, 0.1 M HEPES pH 7.5, 10 % Iso-propanol, 10 % Ethylene glycol and 0.01 M Magnesium acetate equilibrated against 500 ⁇ l precipitating buffer at 20° C. Rod-shaped crystals grown in 4-8 days and were directly collected and frozen in liquid nitrogen. b) Data collection, structure solution, model building and refinement
- the structure of the 1-Crel was solved by molecular replacement and refinement to 2.0A resolution.
- Statistics for the crystallographic data are summarized in Table I.
- the search model was based on a poly-alanine backbone derived from the PDB Igz9 found in the Protein Data Bank. The coordinates from the DNA were deleted in the search model.
- a refined 2Fo-Fc map showed clear and contiguous electron density for the protein backbone and for many of the side-chains.
- ARP/wARP and REFMAC5 were applied for automatic model building and refinement to 2.0 A (Table I).
- the l-Crel deletion mutants ( ⁇ l and ⁇ 2) were amplified by PCR on the wild-type l-Crel (I-Crel D75) cDNA template, with the forward primer 5' gatataccatggccaataccaaatataac 3' (SEQ ID NO: 18) for both mutants and the reverse primer ICreI deltaCter-R: 5' ttatcagtcggccgcatcgttcagagctgcaatctgatccacccagg 3' (SEQ ID NO: 19) for the ⁇ l mutant or Creh2: 5' gagtgcggccgcagtggttttacgcgtcttagaatcg 3' (SEQ ID NO: 20) for the ⁇ 2 mutant.
- the sedimentation velocity experiment was carried out in an XL-A analytical ultracentrifuge (Beckman-Coulter Inc.) at 42,000 rpm and 20° C, using an An50Ti rotor and 1.2mm double-sector centerpieces. Absorbance scans were taken at 280 nm. The protein concentration was 50 ⁇ M in PBS. The sedimentation coefficients were calculated by continuous distribution c(s) Lamm equation model (Schuck, P., Biophys. J., 2000, 78, 1606-1619) as implemented in the SEDFIT program. These experimental sedimentation values were corrected to standard conditions to get the corresponding .?
- NMR spectra were recorded at 25 °C in a Bruker AVANCE 600 spectrometer equipped with a cryoprobe. Protein samples were 500 ⁇ M in PBS buffer (137 mM NaCl, 10 mM Na 2 HPO 4 -2H 2 0, 2.7 mM KCl 5 2 mM KH 2 PO 4 , pH 7.4) plus 5 % 2 H 2 O. DSS (2,2-Dimethyl-2-silapentane-5-sulfonate sodium salt ) was used as internal proton chemical shift reference. 2) Results
- the double mutants I-Crel AM (S138A, K139M) and l-Crel GG (K142G, T143G) were produced, as well as their single variants l-Crel S138A, l-Crel K139M, l-Crel K142G, l-Crel T143G.
- l-Crel S138A, l-Crel K139M, l-Crel K142G, l-Crel T143G was studied. Thermal denaturation circular dichroism was performed to confirm that all the mutants were folded.
- Electrophoretic mobility shift assays in the presence of Mg 2+ and Ca 2+ were used to analyze the behavior of the C-terminal mutants in DNA binding ( Figure 6). Whereas the presence of Ca 2+ allows DNA binding, Mg 2+ is indispensable to bind and cleave DNA (Chevalier et ah, Biochemistry, 2004, 43, 14015-14026). Even though the binding capability of l-Cre ⁇ was abolished in the ⁇ l mutant, the ⁇ 2 was able to bind the labeled DNA probe demonstrating that the C-loop is essential in DNA binding. In addition, binding was detected in the presence of both cations as in the wild type 1-Crel.
- Cleavage assays were performed at 37 °C in 10 mM Tris-HCl (pH 8), 50 mM NaCl 5 10 mM MgCl 2 (or CaCl 2 ) and 1 mM DTT. Concentrations were: 100 ng for the Xmnl linearized target substrate (pGEM-T Easy C 1221 GTC) and 40-0.25ng dilutions for 1-Crel and helix mutant proteins, in 25 ⁇ l final volume reaction.
- the linearized target plasmid has 3 kb and after cleavage yields two smaller bands of 2 kb and 1 kb.
- Reactions were stopped after 1 hour by addition of 5 ⁇ l of 45 % Glycerol, 95 mM EDTA (pH 8), 1.5 % (w/v) SDS, 1.5 mg/ml Proteinase K and 0.048 % (w/v) Bromophenol blue (6x Buffer Stop), incubated at 37 °C for 30 minutes and electrophoresed in a 1 % agarose gel. The fragments were quantified using SYBR Safe DNA gel staining (IN VITROGEN).
- Figure 7 displays a graph representing the percentage of cleavage against the amount of HE (Gels with raw data are available as supporting information).
- the mutants can be divided in two groups based on the comparison of their cleavage properties to the wild type HE; the first is composed of the truncated mutants I-Crel ⁇ l and I-Crel ⁇ 2 and the double mutants I-Crel AM and I-Crel GG which are , whereas the single mutants I-Crel S138A, I-Crel K139M, I-Crel K142G, I-Crel T143G form the second.
- Members the first group displayed a reduced cleavage activity when compared to the wild type I- Crel.
- Example 5 DNA-cleavage activity of the C-terminal mutants, in vivo
- C1221 twenty-four bp target sequence (5 1 - tcaaaacgtcgtacgacgttttga-3': SEQ ID NO: 1) is a palindrome of a half-site of the natural 1-OeI target (5'-tcaaaacgtcgtgagacagtttgg-3': SEQ ID NO: 17).
- C1221 is cleaved as efficiently as the 1-Crel natural target in vitro and ex vivo in both yeast and mammalian cells.
- the palindromic targets, derived from C 1221 were cloned as previously described (Arnould et al, J.
- Mating was performed using a colony gridder (QpixII, Genetix). Mutants were gridded on nylon filters covering YPD plates, using a high gridding density (about 20 spots/cm ). A second gridding process was performed on the same filters to spot a second layer consisting of 64 or 75 different reporter-harboring yeast strains for each variant. Membranes were placed on solid agar YPD rich medium, and incubated at 30 °C for one night, to allow mating.
- filters were transferred to synthetic medium, lacking leucine and tryptophan, with galactose (2 %) as a carbon source, and incubated for five days at 37 0 C (30 °C for 1-OeI), to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02 % X-GaI in 0.5 M sodium phosphate buffer, pH 7.0, 0.1 % SDS, 6 % dimethyl formamide (DMF), 7 mM ⁇ -mercaptoethanol, 1 % agarose, and incubated at 37 °C, to monitor ⁇ -galactosidase activity. Results were analyzed by scanning and quantification was performed using appropriate software. 2) Results
- the profile of S138A and K139M is similar to the profile of I-Crel D75N, whereas the profile of K142G and T143G is more restricted than the profile of l-Crel D75N.
- the profile of K142G and S138A is more restricted than the profile of l-Crel D75N.
- T143G and K139M cleave 6 and 10 additional targets, respectively, 6 of which are in common.
- at least 8 targets are cleaved more efficiently by K139M than by D75N.
- Five targets (2TT_2TG; 2TG_2TT, 2TA_2CT, 2TC_2TC, 2CT_2CT) are not cleaved by K139M; these targets are cleaved by D75N, although less efficiently than by l-Crel.
- T143G is similar to the profile ofl-Cre ⁇ D75N.
- K139M is similar to the profile of l-Crel but without its toxicity; 7 additional targets are cleaved by Kl 39M as compared to D75N.
- the profile of K142G and S138A is similar to the profile of l-Crel D75N.
- K139M and T143G cleave 2 additional targets (7CG_P and 7TTJP) as compared to D75N; however the cleavage profile of K139M and T143G is more restricted than the profile ofl-Crel.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Oncology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Neurology (AREA)
- Communicable Diseases (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Toxicology (AREA)
- Enzymes And Modification Thereof (AREA)
- Neurosurgery (AREA)
- Psychology (AREA)
- Obesity (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Ophthalmology & Optometry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
Claims
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2007347328A AU2007347328B2 (en) | 2007-02-19 | 2007-02-19 | LAGLIDADG homing endonuclease variants having novel substrate specificity and use thereof |
| PCT/IB2007/001527 WO2008102198A1 (en) | 2007-02-19 | 2007-02-19 | Laglidadg homing endonuclease variants having novel substrate specificity and use thereof |
| EP07734802.7A EP2126066B1 (en) | 2007-02-19 | 2007-02-19 | Laglidadg homing endonuclease variants having novel substrate specificity and use thereof |
| JP2009549850A JP5524627B2 (en) | 2007-02-19 | 2007-02-19 | LAGLIDADG homing endonuclease variant with novel substrate specificity and use thereof |
| US12/527,799 US20100086533A1 (en) | 2007-02-19 | 2007-02-19 | Laglidadg homing endonuclease variants having novel substrate specificity and use thereof |
| CA002678526A CA2678526A1 (en) | 2007-02-19 | 2007-02-19 | Laglidadg homing endonuclease variants having novel substrate specificity and use thereof |
| CN200780051453A CN101679959A (en) | 2007-02-19 | 2007-02-19 | LAGLIDADG homing endonuclease variants having novel substrate specificity and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/IB2007/001527 WO2008102198A1 (en) | 2007-02-19 | 2007-02-19 | Laglidadg homing endonuclease variants having novel substrate specificity and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2008102198A1 true WO2008102198A1 (en) | 2008-08-28 |
Family
ID=38610672
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2007/001527 Ceased WO2008102198A1 (en) | 2007-02-19 | 2007-02-19 | Laglidadg homing endonuclease variants having novel substrate specificity and use thereof |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20100086533A1 (en) |
| EP (1) | EP2126066B1 (en) |
| JP (1) | JP5524627B2 (en) |
| CN (1) | CN101679959A (en) |
| AU (1) | AU2007347328B2 (en) |
| CA (1) | CA2678526A1 (en) |
| WO (1) | WO2008102198A1 (en) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011064736A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| WO2011064750A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Chimeric endonucleases and uses thereof |
| WO2011135407A1 (en) * | 2010-04-30 | 2011-11-03 | Cellectis | I-crei variants with new specificity and methods of their generation |
| DE112010004584T5 (en) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Chimeric endonucleases and applications thereof |
| WO2012168910A1 (en) | 2011-06-10 | 2012-12-13 | Basf Plant Science Company Gmbh | Nuclease fusion protein and uses thereof |
| US8445251B2 (en) | 2007-10-31 | 2013-05-21 | Precision Biosciences, Inc. | Rationally-designed single-chain meganucleases with non-palindromic recognition sequences |
| EP2612918A1 (en) | 2012-01-06 | 2013-07-10 | BASF Plant Science Company GmbH | In planta recombination |
| WO2013166113A1 (en) * | 2012-05-04 | 2013-11-07 | E. I. Du Pont De Nemours And Company | Compositions and methods comprising sequences having meganuclease activity |
| US9683257B2 (en) | 2008-07-14 | 2017-06-20 | Precision Biosciences, Inc. | Recognition sequences for I-CreI-derived meganucleases and uses thereof |
| WO2023081756A1 (en) | 2021-11-03 | 2023-05-11 | The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone | Precise genome editing using retrons |
| WO2023141602A2 (en) | 2022-01-21 | 2023-07-27 | Renagade Therapeutics Management Inc. | Engineered retrons and methods of use |
| WO2024044723A1 (en) | 2022-08-25 | 2024-02-29 | Renagade Therapeutics Management Inc. | Engineered retrons and methods of use |
Families Citing this family (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2006224248B2 (en) | 2005-03-15 | 2011-01-06 | Cellectis | I-Crei meganuclease variants with modified specificity, method of preparation and uses thereof |
| WO2009019528A1 (en) * | 2007-08-03 | 2009-02-12 | Cellectis | Meganuclease variants cleaving a dna target sequence from the human interleukin-2 receptor gamma chain gene and uses thereof |
| WO2009074842A1 (en) * | 2007-12-13 | 2009-06-18 | Cellectis | Improved chimeric meganuclease enzymes and uses thereof |
| EP2352821B1 (en) * | 2008-09-08 | 2016-11-23 | Cellectis | Meganuclease variants cleaving a dna target sequence from a glutamine synthetase gene and uses thereof |
| EP2180058A1 (en) | 2008-10-23 | 2010-04-28 | Cellectis | Meganuclease recombination system |
| WO2011036640A2 (en) | 2009-09-24 | 2011-03-31 | Cellectis | Meganuclease reagents of uses thereof for treating genetic diseases caused by frame shift/non sense mutations |
| US20140148361A1 (en) * | 2010-06-07 | 2014-05-29 | Barry L. Stoddard | Generation and Expression of Engineered I-ONUI Endonuclease and Its Homologues and Uses Thereof |
| US9044492B2 (en) | 2011-02-04 | 2015-06-02 | Cellectis Sa | Method for modulating the efficiency of double-strand break-induced mutagenesis |
| DK2836226T3 (en) | 2012-02-24 | 2017-09-18 | Hutchinson Fred Cancer Res | COMPOSITIONS AND PROCEDURES FOR TREATING HEMOGLOBINOPATHY |
| WO2017218512A1 (en) | 2016-06-13 | 2017-12-21 | Grail, Inc. | Enrichment of mutated cell free nucleic acids for cancer detection |
| BR112019004629A2 (en) | 2016-09-08 | 2019-10-01 | Bluebird Bio, Inc. | homing pd-1 endonuclease variants, compositions and methods of use |
| MA46543A (en) * | 2016-10-17 | 2019-08-21 | Bluebird Bio Inc | TGFBETA R2 ENDONUCLEASE VARIANTS, COMPOSITIONS AND METHODS OF USE |
| CN106589134B (en) * | 2016-11-11 | 2021-04-20 | 仪宏 | Chimeric protein pAgoE, construction method and application thereof, chimeric protein pAgoE using guide, construction method and application thereof |
| US12016313B2 (en) | 2017-01-19 | 2024-06-25 | Omniab Operations, Inc. | Human antibodies from transgenic rodents with multiple heavy chain immunoglobulin loci |
| US11680261B2 (en) | 2018-11-15 | 2023-06-20 | Grail, Inc. | Needle-based devices and methods for in vivo diagnostics of disease conditions |
| US12404500B2 (en) | 2018-12-10 | 2025-09-02 | Novo Nordisk A/S | Homing endonuclease variants |
| AU2019395334B2 (en) | 2018-12-10 | 2026-04-23 | Regeneron Pharmaceuticals, Inc. | PDCD-1 homing endonuclease variants |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006097784A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | I-crei meganuclease variants with modified specificity, method of preparation and uses thereof |
| WO2006097854A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | Heterodimeric meganucleases and use thereof |
| WO2007047859A2 (en) * | 2005-10-18 | 2007-04-26 | Precision Biosciences | Rationally-designed meganucleases with altered sequence specificity and dna-binding affinity |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2004208031B2 (en) * | 2003-01-28 | 2009-10-08 | Cellectis | Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof. |
-
2007
- 2007-02-19 US US12/527,799 patent/US20100086533A1/en not_active Abandoned
- 2007-02-19 CA CA002678526A patent/CA2678526A1/en not_active Abandoned
- 2007-02-19 WO PCT/IB2007/001527 patent/WO2008102198A1/en not_active Ceased
- 2007-02-19 EP EP07734802.7A patent/EP2126066B1/en not_active Not-in-force
- 2007-02-19 AU AU2007347328A patent/AU2007347328B2/en not_active Ceased
- 2007-02-19 JP JP2009549850A patent/JP5524627B2/en not_active Expired - Fee Related
- 2007-02-19 CN CN200780051453A patent/CN101679959A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006097784A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | I-crei meganuclease variants with modified specificity, method of preparation and uses thereof |
| WO2006097854A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | Heterodimeric meganucleases and use thereof |
| WO2006097853A1 (en) | 2005-03-15 | 2006-09-21 | Cellectis | I-crei meganuclease variants with modified specificity, method of preparation and uses thereof |
| WO2007047859A2 (en) * | 2005-10-18 | 2007-04-26 | Precision Biosciences | Rationally-designed meganucleases with altered sequence specificity and dna-binding affinity |
Non-Patent Citations (8)
| Title |
|---|
| ARNOULD ET AL., J. MOL. BIOL., vol. 355, 2006, pages 443 - 458 |
| CHEVALIER B ET AL: "Flexible DNA Target Site Recognition by Divergent Homing Endonuclease Isoschizomers I-CreI and I-MsoI", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 329, no. 2, 30 May 2003 (2003-05-30), pages 253 - 269, XP004454255, ISSN: 0022-2836 * |
| CHEVALIER BRETT ET AL: "Metal-dependent DNA cleavage mechanism of the I-CreI LAGLIDADG homing endonuclease", BIOCHEMISTRY, AMERICAN CHEMICAL SOCIETY. EASTON, PA, US, vol. 43, no. 44, 9 November 2004 (2004-11-09), pages 14015 - 14026, XP002412602, ISSN: 0006-2960 * |
| CHEVALIER ET AL., J. MOL. BIOL., vol. 329, 2003, pages 253 - 269 |
| CHEVALIER ET AL., NAT. STRUCT. BIOL., vol. 8, 2001, pages 312 - 316 |
| JURICA, MOL. CELL, vol. 2, 1998, pages 469 - 76 |
| SMITH JULIANNE ET AL: "A combinatorial approach to create artificial homing endonucleases cleaving chosen sequences", NUCLEIC ACIDS RESEARCH, vol. 34, no. 22, December 2006 (2006-12-01), XP009091809, ISSN: 0305-1048 * |
| SMITH, NUCLEIC ACIDS RES., 27 November 2006 (2006-11-27) |
Cited By (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9434931B2 (en) | 2007-10-31 | 2016-09-06 | Precision Biosciences, Inc. | Rationally-designed single-chain meganucleases with non-palindromic recognition sequences |
| US9340777B2 (en) | 2007-10-31 | 2016-05-17 | Precision Biosciences, Inc. | Rationally-designed single-chain meganucleases with non-palindromic recognition sequences |
| US10041053B2 (en) | 2007-10-31 | 2018-08-07 | Precision Biosciences, Inc. | Rationally-designed single-chain meganucleases with non-palindromic recognition sequences |
| EP3098309A1 (en) | 2007-10-31 | 2016-11-30 | Precision Biosciences, Inc. | Rationally-designed single-chain meganucleases with non-palindromic recognition sequences |
| US12351839B2 (en) | 2007-10-31 | 2025-07-08 | Precision Biosciences, Inc. | Rationally-designed single-chain meganucleases with non-palindromic recognition sequences |
| EP2660317A1 (en) | 2007-10-31 | 2013-11-06 | Precision Biosciences, Inc. | Rationally-designed single-chain meganucleases with non-palindromic recognition sequences |
| US8445251B2 (en) | 2007-10-31 | 2013-05-21 | Precision Biosciences, Inc. | Rationally-designed single-chain meganucleases with non-palindromic recognition sequences |
| US10287626B2 (en) | 2008-07-14 | 2019-05-14 | Precision Biosciences, Inc. | Recognition sequences for I-CreI-derived meganucleases and uses thereof |
| EP3211075A2 (en) | 2008-07-14 | 2017-08-30 | Precision Biosciences, Inc. | Recognition sequences for i-crei-derived meganucleases and uses thereof |
| US9683257B2 (en) | 2008-07-14 | 2017-06-20 | Precision Biosciences, Inc. | Recognition sequences for I-CreI-derived meganucleases and uses thereof |
| EP3495478A2 (en) | 2008-07-14 | 2019-06-12 | Precision Biosciences, Inc. | Recognition sequences for i-crei-derived meganucleases and uses thereof |
| EP4001408A2 (en) | 2008-07-14 | 2022-05-25 | Precision Biosciences, Inc. | Recognition sequences for i-crei-derived meganucleases and uses thereof |
| US10273524B2 (en) | 2008-07-14 | 2019-04-30 | Precision Biosciences, Inc. | Recognition sequences for I-CreI-derived meganucleases and uses thereof |
| US10316304B2 (en) | 2009-11-27 | 2019-06-11 | Basf Plant Science Company Gmbh | Chimeric endonucleases and uses thereof |
| US9404099B2 (en) | 2009-11-27 | 2016-08-02 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| WO2011064736A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Optimized endonucleases and uses thereof |
| WO2011064750A1 (en) | 2009-11-27 | 2011-06-03 | Basf Plant Science Company Gmbh | Chimeric endonucleases and uses thereof |
| DE112010004582T5 (en) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Optimized endonucleases and applications thereof |
| DE112010004584T5 (en) | 2009-11-27 | 2012-11-29 | Basf Plant Science Company Gmbh | Chimeric endonucleases and applications thereof |
| DE112010004583T5 (en) | 2009-11-27 | 2012-10-18 | Basf Plant Science Company Gmbh | Chimeric endonucleases and applications thereof |
| WO2011135407A1 (en) * | 2010-04-30 | 2011-11-03 | Cellectis | I-crei variants with new specificity and methods of their generation |
| WO2012168910A1 (en) | 2011-06-10 | 2012-12-13 | Basf Plant Science Company Gmbh | Nuclease fusion protein and uses thereof |
| US9758796B2 (en) | 2011-06-10 | 2017-09-12 | Basf Plant Science Company Gmbh | Nuclease fusion protein and uses thereof |
| EP2612918A1 (en) | 2012-01-06 | 2013-07-10 | BASF Plant Science Company GmbH | In planta recombination |
| WO2013102875A1 (en) | 2012-01-06 | 2013-07-11 | Basf Plant Science Company Gmbh | In planta recombination |
| US10150956B2 (en) | 2012-05-04 | 2018-12-11 | E I Du Pont De Nemours And Company | Compositions and methods comprising sequences having meganuclease activity |
| US9909110B2 (en) | 2012-05-04 | 2018-03-06 | E. I. Du Pont De Nemours And Company | Compositions and methods comprising sequences having meganuclease activity |
| US9499827B2 (en) | 2012-05-04 | 2016-11-22 | E I Du Pont De Nemours And Company | Compositions and methods comprising sequences having meganuclease activity |
| CN104411823A (en) * | 2012-05-04 | 2015-03-11 | 纳幕尔杜邦公司 | Compositions and methods comprising sequences having meganuclease activity |
| WO2013166113A1 (en) * | 2012-05-04 | 2013-11-07 | E. I. Du Pont De Nemours And Company | Compositions and methods comprising sequences having meganuclease activity |
| WO2023081756A1 (en) | 2021-11-03 | 2023-05-11 | The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone | Precise genome editing using retrons |
| WO2023141602A2 (en) | 2022-01-21 | 2023-07-27 | Renagade Therapeutics Management Inc. | Engineered retrons and methods of use |
| WO2024044723A1 (en) | 2022-08-25 | 2024-02-29 | Renagade Therapeutics Management Inc. | Engineered retrons and methods of use |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2678526A1 (en) | 2008-08-28 |
| EP2126066B1 (en) | 2013-05-01 |
| AU2007347328B2 (en) | 2013-03-07 |
| CN101679959A (en) | 2010-03-24 |
| EP2126066A1 (en) | 2009-12-02 |
| US20100086533A1 (en) | 2010-04-08 |
| AU2007347328A1 (en) | 2008-08-28 |
| JP2010518824A (en) | 2010-06-03 |
| JP5524627B2 (en) | 2014-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2007347328B2 (en) | LAGLIDADG homing endonuclease variants having novel substrate specificity and use thereof | |
| EP2121004B1 (en) | Obligate heterodimer meganucleases and uses thereof | |
| US7897372B2 (en) | I-CreI meganuclease variants with modified specificity, method of preparation and uses thereof | |
| WO2009095742A1 (en) | New i-crei derived single-chain meganuclease and uses thereof | |
| WO2009001159A1 (en) | Method for enhancing the cleavage activity of i-crei derived meganucleases | |
| WO2007057781A2 (en) | Laglidadg homing endonuclease variants having mutations in two functional subdomains and use thereof. | |
| WO2008059382A2 (en) | Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof | |
| WO2007093836A1 (en) | Meganuclease variants cleaving a dna target sequence from a xp gene and uses thereof | |
| WO2007060495A1 (en) | I-crei homing endonuclease variants having novel cleavage specificity and use thereof | |
| CA2689305A1 (en) | Method for enhancing the cleavage activity of i-crei derived meganucleases | |
| WO2007034262A1 (en) | Heterodimeric meganucleases and use thereof | |
| WO2008102274A2 (en) | Meganuclease variants cleaving a dna target sequence from the beta-2-microglobulin gene and uses thereof | |
| WO2009074842A1 (en) | Improved chimeric meganuclease enzymes and uses thereof | |
| US20110041194A1 (en) | I-msoi homing endonuclease variants having novel substrate specificity and use thereof | |
| WO2008059317A1 (en) | Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780051453.5 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07734802 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2678526 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007347328 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2009549850 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2007347328 Country of ref document: AU Date of ref document: 20070219 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007734802 Country of ref document: EP |
