WO2008059317A1 - Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof - Google Patents

Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof Download PDF

Info

Publication number
WO2008059317A1
WO2008059317A1 PCT/IB2006/004084 IB2006004084W WO2008059317A1 WO 2008059317 A1 WO2008059317 A1 WO 2008059317A1 IB 2006004084 W IB2006004084 W IB 2006004084W WO 2008059317 A1 WO2008059317 A1 WO 2008059317A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
crel
positions
variant
sequence
Prior art date
Application number
PCT/IB2006/004084
Other languages
French (fr)
Inventor
Julianne Smith
Original Assignee
Cellectis
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cellectis filed Critical Cellectis
Priority to PCT/IB2006/004084 priority Critical patent/WO2008059317A1/en
Priority to SG2011084480A priority patent/SG176487A1/en
Priority to US12/514,913 priority patent/US20100146651A1/en
Priority to CA002669313A priority patent/CA2669313A1/en
Priority to CN200780045983.9A priority patent/CN101583711B/en
Priority to AU2007320880A priority patent/AU2007320880A1/en
Priority to PCT/IB2007/004281 priority patent/WO2008059382A2/en
Priority to EP07859318A priority patent/EP2092063A2/en
Priority to JP2009536820A priority patent/JP5453097B2/en
Priority to BRPI0718747-5A priority patent/BRPI0718747A2/en
Publication of WO2008059317A1 publication Critical patent/WO2008059317A1/en
Priority to IL198693A priority patent/IL198693A0/en
Priority to US13/553,221 priority patent/US20130059387A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • the invention relates to a meganuclease variant cleaving a DNA target sequence from the HPRT gene, to a vector encoding said variant, to a cell, an animal or a plant modified by said vector and to the use of said meganuclease variant and derived products for genome engineering and genome therapy.
  • Meganucleases are by definition sequence-specific endonucleases with large (>14 bp) cleavage sites that can deliver DNA double-strand breaks (DSBs) at specific loci in living cells (EMS and Dujon, Nucleic Acids Res., 1992, 20, 5625- 5631). Meganucleases have been used to stimulate homologous recombination in the vicinity of their target sequences in cultured cells and plants (Rouet et al, MoI. Cell. Biol., 1994, 14, 8096-106; Choulika et al, MoI. Cell. Biol, 1995, 15, 1968-73; Donoho et al, MoI. Cell. Biol, 1998, 18, 4070-8; Elliott et al, MoI.
  • meganuclease-induced recombination has long been limited by the repertoire of natural meganucleases, and the major limitation of the current technology is the requirement for the prior introduction of a meganuclease cleavage site in the locus of interest.
  • the making of artificial meganucleases with tailored substrate specificities is under intense investigation.
  • Such proteins could be used to cleave genuine chromosomal sequences and open new perspectives for genome engineering in wide range of applications.
  • meganucleases could be used to to knock out endogenous genes or knock-in exogenous sequences in the chromosome. It can as well be used for gene correction, and in principle, for the correction of mutations linked with monogenic diseases.
  • meganucleases are essentially represented by homing endonucleases (HEs), a family of endonucleases encoded by mobile genetic elements, whose function is to initiate DNA double-strand break (DSB)-induced recombination events in a process referred to as homing (Chevalier and Stoddard, Nucleic Acids Res., 2001, 29, 3757-74; Kostriken et al, Cell; 1983, 35, 167-74; Jacquier and Dujon, Cell, 1985, 41, 383-94).
  • HEs Several hundreds of HEs have been identified in bacteria, eukaryotes, and archea (Chevalier and Stoddard, precited); however the probability of finding a HE cleavage site in a chosen gene is very low.
  • HEs Given their biological function and their exceptional cleavage properties in terms of efficacy and specificity, HEs provide ideal scaffolds to derive novel endonucleases for genome engineering.
  • LAGLIDADG The LAGLIDADG family, named after a conserved peptidic motif involved in the catalytic center, is the most widespread and the best characterized group (Chevalier and Stoddard, precited). Seven structures are now available. Whereas most proteins from this family are monomeric and display two LAGLIDADG motifs, a few ones have only one motif, but dimerize to cleave palindromic or pseudo-palidromic target sequences.
  • LAGLIDADG peptide is the only conserved region among members of the family, these proteins share a very similar architecture ( Figure IA).
  • the catalytic core is flanked by two DNA-binding domains with a perfect twofold symmetry for homodimers such as l-Crel (Chevalier et al, Nat. Struct. Biol., 2001, 8, 312-6) and l-Msol (Chevalier et al J. MoI. Biol., 2003, 329, 253-69), and with a pseudo symmetry fo monomers such as l-Scel (Moure et al, J. MoI. Biol, 2003, 334, 685-95), l-Dmol (Silva et al., J.
  • the first step is to locally mutagenize a natural LAGLIDADG meganuclease such as l-Crel and to identify collections of variants with altered specificity by screening.
  • the second step is to rely on the modularity of these proteins, and use a combinatorial approach to make novel meganucleases, that cleave the site of choice (Figure IB).
  • the Inventor has engineered functional homing endonuclease (homodimeric) variants, which are able to cleave palindromic chimeric targets ( Figure 1C). Furthermore, a larger combinatorial approach is allowed by assembling four different subdomains to form new heterodimeric molecules which are able to cleave non-palindromic chimeric targets ( Figure ID). The different subdomains can be modified separately to engineer new cleavge specificities and combine in one meganuclease variant (homodimer, heterodimer, single-chain molecule) which is able to cleave a target from a gene of interest.
  • the Hypoxanthine Phosphoribosyltransferase (HPRT) gene is a single copy gene located on X-chromosome and thus present in one copy (XY cells) or expressed from just one allele (XX cells).
  • the mouse and human HPRT genes are available in the NCBI database, under the accession number NC_000086 and NC_000023, respectively. Both genes have 9 exons ( Figure 2) which are transcribed into a 1289 bases mRNA (mouse; accession number NM_013556) or 1331 bases mRNA (human; accession number NMJ)OO 194), containing the HPRT ORF from positions 88 to 744 (mouse) or 86 to 742 (human).
  • the Chinese Hamster (Criteculus sp.) mRNA is a 1301 bases sequence (accession number J00060.1) containing the HPRT ORF from positions 91 to 747.
  • Hypoxanthine Phosphoribosyltransferase is an enzyme that catalyzes the conversion of 5-phosphoribosyl-l-pyrophosphate and hypoxanthine, guanine, or 6- mercaptopurine to the corresponding 5 '-mononucleotides and pyrophosphate.
  • the enzyme is important in purine biosynthesis as well as central nervous system function.
  • the HPRT gene is used as a selectable marker for gene targeting experiments. Compared to other selection markers, HPRT has the advantage of being both a positive and a negative selection marker. In addition mutations in the HPRT gene are associated with the LESCH-NYHAN SYNDROME.
  • an artificial meganuclease targeting the HPRT locus will allow efficient gene insertions (Figure 3A).
  • the ability to efficiently insert genes at this locus has the advantage of allowing reproducible expression levels as well as predictable time lines for generating insertions.
  • HPRT can be used as a selectable marker for gene targeting experiments.
  • a region of the target locus is replaced with an HPRT minigene, with HAT (hypoxanthine/aminopterin/thymidine;
  • HAT is a mixture of sodium hypoxanthine, aminopterin and thymidine.
  • Aminopterin is a potent folic acid antagonist, which inhibits dihydrofolate reductase blocking de novo nucleoside synthesis.
  • Cells can only survive in HAT if the purine and pyrimidine salvage pathways are active.
  • Hypoxanthine is the substrate for purine salvage pathway.
  • HPRT mutants are unable to utilize the purine salvage pathway and are sensitive to HAT selection.
  • the HPRT minigene is itself replaced with an altered region of the target gene to reconstitute the locus, with selection for loss of the HPRT marker using the purine analogue 6-thioguanine (6-TG).
  • the LESCH-NYHAN SYNDROME is an inherited disorder transmitted as a sex-linked trait that is caused by a deficiency of HPRT and characterized by hyperuricemia, severe motior disability and self-injurious behaviour.
  • Current gene therapy strategies are based on a complementation approach, wherein randomly inserted but functional extra copy of the gene provide for the function of the mutated endogenous copy.
  • meganuclease-induced recombination should allow for the precise correction of mutations in situ ( Figure 3C) and thereby bypass the risk due to the randomly inserted transgenes encountered with current gene therapy approaches (Hacein-Bey-Abina et al, Science, 2003, 302, 415-419).
  • the Inventor has identified a series of DNA targets in the HPRT gene that could be cleaved by l-Crel variants (Figure 10).
  • the combinatorial approach described in figure ID was used to assemble four set of mutations into heterodimeric homing endonucleases with fully engineered specificity, to cleave the DNA targets from the HPRT gene.
  • These I-Crel variants which are able to cleave a genomic DNA target from the HPRT gene can be used for genome engineering at the HPRT locus (knock-out and knock in) and for using HPRT as a selectable marker for genome engineering at any locus ( Figure 3 A and 3B).
  • the invention relates to the use of an 1-Crel variant or a single-chain derivative for inducing a site-specific modification in the HPRT gene, for non- therapeutic purpose, wherein said I-Crel variant has at least one substitution in one of the two functional subdomains of the LAGLIDADG core domain situated from positions 26 to 40 and 44 to 77 of I-Crel, and is able to cleave a DNA target sequence selected from the group consisting of the sequences SEQ ID NO: 1 to 14.
  • the cleavage activity of the variant as defined in the present invention may be measured by any well-known, in vitro or in vivo cleavage assay, such as those described in the International PCT Application WO 2004/067736, Arnould et al. (J. MoI. Biol, 2006, 355, 443-458), Epinat et al. (Nucleic Acids Res., 2003, 31, 2952-2962) and Chames et al. (Nucleic Acids Res., 2005, 33, el78).
  • the cleavage activity of the variant of the invention may be measured by a direct repeat recombination assay, in yeast or mammalian cells, using a reporter vector.
  • the reporter vector comprises two truncated, non-functional copies of a reporter gene (direct repeats) and the genomic DNA target sequence within the intervening sequence, cloned in a yeast or a mammalian expression vector. Expression of the variant results in a functional endonuclease which is able to cleave the genomic DNA target sequence. This cleavage induces homologous recombination between the direct repeats, resulting in a functional reporter gene, whose expression can be monitored by appropriate assay.
  • nucleosides are designated as follows: one-letter code is used for designating the base of a nucleoside: a is adenine, t is thymine, c is cytosine, and g is guanine.
  • r represents g or a (purine nucleotides)
  • k represents g or t
  • s represents g or c
  • w represents a or t
  • m represents a or c
  • d represents g, a or t
  • v represents g, a or c
  • b represents g, t or c
  • h represents a, t or c
  • n represents g, a, t or c.
  • - by "meganuclease" is intended an endonuclease having a double- stranded DNA target sequence of 14 to 40 pb.
  • Said meganuclease is either a dimeric enzyme, wherein each domain is on a monomer or a monomeric enzyme comprising the two domains on a single polypeptide.
  • “meganuclease domain” is intended the region which interacts with one half of the DNA target of a meganuclease and is able to associate with the other domain of the same meganuclease which interacts with the other half of the DNA target to form a functional meganuclease able to cleave said DNA target.
  • meganuclease variant or “variant” is intented a meganuclease obtained by replacement of at least one residue in the amino acid sequence of the wild-type meganuclease (natural meganuclease) with a different amino acid.
  • - by "functional variant” is intended a variant which is able to cleave a DNA target sequence, preferably said target is a new target which is not cleaved by the parent meganuclease.
  • such variants have amino acid variation at positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target.
  • “meganuclease variant with novel specificity” is intended a variant having a pattern of cleaved targets different from that of the parent homing endonuclease.
  • the terms “novel specificity”, “modified specificity”, “novel cleavage specificity”, “novel substrate specificity” which are equivalent and used indifferently, refer to the specificity of the variant towards the nucleotides of the DNA target sequence.
  • I-Crel is intended the wild-type 1-OeI having the sequence SWISSPROT P05725 or pdb accession code Ig9y, corresponding to the sequence SEQ ID NO: 143 in the sequence listing.
  • LAGLIDADG core domain or “core domain” is intended the "LAGLIDADG Homing Endonuclease Core Domain” which is the characteristic ⁇ i ⁇ i ⁇ 2 ⁇ 2 ⁇ 3 ⁇ 4 ⁇ 3 fold of the homing endonucleases of the LAGLIDADG family, corresponding to a sequence of about one hundred amino acid residues.
  • Said domain comprises four beta-strands ( ⁇ 1] ⁇ 2) ⁇ 3j ⁇ 4 ) folded in an antiparallel beta-sheet which interacts with one half of the DNA target.
  • This domain is able to associate with another LAGLIDADG Homing Endonuclease Core Domain which interacts with the other half of the DNA target to form a functional endonuclease able to cleave said DNA target.
  • the LAGLIDADG Homing Endonuclease Core Domain corresponds to the residues 6 to 94.
  • single-chain meganuclease is intended a meganuclease comprising two LAGLIDADG Homing Endonuclease domains or core domains linked by a peptidic spacer.
  • the single-chain meganuclease is able to cleave a chimeric DNA target sequence comprising one different half of each parent meganuclease target sequence.
  • subdomain is intended the region of a LAGLIDADG Homing
  • Endonuclease Core Domain which interacts with a distinct part of a homing endonuclease DNA target half-site.
  • Two different subdomains behave independently and the mutation in one subdomain does not alter the binding and cleavage properties of the other subdomain. Therefore, two subdomains bind distinct part of a homing endonuclease DNA target half-site.
  • beta-hairpin is intended two consecutive beta-strands of the antiparallel beta-sheet of a LAGLIDADG homing endonuclease core domain ( ⁇ ! ⁇ 2 or, p 3 p 4 ) which are connected by a loop or a turn,
  • l-Crel sites include the wild-type (natural) non- palindromic 1-OeI homing site and the derived palindromic sequences such as the sequence 5'- t- 1 2C- ⁇ a -lo a -9 a-sa -7 c -6 g,5t-4C -3 g.
  • cleavage site is intended a 20 to 24 bp double-stranded palindromic, partially palindromic (pseudo-palindromic) or non-palindromic polynucleotide sequence that is recognized and cleaved by a LAGLIDADG homing endonuclease such as 1-OeI, or a variant, or a single-chain chimeric meganuclease derived from l-Crel.
  • LAGLIDADG homing endonuclease such as 1-OeI, or a variant, or a single-chain chimeric meganuclease derived from l-Crel.
  • the DNA target is defined by the 5' to 3' sequence of one strand of the double-stranded polynucleotide, as indicate above for C 1221. Cleavage of the DNA target occurs at the nucleotides in positions +2 and -2, respectively for the sense and the antisense strand. Unless otherwiwe indicated, the position at which cleavage of the DNA target by an l-Cre I meganuclease variant occurs, corresponds to the cleavage site on the sense strand of the DNA target.
  • DNA target half-site by "DNA target half-site", "half cleavage site” or half-site” is intended the portion of the DNA target which is bound by each LAGLIDADG homing endonuclease core domain.
  • chimeric DNA target a DNA target, wherein at least one half of said target comprises the combination of nucleotides which are bound by at least two separate subdomains.
  • DNA target sequence from the HPRT gene is intended a 20 to 24 bp sequence of a HPRT gene which is recognized and cleaved by a meganuclease variant.
  • HPRT gene is intended the HPRT gene of a vertebrate.
  • vector a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • homologous is intended a sequence with enough identity to another one to lead to a homologous recombination between sequences, more particularly having at least 95 % identity, preferably 97 % identity and more preferably 99 %.
  • identity refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences. Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or BLAST which are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default settings.
  • mammals as well as other vertebrates (e.g., birds, fish and reptiles).
  • mammals e.g., birds, fish and reptiles.
  • mammalian species include humans and other primates (e.g., monkeys, chimpanzees), rodents (e.g., rats, mice, guinea pigs) and others such as for example: cows, pigs and horses.
  • - by mutation is intended the substitution, deletion, insertion of one or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence.
  • Said mutation can affect the coding sequence of a gene or its regulatory sequence. It may also affect the structure of the genomic sequence or the structure/stability of the encoded mRNA.
  • genetic disease refers to any disease, partially or completely, directly or indirectly, due to an abnormality in one or several genes. Said abnormality can be a mutation. Said genetic disease can be recessive or dominant.
  • said substitution(s) in the subdomain situated from positions 44 to 77 of I- OeI are in positions 44, 68, 70, 75 and/or 77.
  • said substitution(s) in the subdomain situated from positions 26 to 40 of I- OeI are in positions 26, 28, 30, 32, 33, 38 and/or 40.
  • said l-Crel variant comprises one or more substitutions at additional positions situated on the entire I-Crel sequence or only in the C-terminal half of I-Crel (positions 80 to 163).
  • the residues which are mutated may include residues contacting the DNA target sequence or interacting with the DNA backbone or with the nucleotide bases, directly or via a water molecule; these I-O*el interacting residues are well- known in the art.
  • said variant comprises one or more substitutions in positions: 2, 9, 54, 66, 69, 81, 82, 86, 90, 92, 96, 100, 103, 104, 105, 107, 108, 109, 110, 113, 120, 125, 129, 130, 131, 132, 135, 136, 137, 140, 143, 151, 154, 155, 157, 158, 159, 161 and 162 of I-Crel.
  • said substitutions are replacement of the initial amino acids with amino acids selected from the group consisting of: A, D, E, G, H, K, N 5 P, Q, R, S, T, Y, C, V 5 L 5 W, M and I.
  • amino acids selected from the group consisting of: A, D, E, G, H, K, N 5 P, Q, R, S, T, Y, C, V 5 L 5 W, M and I.
  • the asparagine (N) in position 30 may be mutated in: S 5 C 5 R, Y 5 Q 5 D and T 5
  • - the serine (S) in position 32 may be mutated in : D 5 T, R, G and W
  • - the tyrosine (Y) in position 33 may be mutated in: H 5 T 5 G 5 R 5 C 5
  • the glutamine (Q) in position 38 may be mutated in: W, S, T, G 5 E 5 A, Y 5 C 5 D and H
  • the serine (S) in position 40 may be mutated in: Q 5 A 5 T and R 5 - the glutamine (Q) in position 44 may be mutated in : N 5 T 5 R 5 K, D 5
  • arginine (R) in position 68 may be mutated in: K 5 Q 5 E 5 A, Y 5 N 5 H and T,
  • the arginine (R) in position 70 may be mutated in: S 5 H, N and K 5 - the aspartic acid (D) in position 75 may be mutated in: R 5 S 5 N 5 Y 5
  • the isoleucine (I) in position 77 may be mutated in: T 5 W 5 Y 5 K 5 N, R, H 5 D 5 F 5 E 5 Q and L.
  • the l-Crel variants as defined in the present invention may include one or more residues inserted at the NH 2 terminus and/or COOH terminus of the l-Crel sequence.
  • a tag epipe or polyhistidine sequence
  • said tag is useful for the detection and/or the purification of said variant.
  • the l-Crel variant as defined in the invention may be an homodimer or an heterodimer resulting from the association of a first monomer having at least one mutation in positions 26 to 40 or 44 to 77 of l-Crel and a second monomer which is I- Crel or an l-Crel variant.
  • said 1-Crel variant is an heterodimer, resulting from the association of a first and a second monomer having different mutations in positions 26 to 40 and/or 44 to 77 of I-Crel.
  • at least one monomer has at least two substitutions, one in each of the two functional subdomains situated from positions 26 to 40 and 44 to 77 of l-Crel.
  • said heterodimer consist of a first and a second monomer selected from the following pairs of sequences: SEQ ID NO: 83 and 97, SEQ ID NO: 84 and 98, SEQ ID NO: 85 and 99, SEQ ID NO/ 32 and 52, SEQ ID NO: 32 and 53, SEQ ID NO: 32 and 54, SEQ ID NO: 32 and 55, SEQ ID NO: 32 and 56, SEQ ID NO: 32 and 57, SEQ ID NO: 32 and 58, SEQ ID NO: 32 and 60, SEQ ID NO: 32 and 65, SEQ ID NO: 32 and 66, SEQ ID NO: 32 and 67, SEQ ID NO: 32 and 68, SEQ ID NO: 32 and 69, SEQ ID NO: 32 and 70, SEQ ID NO: 32 and 71, SEQ ID NO: 32 and 72 SEQ ID NO: 32 and 73, SEQ ID NO: 32 and 74, SEQ ID NO: 75 and 56, SEQ ID NO: 76 and 56, SEQ ID NO:
  • the single-chain derivative of the I- Cr el variant as defined in the present invention is a fusion protein comprising two monomers or two core domains of a LAGLIDADG meganuclease or a combination of both, wherein at least one monomer or core domain has the sequence of an l-Crel variant having at least one substitution in positions 26 to 40 and/or 44 to 77 of l-Crel, as defined above.
  • the DNA target sequences are present in the HPRT gene of at least one mammal (human or animal).
  • the target sequences SEQ ID NO: 6 and 12 are present at least in the human, mouse and Chinese Hamster (Criteculus sp.) HPRT genes.
  • the target sequences SEQ ID NO: 7 and 9 are present at least in both the mouse and Chinese Hamster HPRT genes.
  • the target sequences SEQ ID NO: 1 to 5, 8, 10, 11, 13 and 14 are present at least in the Chinese Hamster HPRT gene.
  • target sequences having sequence identity with the nucleotides in position + 3 to 5 and ⁇ 8 to 10 of the sequences SEQ ID NO: 8 and 14 are present at least in the human and mouse HPRT genes.
  • Target sequences having sequence identity with the nucleotides in position ⁇ 3 to 5 and + 8 to 10 of the sequences SEQ ID NO: 10 and 11 are present at least in the mouse HPRT gene (sequence identity is not found with the human HPRT gene).
  • a target sequence having sequence identity with the nucleotides in position ⁇ 3 to 5 and ⁇ 8 to 10 of the sequence SEQ ID NO: 9 is present at least in the human HPRT gene.
  • the 1-Crel variants which cleave one of the DNA target sequences SEQ ID NO: 6 and 12 are able to induce a site-specific modification at least in the human, mouse and Chinese Hamster HPRT gene.
  • the I-Oel variants which cleave the DNA target sequences SEQ ID NO: 9 are able to induce a site-specific modification both in the Chinese Hamster and mouse HPRT gene, and for some of them, also in the human HPRT gene.
  • the 1-Crel variants which cleave the DNA target sequences SEQ ID NO: 8 are able to induce a site-specific modification in the Chinese Hamster and for some of them, also in the human and/or mouse HPRT gene; the position of the modification in the HPRT gene corresponds to the position of the genomic DNA cleavage site (position +2 on the sense strand of the genomic DNA target (i.e. positions: 101 (Exon 3), 16 (Exon 8), 21 (Exon 6), 150 (Exon 3), respectively for the sequences SEQ ID NO: 6, 12, 9 and 8).
  • the I-Crel variants which cleave the DNA target sequence SEQ ID NO: 8 are able to induce a site-specific modification in the Chinese Hamster and for some of them, also in the human and/or mouse HPRT gene; the position of the modification in the HPRT gene corresponds to the position of the genomic DNA cleavage site (position +2 on the sense strand of the genomic DNA target (i.e. positions: 101 (Exon 3), 16 (
  • the l-Crel variants which cleave the DNA target sequences SEQ ID NO: 10 and 11 are able to induce a site-specific modification in the Chinese Hamster HPRT gene and for some of them, also in the mouse HPRT gene (but not at the corresponding position in the human HPRT gene); the position of the modification in the HPRT gene corresponds to positions 106 (Exon 3), 51 (Exon 6) and 52 (Exon 6), respectively.
  • the I-Crel variants which cleave the DNA target sequence SEQ ID NO: 14 are able to induce a site-specific modification in the Chinese Hamster HPRT gene and for some of them, also in the human HPRT gene (but not at the corresponding position in the mouse HPRT gene); the position of the modification in the HPRT gene corresponds to position 68 (Exon 9).
  • the I-Crel variants which cleave one of the DNA target sequences SEQ ID NO: 1 to 5 and 13 are able to induce a site-specific modification at least in the Chinese Hamster HPRT gene (but not at the corresponding position in the human or mouse HPRT gene); the position of the modification in the HPRT gene corresponds to positions -7 from the ATG (Exon 1), 54 (Exon 2), 93(Exon 2), 29 (Exon 3), 69(Exon 3), 93 (Exon 9) and 21 (Exon 9), respectively.
  • Table II Sequence of heterodimeric I-Crel variants cleaving having a DNA target from the HPRT gene
  • the sequence of each variant is defined by its amino acid residues at the indicated positions.
  • the first heterodimeric variant of Table II consists of a first monomer having K, Q, D, Y, Q, S, N, K, S, R and T in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively and a second monomer having K, N, S, G, C, S, Q, R, R, N, and I in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively.
  • the positions are indicated by reference to ⁇ -Crel sequence SWISSPROT P05725 or pdb accession code Ig9y; l-Crel has K, N, S, Y, Q, S, Q, R, R, D and I in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively.
  • the positions which are not indicated are not mutated and thus correspond to the wild-type 1-OeI sequence.
  • said l-Crel variant or single-chain derivative are combined with a targeting DNA construct comprising a sequence to be introduced flanked by sequences sharing homologies with the regions of the HPRT gene surrounding the genomic DNA cleavage site of said l-Crel variant or single-chain derivative, as defined above.
  • homologous sequences of at least 50 bp, preferably more than 100 bp and more preferably more than 200 bp are used.
  • shared DNA homologies are located in regions flanking upstream and downstream the site of the break and the DNA sequence to be introduced should be located between the two arms.
  • the sequence to be introduced comprises an exogenous gene of interest or a sequence to inactivate or delete the HPRT gene or part thereof.
  • Such chromosomal DNA alterations can be used for making HPRT knock-out and knock-in animals wherein the HPRT gene is inactivated (knock-out) and eventually replaced with an exogenous gene of interest (knock-in).
  • chromosomal DNA alterations are used also for making genetically modified vertebrate (mammalian including human) cell lines wherein the endogeneous HPRT gene is inactivated and a transgene is eventually inserted at the HPRT locus.
  • HPRT may be used as a positive selection marker (selection for HPRT marker expression with HAT) in further gene targeting procedures at any locus of the chromosomes of the HPRT deficient cell/animal.
  • the subject-matter of the present invention is also a method for making an HPRT knock-in or knock-out animal, comprising at least the step of:
  • step (b) introducing into the animal precursor cell or embryo of step (a) a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA, so as to generate a genomically modified animal precursor cell or embryo having repaired the site of interest by homologous recombination, (c) developping the genomically modified animal precursor cell or embryo of step (b) into a chimeric animal, and
  • step (c) comprises the introduction of the genomically modified precursor cell generated in step (b) into blastocysts so as to generate chimeric animals.
  • the subject-matter of the present invention is also a method for making an HPRT knock-in or knock-out cell, comprising at least the step of:
  • step (b) introducing into the cell of step (a), a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA, so as to generate a recombinant cell having repaired the site of interest by homologous recombination,
  • step (c) isolating the recombinant cell of step (b), by any appropriate mean.
  • the targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest.
  • said targeting DNA construct is inserted in a vector.
  • the HPRT gene may be inactivated by repair of the double-strands break by non-homologous end joining ( Figure 3B).
  • the subject-matter of the present invention is also a method for making an HPRT knock-out animal, comprising at least the step of:
  • step (b) developping the genomically modified animal precursor cell or embryo of step (a) into a chimeric animal, and (c) deriving a transgenic animal from a chimeric animal of step (b).
  • step (b) comprises the introduction of the genomically modified precursor cell obtained in step (a), into blastocysts, so as to generate chimeric animals.
  • the subject-matter of the present invention is also a method for making an HPRT-deficient cell, comprising at least the step of:
  • step(b) isolating the genomically modified HPRT deficient cell of step(a), by any appropriate mean.
  • the cell which is modified may be any cell of interest.
  • the cells are pluripotent precursor cells such as embryo- derived stem (ES) cells, which are well-kown in the art.
  • ES embryo- derived stem
  • Said l-Crel variant/single- chain derivative can be provided directly to the cell or through an expression vector comprising the polynucleotide sequence encoding said meganuclease and suitable for its expression in the used cell.
  • the loss of the endogenous HPRT gene in the modified cells may be selected by using the purine analogue 6-thioguanine (6-TG).
  • said I-Crel variant or single-chain derivative are encoded by a polynucleotide fragment.
  • Said polynucleotide may encode one monomer of an homodimeric or heterodimeric variant, or two domains/monomers of a single-chain chimeric endonuclease.
  • said polynucleotide fragment is inserted in a vector which is suitable for its expression in the used cells.
  • Said vector comprises advantageously a targeting DNA construct as defined above.
  • said vector comprises two different polynucleotide fragments, each encoding one of the monomers of an heterodimeric I-Cre I variant, as defined above.
  • a vector which can be used in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non chromosomal, semisynthetic or synthetic nucleic acids.
  • Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available.
  • Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adeno- associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis virus), paramyxovirus (e. g. measles and Sendai), positive strand RNA viruses such as picor- navirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.
  • orthomyxovirus e. g., influenza virus
  • rhabdovirus e. g., rabies and vesicular stomatitis virus
  • paramyxovirus e. g. measles and Sendai
  • viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example.
  • retroviruses include: avian leukosis- sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
  • Preferred vectors include lentiviral vectors, and particularly self inactivacting lentiviral vectors.
  • Vectors can comprise selectable markers, for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adenosine deaminase, glutamine synthetase, and hypoxanthine-guanine phosphoribosyl transferase for eukaryotic cell culture; TRPl for S. cerevisiae; tetracycline, rifampicin or ampicillin resistance in E. coli.
  • selectable markers for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adenosine deaminase, glut
  • said vectors are expression vectors, wherein the sequence(s) encoding the variant/single-chain molecule of the invention is placed under control of appropriate transcriptional and translational control elements to permit production or synthesis of said variant.
  • said polynucleotide is comprised in an expression cassette. More particularly, the vector comprises a replication origin, a promoter operatively linked to said encoding polynucleotide, a ribosome-binding site, an RNA-splicing site (when genomic DNA is used), a polyadenylation site and a transcription termination site. It also can comprise an enhancer. Selection of the promoter will depend upon the cell in which the polypeptide is expressed.
  • the two polynucleotides encoding each of the monomers are included in one vector which is able to drive the expression of both polynucleotides, simultaneously.
  • Suitable promoters include tissue specific and/or inducible promoters. Examples of inducible promoters are: eukaryotic metallothionine promoter which is induced by increased levels of heavy metals, prokaryotic lacZ promoter which is induced in response to isopropyl- ⁇ - D-thiogalacto-pyranoside (IPTG) and eukaryotic heat shock promoter which is induced by increased temperature.
  • tissue specific promoters are skeletal muscle creatine kinase, prostate-specific antigen (PSA), ⁇ -antitrypsin protease, human surfactant (SP) A and B proteins, ⁇ -casein and acidic whey protein genes.
  • PSA prostate-specific antigen
  • SP human surfactant
  • the targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest.
  • the DNA which repairs the site of interest comprises the sequence of an exogenous gene of interest, and eventually a selection marker, such as the HPRT gene.
  • the DNA which repairs the site of interest comprises sequences that inactivate the endogeneous gene of interest.
  • the subject matter of the present invention is also to the use of an I- OeI variant or a single-chain derivative as defined above, for the preparation of a medicament for preventing, improving or curing a genetic disease associated with a mutation in the HPRT gene in an individual in need thereof, said medicament being administrated by any means to said individual.
  • the use of the 1-OeI variant or a single-chain derivative as defined above comprises at least the step of (a) inducing in somatic tissue(s) of the individual a double stranded cleavage at a site of interest of the HPRT gene comprising at least one recognition and cleavage site of said variant, and (b) introducing into the individual a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA.
  • the targeting DNA is introduced into the individual under conditions appropriate for introduction of the targeting DNA into the site of interest.
  • said double-stranded cleavage is induced, either in toto by administration of said meganuclease to an individual, or ex vivo by introduction of said meganuclease into somatic cells removed from an individual and returned into the individual after modification.
  • the l-Crel variant or single- chain derivative is combined with a targeting DNA construct comprising a sequence which repairs a mutation in the HPRT gene flanked by sequences sharing homologies with the regions of the HPRT gene surrounding the genomic DNA cleavage site of said l-Crel variant or single-chain derivative, as defined above.
  • the targeting construct comprises a HPRT gene fragment which has at least 200 bp of homologous sequence flanking the genomic DNA cleavage site (minimal repair matrix) for repairing the cleavage, and includes the correct sequence of the HPRT gene for repairing the mutation ( Figure 3C). Consequently, the targeting construct for gene correction comprises or consists of the minimal repair matrix; it is preferably from 200 pb to 6000 pb, more preferably from 1000 pb to 2000 pb.
  • cleavage of the gene occurs upstream of a mutation.
  • said mutation is the first known mutation in the sequence of the gene, so that all the downstream mutations of the gene can be corrected simultaneously.
  • the targeting construct comprises the exons downstream of the genomic DNA cleavage site fused in frame (as in the cDNA) and with a polyadenylation site to stop transcription in 3'.
  • the sequence to be introduced is flanked by introns or exons sequences surrounding the cleavage site, so as to allow the transcription of the engineered gene (exon knock-in gene) into a mRNA able to code for a functional protein (Figure 3D).
  • the exon knock-in construct is flanked by sequences upstream and downstream
  • the l-Crel variant or single-chain derivative is encoded by a vector.
  • the vector comprises the targeting DNA construct, as defined above.
  • the genetic disease is the Lesch Nyhan Syndrome.
  • the subject-matter of the present invention is also a composition characterized in that it comprises at least one I-Crel variant or single-chain derivative and/or at least one expression vector encoding said variant/single-chain molecule, as defined above, and a pharmaceutically acceptable excipient.
  • a composition comprises a targeting DNA construct comprising a sequence which repairs a mutation in the HPRT gene, flanked by sequences sharing homologies with the genomic DNA cleavage site of said variant, as defined above.
  • the sequence which repairs the mutation is either a fragment of the gene with the correct sequence or an exon knock-in construct, as defined above.
  • said targeting DNA construct is either included in a recombinant vector or it is included in an expression vector comprising the polynucleotide(s) encoding the variant/single-chain molecule, as defined in the present invention.
  • the subject-matter of the present invention is also products containing at least one I-Crel variant/single-chain derivative or one expression vector encoding said meganucleases, and a vector including a targeting construct, as defined above, as a combined preparation for simultaneous, separate or sequential use in the prevention or the treatment of a genetic disease associated with a mutation in the HPRT gene.
  • the subject-matter of the present invention is also a method for preventing, improving or curing a genetic disease associated with a mutation in the HPRT gene in an individual in need thereof, said method comprising at least the step of administering to said individual a composition as defined above, by any means.
  • the l-Crel variant/single-chain derivative and a pharmaceutically acceptable excipient are administered in a therapeutically effective amount.
  • Such a combination is said to be administered in a "therapeutically effective amount” if the amount administered is physiologically significant.
  • An agent is physiologically significant if its presence results in a detectable change in the physiology of the recipient.
  • an agent is physiologically significant if its presence results in a decrease in the severity of one or more symptoms of the targeted disease and in a genome correction of the lesion or abnormality.
  • the l-Crel variant/single-chain derivative is substantially non-immunogenic, i.e., engender little or no adverse immunological response.
  • a variety of methods for ameliorating or eliminating deleterious immunological reactions of this sort can be used in accordance with the invention.
  • the l-Crel variant/single-chain derivative is substantially free of N-formyl methionine.
  • Another way to avoid unwanted immunological reactions is to conjugate meganucleases to polyethylene glycol (“PEG”) or polypropylene glycol (“PPG”) (preferably of 500 to 20,000 daltons average molecular weight (MW)).
  • Conjugation with PEG or PPG can provide non-immunogenic, physiologically active, water soluble endonuclease conjugates with anti-viral activity. Similar methods also using a polyethylene—polypropylene glycol copolymer are described in Saifer et al. (US 5,006,333).
  • the 1-OeI variant or single-chain derivative can be used either as a polypeptide or as a polynucleotide construct/vector encoding said polypeptide.
  • the meganuclease and if present, the vector comprising targeting DNA and/or nucleic acid encoding a meganuclease are imported or translocated by the cell from the cytoplasm to the site of action in the nucleus.
  • the 1-OeI variant or single-chain derivative may be advantageously associated with: liposomes, polyethyleneimine (PEI), and/or membrane translocating peptides (Bonetta, The Principle, 2002, 16, 38; Ford et al., Gene Ther., 2001, 8, 1-4 ; Wadia and Dowdy, Curr. Opin. Biotechnol., 2002, 13, 52- 56); in the latter case, the sequence of the l-Cre variant/single-chain molecule is fused with the sequence of a membrane translocating peptide (fusion protein).
  • PEI polyethyleneimine
  • Vectors comprising targeting DNA and/or nucleic acid encoding a meganuclease can be introduced into a cell by a variety of methods (e.g., injection, direct uptake, projectile bombardment, liposomes, electroporation). Meganucleases can be stably or transiently expressed into cells using expression vectors. Techniques of expression in eukaryotic cells are well known to those in the art. (See Current Protocols in Human Genetics: Chapter 12 "Vectors For Gene Therapy” & Chapter 13 "Delivery Systems for Gene Therapy”). Optionally, it may be preferable to incorporate a nuclear localization signal into the recombinant protein to be sure that it is expressed within the nucleus.
  • the subject-matter of the present invention is also an I-Crel variant/single-chain derivative, a polynucleotide fragment encoding said variant or a single-chain derivative, a vector comprising said polynucleotide fragment and/or a DNA targeting construct, a prokaryotic or eukaryotic host cell which is modified by a polynucleotide or a vector as defined above, preferably an expression vector.
  • the subject-matter of the present invention is also a non-human transgenic animal or a transgenic plant, wherein all or part of their cells are modified by a polynucleotide or a vector as defined above.
  • a cell refers to a prokaryotic cell, such as a bacterial cell, or an eukaryotic cell, such as an animal, plant or yeast cell.
  • the I-Crel variant as defined in the present invention is obtainable by a method for engineering I-Crel variants able to cleave a genomic DNA target sequence from a vertebrate gene, comprising at least the steps of: (a) constructing a first series of 1-OeI variants having at least one substitution in a first functional subdomain of the LAGLIDADG core domain situated from positions 26 to 40 of l-Crel,
  • step (c) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant 1-OeI site wherein (i) the nucleotide triplet in positions -10 to -8 of the 1-OeI site has been replaced with a nucleotide triplet selected from the group consisting of cag, att, cct, ttg, gac, atg, ttt, ttc, tgg, gtc, aag, gag and (ii) the nucleotide triplet in positions +8 to +10 has been replaced with the reverse complementary sequence of said nucleotide triplet which is substituted in position -10 to -8 of said I-Crel site (i.e.: ctg, aat, agg, caa, gtc, cat, aaa, gaa, cca, gac, ctt, and etc, respectively),
  • step (d) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions -5 to -3 of the l-Crel site has been replaced with a nucleotide triplet selected from the group consisting of : gac, taa, tea, gtg, get, tgt, tgg, ctg, ttg, tag, and gag and (ii) the nucleotide triplet in positions +3 to +5 has been replaced with the reverse complementary sequence of said nucleotide triplet which is substituted in position -5 to -3 of said ⁇ -Cre ⁇ site (i.e.: gtc, tta, tga, cac, age, aca, cca, cag, caa, eta and etc, respectively), (e) selecting and/or screening the variants from the first series of step (
  • step (f) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions +3 to +5 of the I-Crel site has been replaced with the nucleotide triplet selected from the group consisting of: tec, tat, gtg, gaa, tgg, tac, ttt, aca, age, gcg, tec, act, caa and aag and (ii) the nucleotide triplet in positions -5 to -3 has been replaced with the reverse complementary sequence of which is substituted in position +3 to +5 of said l-Crel site (i.e.: gga, ata, cac, ttc, cca, gta, aaa, tgt, get, cgc, gga, agt, ttg and ctt, respectively),
  • said l-Crel variant is obtainable by a method comprising at least the steps (a) to (f) as defined above, and the further steps of:
  • step (h 2 ) selecting and/or screening the heterodimers from step (g 2 ) which are able to cleave said DNA target of the sequence SEQ ID NO: 1 to 14.
  • said I-Crel variant is obtainable by a method comprising at least the steps (a) to (f) as defined above, and the further steps of:
  • step (h 3 ) combining in a single variant, the mutation(s) in positions 26 to 40 and 44 to 77 of two variants from step (e) and step (f), to obtain a novel homodimeric 1-OeI variant which cleaves a sequence wherein (i) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, (ii) the nucleotide triplet in positions -5 to -3 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, (iii) the nucleotide triplet in positions +8 to +10 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said of said DNA target of the sequence SEQ ID NO: 1 to 14 and (
  • said 1-OeI variant is obtainable by a method comprising at least the steps (a) to (f), the step (g 3 ) and/or the step (h 3 ) as defined above, and the further steps of : (i 4 ) combining the variants obtained in step (g 3 ) with the variants obtained in step (h 3 ), 1-OeI or the variants obtained in step (e) or step (f), to form heterodimers, or
  • step (i' 4 ) combining the variants obtained in step (h 3 ) with l-Crel or the variants obtained in step (c) or step (d), to form heterodimers, and (J 4 ) selecting and/or screening the heterodimers from step (i 4 ) or (i' 4 ) which are able to cleave a DNA target of the sequence SEQ ID NO: 1 to 14.
  • the selection and/or screening in steps (c), (d), (e), (f), (gi), (h 2 ), (i 3 ) and (J 4 ) may be performed by using a cleavage assay in vitro or in vivo, as described in the International PCT Application WO 2004/067736, Epinat et al. (Nucleic Acids Res., 2003, 31, 2952-2962), Chames et al. (Nucleic Acids Res., 2005, 33, el78), and Arnould et al. (J. MoI. Biol, 2006, 355, 443-458).
  • steps (c), (d), (e), (f), (gi), (h 2 ), (i 3 ) and/or (J 4 ) are performed in vivo, under conditions where the double- strand break in the mutated DNA target sequence which is generated by said variant leads to the activation of a positive selection marker or a reporter gene, or the inactivation of a negative selection marker or a reporter gene, by recombination- mediated repair of said DNA double-strand break, as described in the International PCT Application WO 2004/067736, Epinat et al. (Nucleic Acids Res., 2003, 31, 2952- 2962), Chames et al.
  • Steps (a) and (b) may comprise the introduction of additional mutations in order to improve the binding and/or cleavage properties of the mutants, particularly at other positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target. These steps may be performed by generating combinatorial libraries as described in the International PCT Application WO 2004/067736 and Arnould et al. (J. MoI. Biol., 2006, 355, 443-458).
  • the (intermolecular) combination of the variants in step (g 2 ), (i 4 ), and (i' 4 ) is performed by co-expressing, either two different variants from steps (c) and (d), (e) and (f), (g 3 ) and Qx 3 ), (g 3 ) and (e), (g 3 ) and (f), (h 3 ) and (c), Qa 3 ) and (d), or one variant from any of steps (c) to (f), (g 3 ) or (h 3 ) with I-Crel, so as to allow the formation of heterodimers.
  • host cells may be modified by one or two recombinant expression vector(s) encoding said variant(s).
  • the cells are then cultured under conditions allowing the expression of the variant(s), so that heterodimers are formed in the host cells, as described previously in the International PCT Application WO 2006/097854 and Arnould et al. (J. MoI. Biol, 2006, 355, 443-458).
  • the (intramolecular) combination of mutations in steps (g 3 ) and (h 3 ) may be performed by amplifying overlapping fragments comprising each of the two subdomains by well-known overlapping PCR techniques.
  • step (g 3 ) and/or (h 3 ) may further comprise the introduction of random mutations on the whole variant or in a part of the variant, in particular the C-terminal half of the variant (positions 80 to 163). This may be performed by generating random mutagenesis libraries on a pool of variants, according to standard mutagenesis methods which are well-known in the art and commercially available.
  • the subject matter of the present invention is also an I-Crel variant having mutations in positions 26 to 40 and/or 44 to 77 of 1-OeI that is useful for engineering the variants able to cleave a DNA target from the HPRT gene, according to the present invention.
  • the invention encompasses the 1-CreI variants as defined in step (c) to (f) of the method for engineering I-Crel variants, as defined above, including the variants of the sequence SEQ ID NO: 24 to 47 and 129 to 142.
  • the invention encompasses also the l-Crel variants as defined in step (g 3 ) and (h 3 ) of the method for engineering I-Crel variants, as defined above, including the valiants of the sequence SEQ ID NO: 52 to 60.
  • Single-chain chimeric endonucleases able to cleave a DNA target from the gene of interest are derived from the variants according to the invention by methods well-known in the art (Epinat et al., Nucleic Acids Res., 2003, 31, 2952-62; Chevalier et al., MoI. Cell, 2002, 10, 895-905; Steuer et al., Chembiochem., 2004, 5, 206-13; International PCT Applications WO 03/078619 and WO 2004/031346). Any of such methods, may be applied for constructing single-chain chimeric endonucleases derived from the variants as defined in the present invention.
  • polynucleotide fragments having the sequence of the targeting DNA construct or the sequence encoding the I-Crel variant or single-chain derivative as defined in the present invention may be prepared by any method known by the man skilled in the art. For example, they are amplified from a DNA template, by polymerase chain reaction with specific primers. Preferably the codons of the cDNAs encoding the l-Crel variant or single-chain derivative are chosen to favour the expression of said proteins in the desired expression system.
  • the recombinant vector comprising said polynucleotides may be obtained and introduced in a host cell by the well-known recombinant DNA and genetic engineering techniques.
  • the L-OeI variant or single-chain derivative as defined in the present the invention are produced by expressing the polypeptide(s) as defined above; preferably said polypeptide(s) are expressed or co-expressed (in the case of the variant only) in a host cell or a transgenic animal/plant modified by one expression vector or two expression vectors (in the case of the variant only), under conditions suitable for the expression or co-expression of the polypeptide(s), and the variant or single-chain derivative is recovered from the host cell culture or from the transgenic animal/plant.
  • FIG. 1 illustrates the modular structure of homing endonucleases and the combinatorial approach for designing custom meganucleases.
  • A Tridimensional structure of the 1-OeI homing endonuclease bound to its DNA target. The catalytic core is surrounded by two ⁇ folds forming a saddle-shaped interaction interface above the DNA major groove.
  • B Different binding sequences derived from the l-Crel target sequence (top right and bottom left) can be combined to obtain heterodimers or single chain fusion molecules cleaving non palindromic chimeric targets (bottom right).
  • C The identification of smaller independent subunits, i.
  • FIG. 2 represents the Hypoxanthine-Guanine Phosphoribosyl Transferase gene and the corresponding mRNA.
  • the exons are boxed and the size of each exon in the mouse gene (accession number NC_000086) is indicated; differences in size with the human gene (NC_000023) are also indicated.
  • the cleavage sites (SEQ ID NO: 1 to 14) of the l-Crel variants are indicated above the exons.
  • the Criteculus sp. HPRT mRNA (accession number J00060.1; SEQ ID NO: 15) is represented below the gene.
  • the ORF is indicated as a grey box.
  • the HprCH3 target site is indicated with its sequence (SEQ ID NO: 4) and position.
  • FIG. 3 illustrates four different strategies for the utilization of a meganuclease cleaving the Hypoxanthine-Guanine Phosphoribosyl Transferase (HPRT) gene.
  • A Gene insertion and/or gene inactivation. Upon cleavage by a meganuclease and recombination with a repair matrix containing a gene of interest (gene insertion) or an inactivation cassette (gene inactivation), flanked by sequences sharing homology with the sequences surrounding the cleavage site, gene insertion or gene inactivation occurs.
  • B Gene inactivation by non-homologous end-joining.
  • C Gene correction. A mutation occurs within the HPRT gene. Upon cleavage by a meganuclease and recombination with a repair matrix the deleterious mutation is corrected.
  • D Exonic sequences knock-in. A mutation occurs within the HPRT gene. The mutated mRNA transcript is featured below the gene. In the repair matrix, exons located downstream of the cleavage site are fused in frame (as in a cDNA), with a polyadenylation site to stop transcription in 3'. Introns and exons sequences can be used as homologous regions. Exonic sequences knock-in results into an engineered gene, transcribed into a mRNA able to code for a functional protein.
  • - figure 4 represents the sequences of the I-Crel N75 scaffold protein and degenerated primers used for the Ulib4 and Ulib5 libraries construction.
  • the scaffolf (SEQ ID NO: 111) is the VCr el ORF including the D75N codon substitution and three additional codons (AAD) at the 3' end.
  • B. Primers (SEQ ID NO: 112, 113, 114), - figure 5 illustrates examples of patterns and the numbers of mutants cleaving each target. A. Examples of profiling.
  • Each novel endonuclease is profiled in yeast on a series of 64 palindromic targets, arrayed as in figure 5B, differing from the sequence C1221 (SEQ ID NO: 16; figure 8B) , at positions ⁇ 8, ⁇ 9 and ⁇ 10.
  • Each target sequence is named after the -10,-9,-8 triplet (1 ONNN).
  • GGG corresponds to the tcgggacgtcgtacgacgtccccga target (SEQ ID NO: 122; figure 8B).
  • Meganucleases are tested 4 times against the 64 targets.
  • Targets cleaved by 1-OeI (D75), I-Crel N75 or ten derived variants are visualised by black or grey spots.
  • FIG. 6 represents the cleavage patterns of the I-Oel variants in position 28, 30, 33, 38 and/or 40.
  • cleavage was monitored in yeast with the 64 targets derived from the C 1221 palindromic target cleaved by l-Crel, by substitution of the nucleotides in positions + 8 to lO.Targets are designated by three letters, corresponding to the nucleotides in position -10, -9 and -8.
  • GGG corresponds to the tcgggacgtcgtacgacgtcccga target (SEQ ID NO: 122).
  • Values (boxed) correspond to the intensity of the cleavage, evaluated by an appropriate software after scanning of the filter, whereas (0) indicates no cleavage.
  • FIG. 7 represents the localisation of the mutations in the protein and DNA target, on a l-Crel homodimer bound to its target.
  • the two set of mutations (residues 44, 68 and 70; residues 30, 33 and 38) are shown in black on the monomer on the left.
  • the two sets of mutations are clearly distinct spatially. However, there is no structural evidence for distinct subdomains. Cognate regions in the DNA target site (region -5 to -3; region -10 to -8) are shown in grey on one half site.
  • AU targets are derived from C 1221, a palindromic target cleaved by l-Crel wild-type, and shown on the top of A and B.
  • A. A first series of 64 targets is derived by mutagenesis of positions ⁇ 5 to ⁇ 3 (in grey boxes). A few examples are shown below. Interactions with l-Crel residues 44, 68 and 70 are shown.
  • B. A second series of 64 target is derived by mutagenesis of positions ⁇ 10 to ⁇ 8 (in grey boxes). A few examples are shown below. Positions ⁇ 8, ⁇ 9 and ⁇ 10 are not contacted by residues 44, 68 and 70.
  • Ten l-Crel variants cleaving the C 1221 target, including I-Crel N75 (QRR) are profiled with the two sets of 64 targets ( ⁇ 5 to ⁇ 3 on the left, and ⁇ 10 to ⁇ 8 on the right). Targets are arranged as in Figure 8C. The C1221 target (squared) is found in both sets. Mutants are identified by three letters corresponding to the residues found in position 44, 68 and 70
  • QRR is Q44, R68, R70
  • all of them have an additional D75N mutation.
  • FIG. 9 represents the localisation of the mutations in the protein and DNA target, on a l-Crel homodimer bound to its target.
  • the two set of mutations (residues 44, 68 and 70; residues 28, 30, 33, 38 and 40 are shown in black on the monomer on the left.
  • the two sets of mutations are clearly distinct spatially. However, there is no structural evidence for distinct subdomains. Cognate regions in the DNA target site (region -5 to -3; region -10 to -8) are shown in grey on one half site.
  • FIG. 10 represents the HprCH3 series of targets and close derivatives.
  • 10GAG_P, 10CAT_P and 5CTT_P are close derivatives found to be cleaved by previously obtained I-Oel mutants. They differ from C 1221 (SEQ ID NO: 16) by the boxed motives.
  • C 1221, 10GAG_P, 10CAT_P and 5CTT_P were first described as 24 bp sequences, but structural data suggest that only the 22 bp are relevant for protein/DNA interaction. However, positions ⁇ 12 are indicated in parenthesis.
  • HprCH3.2 In the HprCH3.2 target (SEQ ID NO: 20), the atga sequence in the middle of the target is replaced with gtac, the bases found in C 1221.
  • HprCH3.3 (SEQ ID NO: 21) is the palindromic sequence derived from the left part of HprCH3.2
  • HprCH3.4 (SEQ ID NO: 22) is the palindromic sequence derived from the right part of HprCH3.2.
  • the boxed motives from 10GAG_P, 1 OC AT_P and 5CTT_P are found in the HprCH3 series of targets
  • - figure 11 illustrates cleavage of HprCH3.3 by 1 ONNNJP mutants.
  • the figure displays an example of primary screening of l-Crel with the HprCH3.3 target. Positive clones are boxed.
  • the sequences of positive mutants at position Gl, H6 and H7 are KNDTQS/QRRDI (SEQ ID NO: 24), KNTPQS/QRRDI (SEQ ID NO: 44) and KNTTQS/QRRDI (SEQ ID NO: 45), respectively (same nomenclature as for Table III).
  • - figure 12 illustrates cleavage of HprCH3.4 by combinatorial mutants.
  • the figure displays an example of primary screening of l-Crel combinatorial mutants with the HprCH3.4 target.
  • the sequences of positive mutants at position A9 and Bl are KNTHQS/RYSDN (SEQ ID NO: 54) and KNSYQS/RYSNI (SEQ ID NO: 60), respectively (same nomenclature as for Table IV).
  • - figure 13 illustrates cleavage of HprCH3.2 and HprCH3 by heterodimeric combinatorial mutants.
  • FIG. 14 illustrates cleavage of the HprCH3 target.
  • a series of I- OeI mutants cutting HprCH3.4 were optimized and co-expressed with a mutant cutting HprCH3.3. Cleavage is tested with the HprCH3 target. Mutants displaying improved cleavage of HprCH3 are circled.
  • C9 corresponds to the heterodimer 28R,32S,33S,38Y,40Q,44R,68,70S,75N,77N (SEQ ID NO: 65) + 33H (SEQ ID NO: 32)
  • E6 corresponds to 28R,32S33S,38Y,40Q,44R,68A,70S,75H,77Y (SEQ ID NO: 66) + 33H (SEQ ID NO: 32)
  • F3 corresponds to 28K,32T,33H,38Q,40S,44K,68Y,70S,75D,77R,92R,96R,107R,132V,140A,143A (SEQ ID NO/ 74) + 33H (SEQ ID NO: 32).
  • Hl 1 is the original heterodimer (a mutant cleaving HprCH3.4, KSSQQS/RYSDN (SEQ ID NO:53), co-expressed with a mutant cleaving HprCH3.3, KNSHQS/QRRDI, SEQ ID NO: 32)).
  • H12 is a positive control.
  • - figure 15 illustrates cleavage of the HprCH3 target.
  • B3 corresponds to the heterodimer 33H,71R,103I,129A and 130G (SEQ ID NO: 80) + 33T,38Y,44K,68Y,70S,75E,and 77V (SEQ ID NO: 56).
  • H3 corresponds to the heterodimer 2I,33H,81V,86I,110G,131R,135Q,151A and 157V (SEQ ID NO:79) + 33T,38Y,44K,68Y,70S,75E and 77V (SEQ ID NO: 56).
  • H12 is a positive control.
  • FIG. 16 represents the pCLS1055 vector map.
  • - figure 17 represents the pCLS0542 vector map.
  • - figure 18 represents the pCLS 1107 vector map.
  • FIG 19 illustrates the DNA target sequences which are present in the Criteculus griseus HPRT gene and the corresponding l-Crel variant which are able to cleave said DNA target.
  • the DNA target is presented (column 3), with its first nucleotide (start, column 1) and last nucleotide (end, column 2); the positions are indicated relatively to the HPRT mRNA sequence (accession number J00060.1).
  • the sequence of each heterodimeric variant is defined by the amino acid residues at the indicated positions of the first monomer (column 4) and the second monomer (column 5).
  • the first heterodimeric variant of figure 19 consists of a first monomer having K, Q, D, Y, Q, S, N, K, S, R and T in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively and a second monomer having K, N, S, G, C, S, Q, R, R, N and I in positions 28, 30, 32, 38, 40, 44, 68, 70, 75 and 77, respectively.
  • I-Crel sequence SWISSPROT P05725 or pdb accession code Ig9y The positions are indicated by reference to I-Crel sequence SWISSPROT P05725 or pdb accession code Ig9y; I-Crel has K, N, S, Y, Q, S, Q, R, R, D, I, in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively.
  • the positions which are not indicated are not mutated and thus correspond to the wild-type l-Crel sequence.
  • Example 1 Functional endonucleases with new specificity towards nucleotides ⁇ 8 to +10 (10NNN)
  • A) Material and methods a) Construction of mutant libraries l-Crel wt (l-Crel D75), l-Crel D75N (1-OeI N75) and I-Crel S70 N75 open reading frames were synthesized, as described previously (Epinat et ah, N.A.R., 2003, 31, 2952-2962). Combinatorial libraries were derived from the l-Crel N75, 1-Crel D75 and l-Crel S70 N75 scaffolds, by replacing different combinations of residues, potentially involved in the interactions with the bases in positions ⁇ 8 to 10 of one DNA target half-site (Q26, K28, N30, S32, Y33, Q38 and S40). The diversity of the meganuclease libraries was generated by PCR using degenerated primers harboring a unique degenerated codon at each of the selected positions.
  • Mutation D75N was introduced by replacing codon 75 with aac. Then, the three codons at positions N30, Y33 and Q38 (Ulib4 library) or K28, N30 and Q38 (Ulib5 library) were replaced by a degenerated codon VVK (18 codons) coding for 12 different amino acids: A,D,E,G,H,K,N,P,Q,R,S,T). In consequence, the maximal (theoretical) diversity of these protein libraries was 12 3 or 1728. However, in terms of nucleic acids, the diversity was 18 3 or 5832.
  • small libraries of complexity 225 (15 2 ) resulting from the randomization of only two positions were constructed in an l-Crel N75 or I-Crel D75 scaffold, using NVK degenerate codon (24 codons, amino acids ACDEGHKNPQRSTWY).
  • FIG. 4A illustrates the two pair of primers (Ulib456for and Ulib4rev; Ulib456for and Ulib5rev) used to generate the Ulib4 and Ulib5 libraries, respectively.
  • the 64 palindromic targets derived from C 1221 were constructed as described in example 1, by using 64 pairs of oligonucleotides (ggcatacaagtttcnnnacgtcgtacgacgtnnngacaatcgtctgtca (SEQ ID NO: 109) and reverse complementary sequences).
  • I-Crel is a dimeric homing endonuclease that cleaves a 22 bp pseudo- palindromic target. Analysis of I-Crel structure bound to its natural target has shown that in each monomer, eight residues establish direct interactions with seven bases (Jurica et al., 1998, precited).
  • the bases of the nucleotides in positions ⁇ 8 to 10 establish direct contacts with 1-OeI amino-acids N30, Y33, Q38 and indirect contacts with I-Crel amino-acids K28 and S40.
  • novel proteins with mutations in positions 30, 33 and 38 could display novel cleavage profiles with the 64 targets resulting from substitutions in positions ⁇ 8, ⁇ 9 and ⁇ 10 of a palindromic target cleaved by l-Crel (lONNN target).
  • mutations might alter the number and positions of the residues involved in direct contact with the DNA bases. More specifically, positions other than 30, 33, 38, but located in the close vicinity on the folded protein, could be involved in the interaction with the same base pairs.
  • the l-Crel scaffold was mutated from D75 to N.
  • the D75N mutation did not affect the protein structure, but decreased the toxicity of l-Crel in overexpression experiments.
  • Ulib4 library was constructed : residues 30, 33 and 38, were randomized, and the regular amino acids (N30, Y33, and Q38) replaced with one out of 12 amino acids (A,D,E,G,H,K,N,P,Q,R,S,T).
  • the resulting library has a complexity of 1728 in terms of protein (5832 in terms of nucleic acids).
  • Ulib5 and Lib4 two other libraries were constructed : Ulib5 and Lib4.
  • residues 28, 30 and 38 were randomized, and the regular amino acids (K28, N30, and Q38) replaced with one out of 12 amino acids (ADEGHKNPQRST).
  • the resulting library has a complexity of 1728 in terms of protein (5832 in terms of nucleic acids).
  • an Arginine in position 70 was first replaced with a Serine.
  • positions 28, 33, 38 and 40 were randomized, and the regular amino acids (K28, Y33, Q38 and S40) replaced with one out of 10 amino acids (A,D,E,K,N,Q,R,S,T,Y).
  • the resulting library has a complexity of 10000 in terms of proteins.
  • Figure 6 illustrates 37 novel targets cleaved by a collection of 141 variants, including 34 targets which are not cleaved by I-Crel and 3 targets which are cleaved by ⁇ -Crel (aag, aat and aac). Twelve examples of profile, including I-Crel N75 and ⁇ -Crel D75 are shown on Figure 5A. Some of these new profiles shared some similarity with the wild type scaffold whereas many others were totally different. Homing endonucleases can usually accommodate some degeneracy in their target sequences, and the l-Crel and I- Crel N75 proteins themselves cleave a series of sixteen and three targets, respectively.
  • positions ⁇ 5, ⁇ 4 and ⁇ 3 are bound by residues 44, 68 and 70.
  • I-Crel variants, mutated in positions 44, 68, 70 and 75, obtained as described in example 1, were shown to display a detectable activity on C 1221, a palindromic target cleaved by l-Crel wild-type (Chevalier, et al, 2003), but were cleaving other targets with various efficacies.
  • positions ⁇ 9 and ⁇ 8 are contacted by residues 30, 33 and 38.
  • Mutants were generated as described in examples 1, by mutating positions 44, 68, 70 and 75, and screening for clones able to cleave C 1221 derived targets. Mutant expressing plasmids are transformed into S. cerevisiae strain FYC2- 6A (MATa, trplA63, leu2M, his3A200). c) Construction of target clone
  • the 64 palindromic targets derived from C 1221 by mutation in ⁇ 5 to ⁇ 3 were constructed as described in example 1, by using 64 pairs of oligonucleotides (ggcatacaagtttcaaaacnnngtacnnngtttttgacaatcgtctgtca (SEQ ID NO :110) and reverse complementary sequences).
  • Mating was performed as described in example 1, using a low gridding density (about 4 spots/cm 2 ).
  • Results 64 targets corresponding to all possible palindromic targets derived from C 1221 were constructed by mutagenesis of bases ⁇ 10 to ⁇ 8, as shown on figure 8B.
  • the l-Crel N75 cleavage profile was established, showing a strong signal with the aaa and aat targets, and a weaker one with the aag target.
  • proteins with a clearly different cleavage profile in ⁇ 5 to ⁇ 3, such as QAR, QNR, TRR, NRR, ERR and DRR have a similar profile in ⁇ 10 to ⁇ 8.
  • the aaa sequence in ⁇ 10 to ⁇ 8 corresponds to the C 1221 target, and is necessarily cleaved by all our variants cleaving C 1221. aat is cleaved as well in most mutants (90 %), whereas aag is often not observed, probably because the signal drops below the detection level in faint cleaver. No other target is ever cleaved.
  • Positions 28, 30, 33, 38 and 40 on one hand, and 44, 68 and 70, on another hand are on a same DNA-binding fold, and there is no structural evidence that they should behave independently.
  • the two sets of mutations are clearly on two spatially distinct regions of this fold (figures 7 and 9) located around different regions of the DNA target.
  • the cumulative impact of a series of mutations could eventually disrupt the folding.
  • mutations from these two series of mutants were combined, and the ability of the resulting variants to cleave the combined target sequence was assayed (Figure ID).
  • non-palindromic target sequence that would be a patchwork of four cleaved 5NNN and IONNN targets, is identified.
  • two derived target sequences representing the left and right halves in palindromic form are designed.
  • mutants efficiently cleaving the IONNN and 5NNN part of each palindromic sequence are selected and their characteristic mutations incorporated into the same coding sequence by in vivo cloning in yeast.
  • combinatorial mutants sequences are named with an eleven letter code, after residues at positions 28, 30, 32, 33, 38, 40, 44, 68 and 70, 75 and 77.
  • KNSTYS/KYSEV stands for l-Crel K28, N30, S32, T33, Y38, S40, K44, Y68, S70, E75, and V77 (I-Crel 28K, 30N, 32S, 33T 3 38Y, 4OS, 44K, 68Y, 70S, 75E and 77V).
  • Parental controls are named with a six letter code, after residues at positions 28, 30, 32, 33, 38 and 40 or a five letter code, after residues at positions 44, 68, 70, 75 and 77.
  • IQSfSTYS stands for I-Crel 28K, 3ON, 32S, 33T, 38Y and 40S
  • KYSEV stands for -Crel 44K, 68Y 3 70S, 75E and 77V.
  • target sequences described in these examples are 22 or 24 bp palindromic sequences. Therefore, they will be described only by the first 11 or 12 nucleotides, followed by the suffix _P; for example, target 5' tcaaaacgtcgtacgacgttttga 3' (SEQ ID NO: 16) cleaved by the I-Crel protein, will be called tcaaaacgtcgt_P.
  • HprCH3 is a 22 bp (non-palindromic) target ( Figure 2) located in Exon 3 (positions 17 to 38) of the Criteculus griseus (Chinese Hamster) HPRT gene; the target sequence corresponds to positions 241 to 262 of the mRNA (accession number J00060; SEQ ID NO: 15; Figure 2).
  • the meganucleases cleaving HprCH3 could be used, either to insert an heterologous gene of interest at the HPRT locus, to allow reproducible gene expression levels in vertebrate recombinant cell lines or transgenic animals, or to inactivate the HPRT gene, to allow the selection of vertebrate recombinant cell lines or transgenic animals ( Figure 3 A and 3B).
  • the HprCH3 sequence is partly a patchwork of the 10GAG_P, 10CAT_P and 5CTT_P targets ( Figure 10) which are cleaved by previously identified meganucleases, obtained as described in International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et al, J. MoI. Biol, 2006, 355, 443-458; example 1.
  • HprCH3 could be cleaved by combinatorial mutants resulting from these previously identified meganucleases.
  • the 10GAG_P, 10CAT_P and 5CTT_P target sequences are 24 bp derivatives of C 1221, a palindromic sequence cleaved by 1-OeI (Arnould et ah, precited).
  • 1-OeI Arnould et ah
  • the structure of I-Crel bound to its DNA target suggests that the two external base pairs of these targets (positions -12 and 12) have no impact on binding and cleavage (Chevalier et al, Nat. Struct. Biol., 2001, 8, 312-316; Chevalier and Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774; Chevalier et al, J. MoI.
  • HprCH3 differs from C 1221 in the 4 bp central region. According to the structure of the l-Crel protein bound to its target, there is no contact between the 4 central base pairs (positions -2 to 2) and the 1-OeI protein (Chevalier et al, Nat. Struct. Biol, 2001, 8, 312-316; Chevalier and Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774; Chevalier et al, J. MoI. Biol, 2003, 329, 253-269).
  • the bases at these positions should not impact the binding efficiency. However, they could affect cleavage, which results from two nicks at the edge of this region.
  • the atga sequence, in -2 to 2 was first substituted with the gtac sequence from C 1221, resulting in target HprCH3.2 ( Figure 10). Then, two palindromic targets, HprCH3.3 and HprCH3.4, were derived from HprCH3.2 ( Figure 10). Since HprCH3.3 and HprCH3.4 are palindromic, they should be cleaved by homodimeric proteins.
  • proteins able to cleave the HprCH3.3 and HprCH3.4 sequences as homodimers were first designed (examples 4 and 5) and then co-expressed to obtain heterodimers cleaving HprCH3 (example 6).
  • Heterodimers cleaving the HprCH3.2 and HprCH3 targets could be identified.
  • a series of mutants cleaving HprCH3.3 and HprCH3.4 was chosen, and then refined. The chosen mutants were randomly mutagenized, and used to form novel heterodimers that were screened against the HprCH3 target (examples 7 and 8).
  • Heterodimers could be identified with an improved cleavage activity for the HprCH3 target.
  • Example 4 Identification of meganucleases cleaving HprCH3.3
  • HprCH3.3 is similar to 10GAG_P at all positions except ⁇ 6. It was hypothesized that positions ⁇ 6 would have little effect on the binding and cleavage activity. Mutants able to cleave the 10GAG_P target were obtained by mutagenesis of
  • the target was cloned as follows: oligonucleotide corresponding to the target sequence flanked by gateway cloning sequence was ordered from
  • PROLIGO 5'tggcatacaagtttcgagatgtcgtacgacatctcgacaatcgtctgtca3' (SEQ ID NO: 23).
  • Mating was performed using a colony gridder (QpixII, GENETIX). Mutants were gridded on nylon filters covering YPD plates, using a low gridding density (4 or 9 spots/cm 2 ). A second gridding process was performed on the same filters to spot a second layer consisting of the reporter-harboring yeast strain. Membranes were placed on solid agar YPD rich medium, and incubated at 30 0 C for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, with galactose (1 %) as a carbon source, and incubated for five days at 37 °C, to select for diploids carrying the expression and target vectors.
  • yeast DNA was extracted using standard protocols and used to transform E. coli. Sequencing of mutant ORFs was then performed on the plasmids by MILLEGEN SA.
  • ORFs were amplified from yeast DNA by PCR (Akada et al., Biotechniques, 2000, 28, 668-670, 672, 674, and sequencing was performed directly on the PCR product by MILLEGEN SA.
  • I-Crel mutants capable of cleaving 10GAG_P were screened for cleavage against the HprCH3.3 DNA target (cgagatgtcgt_P; (SEQ ID NO: 21). 38 positives clones were found, and after sequencing and validation by secondary screening, 24 mutants listed in Table III were identified. Examples of positives are shown in Figure 11. Table III: ⁇ -Crel mutants capable of cleaving the HprCH3.3 DNA target.
  • Example 5 Making of meganucleases cleaving HprCH3.4
  • HprCH3.4 is similar to 5CTT_P at positions ⁇ 1, ⁇ 2, ⁇ 3, ⁇ 4, ⁇ 5 and ⁇ 11 and to lOCATJP at positions ⁇ 1, ⁇ 2, ⁇ 8, ⁇ 9 ⁇ 10 and ⁇ 11. It was hypothesized that positions ⁇ 6 and ⁇ 7 would have little effect on the binding and cleavage activity. Mutants able to cleave 5CTTJ?
  • I-Crel mutants cleaving 10CAT_P or 5CTT_P were previously identified, as described in International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et al, J. MoI. Biol, 2006, 355, 443-458, and example 1.
  • separate overlapping PCR reactions were carried out that amplify the 5' end (aa positions 1-43) or the 3' end (positions 39-167) of the l-Crel coding sequence.
  • PCR amplification is carried out using primers (GaIlOF 5'- gcaactttagtgctgacacatacagg-3' (SEQ ID NO: 48) or GaIlOR 5'- acaaccttgattggagacttgacc-3' (SEQ ID NO: 49) specific to the vector (pCLS0542, Figure 11) and primers (assF 5'-ctannnttgacctttt-3' (SEQ ID NO: 50) or assR 5'- aaaggtcaannntag-3'(SEQ ID NO: 51), where nnn codes for residue 40.
  • primers GaIlOF 5'- gcaactttagtgctgacacatacagg-3' (SEQ ID NO: 48) or GaIlOR 5'- acaaccttgattggagacttgacc-3' (SEQ ID NO: 49) specific to the vector (pCLS0542, Figure 11) and
  • PCR fragments resulting from the amplification reaction realized with the same primers and with the same coding sequence for residue 40 were pooled. Then, each pool of PCR fragments resulting from the reaction with primers GaIlOF and assR or assF and GaIlOR was mixed in an equimolar ratio.
  • Results I-Crel mutants used in this example, and cutting the 10CAT_P target or the 5CTT_P target are listed in Table IV.
  • l-Crel combined mutants were constructed by associating on the l-Crel scaffold, amino acids at positions 44, 68, 70, 75 and 77 from mutants cleaving the 5CTT_P target, with the amino acids at positions 30,32, 33 and 38 from the mutants cleaving the 10CAT_P target (Table IV), resulting in a library of complexity 480.
  • This library was transformed into yeast and 1728 clones (3.6 times the diversity) were screened for cleavage against the HprCH3.4 DNA target (ccatctcttgt_P; SEQ ID NO: 22). 10 positive clones were found, and after sequencing and validation by secondary screening 9 combinatorial mutants were identified (Table IV). The mutants are identified by an 11 letter code, corresponding to the amino acid residues at positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77.
  • KNSTYS/KYSEV stands for l-Crel K28, N30, S32, T33, Y38, S40, K44, Y68, S70, E75, and V77 (SEQ ID NO: 56).
  • Such mutants likely result from recombination between similar PCR fragments during the transformation process. Examples of positives are shown in Figure 12.
  • Example 6 Making of meganucleases cleaving HprCH3.2 and HprCH3
  • yeast DNA was extracted from mutants cleaving the HprCH3.4 target using standard protocols and was used to transform E. c ⁇ /z. The resulting plasmid DNA was then used to transform yeast strains expressing a mutant cutting the HprCH3.3 target. Transformants were selected on -L GIu + G418 medium, b) Mating of meganuclease co-expressing clones and screening in yeast
  • the experimental procedure is as described in example4, except that a low gridding (about 4 spots/cm 2 ) was used.
  • Example 7 Improvement of meganucleases cleaving HprCH3 by random mutagenesis of proteins cleaving HprCH3.4 and assembly with proteins cleaving HprCH3.3
  • I-Crel mutants able to cleave the HprCH3.2 and HprCH3 target by assembly of mutants cleaving the palindromic HprCH3.3 and HprCH3.4 target have been previously identified in example 4. However, these mutants display stronger activity with the HprCH3.2 target compared to the HprCH3 target.
  • Random mutagenesis was performed on a pool of chosen mutants, by PCR using Mn 2+ or by a two-step PCR process using dNTP derivatives 8-oxo- dGTP and dPTP as described in the protocol from Jena Bioscience GmbH for the JBS dNTP-Mutagenis kit.
  • Primers used were preATGCreFor (5'- gcataaattactatacttctatagacacgcaaacacaaatacacagcggccttgccacc-3': SEQ ID NO: 61) and ICrelpostRev (S'-ggctcgaggagctcgtctagaggatcgctcgagttatcagtcggccgG ⁇ ': SEQ ID NO: 62).
  • KNTHQS/KYSNR, KSSQQS/RYSDN, KNTHQS/QRSHY and KNTHQS/QNSQR according to the nomenclature of Table IV; SEQ ID NO: 59, 53, 63 and 64) were pooled, randomly mutagenized and transformed into yeast. 1140 transformed clones were then mated with a yeast strain that contains (i) the HprCH3 target in a reporter plasmid (ii) an expression plasmid containing a mutant that cleaves the HprCH3.3 target (I-Crel 33H or KNSHQS/QRRDI; SEQ ID NO: 32).
  • Table V Functional mutant combinations displaying strong cleavage activity for HprCH3.
  • HprCH3.4 (SEQ ID NO: 65 to 74) l-Crel 28R,30N,32S,33S,38Y,40Q,44R,68A,70S,75N,77N
  • Example 8 Improvement of meganucleases cleaving HprCH3 by random mutagenesis of proteins cleaving HprCH3.3 and assembly with proteins cleaving HprCH3.4
  • Random mutagenesis was performed on a pool of chosen mutants, by PCR using Mn 2+ or by a two-step PCR process using dNTP derivatives 8-oxo- dGTP and dPTP as described in the protocol from Jena Bioscience GmbH for the JBS dNTP-Mutageneis kit.
  • Primers used were preATGCreFor (5'- gcataaattactatacttctatagacacgcaaacacaaatacacacagcggccttgccacc-3': SEQ ID NO: 61) and ICrelpostRev (S'-ggctcgaggagctcgtctagaggatcgctcgagttatcagtcggccgc-S': SEQ ID NO: 62).
  • the yeast strain FYBL2-7B (MAT a, ura3 ⁇ 851, trpl ⁇ 63, lei ⁇ l, lys2 ⁇ 202) containing the HprCH3 target in the yeast reporter vector (pCLS1055, Figure 16) was transformed with mutants, in the kanamycin resistant vector (pCLS1107), cutting the HprCH3.4 target, using a high efficiency LiAc transformation protocol.
  • Mutant-target yeasts were used as target strains for mating assays as described in example 6. Positives resulting clones were verified by sequencing (MILLEGEN) as described in example 4.
  • Crel 33H and I-Crel 33Q also called KNDTQS/QRRDI, KNTTQS/QRRDI, KNSHQS/QRRDI and KNSQQS/QRRDI according to the nomenclature of Table IV; SEQ ID NO: 24, 45, 32 and 35) were pooled, randomly mutagenized and transformed into yeast.
  • 1140 transformed clones were then mated with a yeast strain that contains (i) the HprCH3 target in a reporter plasmid (ii) an expression plasmid containing a mutant that cleaves the HprCH3.4 target (l-Crel 33T,38Y,44K,68Y,70S,75E,77V or KNSTYS/KYSEV; SEQ ID NO: 56).
  • 18 clones were found to efficiently cleave the HprCH3 target.
  • 18 positives contained proteins able to form heterodimers with KNSTYS/KYSEV with cleavage activity for the HprCH3 target.
  • An example of positives is shown in Figure 15. Examples of such heterodimeric mutants are listed in Table VI.

Abstract

An I-CreI variant or a single-chain derivative having at least one substitution in one of the two functional subdomains of the LAGLIDADG core domain, situated from positions 26 to 40 and 44 to 77 of I-CreI, and being able to cleave a DNA target sequence from the HPRT gene having a nucleotide sequence of SEQ ID NO: 1 to 14. Use of said variant for inducing a site-specific modification in the HPRT gene, for therapeutic (gene therapy of Lesch-Nyhan syndrome) or non- therapeutic purpose (engineering of transgenic animals and recombinant cell lines).

Description

MEGANUCLEASEVARIANTS CLEAVINGADNATARGET SEQUENCE FROMTHEHPRT GENEAND USES THEREOF
The invention relates to a meganuclease variant cleaving a DNA target sequence from the HPRT gene, to a vector encoding said variant, to a cell, an animal or a plant modified by said vector and to the use of said meganuclease variant and derived products for genome engineering and genome therapy.
Meganucleases are by definition sequence-specific endonucleases with large (>14 bp) cleavage sites that can deliver DNA double-strand breaks (DSBs) at specific loci in living cells (Thierry and Dujon, Nucleic Acids Res., 1992, 20, 5625- 5631). Meganucleases have been used to stimulate homologous recombination in the vicinity of their target sequences in cultured cells and plants (Rouet et al, MoI. Cell. Biol., 1994, 14, 8096-106; Choulika et al, MoI. Cell. Biol, 1995, 15, 1968-73; Donoho et al, MoI. Cell. Biol, 1998, 18, 4070-8; Elliott et al, MoI. Cell. Biol., 1998, 18, 93-101; Sargent et al, MoI. Cell. Biol., 1997, 17, 267-77; Puchta et al, Proc. Natl. Acad. Sci. USA, 1996, 93, 5055-60; Chiurazzi et al, Plant Cell, 1996, 8, 2057-2066), making meganuclease-induced recombination an efficient and robust method for genome engineering.
The use of meganuclease-induced recombination has long been limited by the repertoire of natural meganucleases, and the major limitation of the current technology is the requirement for the prior introduction of a meganuclease cleavage site in the locus of interest. Thus, the making of artificial meganucleases with tailored substrate specificities is under intense investigation. Such proteins could be used to cleave genuine chromosomal sequences and open new perspectives for genome engineering in wide range of applications. For example, meganucleases could be used to to knock out endogenous genes or knock-in exogenous sequences in the chromosome. It can as well be used for gene correction, and in principle, for the correction of mutations linked with monogenic diseases.
In nature, meganucleases are essentially represented by homing endonucleases (HEs), a family of endonucleases encoded by mobile genetic elements, whose function is to initiate DNA double-strand break (DSB)-induced recombination events in a process referred to as homing (Chevalier and Stoddard, Nucleic Acids Res., 2001, 29, 3757-74; Kostriken et al, Cell; 1983, 35, 167-74; Jacquier and Dujon, Cell, 1985, 41, 383-94). Several hundreds of HEs have been identified in bacteria, eukaryotes, and archea (Chevalier and Stoddard, precited); however the probability of finding a HE cleavage site in a chosen gene is very low.
Given their biological function and their exceptional cleavage properties in terms of efficacy and specificity, HEs provide ideal scaffolds to derive novel endonucleases for genome engineering.
HEs belong to four major families. The LAGLIDADG family, named after a conserved peptidic motif involved in the catalytic center, is the most widespread and the best characterized group (Chevalier and Stoddard, precited). Seven structures are now available. Whereas most proteins from this family are monomeric and display two LAGLIDADG motifs, a few ones have only one motif, but dimerize to cleave palindromic or pseudo-palidromic target sequences.
Although the LAGLIDADG peptide is the only conserved region among members of the family, these proteins share a very similar architecture (Figure IA). The catalytic core is flanked by two DNA-binding domains with a perfect twofold symmetry for homodimers such as l-Crel (Chevalier et al, Nat. Struct. Biol., 2001, 8, 312-6) and l-Msol (Chevalier et al J. MoI. Biol., 2003, 329, 253-69), and with a pseudo symmetry fo monomers such as l-Scel (Moure et al, J. MoI. Biol, 2003, 334, 685-95), l-Dmol (Silva et al., J. MoI. Biol., 1999, 286, 1123-36) or I-Aniϊ (Bolduc et al, Genes Dev., 2003, 17, 2875-88). Both monomers or both domains (for monomeric proteins) contribute to the catalytic core, organized around divalent cations. Just above the catalytic core, the two LAGLIDADG peptides play also an essential role in the dimerization interface. DNA binding depends on two typical saddle-shaped ββαββ folds, sitting on the DNA major groove. Analysis of l-Crel structure bound to its natural target shows that in each monomer, eight residues (Y33, Q38, N30, K28, Q26, Q44, R68 and R70) establish direct interaction with seven bases at positions ± 3, 4, 5, 6, 7, 9 and 10 (Jurica et al, MoI. Cell., 1998, 2, 469-76). In addition, some residues establish water-mediated contact with several bases; for example S40, K28 and N30 with the base pair at position +8 and -8 (Chevalier et al, 2003, precited). Other domains can be found, for example in inteins such as Vl-Pful (Ichiyanagi et al, J. MoI. Biol., 2000, 300, 889-901) and Yl-Scel (Moure et al, Nat. Struct. Biol, 2002, 9, 764-70), which protein splicing domain is also involved in DNA binding.
The making of functional chimeric and single chain artificial HEs, by fusing the N-terminal l-Dmol domain with an l-Crel monomer (Epinat et al, Nucleic Acids Res., 2003, 31, 2952-62; Chevalier et al, MoI. Cell, 2002, 10, 895- 905; Steuer et al, Chembiochem., 2004, 5, 206-13; International PCT Applications WO 03/078619 and WO 2004/031346) have demonstrasted the plasticity of LAGLIDADG proteins: different monomers or core domains could be fused in a single protein, to obtain novel meganucleases cleaving novel (non-palindromic) target sequences.
Besides, different groups have have used a rational approach to locally alter the specificity of the 1-OeI (Seligman et al, Genetics, 1997, 147, 1653- 64; Sussman et al, J. MoI. Biol., 2004, 342, 31-41; Seligman et al, Nucleic Acids Res., published September 13, 2006; Arnould et al, J. MoI. Biol, 2006, 355, 443-458 and International PCT Applications WO 2006/097853 and WO 2006/097784), I-Scel (Doyon et al, J. Am. Chem. Soc, 2006, 128, 2477-2484), PI-SceI (Gimble et al, J. MoI. Biol., 2003, 334, 993-1008) and l-Msol (Ashworth et al, Nature, 2006, 441, 656-659)
Hundreds of l-Crel derivatives with altered specificity were engineered by combining the semi-rational approach and High Throughput Screening (HTS; Arnould et al. (precited); International PCT Applications WO 2006/097853 and WO 2006/097784); residues Q44, R68 and R70 or Q44, R68, D75 and 177 of l-Crel were mutagenized and a collection of variants with altered specificity in positions + 3 to 5 (5NNN DNA target) were identified by screening. Then, two different variants (Figure IB; top right and bottom left) were combined and assembled in a functional heterodimeric endonuclease (figure IB; bottom right) able to cleave a chimeric target resulting from the fusion of a different half of each variant DNA target sequence (Figure IB; Arnould et al., precited; International PCT Application WO 2006/097854). Interestingly, the novel proteins had kept proper folding and stability, high activity, and a narrow specificity. Therefore, a two step strategy may be used to tailor the specificity of a natural LAGLIDADG meganuclease. The first step is to locally mutagenize a natural LAGLIDADG meganuclease such as l-Crel and to identify collections of variants with altered specificity by screening. The second step is to rely on the modularity of these proteins, and use a combinatorial approach to make novel meganucleases, that cleave the site of choice (Figure IB).
The generation of collections of novel meganucleases, and the ability to combine them by assembling two different monomers/core domains considerably enriches the number of DNA sequences that can be targeted, but does not yet saturate all potential sequences.
To reach a larger number of sequences, it would be extremely valuable to be able to identify smaller independent subdomains that could be combined (Figure 1C).
However, a combinatorial approach is much more difficult to apply within a single monomer or domain than between monomers since the structure of the binding interface is very compact and the two different ββ hairpins which are responsible for virtually all base-specific interactions do not constitute separate subdomains, but are part of a single fold. For example, in the internal part of the DNA binding regions of I-Crel, the gtc triplet is bound by one residue from the first hairpin (Q44), and two residues from the second hairpin (R68 and R70; see Figure IB of Chevalier et al., 2003, precited). In addition the cumulative impact of a series of mutation could eventually disrupt proper folding.
In spite of this lack of apparent modularity at the structural level, the Inventor has demonstrated that residues 28 to 40 and 44 to 77 of l-Crel form two separable functional subdomains, able to bind distinct parts of a homing endonuclease half-site.
By assembling two subdomains from different monomers or core domains within the same monomer, the Inventor has engineered functional homing endonuclease (homodimeric) variants, which are able to cleave palindromic chimeric targets (Figure 1C). Furthermore, a larger combinatorial approach is allowed by assembling four different subdomains to form new heterodimeric molecules which are able to cleave non-palindromic chimeric targets (Figure ID). The different subdomains can be modified separately to engineer new cleavge specificities and combine in one meganuclease variant (homodimer, heterodimer, single-chain molecule) which is able to cleave a target from a gene of interest.
The Hypoxanthine Phosphoribosyltransferase (HPRT) gene is a single copy gene located on X-chromosome and thus present in one copy (XY cells) or expressed from just one allele (XX cells). For example, the mouse and human HPRT genes are available in the NCBI database, under the accession number NC_000086 and NC_000023, respectively. Both genes have 9 exons (Figure 2) which are transcribed into a 1289 bases mRNA (mouse; accession number NM_013556) or 1331 bases mRNA (human; accession number NMJ)OO 194), containing the HPRT ORF from positions 88 to 744 (mouse) or 86 to 742 (human). The Chinese Hamster (Criteculus sp.) mRNA is a 1301 bases sequence (accession number J00060.1) containing the HPRT ORF from positions 91 to 747.
Hypoxanthine Phosphoribosyltransferase is an enzyme that catalyzes the conversion of 5-phosphoribosyl-l-pyrophosphate and hypoxanthine, guanine, or 6- mercaptopurine to the corresponding 5 '-mononucleotides and pyrophosphate. The enzyme is important in purine biosynthesis as well as central nervous system function. Given its biological function, the HPRT gene is used as a selectable marker for gene targeting experiments. Compared to other selection markers, HPRT has the advantage of being both a positive and a negative selection marker. In addition mutations in the HPRT gene are associated with the LESCH-NYHAN SYNDROME.
Gene targeting of the mouse HPRT was performed first in Embryo- derived Stem (ES) cells by Thomas, K.R. and M.R. Cappechi (Cell, 1987, 51, 503- 512). However, efficiencies remained very low (about 10"7 of transfected cells). The ability to generate a double-strand break at the HPRT locus provides a means to significantly enhance homologous recombination at the locus. Using classical gene targeting, Donoho et al (MoI. Cell. Biol, 1998, 18, 4070-4078) introduced clevage sites for the l-Scel meganuclease into the mouse HPRT gene. In a second step, they could induce gene targeting in 1 % of the cells by cotransformation with a repair matrix and an l-Scel expression vector.
Thus, an artificial meganuclease targeting the HPRT locus will allow efficient gene insertions (Figure 3A). The ability to efficiently insert genes at this locus has the advantage of allowing reproducible expression levels as well as predictable time lines for generating insertions.
Additionally, as has been described for mice (van der Lugt et al. Gene, 1991, 105, 263-267; Selfridge et al, Somat. Cell. MoI. Genet., 1992, 18, 325- 336), HPRT can be used as a selectable marker for gene targeting experiments.
The double replacement gene targeting procedure, which was originally suggested by Reid and co-workers (Proc. Natl. Acad. Sci. USA, 1990, 87, 4299-4303) is based on HPRT selectable markers (Magin et al., Gene, 1992, 122, 289- 296), to produce mice with subtle gene alterations. This procedure is based on the use of hypoxanthine phosphoribosy transferase (HPRT) minigenes in HPRT-deficient embryonic stem cells and the ability to select both for and against HPRT expression.
In the first step, to inactivate the target, a region of the target locus is replaced with an HPRT minigene, with HAT (hypoxanthine/aminopterin/thymidine;
(Littlefield J. W., Science, 1964, 145, 709-) selection for HPRT marker expression. HAT is a mixture of sodium hypoxanthine, aminopterin and thymidine. Aminopterin is a potent folic acid antagonist, which inhibits dihydrofolate reductase blocking de novo nucleoside synthesis. Cells can only survive in HAT if the purine and pyrimidine salvage pathways are active. Hypoxanthine is the substrate for purine salvage pathway. Thus, HPRT mutants are unable to utilize the purine salvage pathway and are sensitive to HAT selection.
In the second targeting step the HPRT minigene is itself replaced with an altered region of the target gene to reconstitute the locus, with selection for loss of the HPRT marker using the purine analogue 6-thioguanine (6-TG).
However, this requires that the cells before introduction of the marker contain an inactive HPRT gene. Thus, an artificial meganuclease targeting the HPRT gene could be used to inactivate the HPRT gene (Figure 3 A and B).
The LESCH-NYHAN SYNDROME is an inherited disorder transmitted as a sex-linked trait that is caused by a deficiency of HPRT and characterized by hyperuricemia, severe motior disability and self-injurious behaviour. A very heterogeneous collection of mutations associated with the Lesch-Nyhan disease or less severe clinical phenotypes with only some portions of the full syndrome, have been identified. Current gene therapy strategies are based on a complementation approach, wherein randomly inserted but functional extra copy of the gene provide for the function of the mutated endogenous copy. In contrast, meganuclease-induced recombination should allow for the precise correction of mutations in situ (Figure 3C) and thereby bypass the risk due to the randomly inserted transgenes encountered with current gene therapy approaches (Hacein-Bey-Abina et al, Science, 2003, 302, 415-419).
The most accurate way to correct a genetic defect is to use a repair matrix with a non mutated copy of the gene, resulting in a reversion of the mutation (Figure 3C). However, the efficiency of gene correction decreases as the distance between the mutation and the DSB grows, with a five-fold decrease by 200 bp of distance. Therefore, a given meganuclease can be used to correct only mutations in the vicinity of its DNA target. An alternative, termed "exon knock-in" is featured in Figure 3D. In this case, a meganuclease cleaving in the 5' part of the gene can be used to knock-in functional exonic sequences upstream of the deleterious mutation. Although this method places the transgene in its regular location, it also results in exons duplication, which impact on the long range remains to be evaluated. In addition, should naturally cis-acting elements be placed in an intron downstream of the cleavage, their immediate environment would be modified and their proper function would also need to be explored. However, this method has a tremendous advantage: a single meganuclease could be used for many different patients.
The Inventor has identified a series of DNA targets in the HPRT gene that could be cleaved by l-Crel variants (Figure 10). The combinatorial approach described in figure ID was used to assemble four set of mutations into heterodimeric homing endonucleases with fully engineered specificity, to cleave the DNA targets from the HPRT gene. These I-Crel variants which are able to cleave a genomic DNA target from the HPRT gene can be used for genome engineering at the HPRT locus (knock-out and knock in) and for using HPRT as a selectable marker for genome engineering at any locus (Figure 3 A and 3B).
In addition, these meganucleases could be used for repairing the HPRT mutations associated with the LESCH-NYHAN syndrome (Figure 3C and 3D). The invention relates to the use of an 1-Crel variant or a single-chain derivative for inducing a site-specific modification in the HPRT gene, for non- therapeutic purpose, wherein said I-Crel variant has at least one substitution in one of the two functional subdomains of the LAGLIDADG core domain situated from positions 26 to 40 and 44 to 77 of I-Crel, and is able to cleave a DNA target sequence selected from the group consisting of the sequences SEQ ID NO: 1 to 14.
The cleavage activity of the variant as defined in the present invention may be measured by any well-known, in vitro or in vivo cleavage assay, such as those described in the International PCT Application WO 2004/067736, Arnould et al. (J. MoI. Biol, 2006, 355, 443-458), Epinat et al. (Nucleic Acids Res., 2003, 31, 2952-2962) and Chames et al. (Nucleic Acids Res., 2005, 33, el78). For example, the cleavage activity of the variant of the invention may be measured by a direct repeat recombination assay, in yeast or mammalian cells, using a reporter vector. The reporter vector comprises two truncated, non-functional copies of a reporter gene (direct repeats) and the genomic DNA target sequence within the intervening sequence, cloned in a yeast or a mammalian expression vector. Expression of the variant results in a functional endonuclease which is able to cleave the genomic DNA target sequence. This cleavage induces homologous recombination between the direct repeats, resulting in a functional reporter gene, whose expression can be monitored by appropriate assay.
Definitions
- Amino acid residues in a polypeptide sequence are designated herein according to the one-letter code, in which, for example, Q means GIn or Glutamine residue, R means Arg or Arginine residue and D means Asp or Aspartic acid residue.
- Nucleotides are designated as follows: one-letter code is used for designating the base of a nucleoside: a is adenine, t is thymine, c is cytosine, and g is guanine. For the degenerated nucleotides, r represents g or a (purine nucleotides), k represents g or t, s represents g or c, w represents a or t, m represents a or c, y repre- sents t or c (pyrimidine nucleotides), d represents g, a or t, v represents g, a or c, b represents g, t or c, h represents a, t or c, and n represents g, a, t or c. - by "meganuclease", is intended an endonuclease having a double- stranded DNA target sequence of 14 to 40 pb. Said meganuclease is either a dimeric enzyme, wherein each domain is on a monomer or a monomeric enzyme comprising the two domains on a single polypeptide. - by "meganuclease domain" is intended the region which interacts with one half of the DNA target of a meganuclease and is able to associate with the other domain of the same meganuclease which interacts with the other half of the DNA target to form a functional meganuclease able to cleave said DNA target.
- by "meganuclease variant" or "variant" is intented a meganuclease obtained by replacement of at least one residue in the amino acid sequence of the wild-type meganuclease (natural meganuclease) with a different amino acid.
- by "functional variant" is intended a variant which is able to cleave a DNA target sequence, preferably said target is a new target which is not cleaved by the parent meganuclease. For example, such variants have amino acid variation at positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target.
- by "meganuclease variant with novel specificity" is intended a variant having a pattern of cleaved targets different from that of the parent homing endonuclease. The terms "novel specificity", "modified specificity", "novel cleavage specificity", "novel substrate specificity" which are equivalent and used indifferently, refer to the specificity of the variant towards the nucleotides of the DNA target sequence.
- by "I-Crel" is intended the wild-type 1-OeI having the sequence SWISSPROT P05725 or pdb accession code Ig9y, corresponding to the sequence SEQ ID NO: 143 in the sequence listing.
- by "LAGLIDADG core domain" or "core domain" is intended the "LAGLIDADG Homing Endonuclease Core Domain" which is the characteristic αiβiβ2α2β3β4α3 fold of the homing endonucleases of the LAGLIDADG family, corresponding to a sequence of about one hundred amino acid residues. Said domain comprises four beta-strands (β1] β2) β3j β4) folded in an antiparallel beta-sheet which interacts with one half of the DNA target. This domain is able to associate with another LAGLIDADG Homing Endonuclease Core Domain which interacts with the other half of the DNA target to form a functional endonuclease able to cleave said DNA target. For example, in the case of the dimeric homing endonuclease 1-OeI (163 amino acids), the LAGLIDADG Homing Endonuclease Core Domain corresponds to the residues 6 to 94. - by "single-chain meganuclease" is intended a meganuclease comprising two LAGLIDADG Homing Endonuclease domains or core domains linked by a peptidic spacer. The single-chain meganuclease is able to cleave a chimeric DNA target sequence comprising one different half of each parent meganuclease target sequence. - by "subdomain" is intended the region of a LAGLIDADG Homing
Endonuclease Core Domain which interacts with a distinct part of a homing endonuclease DNA target half-site. Two different subdomains behave independently and the mutation in one subdomain does not alter the binding and cleavage properties of the other subdomain. Therefore, two subdomains bind distinct part of a homing endonuclease DNA target half-site.
- by "beta-hairpin" is intended two consecutive beta-strands of the antiparallel beta-sheet of a LAGLIDADG homing endonuclease core domain (β!β2 or, p3p4 ) which are connected by a loop or a turn,
- by "1-OeI site" is intended a 22 to 24 bp double-stranded DNA sequence which is cleaved by Ϊ-Crel. l-Crel sites include the wild-type (natural) non- palindromic 1-OeI homing site and the derived palindromic sequences such as the sequence 5'- t-12C-πa-loa-9a-sa-7c-6g,5t-4C-3g.2t-1a+1c+2g+3a+4c+5g+6t+7t+8t+9t+1og+1ia+12 also called C 1221 (SEQ ID NO :16; figure 10).
- by "DNA tarfiet", "DNA target sequence", "target sequence" , "target-site", "target" , "site"; "site of interest"; "recognition site", "recognition sequence", "homing recognition site", "homing site", "cleavage site" is intended a 20 to 24 bp double-stranded palindromic, partially palindromic (pseudo-palindromic) or non-palindromic polynucleotide sequence that is recognized and cleaved by a LAGLIDADG homing endonuclease such as 1-OeI, or a variant, or a single-chain chimeric meganuclease derived from l-Crel. These terms refer to a distinct DNA location, preferably a genomic location, at which a double stranded break (cleavage) is to be induced by the endonuclease. The DNA target is defined by the 5' to 3' sequence of one strand of the double-stranded polynucleotide, as indicate above for C 1221. Cleavage of the DNA target occurs at the nucleotides in positions +2 and -2, respectively for the sense and the antisense strand. Unless otherwiwe indicated, the position at which cleavage of the DNA target by an l-Cre I meganuclease variant occurs, corresponds to the cleavage site on the sense strand of the DNA target.
- by "DNA target half-site", "half cleavage site" or half-site" is intended the portion of the DNA target which is bound by each LAGLIDADG homing endonuclease core domain.
- by "chimeric DNA target", "combined target" or "hybrid DNA target" is intended a DNA target, wherein at least one half of said target comprises the combination of nucleotides which are bound by at least two separate subdomains.
- by "DNA target sequence from the HPRT gene" is intended a 20 to 24 bp sequence of a HPRT gene which is recognized and cleaved by a meganuclease variant. - by "HPRT gene" is intended the HPRT gene of a vertebrate.
- by "vector" is intended a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- by "homologous" is intended a sequence with enough identity to another one to lead to a homologous recombination between sequences, more particularly having at least 95 % identity, preferably 97 % identity and more preferably 99 %.
- "identity" refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences. Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or BLAST which are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default settings. - "individual" includes mammals, as well as other vertebrates (e.g., birds, fish and reptiles). The terms "mammal" and "mammalian", as used herein, refer to any vertebrate animal, including monotremes, marsupials and placental, that suckle their young and either give birth to living young (eutharian or placental mammals) or are egg-laying (metatharian or nonplacental mammals). Examples of mammalian species include humans and other primates (e.g., monkeys, chimpanzees), rodents (e.g., rats, mice, guinea pigs) and others such as for example: cows, pigs and horses.
- by mutation is intended the substitution, deletion, insertion of one or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence. Said mutation can affect the coding sequence of a gene or its regulatory sequence. It may also affect the structure of the genomic sequence or the structure/stability of the encoded mRNA.
■ "genetic disease" refers to any disease, partially or completely, directly or indirectly, due to an abnormality in one or several genes. Said abnormality can be a mutation. Said genetic disease can be recessive or dominant.
In a preferred embodiment of the use according to the present invention, said substitution(s) in the subdomain situated from positions 44 to 77 of I- OeI are in positions 44, 68, 70, 75 and/or 77.
In another preferred embodiment of the use according to the present invention, said substitution(s) in the subdomain situated from positions 26 to 40 of I- OeI are in positions 26, 28, 30, 32, 33, 38 and/or 40.
In another preferred embodiment of the use according to the present invention, said l-Crel variant comprises one or more substitutions at additional positions situated on the entire I-Crel sequence or only in the C-terminal half of I-Crel (positions 80 to 163). The residues which are mutated may include residues contacting the DNA target sequence or interacting with the DNA backbone or with the nucleotide bases, directly or via a water molecule; these I-O*el interacting residues are well- known in the art.
For example, said variant, comprises one or more substitutions in positions: 2, 9, 54, 66, 69, 81, 82, 86, 90, 92, 96, 100, 103, 104, 105, 107, 108, 109, 110, 113, 120, 125, 129, 130, 131, 132, 135, 136, 137, 140, 143, 151, 154, 155, 157, 158, 159, 161 and 162 of I-Crel. In another preferred embodiment of the use according to the present invention, said substitutions are replacement of the initial amino acids with amino acids selected from the group consisting of: A, D, E, G, H, K, N5 P, Q, R, S, T, Y, C, V5 L5 W, M and I. For example:
- the lysine (K) in position 28 may be mutated in : R,
- the asparagine (N) in position 30 may be mutated in: S5 C5 R, Y5 Q5 D and T5
- the serine (S) in position 32 may be mutated in : D5 T, R, G and W, - the tyrosine (Y) in position 33 may be mutated in: H5 T5 G5 R5 C5
Q5 D and S5
- the glutamine (Q) in position 38 may be mutated in: W, S, T, G5 E5 A, Y5 C5 D and H
- the serine (S) in position 40 may be mutated in: Q5 A5 T and R5 - the glutamine (Q) in position 44 may be mutated in : N5 T5 R5 K, D5
Y and A5
- the arginine (R) in position 68 may be mutated in: K5 Q5 E5 A, Y5 N5 H and T,
- the arginine (R) in position 70 may be mutated in: S5 H, N and K5 - the aspartic acid (D) in position 75 may be mutated in: R5 S5 N5 Y5
E5 H and Q5 and
- the isoleucine (I) in position 77 may be mutated in: T5 W5 Y5 K5 N, R, H5 D5 F5 E5 Q and L.
In addition, the l-Crel variants as defined in the present invention may include one or more residues inserted at the NH2 terminus and/or COOH terminus of the l-Crel sequence. For example, a tag (epitope or polyhistidine sequence) is introduced at the NH2 terminus and/or COOH terminus; said tag is useful for the detection and/or the purification of said variant.
The l-Crel variant as defined in the invention may be an homodimer or an heterodimer resulting from the association of a first monomer having at least one mutation in positions 26 to 40 or 44 to 77 of l-Crel and a second monomer which is I- Crel or an l-Crel variant. In another preferred embodiment of the use according to the present invention, said 1-Crel variant is an heterodimer, resulting from the association of a first and a second monomer having different mutations in positions 26 to 40 and/or 44 to 77 of I-Crel. In a more preferred embodiment, at least one monomer has at least two substitutions, one in each of the two functional subdomains situated from positions 26 to 40 and 44 to 77 of l-Crel.
More preferably, said heterodimer consist of a first and a second monomer selected from the following pairs of sequences: SEQ ID NO: 83 and 97, SEQ ID NO: 84 and 98, SEQ ID NO: 85 and 99, SEQ ID NO/ 32 and 52, SEQ ID NO: 32 and 53, SEQ ID NO: 32 and 54, SEQ ID NO: 32 and 55, SEQ ID NO: 32 and 56, SEQ ID NO: 32 and 57, SEQ ID NO: 32 and 58, SEQ ID NO: 32 and 60, SEQ ID NO: 32 and 65, SEQ ID NO: 32 and 66, SEQ ID NO: 32 and 67, SEQ ID NO: 32 and 68, SEQ ID NO: 32 and 69, SEQ ID NO: 32 and 70, SEQ ID NO: 32 and 71, SEQ ID NO: 32 and 72 SEQ ID NO: 32 and 73, SEQ ID NO: 32 and 74, SEQ ID NO: 75 and 56, SEQ ID NO: 76 and 56, SEQ ID NO: 77 and 56, SEQ ID NO: 78 and 56, SEQ ID NO: 79 and 56, SEQ ID NO: 80 and 56, SEQ ID NO: 81 and 56, SEQ ID NO: 82 and 56, SEQ ID NO: 86 and 96, SEQ ID NO: 87 and 100, SEQ ID NO: 88 and 101, SEQ ID NO: 89 and 102, SEQ ID NO: 90 and 103, SEQ ID NO: 91 and 104, SEQ ID NO: 92 and 105, SEQ ID NO: 93 and 106, SEQ ID NO: 94 and 107, SEQ ID NO: 95 and 108.
The single-chain derivative of the I- Cr el variant as defined in the present invention is a fusion protein comprising two monomers or two core domains of a LAGLIDADG meganuclease or a combination of both, wherein at least one monomer or core domain has the sequence of an l-Crel variant having at least one substitution in positions 26 to 40 and/or 44 to 77 of l-Crel, as defined above.
The DNA target sequences which are cleaved by the l-Crel variant or single-chain derivative are situated in the HPRT ORF and these sequences cover all the HPRT ORF (Table I and figure 2). Table I: Targets position and identity in mammals
Figure imgf000016_0001
1, : The position is relative to the start of the corresponding Exon except for the target SEQ ID NO : 1 whose position is indicated relatively to the ATG initiation codon. 2 : 100 % identity at positions ± 3 to 5 et 8 to 10 with no gap 3_: 100 % identity at positions ± 3 to 5 et 8 to 10 with gap in the middle
The DNA target sequences are present in the HPRT gene of at least one mammal (human or animal).
For example, the target sequences SEQ ID NO: 6 and 12 are present at least in the human, mouse and Chinese Hamster (Criteculus sp.) HPRT genes. The target sequences SEQ ID NO: 7 and 9 are present at least in both the mouse and Chinese Hamster HPRT genes.
The target sequences SEQ ID NO: 1 to 5, 8, 10, 11, 13 and 14 are present at least in the Chinese Hamster HPRT gene.
In addition, target sequences having sequence identity with the nucleotides in position + 3 to 5 and ± 8 to 10 of the sequences SEQ ID NO: 8 and 14 are present at least in the human and mouse HPRT genes. Target sequences having sequence identity with the nucleotides in position ± 3 to 5 and + 8 to 10 of the sequences SEQ ID NO: 10 and 11 are present at least in the mouse HPRT gene (sequence identity is not found with the human HPRT gene). A target sequence having sequence identity with the nucleotides in position ± 3 to 5 and ± 8 to 10 of the sequence SEQ ID NO: 9 is present at least in the human HPRT gene.
Therefore, the 1-Crel variants which cleave one of the DNA target sequences SEQ ID NO: 6 and 12 are able to induce a site-specific modification at least in the human, mouse and Chinese Hamster HPRT gene. In addition, the I-Oel variants which cleave the DNA target sequences SEQ ID NO: 9 are able to induce a site-specific modification both in the Chinese Hamster and mouse HPRT gene, and for some of them, also in the human HPRT gene. The 1-Crel variants which cleave the DNA target sequences SEQ ID NO: 8 are able to induce a site-specific modification in the Chinese Hamster and for some of them, also in the human and/or mouse HPRT gene; the position of the modification in the HPRT gene corresponds to the position of the genomic DNA cleavage site (position +2 on the sense strand of the genomic DNA target (i.e. positions: 101 (Exon 3), 16 (Exon 8), 21 (Exon 6), 150 (Exon 3), respectively for the sequences SEQ ID NO: 6, 12, 9 and 8). The I-Crel variants which cleave the DNA target sequence SEQ ID
NO: 7 are able to induce a site-specific modification at least in the mouse and Chinese Hamster HPRT gene (but not at the corresponding position in the human HPRT gene). In addition, the l-Crel variants which cleave the DNA target sequences SEQ ID NO: 10 and 11 are able to induce a site-specific modification in the Chinese Hamster HPRT gene and for some of them, also in the mouse HPRT gene (but not at the corresponding position in the human HPRT gene); the position of the modification in the HPRT gene corresponds to positions 106 (Exon 3), 51 (Exon 6) and 52 (Exon 6), respectively.
The I-Crel variants which cleave the DNA target sequence SEQ ID NO: 14 are able to induce a site-specific modification in the Chinese Hamster HPRT gene and for some of them, also in the human HPRT gene (but not at the corresponding position in the mouse HPRT gene); the position of the modification in the HPRT gene corresponds to position 68 (Exon 9).
The I-Crel variants which cleave one of the DNA target sequences SEQ ID NO: 1 to 5 and 13 are able to induce a site-specific modification at least in the Chinese Hamster HPRT gene (but not at the corresponding position in the human or mouse HPRT gene); the position of the modification in the HPRT gene corresponds to positions -7 from the ATG (Exon 1), 54 (Exon 2), 93(Exon 2), 29 (Exon 3), 69(Exon 3), 93 (Exon 9) and 21 (Exon 9), respectively.
Examples of heterodimeric variants which cleave each DNA target are presented in Table II and Figure 19.
Table II: Sequence of heterodimeric I-Crel variants cleaving having a DNA target from the HPRT gene
Figure imgf000018_0001
Figure imgf000019_0001
The sequence of each variant is defined by its amino acid residues at the indicated positions. For example, the first heterodimeric variant of Table II consists of a first monomer having K, Q, D, Y, Q, S, N, K, S, R and T in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively and a second monomer having K, N, S, G, C, S, Q, R, R, N, and I in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively. The positions are indicated by reference to Ϊ-Crel sequence SWISSPROT P05725 or pdb accession code Ig9y; l-Crel has K, N, S, Y, Q, S, Q, R, R, D and I in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively. The positions which are not indicated are not mutated and thus correspond to the wild-type 1-OeI sequence.
In another preferred embodiment of the use according to the present invention, said l-Crel variant or single-chain derivative are combined with a targeting DNA construct comprising a sequence to be introduced flanked by sequences sharing homologies with the regions of the HPRT gene surrounding the genomic DNA cleavage site of said l-Crel variant or single-chain derivative, as defined above.
Preferably, homologous sequences of at least 50 bp, preferably more than 100 bp and more preferably more than 200 bp are used. Indeed, shared DNA homologies are located in regions flanking upstream and downstream the site of the break and the DNA sequence to be introduced should be located between the two arms. The sequence to be introduced comprises an exogenous gene of interest or a sequence to inactivate or delete the HPRT gene or part thereof. Such chromosomal DNA alterations can be used for making HPRT knock-out and knock-in animals wherein the HPRT gene is inactivated (knock-out) and eventually replaced with an exogenous gene of interest (knock-in).
Accordingly, such chromosomal DNA alterations are used also for making genetically modified vertebrate (mammalian including human) cell lines wherein the endogeneous HPRT gene is inactivated and a transgene is eventually inserted at the HPRT locus.
In addition, following inactivation of the endogenous HPRT gene, HPRT may be used as a positive selection marker (selection for HPRT marker expression with HAT) in further gene targeting procedures at any locus of the chromosomes of the HPRT deficient cell/animal.
The subject-matter of the present invention is also a method for making an HPRT knock-in or knock-out animal, comprising at least the step of:
(a) introducing into a pluripotent precursor cell or an embryo of an animal, an l-Crel variant or single-chain derivative, as defined above, so as to into induce a double stranded cleavage at a site of interest of the HPRT gene comprising a DNA recognition and cleavage site of said l-Crel variant or single-chain derivative, simultaneously or consecutively,
(b) introducing into the animal precursor cell or embryo of step (a) a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA, so as to generate a genomically modified animal precursor cell or embryo having repaired the site of interest by homologous recombination, (c) developping the genomically modified animal precursor cell or embryo of step (b) into a chimeric animal, and
(d) deriving a transgenic animal from the chimeric animal of step
(C).
Preferably, step (c) comprises the introduction of the genomically modified precursor cell generated in step (b) into blastocysts so as to generate chimeric animals. The subject-matter of the present invention is also a method for making an HPRT knock-in or knock-out cell, comprising at least the step of:
(a) introducing into a cell, an I-Creϊ variant or single-chain derivative, as defined above, so as to into induce a double stranded cleavage at a site of interest of the HPRT gene comprising a DNA recognition and cleavage site for said l-Crel variant or single-chain derivative, simultaneously or consecutively,
(b) introducing into the cell of step (a), a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA, so as to generate a recombinant cell having repaired the site of interest by homologous recombination,
(c) isolating the recombinant cell of step (b), by any appropriate mean.
The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest.
In a preferred embodiment, said targeting DNA construct is inserted in a vector.
Alternatively, the HPRT gene may be inactivated by repair of the double-strands break by non-homologous end joining (Figure 3B). The subject-matter of the present invention is also a method for making an HPRT knock-out animal, comprising at least the step of:
(a) introducing into a pluripotent precursor cell or an embryo of an animal, an I-Crel variant or single-chain derivative, as defined above, so as to induce a double stranded cleavage at a site of interest of the HPRT gene comprising a DNA recognition and cleavage site of said 1-OeI variant or single-chain derivative, and thereby generate genomically modified precursor cell or embryo having repaired the double-strands break by non-homologous end joining,
(b) developping the genomically modified animal precursor cell or embryo of step (a) into a chimeric animal, and (c) deriving a transgenic animal from a chimeric animal of step (b). Preferably, step (b) comprises the introduction of the genomically modified precursor cell obtained in step (a), into blastocysts, so as to generate chimeric animals.
The subject-matter of the present invention is also a method for making an HPRT-deficient cell, comprising at least the step of:
(a) introducing into a cell, an 1-OeI variant or single-chain derivative, as defined above, so as to induce a double stranded cleavage at a site of interest of the HPRT gene comprising a DNA recognition and cleavage site of said I- OeI variant or single-chain derivative, and thereby generate genomically modified HPRT deficient cell having repaired the double-strands break, by non-homologous end joining, and
(b) isolating the genomically modified HPRT deficient cell of step(a), by any appropriate mean.
The cell which is modified may be any cell of interest. For making transgenic/knock-out animals, the cells are pluripotent precursor cells such as embryo- derived stem (ES) cells, which are well-kown in the art. Said l-Crel variant/single- chain derivative can be provided directly to the cell or through an expression vector comprising the polynucleotide sequence encoding said meganuclease and suitable for its expression in the used cell. In addition, the loss of the endogenous HPRT gene in the modified cells may be selected by using the purine analogue 6-thioguanine (6-TG).
In another preferred embodiment of the use according to the present invention, said I-Crel variant or single-chain derivative are encoded by a polynucleotide fragment. Said polynucleotide may encode one monomer of an homodimeric or heterodimeric variant, or two domains/monomers of a single-chain chimeric endonuclease.
In a more preferred embodiment, said polynucleotide fragment is inserted in a vector which is suitable for its expression in the used cells. Said vector comprises advantageously a targeting DNA construct as defined above. Preferably, said vector comprises two different polynucleotide fragments, each encoding one of the monomers of an heterodimeric I-Cre I variant, as defined above. A vector which can be used in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non chromosomal, semisynthetic or synthetic nucleic acids. Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available.
Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adeno- associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis virus), paramyxovirus (e. g. measles and Sendai), positive strand RNA viruses such as picor- navirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e. g., vaccinia, fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of retroviruses include: avian leukosis- sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
Preferred vectors include lentiviral vectors, and particularly self inactivacting lentiviral vectors.
Vectors can comprise selectable markers, for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adenosine deaminase, glutamine synthetase, and hypoxanthine-guanine phosphoribosyl transferase for eukaryotic cell culture; TRPl for S. cerevisiae; tetracycline, rifampicin or ampicillin resistance in E. coli.
Preferably said vectors are expression vectors, wherein the sequence(s) encoding the variant/single-chain molecule of the invention is placed under control of appropriate transcriptional and translational control elements to permit production or synthesis of said variant. Therefore, said polynucleotide is comprised in an expression cassette. More particularly, the vector comprises a replication origin, a promoter operatively linked to said encoding polynucleotide, a ribosome-binding site, an RNA-splicing site (when genomic DNA is used), a polyadenylation site and a transcription termination site. It also can comprise an enhancer. Selection of the promoter will depend upon the cell in which the polypeptide is expressed. Preferably, when said variant is an heterodimer, the two polynucleotides encoding each of the monomers are included in one vector which is able to drive the expression of both polynucleotides, simultaneously. Suitable promoters include tissue specific and/or inducible promoters. Examples of inducible promoters are: eukaryotic metallothionine promoter which is induced by increased levels of heavy metals, prokaryotic lacZ promoter which is induced in response to isopropyl-β- D-thiogalacto-pyranoside (IPTG) and eukaryotic heat shock promoter which is induced by increased temperature. Examples of tissue specific promoters are skeletal muscle creatine kinase, prostate-specific antigen (PSA), α-antitrypsin protease, human surfactant (SP) A and B proteins, β-casein and acidic whey protein genes.
The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest.
For making knock-in animals/cells the DNA which repairs the site of interest comprises the sequence of an exogenous gene of interest, and eventually a selection marker, such as the HPRT gene.
For making knock-out animals/cells, the DNA which repairs the site of interest comprises sequences that inactivate the endogeneous gene of interest.
The subject matter of the present invention is also to the use of an I- OeI variant or a single-chain derivative as defined above, for the preparation of a medicament for preventing, improving or curing a genetic disease associated with a mutation in the HPRT gene in an individual in need thereof, said medicament being administrated by any means to said individual.
In this case, the use of the 1-OeI variant or a single-chain derivative as defined above, comprises at least the step of (a) inducing in somatic tissue(s) of the individual a double stranded cleavage at a site of interest of the HPRT gene comprising at least one recognition and cleavage site of said variant, and (b) introducing into the individual a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA. The targeting DNA is introduced into the individual under conditions appropriate for introduction of the targeting DNA into the site of interest.
According to the present invention, said double-stranded cleavage is induced, either in toto by administration of said meganuclease to an individual, or ex vivo by introduction of said meganuclease into somatic cells removed from an individual and returned into the individual after modification. In a preferred embodiment of said use, the l-Crel variant or single- chain derivative is combined with a targeting DNA construct comprising a sequence which repairs a mutation in the HPRT gene flanked by sequences sharing homologies with the regions of the HPRT gene surrounding the genomic DNA cleavage site of said l-Crel variant or single-chain derivative, as defined above. For correcting the HPRT gene, cleavage of the gene occurs in the vicinity of the mutation, preferably, within 500 bp of the mutation (Figure 3C). The targeting construct comprises a HPRT gene fragment which has at least 200 bp of homologous sequence flanking the genomic DNA cleavage site (minimal repair matrix) for repairing the cleavage, and includes the correct sequence of the HPRT gene for repairing the mutation (Figure 3C). Consequently, the targeting construct for gene correction comprises or consists of the minimal repair matrix; it is preferably from 200 pb to 6000 pb, more preferably from 1000 pb to 2000 pb.
For restoring a functional gene (Figure 3D), cleavage of the gene occurs upstream of a mutation. Preferably said mutation is the first known mutation in the sequence of the gene, so that all the downstream mutations of the gene can be corrected simultaneously. The targeting construct comprises the exons downstream of the genomic DNA cleavage site fused in frame (as in the cDNA) and with a polyadenylation site to stop transcription in 3'. The sequence to be introduced (exon knock-in construct) is flanked by introns or exons sequences surrounding the cleavage site, so as to allow the transcription of the engineered gene (exon knock-in gene) into a mRNA able to code for a functional protein (Figure 3D). For example, the exon knock-in construct is flanked by sequences upstream and downstream In another preferred embodiment of said use, the l-Crel variant or single-chain derivative is encoded by a vector. Preferably, the vector comprises the targeting DNA construct, as defined above.
In another preferred embodiment of said use, the genetic disease is the Lesch Nyhan Syndrome.
The subject-matter of the present invention is also a composition characterized in that it comprises at least one I-Crel variant or single-chain derivative and/or at least one expression vector encoding said variant/single-chain molecule, as defined above, and a pharmaceutically acceptable excipient. In a preferred embodiment of said composition, it comprises a targeting DNA construct comprising a sequence which repairs a mutation in the HPRT gene, flanked by sequences sharing homologies with the genomic DNA cleavage site of said variant, as defined above. The sequence which repairs the mutation is either a fragment of the gene with the correct sequence or an exon knock-in construct, as defined above.
Preferably, said targeting DNA construct is either included in a recombinant vector or it is included in an expression vector comprising the polynucleotide(s) encoding the variant/single-chain molecule, as defined in the present invention. The subject-matter of the present invention is also products containing at least one I-Crel variant/single-chain derivative or one expression vector encoding said meganucleases, and a vector including a targeting construct, as defined above, as a combined preparation for simultaneous, separate or sequential use in the prevention or the treatment of a genetic disease associated with a mutation in the HPRT gene.
The subject-matter of the present invention is also a method for preventing, improving or curing a genetic disease associated with a mutation in the HPRT gene in an individual in need thereof, said method comprising at least the step of administering to said individual a composition as defined above, by any means. For purposes of therapy, the l-Crel variant/single-chain derivative and a pharmaceutically acceptable excipient are administered in a therapeutically effective amount. Such a combination is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant. An agent is physiologically significant if its presence results in a detectable change in the physiology of the recipient. In the present context, an agent is physiologically significant if its presence results in a decrease in the severity of one or more symptoms of the targeted disease and in a genome correction of the lesion or abnormality.
In one embodiment of the uses according to the present invention, the l-Crel variant/single-chain derivative is substantially non-immunogenic, i.e., engender little or no adverse immunological response. A variety of methods for ameliorating or eliminating deleterious immunological reactions of this sort can be used in accordance with the invention. In a preferred embodiment, the l-Crel variant/single-chain derivative is substantially free of N-formyl methionine. Another way to avoid unwanted immunological reactions is to conjugate meganucleases to polyethylene glycol ("PEG") or polypropylene glycol ("PPG") (preferably of 500 to 20,000 daltons average molecular weight (MW)). Conjugation with PEG or PPG, as described by Davis et al. (US 4,179,337) for example, can provide non-immunogenic, physiologically active, water soluble endonuclease conjugates with anti-viral activity. Similar methods also using a polyethylene—polypropylene glycol copolymer are described in Saifer et al. (US 5,006,333). The 1-OeI variant or single-chain derivative can be used either as a polypeptide or as a polynucleotide construct/vector encoding said polypeptide. It is introduced into cells, in vitro, ex vivo or in vivo, by any convenient means well-known to those in the art, which are appropriate for the particular cell type, alone or in association with either at least an appropriate vehicle or carrier and/or with the targeting DNA. Once in a cell, the meganuclease and if present, the vector comprising targeting DNA and/or nucleic acid encoding a meganuclease are imported or translocated by the cell from the cytoplasm to the site of action in the nucleus.
The 1-OeI variant or single-chain derivative (polypeptide) may be advantageously associated with: liposomes, polyethyleneimine (PEI), and/or membrane translocating peptides (Bonetta, The Scientist, 2002, 16, 38; Ford et al., Gene Ther., 2001, 8, 1-4 ; Wadia and Dowdy, Curr. Opin. Biotechnol., 2002, 13, 52- 56); in the latter case, the sequence of the l-Cre variant/single-chain molecule is fused with the sequence of a membrane translocating peptide (fusion protein).
Vectors comprising targeting DNA and/or nucleic acid encoding a meganuclease can be introduced into a cell by a variety of methods (e.g., injection, direct uptake, projectile bombardment, liposomes, electroporation). Meganucleases can be stably or transiently expressed into cells using expression vectors. Techniques of expression in eukaryotic cells are well known to those in the art. (See Current Protocols in Human Genetics: Chapter 12 "Vectors For Gene Therapy" & Chapter 13 "Delivery Systems for Gene Therapy"). Optionally, it may be preferable to incorporate a nuclear localization signal into the recombinant protein to be sure that it is expressed within the nucleus.
The subject-matter of the present invention is also an I-Crel variant/single-chain derivative, a polynucleotide fragment encoding said variant or a single-chain derivative, a vector comprising said polynucleotide fragment and/or a DNA targeting construct, a prokaryotic or eukaryotic host cell which is modified by a polynucleotide or a vector as defined above, preferably an expression vector.
The subject-matter of the present invention is also a non-human transgenic animal or a transgenic plant, wherein all or part of their cells are modified by a polynucleotide or a vector as defined above. As used herein, a cell refers to a prokaryotic cell, such as a bacterial cell, or an eukaryotic cell, such as an animal, plant or yeast cell.
The I-Crel variant as defined in the present invention is obtainable by a method for engineering I-Crel variants able to cleave a genomic DNA target sequence from a vertebrate gene, comprising at least the steps of: (a) constructing a first series of 1-OeI variants having at least one substitution in a first functional subdomain of the LAGLIDADG core domain situated from positions 26 to 40 of l-Crel,
(b) constructing a second series of l-Crel variants having at least one substitution in a second functional subdomain of the LAGLIDADG core domain situated from positions 44 to 77 of l-Crel,
(c) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant 1-OeI site wherein (i) the nucleotide triplet in positions -10 to -8 of the 1-OeI site has been replaced with a nucleotide triplet selected from the group consisting of cag, att, cct, ttg, gac, atg, ttt, ttc, tgg, gtc, aag, gag and (ii) the nucleotide triplet in positions +8 to +10 has been replaced with the reverse complementary sequence of said nucleotide triplet which is substituted in position -10 to -8 of said I-Crel site (i.e.: ctg, aat, agg, caa, gtc, cat, aaa, gaa, cca, gac, ctt, and etc, respectively),
(d) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions -5 to -3 of the l-Crel site has been replaced with a nucleotide triplet selected from the group consisting of : gac, taa, tea, gtg, get, tgt, tgg, ctg, ttg, tag, and gag and (ii) the nucleotide triplet in positions +3 to +5 has been replaced with the reverse complementary sequence of said nucleotide triplet which is substituted in position -5 to -3 of said Ϊ-Creϊ site (i.e.: gtc, tta, tga, cac, age, aca, cca, cag, caa, eta and etc, respectively), (e) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions +8 to +10 of the 1-OeI site has been replaced a nucleotide triplet selected from the group consisting of: cat, cga, tat, ggg, tac, taa, cag, gca, aca, gaa, tga, atg, and (ii) the nucleotide triplet in positions -10 to -8 has been replaced with the reverse complementary sequence of said nucleotide triplet which is substituted in position +8 to +10 of said 1-OeI site (i.e.: atg, teg, ata, ccc, gta, tta, ctg, tgc, tgt, ttc, tea and cat, respectively),
(f) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions +3 to +5 of the I-Crel site has been replaced with the nucleotide triplet selected from the group consisting of: tec, tat, gtg, gaa, tgg, tac, ttt, aca, age, gcg, tec, act, caa and aag and (ii) the nucleotide triplet in positions -5 to -3 has been replaced with the reverse complementary sequence of which is substituted in position +3 to +5 of said l-Crel site (i.e.: gga, ata, cac, ttc, cca, gta, aaa, tgt, get, cgc, gga, agt, ttg and ctt, respectively),
(gi) selecting and/or screening the variants from steps (c) to (f) which are able to cleave a DNA target of the sequence SEQ ID NO: 1 to 14. According to a first embodiment of the invention, said l-Crel variant is obtainable by a method comprising at least the steps (a) to (f) as defined above, and the further steps of:
(g2) combining different variants obtained in any of step (c) to (f) with each other or with l-Crel, to form heterodimers, and
(h2) selecting and/or screening the heterodimers from step (g2) which are able to cleave said DNA target of the sequence SEQ ID NO: 1 to 14.
According to a second embodiment of the invention, said I-Crel variant is obtainable by a method comprising at least the steps (a) to (f) as defined above, and the further steps of:
(g3) combining in a single variant, the mutation(s) in positions 26 to 40 and 44 to 77 of two variants from step (c) and step (d), to obtain a novel homodimeric l-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions -10 to -8 is identical to the nucleotide triplet which is present in positions -10 to -8 of said DNA target of the sequence SEQ ID NO: 1 to 14, (ii) the nucleotide triplet in positions +8 to +10 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said DNA target of the sequence SEQ ID NO: 1 to 14, (iii) the nucleotide triplet in positions -5 to -3 is identical to the nucleotide triplet which is present in positions -5 to -3 of said DNA target of the sequence SEQ ID NO: 1 to 14 (iv) the nucleotide triplet in positions +3 to +5 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -5 to -3 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, and/or,
(h3) combining in a single variant, the mutation(s) in positions 26 to 40 and 44 to 77 of two variants from step (e) and step (f), to obtain a novel homodimeric 1-OeI variant which cleaves a sequence wherein (i) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, (ii) the nucleotide triplet in positions -5 to -3 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, (iii) the nucleotide triplet in positions +8 to +10 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said of said DNA target of the sequence SEQ ID NO: 1 to 14 and (iv) the nucleotide triplet in positions -10 to -8 is identical to the reverse complementary sequence of the nucleotide triplet in positions +8 to +10 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, and (i3) selecting and/or screening the variants from steps (g3) or (h3) which are able to cleave a DNA target of the sequence SEQ ID NO: 1 to 14.
According to a third embodiment of the invention, said 1-OeI variant is obtainable by a method comprising at least the steps (a) to (f), the step (g3) and/or the step (h3) as defined above, and the further steps of : (i4) combining the variants obtained in step (g3) with the variants obtained in step (h3), 1-OeI or the variants obtained in step (e) or step (f), to form heterodimers, or
(i'4) combining the variants obtained in step (h3) with l-Crel or the variants obtained in step (c) or step (d), to form heterodimers, and (J4) selecting and/or screening the heterodimers from step (i4) or (i'4) which are able to cleave a DNA target of the sequence SEQ ID NO: 1 to 14.
The selection and/or screening in steps (c), (d), (e), (f), (gi), (h2), (i3) and (J4) may be performed by using a cleavage assay in vitro or in vivo, as described in the International PCT Application WO 2004/067736, Epinat et al. (Nucleic Acids Res., 2003, 31, 2952-2962), Chames et al. (Nucleic Acids Res., 2005, 33, el78), and Arnould et al. (J. MoI. Biol, 2006, 355, 443-458). Preferably, steps (c), (d), (e), (f), (gi), (h2), (i3) and/or (J4) are performed in vivo, under conditions where the double- strand break in the mutated DNA target sequence which is generated by said variant leads to the activation of a positive selection marker or a reporter gene, or the inactivation of a negative selection marker or a reporter gene, by recombination- mediated repair of said DNA double-strand break, as described in the International PCT Application WO 2004/067736, Epinat et al. (Nucleic Acids Res., 2003, 31, 2952- 2962), Chames et al. (Nucleic Acids Res., 2005, 33, el78), and Arnould et al. (J. MoI. Biol, 2006, 355, 443-458). Steps (a) and (b) may comprise the introduction of additional mutations in order to improve the binding and/or cleavage properties of the mutants, particularly at other positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target. These steps may be performed by generating combinatorial libraries as described in the International PCT Application WO 2004/067736 and Arnould et al. (J. MoI. Biol., 2006, 355, 443-458).
The (intermolecular) combination of the variants in step (g2), (i4), and (i'4) is performed by co-expressing, either two different variants from steps (c) and (d), (e) and (f), (g3) and Qx3), (g3) and (e), (g3) and (f), (h3) and (c), Qa3) and (d), or one variant from any of steps (c) to (f), (g3) or (h3) with I-Crel, so as to allow the formation of heterodimers. For example;, host cells may be modified by one or two recombinant expression vector(s) encoding said variant(s). The cells are then cultured under conditions allowing the expression of the variant(s), so that heterodimers are formed in the host cells, as described previously in the International PCT Application WO 2006/097854 and Arnould et al. (J. MoI. Biol, 2006, 355, 443-458).
The (intramolecular) combination of mutations in steps (g3) and (h3) may be performed by amplifying overlapping fragments comprising each of the two subdomains by well-known overlapping PCR techniques.
In addition, step (g3) and/or (h3) may further comprise the introduction of random mutations on the whole variant or in a part of the variant, in particular the C-terminal half of the variant (positions 80 to 163). This may be performed by generating random mutagenesis libraries on a pool of variants, according to standard mutagenesis methods which are well-known in the art and commercially available.
The subject matter of the present invention is also an I-Crel variant having mutations in positions 26 to 40 and/or 44 to 77 of 1-OeI that is useful for engineering the variants able to cleave a DNA target from the HPRT gene, according to the present invention. In particular, the invention encompasses the 1-CreI variants as defined in step (c) to (f) of the method for engineering I-Crel variants, as defined above, including the variants of the sequence SEQ ID NO: 24 to 47 and 129 to 142. The invention encompasses also the l-Crel variants as defined in step (g3) and (h3) of the method for engineering I-Crel variants, as defined above, including the valiants of the sequence SEQ ID NO: 52 to 60.
Single-chain chimeric endonucleases able to cleave a DNA target from the gene of interest are derived from the variants according to the invention by methods well-known in the art (Epinat et al., Nucleic Acids Res., 2003, 31, 2952-62; Chevalier et al., MoI. Cell, 2002, 10, 895-905; Steuer et al., Chembiochem., 2004, 5, 206-13; International PCT Applications WO 03/078619 and WO 2004/031346). Any of such methods, may be applied for constructing single-chain chimeric endonucleases derived from the variants as defined in the present invention.
The polynucleotide fragments having the sequence of the targeting DNA construct or the sequence encoding the I-Crel variant or single-chain derivative as defined in the present invention, may be prepared by any method known by the man skilled in the art. For example, they are amplified from a DNA template, by polymerase chain reaction with specific primers. Preferably the codons of the cDNAs encoding the l-Crel variant or single-chain derivative are chosen to favour the expression of said proteins in the desired expression system.
The recombinant vector comprising said polynucleotides may be obtained and introduced in a host cell by the well-known recombinant DNA and genetic engineering techniques.
The L-OeI variant or single-chain derivative as defined in the present the invention are produced by expressing the polypeptide(s) as defined above; preferably said polypeptide(s) are expressed or co-expressed (in the case of the variant only) in a host cell or a transgenic animal/plant modified by one expression vector or two expression vectors (in the case of the variant only), under conditions suitable for the expression or co-expression of the polypeptide(s), and the variant or single-chain derivative is recovered from the host cell culture or from the transgenic animal/plant.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Harries & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds. -in-chief, Academic Press, Inc., New York), specifically, VoIs.154 and 155 (Wu et al. eds.) and Vol. 185, "Gene Expression Technology" (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1986).
In addition to the preceding features, the invention further comprises other features which will emerge from the description which follows, which refers to examples illustrating the l-Crel meganuclease variants and their uses according to the invention, as well as to the appended drawings in which:
- figure 1 illustrates the modular structure of homing endonucleases and the combinatorial approach for designing custom meganucleases. A. Tridimensional structure of the 1-OeI homing endonuclease bound to its DNA target. The catalytic core is surrounded by two αββαββα folds forming a saddle-shaped interaction interface above the DNA major groove. B. Different binding sequences derived from the l-Crel target sequence (top right and bottom left) can be combined to obtain heterodimers or single chain fusion molecules cleaving non palindromic chimeric targets (bottom right). C. The identification of smaller independent subunits, i. e., a subunit within a single monomer or αββαββα fold (top right and bottom left) would allow for the design of novel chimeric molecules (bottom right), by combination of mutations within the same monomer. Such molecules cleave palindromic chimeric targets (bottom right). D. The combination of the two former steps would allow a larger combinatorial approach, involving four different subdomains. In a first step, couples of novel meganucleases could be combined in new molecules ("half-meganucleases") cleaving palindromic targets derived from the target one wants to cleave. Then, the combination of such "half-meganuclease" can result in an heterodimeric species cleaving the target of interest. Thus, the identification of a small number of new cleavers for each subdomain would allow for the design of a very large number of novel endonucleases with tailored specificities.
- figure 2 represents the Hypoxanthine-Guanine Phosphoribosyl Transferase gene and the corresponding mRNA. The exons are boxed and the size of each exon in the mouse gene (accession number NC_000086) is indicated; differences in size with the human gene (NC_000023) are also indicated. The cleavage sites (SEQ ID NO: 1 to 14) of the l-Crel variants are indicated above the exons. The Criteculus sp. HPRT mRNA (accession number J00060.1; SEQ ID NO: 15) is represented below the gene. The ORF is indicated as a grey box. The HprCH3 target site is indicated with its sequence (SEQ ID NO: 4) and position.
- figure 3 illustrates four different strategies for the utilization of a meganuclease cleaving the Hypoxanthine-Guanine Phosphoribosyl Transferase (HPRT) gene. A. Gene insertion and/or gene inactivation. Upon cleavage by a meganuclease and recombination with a repair matrix containing a gene of interest (gene insertion) or an inactivation cassette (gene inactivation), flanked by sequences sharing homology with the sequences surrounding the cleavage site, gene insertion or gene inactivation occurs. B. Gene inactivation by non-homologous end-joining. Upon cleavage by a meganuclease, the DNA ends are degraded and rejoined by Non- Homologous- End- Joining (NHEJ), and gene inactivation occurs. C. Gene correction. A mutation occurs within the HPRT gene. Upon cleavage by a meganuclease and recombination with a repair matrix the deleterious mutation is corrected. D. Exonic sequences knock-in. A mutation occurs within the HPRT gene. The mutated mRNA transcript is featured below the gene. In the repair matrix, exons located downstream of the cleavage site are fused in frame (as in a cDNA), with a polyadenylation site to stop transcription in 3'. Introns and exons sequences can be used as homologous regions. Exonic sequences knock-in results into an engineered gene, transcribed into a mRNA able to code for a functional protein.
- figure 4 represents the sequences of the I-Crel N75 scaffold protein and degenerated primers used for the Ulib4 and Ulib5 libraries construction. A. The scaffolf (SEQ ID NO: 111) is the VCr el ORF including the D75N codon substitution and three additional codons (AAD) at the 3' end. B. Primers (SEQ ID NO: 112, 113, 114), - figure 5 illustrates examples of patterns and the numbers of mutants cleaving each target. A. Examples of profiling. Each novel endonuclease is profiled in yeast on a series of 64 palindromic targets, arrayed as in figure 5B, differing from the sequence C1221 (SEQ ID NO: 16; figure 8B) , at positions ±8, ±9 and ±10. Each target sequence is named after the -10,-9,-8 triplet (1 ONNN). For example GGG corresponds to the tcgggacgtcgtacgacgtcccga target (SEQ ID NO: 122; figure 8B). Meganucleases are tested 4 times against the 64 targets. Targets cleaved by 1-OeI (D75), I-Crel N75 or ten derived variants are visualised by black or grey spots. B. Numbers of mutants cleaving each target, and average intensity of cleavage. Each sequence is named after the -10,-9,-8 triplet (1 ONNN). The number of proteins cleaving each target is shown below, and the level of grey coloration is proportional to the average signal intensity obtained with these cutters in yeast.
- figure 6 represents the cleavage patterns of the I-Oel variants in position 28, 30, 33, 38 and/or 40. For each of the 141 1-OeI variants obtained after screening, and defined by residues in position 28, 30, 33, 38, 40, 70 and 75, cleavage was monitored in yeast with the 64 targets derived from the C 1221 palindromic target cleaved by l-Crel, by substitution of the nucleotides in positions + 8 to lO.Targets are designated by three letters, corresponding to the nucleotides in position -10, -9 and -8. For example GGG corresponds to the tcgggacgtcgtacgacgtcccga target (SEQ ID NO: 122). Values (boxed) correspond to the intensity of the cleavage, evaluated by an appropriate software after scanning of the filter, whereas (0) indicates no cleavage.
- figure 7 represents the localisation of the mutations in the protein and DNA target, on a l-Crel homodimer bound to its target. The two set of mutations (residues 44, 68 and 70; residues 30, 33 and 38) are shown in black on the monomer on the left. The two sets of mutations are clearly distinct spatially. However, there is no structural evidence for distinct subdomains. Cognate regions in the DNA target site (region -5 to -3; region -10 to -8) are shown in grey on one half site.
- figure 8: l-Crel derivative target definition (A and B) and profiling (C and D). AU targets are derived from C 1221, a palindromic target cleaved by l-Crel wild-type, and shown on the top of A and B. A. A first series of 64 targets is derived by mutagenesis of positions ±5 to ±3 (in grey boxes). A few examples are shown below. Interactions with l-Crel residues 44, 68 and 70 are shown. B. A second series of 64 target is derived by mutagenesis of positions ±10 to ±8 (in grey boxes). A few examples are shown below. Positions ±8, ±9 and ±10 are not contacted by residues 44, 68 and 70. C. Organisation of the targets as in Figure 8D. For the left panel, the three letters in the table indicate the bases in positions ±3, ±4 and ±5 (for example, GGG means tcaaaacggggtaccccgttttga (SEQ ID NO: 115)). For the right panels, the three letters indicate the bases in positions ±8, ±9 and ±10 (for example, GGG means tcgggacgtcgtacgacgtcccga (SEQ ID NO: 122)). D. Profiling. Ten l-Crel variants cleaving the C 1221 target, including I-Crel N75 (QRR) are profiled with the two sets of 64 targets (±5 to ±3 on the left, and ±10 to ±8 on the right). Targets are arranged as in Figure 8C. The C1221 target (squared) is found in both sets. Mutants are identified by three letters corresponding to the residues found in position 44, 68 and 70
(example:QRR is Q44, R68, R70), and all of them have an additional D75N mutation.
- figure 9 represents the localisation of the mutations in the protein and DNA target, on a l-Crel homodimer bound to its target. The two set of mutations (residues 44, 68 and 70; residues 28, 30, 33, 38 and 40 are shown in black on the monomer on the left. The two sets of mutations are clearly distinct spatially. However, there is no structural evidence for distinct subdomains. Cognate regions in the DNA target site (region -5 to -3; region -10 to -8) are shown in grey on one half site.
- figure 10 represents the HprCH3 series of targets and close derivatives. 10GAG_P, 10CAT_P and 5CTT_P (SEQ ID NO: 17 to 19) are close derivatives found to be cleaved by previously obtained I-Oel mutants. They differ from C 1221 (SEQ ID NO: 16) by the boxed motives. C 1221, 10GAG_P, 10CAT_P and 5CTT_P were first described as 24 bp sequences, but structural data suggest that only the 22 bp are relevant for protein/DNA interaction. However, positions ±12 are indicated in parenthesis. In the HprCH3.2 target (SEQ ID NO: 20), the atga sequence in the middle of the target is replaced with gtac, the bases found in C 1221. HprCH3.3 (SEQ ID NO: 21) is the palindromic sequence derived from the left part of HprCH3.2, and HprCH3.4 (SEQ ID NO: 22) is the palindromic sequence derived from the right part of HprCH3.2. As shown in the Figure, the boxed motives from 10GAG_P, 1 OC AT_P and 5CTT_P are found in the HprCH3 series of targets
- figure 11 illustrates cleavage of HprCH3.3 by 1 ONNNJP mutants. The figure displays an example of primary screening of l-Crel with the HprCH3.3 target. Positive clones are boxed. The sequences of positive mutants at position Gl, H6 and H7 are KNDTQS/QRRDI (SEQ ID NO: 24), KNTPQS/QRRDI (SEQ ID NO: 44) and KNTTQS/QRRDI (SEQ ID NO: 45), respectively (same nomenclature as for Table III). - figure 12 illustrates cleavage of HprCH3.4 by combinatorial mutants. The figure displays an example of primary screening of l-Crel combinatorial mutants with the HprCH3.4 target. The sequences of positive mutants at position A9 and Bl are KNTHQS/RYSDN (SEQ ID NO: 54) and KNSYQS/RYSNI (SEQ ID NO: 60), respectively (same nomenclature as for Table IV). - figure 13 illustrates cleavage of HprCH3.2 and HprCH3 by heterodimeric combinatorial mutants. A. Secondary screening of combinations of I- Crel mutants with the HprCH3.2. target. B. Secondary screening of the same combinations of I-Crel mutants with the HprCH3 target.
- figure 14 illustrates cleavage of the HprCH3 target. A series of I- OeI mutants cutting HprCH3.4 were optimized and co-expressed with a mutant cutting HprCH3.3. Cleavage is tested with the HprCH3 target. Mutants displaying improved cleavage of HprCH3 are circled. In the filter shown, C9 corresponds to the heterodimer 28R,32S,33S,38Y,40Q,44R,68,70S,75N,77N (SEQ ID NO: 65) + 33H (SEQ ID NO: 32), E6 corresponds to 28R,32S33S,38Y,40Q,44R,68A,70S,75H,77Y (SEQ ID NO: 66) + 33H (SEQ ID NO: 32) and F3 corresponds to 28K,32T,33H,38Q,40S,44K,68Y,70S,75D,77R,92R,96R,107R,132V,140A,143A (SEQ ID NO/ 74) + 33H (SEQ ID NO: 32). Hl 1 is the original heterodimer (a mutant cleaving HprCH3.4, KSSQQS/RYSDN (SEQ ID NO:53), co-expressed with a mutant cleaving HprCH3.3, KNSHQS/QRRDI, SEQ ID NO: 32)). H12 is a positive control. - figure 15 illustrates cleavage of the HprCH3 target. A series of I-
OeI mutants cutting HprCH3.3 were optimized and co-expressed with a mutant cutting HprCH3.4. Cleavage is tested with the HprCH3 target. Mutants displaying efficient cleavage of HprCH3 are circled. In the first filter, B3 corresponds to the heterodimer 33H,71R,103I,129A and 130G (SEQ ID NO: 80) + 33T,38Y,44K,68Y,70S,75E,and 77V (SEQ ID NO: 56). In the second filter, H3 corresponds to the heterodimer 2I,33H,81V,86I,110G,131R,135Q,151A and 157V (SEQ ID NO:79) + 33T,38Y,44K,68Y,70S,75E and 77V (SEQ ID NO: 56). H12 is a positive control.
- figure 16 represents the pCLS1055 vector map.
- figure 17 represents the pCLS0542 vector map. - figure 18 represents the pCLS 1107 vector map.
- figure 19 illustrates the DNA target sequences which are present in the Criteculus griseus HPRT gene and the corresponding l-Crel variant which are able to cleave said DNA target. The DNA target is presented (column 3), with its first nucleotide (start, column 1) and last nucleotide (end, column 2); the positions are indicated relatively to the HPRT mRNA sequence (accession number J00060.1). The sequence of each heterodimeric variant is defined by the amino acid residues at the indicated positions of the first monomer (column 4) and the second monomer (column 5). For example, the first heterodimeric variant of figure 19 consists of a first monomer having K, Q, D, Y, Q, S, N, K, S, R and T in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively and a second monomer having K, N, S, G, C, S, Q, R, R, N and I in positions 28, 30, 32, 38, 40, 44, 68, 70, 75 and 77, respectively. The positions are indicated by reference to I-Crel sequence SWISSPROT P05725 or pdb accession code Ig9y; I-Crel has K, N, S, Y, Q, S, Q, R, R, D, I, in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively. The positions which are not indicated are not mutated and thus correspond to the wild-type l-Crel sequence.
Example 1: Functional endonucleases with new specificity towards nucleotides ±8 to +10 (10NNN)
The method for producing meganuclease variants and the assays based on cleavage-induced recombination in mammal or yeast cells, which are used for screening variants with altered specificity are described in the International PCT Application WO 2004/067736; Epinat et al, Nucleic Acids Res., 2003, 31, 2952- 2962; Chames et al, Nucleic Acids Res., 2005, 33, el78, and Arnould et al, J. MoI. Biol., 2006, 355, 443-458. These assays result in a functional LacZ reporter gene which can be monitored by standard methods. A) Material and methods a) Construction of mutant libraries l-Crel wt (l-Crel D75), l-Crel D75N (1-OeI N75) and I-Crel S70 N75 open reading frames were synthesized, as described previously (Epinat et ah, N.A.R., 2003, 31, 2952-2962). Combinatorial libraries were derived from the l-Crel N75, 1-Crel D75 and l-Crel S70 N75 scaffolds, by replacing different combinations of residues, potentially involved in the interactions with the bases in positions ± 8 to 10 of one DNA target half-site (Q26, K28, N30, S32, Y33, Q38 and S40). The diversity of the meganuclease libraries was generated by PCR using degenerated primers harboring a unique degenerated codon at each of the selected positions.
Mutation D75N was introduced by replacing codon 75 with aac. Then, the three codons at positions N30, Y33 and Q38 (Ulib4 library) or K28, N30 and Q38 (Ulib5 library) were replaced by a degenerated codon VVK (18 codons) coding for 12 different amino acids: A,D,E,G,H,K,N,P,Q,R,S,T). In consequence, the maximal (theoretical) diversity of these protein libraries was 123 or 1728. However, in terms of nucleic acids, the diversity was 183 or 5832.
In Lib4, ordered from BIOMETHODES, an arginine in position 70 of the l-Crel N75 scaffold was first replaced with a serine (R70S). Then positions 28, 33, 38 and 40 were randomized. The regular amino acids (K28, Y33, Q38 and S40) were replaced with one out of 10 amino acids (A,D,E,K,N,Q,R,S,T,Y). The resulting library has a theoretical complexity of 10000 in terms of proteins.
In addition, small libraries of complexity 225 (152) resulting from the randomization of only two positions were constructed in an l-Crel N75 or I-Crel D75 scaffold, using NVK degenerate codon (24 codons, amino acids ACDEGHKNPQRSTWY).
Fragments carrying combinations of the desired mutations were obtained by PCR, using a pair of degenerated primers coding for 10, 12 or 15 different amino acids, and as DNA template, the l-Crel N75 (Figure 4A), I-Crel D75 or l-Crel S70 N75 open reading frames (ORF). For example, figure 4B illustrates the two pair of primers (Ulib456for and Ulib4rev; Ulib456for and Ulib5rev) used to generate the Ulib4 and Ulib5 libraries, respectively. The corresponding PCR products were cloned back into the I-Crel N75, I-Crel D75 or l-Crel S70 N75 ORF, in the yeast replicative expression vector pCLS0542 (Epinat et al, precited), carrying a LEU2 auxotrophic marker gene. In this 2 micron-based replicative vector, 1-OeI variants are under the control of a galactose inducible promoter. b) Construction of target clones The 64 palindromic targets derived from C 1221 were constructed as described in example 1, by using 64 pairs of oligonucleotides (ggcatacaagtttcnnnacgtcgtacgacgtnnngacaatcgtctgtca (SEQ ID NO: 109) and reverse complementary sequences). c) Sequence The open reading frame (ORF) of positive clones identified during the first and/or secondary screening in yeast was amplified by PCR on yeast colonies using primers: PCR-GaIlO-F (gcaactttagtgctgacacatacagg, SEQ ID NO: 48) and PCR-GaIlO-R (acaaccttgattgcagacttgacc, SEQ ID NO: 49). d) Structure analyses All analyses of protein structures were realized using Pymol. The structures from I-Crel correspond to pdb entry Ig9y. Residue numbering in the text always refer to these structures, except for residues in the second l-Crel protein domain of the homodimer where residue numbers were set as for the first domain. B) Results I-Crel is a dimeric homing endonuclease that cleaves a 22 bp pseudo- palindromic target. Analysis of I-Crel structure bound to its natural target has shown that in each monomer, eight residues establish direct interactions with seven bases (Jurica et al., 1998, precited). According to these structural data, the bases of the nucleotides in positions ± 8 to 10 establish direct contacts with 1-OeI amino-acids N30, Y33, Q38 and indirect contacts with I-Crel amino-acids K28 and S40. Thus, novel proteins with mutations in positions 30, 33 and 38 could display novel cleavage profiles with the 64 targets resulting from substitutions in positions ± 8, ± 9 and ± 10 of a palindromic target cleaved by l-Crel (lONNN target). In addition, mutations might alter the number and positions of the residues involved in direct contact with the DNA bases. More specifically, positions other than 30, 33, 38, but located in the close vicinity on the folded protein, could be involved in the interaction with the same base pairs.
An exhaustive protein library vs. target library approach was undertaken to engineer locally this part of the DNA binding interface. Randomization of 5 amino acids positions would lead to a theoretical diversity of 205 = 3.2x106. However, libraries with lower diversity were generated by randomizing 2, 3 or 4 residues at a time, resulting in a diversity of 225 (152), 1728 (123) or 10,000 (104). This strategy allowed an extensive screening of each of these libraries against the 64 palindromic 10NNN DNA targets using a yeast based assay described previously (Epinat et al, 2003, precited and International PCT Application WO 2004/067736).
First, the l-Crel scaffold was mutated from D75 to N. The D75N mutation did not affect the protein structure, but decreased the toxicity of l-Crel in overexpression experiments.
Next the Ulib4 library was constructed : residues 30, 33 and 38, were randomized, and the regular amino acids (N30, Y33, and Q38) replaced with one out of 12 amino acids (A,D,E,G,H,K,N,P,Q,R,S,T). The resulting library has a complexity of 1728 in terms of protein (5832 in terms of nucleic acids).
Then, two other libraries were constructed : Ulib5 and Lib4. In Ulib5, residues 28, 30 and 38, were randomized, and the regular amino acids (K28, N30, and Q38) replaced with one out of 12 amino acids (ADEGHKNPQRST). The resulting library has a complexity of 1728 in terms of protein (5832 in terms of nucleic acids). In Lib4, an Arginine in position 70 was first replaced with a Serine. Then, positions 28, 33, 38 and 40 were randomized, and the regular amino acids (K28, Y33, Q38 and S40) replaced with one out of 10 amino acids (A,D,E,K,N,Q,R,S,T,Y). The resulting library has a complexity of 10000 in terms of proteins.
In a primary screening experiment, 20000 clones from Ulib4, 10000 clones from Ulib5 and 20000 clones from Lib4 were mated with each one of the 64 tester strains, and diploids were tested for beta-galactosidase activity. All clones displaying cleavage activity with at least one out of the 64 targets were tested in a second round of screening against the 64 targets, in quadriplate, and each cleavage profile was established, as shown on Figure 5. Then, meganuclease ORFs were amplified from each strain by PCR, and sequenced. After secondary screening and sequencing of positives over the entire coding region, a total of 1484 unique mutants were isolated showing a cleavage activity against at least one target. Different patterns could be observed. Figure 6 illustrates 37 novel targets cleaved by a collection of 141 variants, including 34 targets which are not cleaved by I-Crel and 3 targets which are cleaved by Ϊ-Crel (aag, aat and aac). Twelve examples of profile, including I-Crel N75 and Ϊ-Crel D75 are shown on Figure 5A. Some of these new profiles shared some similarity with the wild type scaffold whereas many others were totally different. Homing endonucleases can usually accommodate some degeneracy in their target sequences, and the l-Crel and I- Crel N75 proteins themselves cleave a series of sixteen and three targets, respectively. Cleavage degeneracy was found for many of the novel endonucleases, with an average of 9.9 cleaved targets per mutant (standard deviation: 11). However, among the 1484 mutants identified, 219 (15 %) were found to cleave only one DNA target, 179 (12 %) cleave two, and 169 (11 %) and 120 (8 %) were able to cleave 3 and 4 targets respectively. Thus, irrespective of their preferred target, a significant number of l-Crel derivatives display a specificity level that is similar if not higher than that of the I-Crel N75 mutant (three IONNN target sequences cleaved), or l-Crel (sixteen IONNN target sequences cleaved). Also, the majority of the mutants isolated for altered specificity for IONNN sequences no longer cleave the original C 1221 target sequence (61 % and 59 %, respectively).
Altogether, this large collection of mutants allowed the targeting of all of the 64 possible DNA sequences differing at positions ±10, ±9, and ±8 (Figure 5B). However, there were huge variations in the numbers of mutants cleaving each target (Figure 5B), these numbers ranged from 3 to 936, with an average of 228.5 (standard deviation: 201.5). Cleavage was frequently observed for targets with a guanine in ±8 or an adenine in ±9, whereas a cytosine in ±10 or ±8 was correlated with low numbers of cleavers. In addition, all targets were not cleaved with the same efficiency. Since significant variations of signal could be observed for a same target, depending on the mutant (compare cleavage efficiencies for the wild type IOAAA target in Figure 5B, for example), an average cleavage efficiency was measured for each target as previously reported (Arnould et al, J. MoI. Biol., 2006, 355, 443-458). These average efficiencies are represented by grey levels on Figure 5B. Analysis of the results show a clear correlation between this average efficiency and the numbers of cleavers, with the most frequently cut target being also the most efficiently cut (compare for example lOTCN, IOCTN and IOCCN targets with 10GAN5 IOAAN and IOTAN in Figure 5B). Thus, hundreds of novel variants were obtained, including mutants with novel substrate specificity ; these variants can keep high levels of activity and the specificity of the novel proteins can be even narrower than that of the wild-type protein for its target. Example 2: Two Ϊ-Creϊ functional subdomains can behave independantly in terms of DNA binding.
This example shows that an Ϊ-Crel target can be separated in two parts, bound by different subdomains, behaving independently. In the 1-OeI DNA target, positions ±5, ±4 and ±3 are bound by residues 44, 68 and 70. Several I-Crel variants, mutated in positions 44, 68, 70 and 75, obtained as described in example 1, were shown to display a detectable activity on C 1221, a palindromic target cleaved by l-Crel wild-type (Chevalier, et al, 2003), but were cleaving other targets with various efficacies. In the external part of the binding site, positions ±9 and ±8 are contacted by residues 30, 33 and 38. A shown on figure 7, the two set of residues are in distinct parts of the proteins. There is no direct interaction with bases ±8. If positions ±5 to ±3 and ±10 to ±8 are bound by two different, independent functional subdomains, engineering of one subdomain should not impact the binding properties of the other domain.
In order to determine if positions ±5 to ±3 and ±9 to ±8 are bound by two different, independent functional subdomains, mutants with altered specificity in the ±5 to ±3 region, but still binding C 1221, were assayed for their cleavage properties in the ±10 to ±8 region. A) Material and Methods a) Structure analyses
All analyses of protein structures were realized using Pymol. The structures from I-Crel correspond to pdb entry Ig9y. Residue numbering in the text always refer to these structures, except for residues in the second I-Crel protein domain of the homodimer where residue numbers were set as for the first domain. b) I-Oel variant expressing yeast strain
Mutants were generated as described in examples 1, by mutating positions 44, 68, 70 and 75, and screening for clones able to cleave C 1221 derived targets. Mutant expressing plasmids are transformed into S. cerevisiae strain FYC2- 6A (MATa, trplA63, leu2M, his3A200). c) Construction of target clone
The 64 palindromic targets derived from C 1221 by mutation in ±5 to ±3 were constructed as described in example 1, by using 64 pairs of oligonucleotides (ggcatacaagtttcaaaacnnngtacnnngttttgacaatcgtctgtca (SEQ ID NO :110) and reverse complementary sequences). d) Mating of meganuclease expressing clones and screening in yeast
Mating was performed as described in example 1, using a low gridding density (about 4 spots/cm2).
B) Results 64 targets corresponding to all possible palindromic targets derived from C 1221 were constructed by mutagenesis of bases ±10 to ±8, as shown on figure 8B. The l-Crel N75 cleavage profile was established, showing a strong signal with the aaa and aat targets, and a weaker one with the aag target.
As shown on figure 8C, proteins with a clearly different cleavage profile in ±5 to ±3, such as QAR, QNR, TRR, NRR, ERR and DRR have a similar profile in ±10 to ±8. The aaa sequence in ±10 to ±8 corresponds to the C 1221 target, and is necessarily cleaved by all our variants cleaving C 1221. aat is cleaved as well in most mutants (90 %), whereas aag is often not observed, probably because the signal drops below the detection level in faint cleaver. No other target is ever cleaved. These results show that the ±5 to ±3 and ±10 to ±8 regions are bound by two different, largely independent binding units. Example 3: Strategy for engineering novel meganucleases cleaving a target from the HPRT gene
A) Principle of the combinatorial approach for designing novel meganucleases with tailored specificity The objective here is to determine whether it is possible to combine separable functional subdomains in the l-Crel DNA-binding interface, in order to cleave novel DNA targets.
The identification of distinct groups of mutations in the l-Crel coding sequence that alter the cleavage specificity towards two different regions of the C 1221 target sequence (10NNN (positions - 10 to -8 and + 8 to +10: ± 8 to 10 or ± 10 to 8; example 1) and 5NNN (positions- 5 to -3 and + 3 to +5: + 3 to 5 or + 5 to 3; Arnould et al., J. MoI. Biol, 2006, 355, 443-458, International Applications WO 2006/097784 and WO 2006/097853) raises the possibility of combining these two groups of mutants intramolecularly to generate a combinatorial mutant capable of cleaving a target sequence simultaneously altered at positions IONNN and 5NNN (Figure 1C).
Positions 28, 30, 33, 38 and 40 on one hand, and 44, 68 and 70, on another hand are on a same DNA-binding fold, and there is no structural evidence that they should behave independently. However, the two sets of mutations are clearly on two spatially distinct regions of this fold (figures 7 and 9) located around different regions of the DNA target. In addition, the cumulative impact of a series of mutations could eventually disrupt the folding. To check whether they are part of two independent functional subunits, mutations from these two series of mutants were combined, and the ability of the resulting variants to cleave the combined target sequence was assayed (Figure ID). Therefore, a non-palindromic target sequence that would be a patchwork of four cleaved 5NNN and IONNN targets, is identified. In addition, two derived target sequences representing the left and right halves in palindromic form, are designed. To generate appropriate I-Crel combinatorial mutants capable of targeting the palindromic targets, mutants efficiently cleaving the IONNN and 5NNN part of each palindromic sequence are selected and their characteristic mutations incorporated into the same coding sequence by in vivo cloning in yeast. Throughout the text and figures, combinatorial mutants sequences are named with an eleven letter code, after residues at positions 28, 30, 32, 33, 38, 40, 44, 68 and 70, 75 and 77. For example, KNSTYS/KYSEV stands for l-Crel K28, N30, S32, T33, Y38, S40, K44, Y68, S70, E75, and V77 (I-Crel 28K, 30N, 32S, 33T3 38Y, 4OS, 44K, 68Y, 70S, 75E and 77V). Parental controls are named with a six letter code, after residues at positions 28, 30, 32, 33, 38 and 40 or a five letter code, after residues at positions 44, 68, 70, 75 and 77. For example, IQSfSTYS stands for I-Crel 28K, 3ON, 32S, 33T, 38Y and 40S, and KYSEV stands for -Crel 44K, 68Y3 70S, 75E and 77V.
All target sequences described in these examples are 22 or 24 bp palindromic sequences. Therefore, they will be described only by the first 11 or 12 nucleotides, followed by the suffix _P; for example, target 5' tcaaaacgtcgtacgacgttttga 3' (SEQ ID NO: 16) cleaved by the I-Crel protein, will be called tcaaaacgtcgt_P.
B) Design of novel meganucleases cleaving a target from the Criteculus griseus HPRT gene This combinatorial approach, was used to engineer the DNA binding domain of the I-Crel meganuclease, and cleave the Cricetulus griseus HPRT gene.
HprCH3 is a 22 bp (non-palindromic) target (Figure 2) located in Exon 3 (positions 17 to 38) of the Criteculus griseus (Chinese Hamster) HPRT gene; the target sequence corresponds to positions 241 to 262 of the mRNA (accession number J00060; SEQ ID NO: 15; Figure 2).
The meganucleases cleaving HprCH3 could be used, either to insert an heterologous gene of interest at the HPRT locus, to allow reproducible gene expression levels in vertebrate recombinant cell lines or transgenic animals, or to inactivate the HPRT gene, to allow the selection of vertebrate recombinant cell lines or transgenic animals (Figure 3 A and 3B).
The HprCH3 sequence is partly a patchwork of the 10GAG_P, 10CAT_P and 5CTT_P targets (Figure 10) which are cleaved by previously identified meganucleases, obtained as described in International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et al, J. MoI. Biol, 2006, 355, 443-458; example 1. Thus, HprCH3 could be cleaved by combinatorial mutants resulting from these previously identified meganucleases. The 10GAG_P, 10CAT_P and 5CTT_P target sequences are 24 bp derivatives of C 1221, a palindromic sequence cleaved by 1-OeI (Arnould et ah, precited). However, the structure of I-Crel bound to its DNA target suggests that the two external base pairs of these targets (positions -12 and 12) have no impact on binding and cleavage (Chevalier et al, Nat. Struct. Biol., 2001, 8, 312-316; Chevalier and Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774; Chevalier et al, J. MoI. Biol, 2003, 329, 253-269), and in this study, only positions -11 to 11 were considered. Consequently, the HprCH3 series of targets were defined as 22 bp sequences instead of 24 bp. HprCH3 differs from C 1221 in the 4 bp central region. According to the structure of the l-Crel protein bound to its target, there is no contact between the 4 central base pairs (positions -2 to 2) and the 1-OeI protein (Chevalier et al, Nat. Struct. Biol, 2001, 8, 312-316; Chevalier and Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774; Chevalier et al, J. MoI. Biol, 2003, 329, 253-269). Thus, the bases at these positions should not impact the binding efficiency. However, they could affect cleavage, which results from two nicks at the edge of this region. Thus, the atga sequence, in -2 to 2 was first substituted with the gtac sequence from C 1221, resulting in target HprCH3.2 (Figure 10). Then, two palindromic targets, HprCH3.3 and HprCH3.4, were derived from HprCH3.2 (Figure 10). Since HprCH3.3 and HprCH3.4 are palindromic, they should be cleaved by homodimeric proteins. Thus, proteins able to cleave the HprCH3.3 and HprCH3.4 sequences as homodimers were first designed (examples 4 and 5) and then co-expressed to obtain heterodimers cleaving HprCH3 (example 6). Heterodimers cleaving the HprCH3.2 and HprCH3 targets could be identified. In order to improve cleavage activity for the HprCH3 target, a series of mutants cleaving HprCH3.3 and HprCH3.4 was chosen, and then refined. The chosen mutants were randomly mutagenized, and used to form novel heterodimers that were screened against the HprCH3 target (examples 7 and 8). Heterodimers could be identified with an improved cleavage activity for the HprCH3 target. Example 4: Identification of meganucleases cleaving HprCH3.3
This example, shows that l-Crel mutants can cut the HprCH3.3 DNA target sequence derived from the left part of the HprCH3.2 target in a palindromic form (Figure 10). Target sequences described in this example are 22 bp palindromic sequences. Therefore, they will be described only by the first 11 nucleotides, followed by the suffix _P (For example, target HprCH3.3 will be noted cgagatgtcgt_P (SEQ ID
NO: 21).
HprCH3.3 is similar to 10GAG_P at all positions except ±6. It was hypothesized that positions ±6 would have little effect on the binding and cleavage activity. Mutants able to cleave the 10GAG_P target were obtained by mutagenesis of
I-Crel or l-Crel S70 N75, at positions 28, 30, 32, 33, 38, 40, as described in example
1. Screening of these mutants would allow the identification of meganucleases that cleave the HprCH3.3 target.
A) Material and Methods a) Construction of target vector
The target was cloned as follows: oligonucleotide corresponding to the target sequence flanked by gateway cloning sequence was ordered from
PROLIGO: 5'tggcatacaagtttcgagatgtcgtacgacatctcgacaatcgtctgtca3' (SEQ ID NO: 23).
Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned using the Gateway protocol (INVITROGEN) into the yeast reporter vector (pCLS1055, Figure 16). Yeast reporter vector was transformed into Saccharomyces cerevisiae strain FYBL2-7B (MAT a, ura3Δ851, trplΔ63, leu2Al, lys2Δ202), resulting in a reporter strain. b) Mating of meganuclease expressing clones and screening in yeast I-Crel mutants cleaving 10GAG_P were previously identified, as described in example 1. These mutants were present on a yeast expression plasmid
(pCLS0542, Figure 17) in the S. cerevisiae strain FYC2-6A (MATa, trplΔ63, leu2Δl, his3Δ200).
Meganuclease expressing clones were mated with the reporter strain and diploids were tested for beta-galactosidase activity, by using the screening assay described previously in International PCT Application WO 2004/067736; Epinat et ah, Nucleic Acids Res., 2003, 31, 2952-2962; Chames et ah, Nucleic Acids Res.,
2005, 33, el78, and Arnould et al, J. MoI. Biol, 2006, 355, 443-458.
Mating was performed using a colony gridder (QpixII, GENETIX). Mutants were gridded on nylon filters covering YPD plates, using a low gridding density (4 or 9 spots/cm2). A second gridding process was performed on the same filters to spot a second layer consisting of the reporter-harboring yeast strain. Membranes were placed on solid agar YPD rich medium, and incubated at 30 0C for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, with galactose (1 %) as a carbon source, and incubated for five days at 37 °C, to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02 % X-GaI in 0.5 M sodium phosphate buffer, pH 7.0, 0.1 % SDS, 6 % dimethyl formamide (DMF), 7 mM β-mercaptoethanol, 1% agarose, and incubated at 37°C, to monitor β-galactosidase activity. After two days of incubation, positive clones were identified by scanning and the β-galactosidase activity of the clones was quantified using appropriate software.
The clones showing an activity against at least one target were isolated (first screening) and each positive clone was tested against the reporter strain in quadruplicate (secondary screening), c) Sequencing of mutants To recover the mutant expression plasmids, yeast DNA was extracted using standard protocols and used to transform E. coli. Sequencing of mutant ORFs was then performed on the plasmids by MILLEGEN SA. Alternatively, ORFs were amplified from yeast DNA by PCR (Akada et al., Biotechniques, 2000, 28, 668-670, 672, 674, and sequencing was performed directly on the PCR product by MILLEGEN SA.
B) Results
I-Crel mutants capable of cleaving 10GAG_P were screened for cleavage against the HprCH3.3 DNA target (cgagatgtcgt_P; (SEQ ID NO: 21). 38 positives clones were found, and after sequencing and validation by secondary screening, 24 mutants listed in Table III were identified. Examples of positives are shown in Figure 11. Table III: Ϊ-Crel mutants capable of cleaving the HprCH3.3 DNA target.
Figure imgf000051_0001
Example 5: Making of meganucleases cleaving HprCH3.4
This example shows that 1-OeI mutants can cleave the HprCH3.4 DNA target sequence derived from the right part of the HprCH3.2 target in a palindromic form (Figure 10). All target sequences described in this example are 22 bp palindromic sequences. Therefore, they will be described only by the first 11 nucleotides, followed by the suffix _P (for example, HprCH3.4 will be called ccatctcttgt_P; SEQ ID NO: 22).
HprCH3.4 is similar to 5CTT_P at positions ±1, ±2, ±3, ±4, ±5 and ±11 and to lOCATJP at positions ±1, ±2, ±8, ±9 ±10 and ±11. It was hypothesized that positions ±6 and ±7 would have little effect on the binding and cleavage activity. Mutants able to cleave 5CTTJ? (caaaaccttgt_P; SEQ ID NO: 19 ) were obtained by mutagenesis of 1-Crel N75 at positions 44, 68 and 70 or l-Crel S70 at positions 44, 68, 75 and 77, as described previously (International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et al, J. MoI. Biol, 2006, 355, 443- 458). Mutants able to cleave the 10CAT_P target (ccatacgtcgt_P; SEQ ID NO: 18) were obtained by mutagenesis of l-Crel (D75), at positions 30, 32, 33 and 38, as described in example 1. Thus, combining such pairs of mutants would allow for the cleavage of the HprCH3.4 target. Therefore, to check whether combined mutants could cleave the HprCH3.4 target, amino acids at positions 44, 68, 70, 75 and 77 from proteins cleaving 5CTT_P were combined with the amino acids at positions 30, 32, 33 and 38 from proteins cleaving 10CAT_P. A) Material and Methods a) Construction of target vector
The experimental procedure is as described in example 4. b) Construction of combinatorial mutants
I-Crel mutants cleaving 10CAT_P or 5CTT_P were previously identified, as described in International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et al, J. MoI. Biol, 2006, 355, 443-458, and example 1. In order to generate l-Crel derived coding sequence containing mutations from both series, separate overlapping PCR reactions were carried out that amplify the 5' end (aa positions 1-43) or the 3' end (positions 39-167) of the l-Crel coding sequence. For both the 5' and 3' end, PCR amplification is carried out using primers (GaIlOF 5'- gcaactttagtgctgacacatacagg-3' (SEQ ID NO: 48) or GaIlOR 5'- acaaccttgattggagacttgacc-3' (SEQ ID NO: 49) specific to the vector (pCLS0542, Figure 11) and primers (assF 5'-ctannnttgaccttt-3' (SEQ ID NO: 50) or assR 5'- aaaggtcaannntag-3'(SEQ ID NO: 51), where nnn codes for residue 40. The PCR fragments resulting from the amplification reaction realized with the same primers and with the same coding sequence for residue 40 were pooled. Then, each pool of PCR fragments resulting from the reaction with primers GaIlOF and assR or assF and GaIlOR was mixed in an equimolar ratio. Finally, approximately 25 ng of each final pool of the two overlapping PCR fragments and 75 ng of vector DNA (pCLS1107, Figure 18) linearized by digestion with DraIII and NgoMIV were used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MATα, trplΔ63, leu2Δl, his3Δ200) using a high efficiency LiAc transformation protocol (Gietz and Woods, Methods Enzymol., 2002, 350, 87-96). An intact coding sequence containing both groups of mutations is generated by in vivo homologous recombination in yeast. c) Mating of meganuclease expressing clones and screening in yeast
The experimental procedure is as described in example 4 d) Sequencing of mutants
The experimental procedure is as described in example 4 B) Results I-Crel mutants used in this example, and cutting the 10CAT_P target or the 5CTT_P target are listed in Table IV. l-Crel combined mutants were constructed by associating on the l-Crel scaffold, amino acids at positions 44, 68, 70, 75 and 77 from mutants cleaving the 5CTT_P target, with the amino acids at positions 30,32, 33 and 38 from the mutants cleaving the 10CAT_P target (Table IV), resulting in a library of complexity 480. This library was transformed into yeast and 1728 clones (3.6 times the diversity) were screened for cleavage against the HprCH3.4 DNA target (ccatctcttgt_P; SEQ ID NO: 22). 10 positive clones were found, and after sequencing and validation by secondary screening 9 combinatorial mutants were identified (Table IV). The mutants are identified by an 11 letter code, corresponding to the amino acid residues at positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77. For example, KNSTYS/KYSEV stands for l-Crel K28, N30, S32, T33, Y38, S40, K44, Y68, S70, E75, and V77 (SEQ ID NO: 56).
Among these nine mutants, four corresponded to the bona fide assembly of 2 parental molecules (Table IV; SEQ ID NO: 52 to 55), whereas five others displayed non parental combinations at positions 28, 30, 32, 33, 38, 40 or 44, 68, 70, 75, 77These five mutants are:
- KNSTYS/KYSEV (SEQ ID NO: 56) - KNRDQS/KYSDR (SEQ ID NO: 57)
- KNSSDS/KYSDR (SEQ ID NO: 58)
- KNTHQS/KYSNR (SEQ ID NO: 59)
- KNSYQS/RYSNI (SEQ ID NO: 60)
Such mutants likely result from recombination between similar PCR fragments during the transformation process. Examples of positives are shown in Figure 12.
Table IV: Cleavage of the HprCH3.4 target by mutants theoretically present in the combinatorial library
Figure imgf000054_0001
Figure imgf000055_0001
+ indicates a functional combination.
Example 6: Making of meganucleases cleaving HprCH3.2 and HprCH3
I- OeI mutants able to cleave each of the palindromic HprCH3 derived targets (HprCH3.3 and HprCH3.4) were identified in example 4 and example 5. Pairs of such mutants (one cutting HprCH3.3 and one cutting HprCH3.4) were co- expressed in yeast. Upon co-expression, there should be three active molecular species, two homodimers, and one heterodimer. It was assayed whether the heterodimers that should be formed, cut the HprCH3 and HprCH3.2 targets. A) Materials and Methods a) Mutant co-expression
The experimental procedures are as described in International PCT Application WO 2006/097854 and Arnould et αl. J. MoI. Biol., 2006, 355, 443-458.
Briefly, yeast DNA was extracted from mutants cleaving the HprCH3.4 target using standard protocols and was used to transform E. cø/z.The resulting plasmid DNA was then used to transform yeast strains expressing a mutant cutting the HprCH3.3 target. Transformants were selected on -L GIu + G418 medium, b) Mating of meganuclease co-expressing clones and screening in yeast
The experimental procedure is as described in example4, except that a low gridding (about 4 spots/cm2) was used.
B) Results:
Co-expression of mutants cleaving the HprCH3.3 and HprCH3.4 sequences resulted in efficient cleavage of the HprCH3.2 target in most cases (Figure 13A). In addition, some of these combinations were able to cut the HprCH3 natural target that differs from the HprCH3.2 sequence by 4 bp at positions -1, -2, 1 and 2. (Figure 13B). Functional combinations are summarized in Table V and Table VI. Table V: Cleavage of the HprCH3.2 target by the heterodimeric mutants
Figure imgf000056_0001
+ indicates a functional combination
Mutants in bold are mutants with alternative mutations in example 5. Table VI: Cleavage of the HprCH3 target by the heterodimeric mutants
Figure imgf000057_0001
+ indicates a functional combination
* Mutants in bold are mutants with alternative mutations in example 5.
Example 7: Improvement of meganucleases cleaving HprCH3 by random mutagenesis of proteins cleaving HprCH3.4 and assembly with proteins cleaving HprCH3.3
I-Crel mutants able to cleave the HprCH3.2 and HprCH3 target by assembly of mutants cleaving the palindromic HprCH3.3 and HprCH3.4 target have been previously identified in example 4. However, these mutants display stronger activity with the HprCH3.2 target compared to the HprCH3 target.
Therefore the combinatorial mutants cleaving HprCH3 were mutagenized, and variants displaying stronger cleavage of this target were screened. According to the structure of the l-Crel protein bound to its target, there is no contact between the 4 central base pairs (positions -2 to 2) and the I-Crel protein (Chevalier et al, Nat. Struct. Biol., 2001, 8, 312-316; Chevalier and Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774; Chevalier et al, J. MoI. Biol, 2003, 329, 253-269). Thus, it is difficult to rationally choose a set of positions to mutagenize, and mutagenesis was performed on the whole protein. Random mutagenesis results in high complexity libraries. Therefore, to limit the complexity of the variant libraries to be tested, only one of the two components of the heterodimers cleaving HprCH3 was mutagenized. . Thus, in a first step, proteins cleaving HprCH3.4 were mutagenized, and in a second step, it was assessed whether they could cleave HprCH3 when co-expressed with a protein cleaving HprCH3.3.
A) Material and Methods a) Construction of libraries by random mutagenesis
Random mutagenesis was performed on a pool of chosen mutants, by PCR using Mn2+ or by a two-step PCR process using dNTP derivatives 8-oxo- dGTP and dPTP as described in the protocol from Jena Bioscience GmbH for the JBS dNTP-Mutagenis kit. Primers used were preATGCreFor (5'- gcataaattactatacttctatagacacgcaaacacaaatacacagcggccttgccacc-3': SEQ ID NO: 61) and ICrelpostRev (S'-ggctcgaggagctcgtctagaggatcgctcgagttatcagtcggccgGθ': SEQ ID NO: 62). Approximately 25 ng of the PCR product and 75 ng of vector DNA (pCLSl 107, Figure 18) linearized by digestion with DraIII and NgoMIVwere used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A {MAT a, trplΔ63, leu2Δl, his3Δ200) using a high efficiency LiAc transformation protocol (Gietz and Woods, Methods Enzymol., 2002, 350, 87-96). Expression plasmids containing an intact coding sequence for the l-Crel mutant were generated by in vivo homologous recombination in yeast. b) Mutant-target yeast strains, screening and sequencing The yeast strain FYBL2-7B {MAT a, ura3Δ851, trplΔ63, !eu2Δl, lys2Δ202) containing the HprCH3 target in the yeast reporter vector (pCLS1055, Figure 16) was transformed with mutants, in the leucine vector (pCLS0542), cutting the HprCH3.3 target, using a high efficiency LiAc transformation protocol. Mutant- target yeasts were used as target strains for mating assays as described in example 4. Positives resulting clones were verified by sequencing (MILLEGEN) as described in example 4.
B) Results:
Four mutants cleaving HprCH3.4 (1-OeI
32T,33H,44K,68Y,70S,75N,77R, l-Crel 30S,33Q,44R,68Y,70S,77N, l-Crel 32T,33H,70S,75H,77Y and I-Crel 32T,33H,68N,70S,75Q,77R; also called
KNTHQS/KYSNR, KSSQQS/RYSDN, KNTHQS/QRSHY and KNTHQS/QNSQR according to the nomenclature of Table IV; SEQ ID NO: 59, 53, 63 and 64) were pooled, randomly mutagenized and transformed into yeast. 1140 transformed clones were then mated with a yeast strain that contains (i) the HprCH3 target in a reporter plasmid (ii) an expression plasmid containing a mutant that cleaves the HprCH3.3 target (I-Crel 33H or KNSHQS/QRRDI; SEQ ID NO: 32). After mating with this yeast strain, 23 clones were found to cleave the HprCH3 target more efficiently than the original mutant. Thus, 23 positives contained proteins able to form heterodimers with KNSHQS/QRRDI with strong cleavage activity for the HprCH3 target. An example of positives is shown in Figure 14. Sequencing of these 23 positive clones indicates that 10 distinct mutants listed in Table V were identified.
Table V: Functional mutant combinations displaying strong cleavage activity for HprCH3.
Optimized Mutants HprCH3.4 (SEQ ID NO: 65 to 74) l-Crel 28R,30N,32S,33S,38Y,40Q,44R,68A,70S,75N,77N
]-Crel 28R,30N,32S,33S.38Y,40Q,44R,68A,70S,75H,77Y l-Crel 28R,30N,32T,33S,38Y,40Q,44R,68Y,70S,75N,77N,140M
]-Crel 28K,30N,32T,33H,38H,40S,44Q,68Y,7QS,75D,77R
O \-Cre\ 28K,30N,32T,33H,38Q,40S,44K,68YJ0S,75DJ7R
I-Crel 28K,30N,32T,33H,38Q,40S,44Q,68N, 7QS.75H.77R
\-Cre\ 28K30N,32T,33H,38QΛ0SΛ4Q,68R,70SJ5H,77R l-Cre] 28K,30A/,32r,33H,38Q,40S,44Q,68H,70S,75H,77H
I-Crel 28K,30A/,32r,33rt,38Q,40S,44Q,68H,70S,75H,77H,92R
S I-Crel 28K,30N,32T,33H,38Q, 40S,44K,68Y,70S,75D,77R,92R,96R,107R,132V>140A,143A
Example 8; Improvement of meganucleases cleaving HprCH3 by random mutagenesis of proteins cleaving HprCH3.3 and assembly with proteins cleaving HprCH3.4
As a complement to example 6, it was also decided to perform random mutagenesis with the mutants that cleave HprCH3.3. Only one HprCh3.3 mutant was capable of cleaving HprCH3 so this mutant and three other mutants that strongly cleave HprCH3.3 but not HprCH3 were used for random mutagenesis.
The mutagenized proteins cleaving HprCH3.3 were then tested to determine if they could efficiently cleave HprCH3 when co-expressed with a protein cleaving HprCH3.4. A) Material and Methods a) Construction of libraries by random mutagenesis
Random mutagenesis was performed on a pool of chosen mutants, by PCR using Mn2+ or by a two-step PCR process using dNTP derivatives 8-oxo- dGTP and dPTP as described in the protocol from Jena Bioscience GmbH for the JBS dNTP-Mutageneis kit. Primers used were preATGCreFor (5'- gcataaattactatacttctatagacacgcaaacacaaatacacagcggccttgccacc-3': SEQ ID NO: 61) and ICrelpostRev (S'-ggctcgaggagctcgtctagaggatcgctcgagttatcagtcggccgc-S': SEQ ID NO: 62). Approximately 25 ng of the PCR product and 75 ng of vector DNA (pCLS0542, Figure 17) linearized by digestion with Ncol and Eagl were used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MATa, trplΔ63, leu2Δl, his3Δ200) using a high efficiency LiAc transformation protocol (Gietz and Woods, Methods Enzymol., 2002, 350, 87-96). Expression plasmids containing an intact coding sequence for the I-Crel mutant were generated by in vivo homologous recombination in yeast. b) Mutant-target yeast strains, screening and sequencing
The yeast strain FYBL2-7B (MAT a, ura3Δ851, trplΔ63, leiύΔl, lys2Δ202) containing the HprCH3 target in the yeast reporter vector (pCLS1055, Figure 16) was transformed with mutants, in the kanamycin resistant vector (pCLS1107), cutting the HprCH3.4 target, using a high efficiency LiAc transformation protocol. Mutant-target yeasts were used as target strains for mating assays as described in example 6. Positives resulting clones were verified by sequencing (MILLEGEN) as described in example 4.
B) Results Four mutants cleaving HprCH3.3 (1-OeI 32D,33T, l-Crel 32T,33T, I-
Crel 33H and I-Crel 33Q, also called KNDTQS/QRRDI, KNTTQS/QRRDI, KNSHQS/QRRDI and KNSQQS/QRRDI according to the nomenclature of Table IV; SEQ ID NO: 24, 45, 32 and 35) were pooled, randomly mutagenized and transformed into yeast. 1140 transformed clones were then mated with a yeast strain that contains (i) the HprCH3 target in a reporter plasmid (ii) an expression plasmid containing a mutant that cleaves the HprCH3.4 target (l-Crel 33T,38Y,44K,68Y,70S,75E,77V or KNSTYS/KYSEV; SEQ ID NO: 56). After mating with this yeast strain, 18 clones were found to efficiently cleave the HprCH3 target. Thus, 18 positives contained proteins able to form heterodimers with KNSTYS/KYSEV with cleavage activity for the HprCH3 target. An example of positives is shown in Figure 15. Examples of such heterodimeric mutants are listed in Table VI.
Table VI: Functional mutant combinations displaying cleavage activity for
HprCH3
Optimized Mutants HprCH3.3 (SEQ ID NO: 75 to 82)
I-Crel 33H 66C 137V 155R 162P
I-Crel 9L 33H 1001 108V 154G 155P 161P l-Crel 2Y 33H 109V 125A
I-Crel 33H 113S 136S
1 1 I-Crel 2133H 81V 861 110G 131R 1350. 151A 157V I i I-Crel 33H 71R 1031 129A 130G
I-Crel 33H 69V 82R 9OR 120V 139R 158M
! I-Crel 33H 54L 86D 100R 104M 105A 136S 159R o

Claims

1°) Use of an l-Crel variant or a single-chain derivative for inducing a site-specific modification in the HPRT gene, for non-therapeutic purpose, wherein said l-Crel variant has at least one substitution in one of the two functional subdomains of the LAGLIDADG core domain situated from positions 26 to 40 and 44 to 77 of l-Crel, and is able to cleave a DNA target sequence selected from the group consisting of the sequences SEQ ID NO: 1 to 14.
2°) The use according to claim 1, wherein said HPRT gene is a non- human mammal HPRT gene. 3°) The use according to claim 2, wherein said HPRT gene is the
Criteculus sp, HPRT gene.
4°) The use according to claim 2, wherein said HPRT gene is the the Mus musculus HPRT gene.
5°) The use according to claim 4, wherein said 1-OeI variant cleaves a DNA target of the sequence SEQ ID NO: 6, 7, 8, 9, 10, 11, 12 or 14.
6°) The use according to claim 1, wherein said HPRT gene is the Homo sapiens HPRT gene.
7°) The use according to claim 6, wherein said I-Crel variant cleaves a DNA target of the sequence SEQ ID NO: 6, 8, 9, 12 or 14 8°) The use according to anyone of claims 1 to 7, wherein said I-
Crel variant or single-chain derivative are combined with a targeting DNA construct comprising a sequence to be introduced flanked by sequences sharing homologies with the regions of the HPRT gene surrounding the genomic DNA cleavage site of said l-Cre I variant or single chain derivative. 9°) The use according to claim 8, wherein said sequence to be introduced comprises a gene of interest.
10°) The use according to claim 8, wherein said sequence to be introduced comprises an inactivation cassette for the HPRT gene.
11°) The use according to anyone of claims 8 to 10, wherein said targeting DNA construct is inserted in a vector.
12°) The use according to anyone of claim 1 to 11, wherein said I- Crel variant or single-chain derivative are encoded by a polynucleotide fragment. 13°) The use according to claim 12, wherein said fragment is inserted in an expression vector.
14°) The use according to claim 13, wherein said vector comprises two different polynucleotide fragments, each encoding one of the monomers of an heterodimeric l-Cre I variant.
15°) The use according to claim 13 or claim 14, wherein said vector includes a targeting DNA construct as defined in anyone of claims 8 to 10.
16°) The use according to anyone of claims 1 to 15, wherein said site-specific modification of the HPRT gene consists in the insertion of a gene of interest by cleavage of the HPRT gene by said l-Crel variant and homologous recombination with a targeting DNA construct as defined in claim 9.
17°) The use according to anyone of claims 1 to 15, wherein said site-specific modification of the HPRT gene consists in the insertion of an inactivation cassette by cleavage of the HPRT gene by said I-Crel variant and homologous recombination with a targeting DNA construct as defined in claim 10.
18°) The use according to anyone of claims 1 to 7, wherein said site- specific modification of the HPRT gene consists in the the inactivation of the HPRT gene by cleavage of the HPRT gene by said l-Crel variant and repair of the double- strands break by non-homologous end joining. 19°) The use according to anyone of claims 1 to 18, for making non- human transgenic animals or recombinant cell lines.
20°) The use according to claim 19, for making recombinant human cell lines.
21°) The use according to anyone of claims 1 to 20, wherein said I- Crel variant is obtainable by a method comprising at least the steps of:
(a) constructing a first series of Ϊ-Creϊ variants having at least one substitution in a first functional subdomain of the LAGLIDADG core domain situated from positions 26 to 40 of l-Crel,
(b) constructing a second series of I-Crel variants having at least one substitution in a second functional subdomain of the LAGLIDADG core domain situated from positions 44 to 77 of l-Crel, (c) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant I-Crel site wherein (i) the nucleotide triplet in positions -10 to -8 of the l-Crel site has been replaced with a nucleotide triplet selected from the group consisting of cag, art, cct, ttg, gac, atg, ttt, ttc, tgg, gtc, aag, gag and (ii) the nucleotide triplet in positions +8 to +10 has been replaced with the reverse complementary sequence of said nucleotide triplet which is substituted in position -10 to -8 of said l-Crel site (i.e.: ctg, aat, agg, caa, gtc, cat, aaa, gaa, cca, gac, ctt, and etc, respectively),
(d) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions -5 to -3 of the l-Crel site has been replaced with a nucleotide triplet selected from the group consisting of : gac, taa, tea, gtg, get, tgt, tgg, ctg, ttg, tag, and gag and (ii) the nucleotide triplet in positions +3 to +5 has been replaced with the reverse complementary sequence of said nucleotide triplet which is substituted in position -5 to -3 of said I-Crel site (i.e.: gtc, tta, tga, cac, age, aca, cca, cag, caa, eta and etc, respectively),
(e) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant I-Crel site wherein (i) the nucleotide triplet in positions +8 to +10 of the I-Crel site has been replaced a nucleotide triplet selected from the group consisting of: cat, cga, tat, ggg, tac, taa, cag, gca, aca, gaa, tga, atg, and (ii) the nucleotide triplet in positions -10 to -8 has been replaced with the reverse complementary sequence of said nucleotide triplet which is substituted in position +8 to +10 of said I-Crel site (i.e.: atg, teg, ata, ccc, gta, tta, ctg, tgc, tgt, ttc, tea and cat, respectively), (f) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein (i) the nucleotide triplet in positions +3 to +5 of the I-Crel site has been replaced with the nucleotide triplet selected from the group consisting of: tec, tat, gtg, gaa, tgg, tac, ttt, aca, age, gcg, tec, act, caa and aag and (ii) the nucleotide triplet in positions -5 to -3 has been replaced with the reverse complementary sequence of which is substituted in position +3 to +5 of said I-Crel site (i.e.: gga, ata, cac, ttc, cca, gta, aaa, tgt, get, cgc, gga, agt, ttg and ctt, respectively), (gO selecting and/or screening the variants from steps (c) to (f) which are able to cleave a DNA target of the sequence SEQ ID NO: 1 to 14.
22°) The use according to anyone of claims 1 to 20, wherein said I- Crel variant is obtainable by a method comprising at least the steps (a) to (f) as defined in claim 13, and the further steps of:
(g2) combining different variants obtained in any of step (c) to (f) with each other or with l-Crel, to form heterodimers, and
(h2) selecting and/or screening the heterodimers from step (g2) which are able to cleave said DNA target of the sequence SEQ ID NO: 1 to 14. 23°) The use according to anyone of claims 1 to 20, whereien said I-
OeI variant is obtainable by a method comprising at least the steps (a) to (f) as defined in claim 21, and the further steps of:
(g3) combining in a single variant, the mutation(s) in positions 26 to
40 and 44 to 77 of two variants from step (c) and step (d), to obtain a novel homodimeric l-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions -10 to -8 is identical to the nucleotide triplet which is present in positions -10 to -8 of said DNA target of the sequence SEQ ID NO: 1 to 14, (ii) the nucleotide triplet in positions +8 to +10 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said DNA target of the sequence SEQ ID NO: 1 to 14, (iii) the nucleotide triplet in positions -5 to
-3 is identical to the nucleotide triplet which is present in positions -5 to -3 of said
DNA target of the sequence SEQ ID NO: 1 to 14 (iv) the nucleotide triplet in positions
+3 to +5 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -5 to -3 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, and/or,
(h3) combining in a single variant, the mutation(s) in positions 26 to 40 and 44 to 77 of two variants from step (e) and step (f), to obtain a novel homodimeric l-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, (ii) the nucleotide triplet in positions -5 to -3 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, (iii) the nucleotide triplet in positions +8 to +10 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said of said DNA target of the sequence SEQ ID NO: 1 to 14 and (iv) the nucleotide triplet in positions -10 to -8 is identical to the reverse complementary sequence of the nucleotide triplet in positions +8 to +10 of said of said DNA target of the sequence SEQ ID NO: 1 to 14, and
(13) selecting and/or screening the variants from steps (g3) or (h3) which are able to cleave a DNA target of the sequence SEQ ID NO: 1 to 14.
24°) The use according to anyone of claims 1 to 20, whereien said I- Cr el variant is obtainable by a method comprising at least the steps (a) to (f) as defined in claim 20, the step (g3) and/or the step (h3) as defined in claim 23, and the further steps of :
(14) combining the variants obtained in step (g3) with the variants obtained in step (h3), I-Crel or the variants obtained in step (e) or step (f), to form heterodimers, or
(T4) combining the variants obtained in step (h3) with l-Crel or the variants obtained in step (c) or step (d), to form heterodimers, and
(J4) selecting and/or screening the heterodimers from step (i4) or (i'4) which are able to cleave a DNA target of the sequence SEQ ID NO: 1 to 14. 25°) The use according to anyone of claims 1, 21 to 24, wherein said substitution(s) in the subdomain situated from positions 44 to 77 of l-Crel are in positions 44, 68, 70, 75 and/or 77.
26°) The use according to anyone of claims 1, 21 to 24, wherein said substitution(s) in the subdomain situated from positions 26 to 40 of I-Crel are in positions 26, 28, 30, 32, 33, 38 and/or 40.
27°) The use according to anyone of claims 1, 21 to 26, wherein said I-CV*eI variant comprises one or more additional substitution(s) in 1-OeI.
28°) The use according to claim 27, wherein said substitutions are in positions: 2, 9, 54, 66, 69, 81, 82, 86, 90, 92, 96, 100, 103, 104, 105, 107, 108, 109, 110, 113, 120, 125, 129, 130, 131, 132, 135, 136, 137, 140, 143, 151, 154, 155, 157, 158, 159, 161 or 162 of I-OeI. 29°) The use according to anyone of claims 1, 21 to 28, wherein said substitutions are replacement of the initial amino acids with amino acids selected in the group consisting of A, C, D, E, G, H, K, N, P, Q, R, S, T , Y, W, L, V, M and I.
30°) The use according to anyone of claims 1 to 29, wherein said I- OeI variant is an heterodimer, resulting from the association of a first and a second monomer having different mutations in positions 26 to 40 and/or 44 to 77 of I-Crel.
31°) The use according to claim 30, wherein at least one monomer has at least two substitutions, one in each of the two functional subdomains situated from positions 26 to 40 and 44 to 77 of l-Crel. 32°) The use according to claim 31, wherein said heterodimer consist of a first and a second monomer selected from the following pairs of sequences: SEQ ID NO: 83 and 97, SEQ ID NO: 84 and 98, SEQ ID NO: 85 and 99, SEQ ID NO/ 32 and 52, SEQ ID NO: 32 and 53, SEQ ID NO: 32 and 54, SEQ ID NO: 32 and 55, SEQ ID NO: 32 and 56, SEQ ID NO: 32 and 57, SEQ ID NO: 32 and 58, SEQ ID NO: 32 and 60, SEQ ID NO: 32 and 65, SEQ ID NO: 32 and 66, SEQ ID NO: 32 and 67, SEQ ID NO: 32 and 68, SEQ ID NO: 32 and 69, SEQ ID NO: 32 and 70, SEQ ID NO: 32 and 71, SEQ ID NO: 32 and 72 SEQ ID NO: 32 and 73, SEQ ID NO: 32 and 74, SEQ ID NO: 75 and 56, SEQ ID NO: 76 and 56, SEQ ID NO: 77 and 56, SEQ ID NO: 78 and 56, SEQ ID NO: 79 and 56, SEQ ID NO: 80 and 56, SEQ ID NO: 81 and 56, SEQ ID NO: 82 and 56, SEQ ID NO: 86 and 96, SEQ ID NO/ 87 and 100, SEQ ID NO: 88 and 101, SEQ ID NO: 89 and 102, SEQ ID NO: 90 and 103, SEQ ID NO: 91 and 104, SEQ ID NO: 92 and 105, SEQ ID NO: 93 and 106, SEQ ID NO: 94 and 107, SEQ ID NO: 95 and 108.
33°) Use of an l-Crel variant or a single-chain derivative as defined in anyone of claims 1, 21 to 32, for the preparation of a medicament for preventing, improving or curing a genetic disease associated with a mutation in the HPRT gene.
34°) The use according to claim 33, wherein said l-Crel variant or single-chain derivative is associated with a targeting DNA construct comprising a sequence which repairs a mutation in the HPRT gene flanked by sequences sharing homologies with the regions of the HPRT gene surrounding the genomic DNA target of said l-Crel variant or single-chain derivative, as defined in claim 8 or 11. 35°) The use according to claim 34, wherein said sequence which repairs said mutation is the correct sequence of the HPRT gene.
36°) The use according to claim 34, wherein said sequence which repairs said mutation comprises the exons of the HPRT downstream of the genomic cleavage site fused in frame, and a polyadenylation site to stop transcription in 3 ' .
37°) The use according to anyone of claims 34 to 36, wherein the I- Crel variant or single-chain derivative is encoded by a vector comprising the targeting DNA construct.
38°) The use according to anyone of claims 33 to 37, wherein said genetic disease is the Lesch Nyhan Syndrome.
39°) An l-Crel variant as defined in anyone of claims 1 and 21 to 32.
40°) A single-chain chimeric endonuclease derived from an 1-Creϊ variant according to claim 39. 41°) A polynucleotide fragment encoding a variant according to claim 39 or a single-chain chimeric endonuclease according to claim 40.
42°) An expression vector comprising at least one polynucleotide fragment according to claim 41.
43°) The expression vector according to claim 42, which comprises two different polynucleotide fragments, each encoding one of the monomers of an heterodimeric variant as defined in anyone of claims 14 and 30 to 32.
44°) The expression vector according to claim 42 or claim 43, which comprises a targeting DNA construct as defined in anyone of claims 8 to 10 and 34 to 36. 45°) A vector comprising a targeting DNA construct as defined in anyone of claims 8 to 10 and 34 to 36.
46°) A host cell which is modified by a polynucleotide according to claim 41 or a vector according to anyone of claims 42 to 45.
47°) A non-human transgenic animal comprising one or two polynucleotide fragments as defined in anyone of claims 41 to 43.
48°) A transgenic plant comprising one or two polynucleotide fragments as defined in anyone of claims 41 to 43. 49°) A composition comprising at least one 1-OeI variant as defined in anyone of claims 1 and 21 to 32 or a single-chain chimeric endonuclease according to claim 39, and/or at least one expression vector according to anyone of claims 42 to 44. 50°) Products containing at least one Ϊ-Crel variant as defined in anyone of claims 1 and 21 to 32, one single-chain chimeric endonuclease according to claim 39, or one expression vector according to anyone of claims 42 to 44, and one vector as defined in anyone of claims 34 to 36, as a combined preparation for simultaneous, separate or sequential use in the prevention or the treatment of a genetic disease associated with a mutation in the HPRT gene.
PCT/IB2006/004084 2006-11-14 2006-11-14 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof WO2008059317A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
PCT/IB2006/004084 WO2008059317A1 (en) 2006-11-14 2006-11-14 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
AU2007320880A AU2007320880A1 (en) 2006-11-14 2007-11-13 Meganuclease variants cleaving a DNA target sequence from the HPRT gene and uses thereof
US12/514,913 US20100146651A1 (en) 2006-11-14 2007-11-13 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
CA002669313A CA2669313A1 (en) 2006-11-14 2007-11-13 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
CN200780045983.9A CN101583711B (en) 2006-11-14 2007-11-13 Meganuclease variants cleaving a DNA target sequence from the HPRT gene and uses thereof
SG2011084480A SG176487A1 (en) 2006-11-14 2007-11-13 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
PCT/IB2007/004281 WO2008059382A2 (en) 2006-11-14 2007-11-13 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
EP07859318A EP2092063A2 (en) 2006-11-14 2007-11-13 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
JP2009536820A JP5453097B2 (en) 2006-11-14 2007-11-13 Meganuclease variants that cleave DNA target sequences from HPRT genes and uses thereof
BRPI0718747-5A BRPI0718747A2 (en) 2006-11-14 2007-11-13 MEGANUCLEASE VARIANTS KEYING ONE OR SEQUENCE DNA TARGET FROM THE HPRT GENE AND USES THEREOF.
IL198693A IL198693A0 (en) 2006-11-14 2009-05-11 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
US13/553,221 US20130059387A1 (en) 2006-11-14 2012-07-19 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2006/004084 WO2008059317A1 (en) 2006-11-14 2006-11-14 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof

Publications (1)

Publication Number Publication Date
WO2008059317A1 true WO2008059317A1 (en) 2008-05-22

Family

ID=38141142

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2006/004084 WO2008059317A1 (en) 2006-11-14 2006-11-14 Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof

Country Status (2)

Country Link
CN (1) CN101583711B (en)
WO (1) WO2008059317A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011135407A1 (en) * 2010-04-30 2011-11-03 Cellectis I-crei variants with new specificity and methods of their generation
WO2012167192A2 (en) 2011-06-01 2012-12-06 Precision Biosciences, Inc. Methods and products for producing engineered mammalian cell lines with amplified transgenes
US8445251B2 (en) 2007-10-31 2013-05-21 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
WO2013123408A1 (en) * 2012-02-17 2013-08-22 Sigma-Aldrich Co. Llc Cells deficient in hypoxanthine-guanine phosphoribosyltransferase
US8530214B2 (en) 2003-01-28 2013-09-10 Cellectis S.A. Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof
US8927247B2 (en) 2008-01-31 2015-01-06 Cellectis, S.A. I-CreI derived single-chain meganuclease and uses thereof
US9683257B2 (en) 2008-07-14 2017-06-20 Precision Biosciences, Inc. Recognition sequences for I-CreI-derived meganucleases and uses thereof
WO2020227534A1 (en) * 2019-05-07 2020-11-12 Precision Biosciences, Inc. Optimization of engineered meganucleases for recognition sequences

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3613854A1 (en) * 2014-03-05 2020-02-26 National University Corporation Kobe University Genomic sequence modification method for specifically converting nucleic acid bases of targeted dna sequence, and molecular complex for use in same

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004067753A2 (en) * 2003-01-28 2004-08-12 Cellectis Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof.
WO2006097853A1 (en) * 2005-03-15 2006-09-21 Cellectis I-crei meganuclease variants with modified specificity, method of preparation and uses thereof
WO2006097784A1 (en) * 2005-03-15 2006-09-21 Cellectis I-crei meganuclease variants with modified specificity, method of preparation and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004067753A2 (en) * 2003-01-28 2004-08-12 Cellectis Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof.
WO2006097853A1 (en) * 2005-03-15 2006-09-21 Cellectis I-crei meganuclease variants with modified specificity, method of preparation and uses thereof
WO2006097784A1 (en) * 2005-03-15 2006-09-21 Cellectis I-crei meganuclease variants with modified specificity, method of preparation and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ARNOULD ET AL: "Engineering of Large Numbers of Highly Specific Homing Endonucleases that Induce Recombination on Novel DNA Targets", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 355, no. 3, 20 January 2006 (2006-01-20), pages 443 - 458, XP005206991, ISSN: 0022-2836 *
SELIGMAN L M ET AL: "Mutations altering the cleavage specificity of a homing endonuclease", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 30, no. 17, 1 September 2002 (2002-09-01), pages 3870 - 3879, XP002282592, ISSN: 0305-1048 *
STEUER SHAWN ET AL: "Chimeras of the homing endonuclease PI-SceI and the homologous Candida tropicalis intein: a study to explore the possibility of exchanging DNA-binding modules to obtain highly specific endonucleases with altered specificity", CHEMBIOCHEM - A EUROPEAN JOURNAL OF CHEMICAL BIOLOGY, WILEY VCH, WEINHEIM, DE, vol. 5, no. 2, 6 February 2004 (2004-02-06), pages 206 - 213, XP002412601, ISSN: 1439-4227 *

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8530214B2 (en) 2003-01-28 2013-09-10 Cellectis S.A. Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof
US8697395B2 (en) 2003-01-28 2014-04-15 Cellectis S.A. Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof
US8624000B2 (en) 2003-01-28 2014-01-07 Cellectis S.A. Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof
US9434931B2 (en) 2007-10-31 2016-09-06 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
EP3098309A1 (en) 2007-10-31 2016-11-30 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
EP2660317A1 (en) 2007-10-31 2013-11-06 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US8445251B2 (en) 2007-10-31 2013-05-21 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US10041053B2 (en) 2007-10-31 2018-08-07 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US9340777B2 (en) 2007-10-31 2016-05-17 Precision Biosciences, Inc. Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US8927247B2 (en) 2008-01-31 2015-01-06 Cellectis, S.A. I-CreI derived single-chain meganuclease and uses thereof
US9683257B2 (en) 2008-07-14 2017-06-20 Precision Biosciences, Inc. Recognition sequences for I-CreI-derived meganucleases and uses thereof
EP3211075A2 (en) 2008-07-14 2017-08-30 Precision Biosciences, Inc. Recognition sequences for i-crei-derived meganucleases and uses thereof
US10273524B2 (en) 2008-07-14 2019-04-30 Precision Biosciences, Inc. Recognition sequences for I-CreI-derived meganucleases and uses thereof
US10287626B2 (en) 2008-07-14 2019-05-14 Precision Biosciences, Inc. Recognition sequences for I-CreI-derived meganucleases and uses thereof
EP3495478A2 (en) 2008-07-14 2019-06-12 Precision Biosciences, Inc. Recognition sequences for i-crei-derived meganucleases and uses thereof
EP4001408A2 (en) 2008-07-14 2022-05-25 Precision Biosciences, Inc. Recognition sequences for i-crei-derived meganucleases and uses thereof
WO2011135407A1 (en) * 2010-04-30 2011-11-03 Cellectis I-crei variants with new specificity and methods of their generation
US9822381B2 (en) 2011-06-01 2017-11-21 Precision Biosciences, Inc. Methods and products for producing engineered mammalian cell lines with amplified transgenes
WO2012167192A2 (en) 2011-06-01 2012-12-06 Precision Biosciences, Inc. Methods and products for producing engineered mammalian cell lines with amplified transgenes
EP3489366A1 (en) 2011-06-01 2019-05-29 Precision Biosciences, Inc. Methods for producing engineered mammalian cell lines with amplified transgenes
EP3683319A1 (en) 2011-06-01 2020-07-22 Precision Biosciences, Inc. Methods and products for producing engineered mammalian cell lines with amplified transgenes
WO2013123408A1 (en) * 2012-02-17 2013-08-22 Sigma-Aldrich Co. Llc Cells deficient in hypoxanthine-guanine phosphoribosyltransferase
WO2020227534A1 (en) * 2019-05-07 2020-11-12 Precision Biosciences, Inc. Optimization of engineered meganucleases for recognition sequences

Also Published As

Publication number Publication date
CN101583711B (en) 2014-04-02
CN101583711A (en) 2009-11-18

Similar Documents

Publication Publication Date Title
US20100146651A1 (en) Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
EP2046950B1 (en) Meganuclease variants cleaving a DNA target sequence from a RAG1 gene and uses thereof
US20130061341A1 (en) Meganuclease variants cleaving a dna target sequence from a xp gene and uses thereof
US20100203031A1 (en) Method for enhancing the cleavage activity of i-crei derived meganucleases
US20140017731A1 (en) Meganuclease variants cleaving a dna target sequence from the human interleukin-2 receptor gamma chain gene and uses thereof
WO2009001159A1 (en) Method for enhancing the cleavage activity of i-crei derived meganucleases
WO2008102274A2 (en) Meganuclease variants cleaving a dna target sequence from the beta-2-microglobulin gene and uses thereof
AU2008263501A1 (en) Meganuclease variants cleaving a DNA target sequence from the mouse ROSA26 locus and uses thereof
EP2352821A1 (en) Meganuclease variants cleaving a dna target sequence from a glutamine synthetase gene and uses thereof
WO2008059317A1 (en) Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
JP2011504744A (en) I-MsoI homing endonuclease variant with novel substrate specificity and use thereof
WO2011021062A1 (en) Meganuclease variants cleaving a dna target sequence from the human lysosomal acid alpha-glucosidase gene and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 06847297

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06847297

Country of ref document: EP

Kind code of ref document: A1