WO2008098787A2

WO2008098787A2 - Cd83 as a molecular switch for the induction of regulatory (immunosuppressive) t-cells

Info

Publication number: WO2008098787A2
Application number: PCT/EP2008/001186
Authority: WO
Inventors: Wiebke Hansen; Jan Buer; Simone Reinwald
Original assignee: Helmholtz-Zentrum für Infektionsforschung GmbH
Priority date: 2007-02-16
Filing date: 2008-02-15
Publication date: 2008-08-21
Also published as: WO2008098787A3

Abstract

The present invention makes use of the role of the surface protein CD83 in the induction of regulatory T cells (Tregs). The present invention relates to means and methods for overexpressing CD83 as well as methods for identifying compounds that are interacting with the CD83 polypeptide, and to compounds capable of functioning as immunomodulators in mammals, in particular humans. In addition, the present invention relates to methods of treatment of a subject, in particular a human, suffering from an undesired immunoreaction. The transmembrane protein CD83 has been initially described as a maturation marker for dendritic cells (DCs). Moreover, there is increasing evidence that CD83 also regulates B cell function, thymic T cell maturation and peripheral T cell activation. Here, we show that CD83 expression confers immunosuppressive function to CD4+ T cells. CD83 mRNA is differentially expressed in naturally occurring CD4+CD25+ regulatory T (Treg) cells and upon activation these cells rapidly express large amounts of surface CD83. Transduction of naive CD4+CD25- T cells with CD83 encoding retroviruses induces a regulatory phenotype in vitro, which is accompanied by the induction of Foxp3. Functional analysis of CD83-transduced T cells in vivo demonstrates that these CD83+Foxp3+ T cells are able to interfere with the effector phase of severe contact hypersensitivity (CHS) reaction of the skin. Moreover, adoptive transfer of these cells prevents the paralysis associated with experimental autoimmune encephalomyelitis (EAE), suppresses pro-inflammatory cytokines IFN- and IL- 17 and increases anti-inflammatory IL-IO in recipient mice. Together, our data provides the first evidence that CD83 expression can contribute to the immunosuppressive function of CD4+ T cells in vivo.

Description

CD83 as a molecular switch for the induction of regulatory (immunosuppressive) T-cells

The present invention makes use of the role of the surface protein CD83 in the induction of regulatory T cells (Tregs). The present invention relates to means and methods for overexpressing CD83 as well as methods for identifying compounds that are interacting with the CD83 polypeptide, and to compounds capable of functioning as immunomodulators in mammals, in particular humans. In addition, the present invention relates to methods of treatment of a subject, in particular a human, suffering from an undesired immunoreaction.

BACKGROUND OF THE INVENTION

CD83 is a glycoprotein of the Ig-superfamiliy and so far known as a maturation marker on human dendritic cells (DCs) (Berchtold S, Muhl-Zurbes P, Heufler C, Winklehner P, Schuler G, Steinkasserer A. Cloning, recombinant expression and biochemical characterization of the murine CD83 molecule which is specifically upregulated during dendritic cell maturation. FEBS Lett. 1999 Nov 19;461(3):211-6.). The soluble form of CD83 is present at elevated levels in a number of hematological malignancies, and levels of the soluble forms of CD80, CD86, and CD83 are elevated in the synovial fluid of rheumatoid arthritis patients. The fact that CD83 is strongly upregulated together with co-stimulatory molecules such as CD80 and CD86 during DC maturation suggests it plays an important role in the induction of immune responses (Lechmann M, Zinser E, Golka A, Steinkasserer A.Role of CD83 in the immunomodulation of dendritic cells. Int Arch Allergy Immunol. 2002 Oct; 129(2): 113-8).

Tregs, which are also known as suppressor T cells, are a specialized subpopulation of T cells, which act to suppress activation of the immune system and thereby maintain the immune system homeostasis and tolerance to self. In order to function properly, the immune system must discriminate between self and non-self. In case the self/non-self discrimination fails, the immune system will destroy cells and tissues of the body and, as a result, will cause autoimmune diseases. Tregs actively suppress such activation of the immune system and therefore prevent the pathological self-reactivity, i.e. the autoimmune disease. Therefore, Tregs play a critical role within the immune system and the immunosuppressive potential of these cells could be harnessed therapeutically in order to treat autoimmune diseases and facilitate transplantation tolerance, or to specifically eliminate cancer cells and/or to potentiate cancer immunotherapy.

Similar to other T cells, Tregs are developed in the thymus. In addition, Tregs can be also generated in the periphery, however the underlying molecular mechanism is not known yet. In order to define Tregs, the expression of the two CD4 and CD25 cell surface molecules is used, and these cells are often referred to as CD4⁺CD25⁺ Tregs. However, the use of CD25 as a marker for Tregs is problematic, since CD25 is also expressed on non-regulatory T cells in cases of immune activation, such as, for example, during an immune response to a pathogen. As identified through CD4 and CD25 expression, Tregs comprise only about 5-10% of the mature CD4⁺ helper T cell subpopulation in mice and about 1-2% CD4⁺ helper T cells in humans.

In addition, CD4⁺CD25⁺ regulatory T cells have also been referred to as "naturally-occurring" Tregs in order to distinguish them from "suppressor" T cell populations that are generated in vitro. In fact, the "naturally-occurring" CD4⁺CD25⁺ regulatory T cell population is a subset of the total Foxp3 -expressing regulatory T cell population. The situation is further complicated by reports of additional "suppressor" T cell populations, including TrI, CD8⁺CD28^", and Qa-I restricted T cells. However the contribution of these populations to self-tolerance and immune homeostasis is less well defined. Recent evidence suggests that mast cells may be important mediators of Treg-dependent peripheral tolerance.

US 6,913,882 describes methods of screening for B cell activity modulators comprising: a) providing a B cell that expresses one or more expression profile genes selected from the group consisting of carb anh II, IgD, CD72, SATBl, ApoE, CD83, cyclin D2, Cctq, MEF-2C, TGIF, Aeg-2, lck, E2-20K, pcp-4, kappa V, neurogranin, NAB2, gfi-1 hIP-30, TRAP, bmk, CD36, Evi-2, vimetin, LyβE.l and c-fes; b) adding a drug candidate to the B cell; c) determining the expression level of at least one gene of the expression profile genes in the B cell; d) comparing the expression level of the at least one gene in the B cell with the expression level of the at least one gene in a control cell not contacted with the drug candidate to determine (i) whether expression of carb anh II, CD72, SATBl, ApoE, CD83, cyclin D2, Cctg, MEF-2C, TGIF, Aeg-2, lck, E2-20K, pcp-4, kappa V, neurogranin, NAB2 and/or gfi-1 is increased in the B cell relative to a control cell not contacted with the drug candidate, or (ii) whether expression of LyβE.l, vimentin. hIP-30, TRAP, bmk, CD36, Evi-2 and/or c-fes is decreased in the B cell relative to the control cell; and e) identifying the drug candidate as a potential modulator of B cell tolerance if the expression level of a gene listed in (i) is increased and/or the expression level of a gene listed in (ii) is decreased.

US 6,274,378 describes an in vitro method of producing mature CD83 positive dendritic cells from CD83 negative immature dendritic cells, said method comprising culturing the CD83 negative immature dendritic cells in the presence of a dendritic cell maturation factor for a time sufficient for said immature dendritic cells to mature and express characteristics of mature dendritic cells including an increase in CD83 expression which is stable for up to three days following removal of said dendritic cell maturation factor, wherein the dendritic cell maturation factor comprises IFN-a.

WO 97/29781 relates to methods and compositions (vaccines) for stimulating a humoral immune response in which a soluble form of CD83 is employed as an adjuvant together with a given antigen. Soluble forms comprise CD83 fusion protein and a soluble form consisting of amino acids 1 to 124, the extracellular domain of CD83. In addition to the use of CD83 as adjuvant for vaccine preparations, this document discusses the use of antagonists (antibodies) against CD83 for inhibiting undesirable antigen specific responses in mammals.

US 7,169,898 provides for the use of soluble forms of CD83 and nucleic acids encoding them for the treatment of diseases caused by the dysfunction or undesired function of a cellular immune response involving T cells. The invention moreover provides soluble CD83 molecules specifically suited for said purpose, antibodies against said specific soluble CD83 proteins and assay methods and kits comprising said antibodies. The invention is based on the finding that soluble CD83 proteins provide for an improved maturation of DCs and that their capacity for presenting antigens to T-cells is improved.

Luthje et al. (Luthje K, Cramer SO, Ehrlich S, Veit A, Steeg C, Fleischer B, Bonin A, Breloer M. Transgenic expression of a CD83-immunoglobulin fusion protein impairs the development of immune-competent CD4-positive T cells. Eur J Immunol. 2006 Aug;36(8):2035-45.) describe that the murine transmembrane glycoprotein CD83 is an important regulator for both thymic T cell maturation and peripheral T cell response. CD83 deficiency leads to a block in the thymic maturation of CD4-positive T cells, and interference with peripheral CD83/CD83 ligand interaction by addition of soluble CD83 suppresses immune responses in vivo and in vitro. They suggest that thymic selection in the presence of a specific CD83-fusion protein (CD83Ig) leads to an intrinsic T cell defect of CD4-positive T cells resembling the phenotype described for CD4-positive T cells derived from CD83-deficient mouse strains.

Breloer et al. (Breloer M, Kretschmer B, Luthje K, Ehrlich S, Ritter U, Bickert T, Steeg C, Fillatreau S, Hoehlig K, Lampropoulou V, Fleischer B CD83 is a regulator of murine B cell function in vivo. Eur J Immunol. 2007 Feb 1) describe that several lines of evidence suggest that CD83 regulates thymic T cell maturation as well as peripheral T cell activation. They further show that CD83 is involved also in the regulation of B cell function.

As mentioned above, Tregs have an immunosuppressive potential which could be harnessed therapeutically. Therefore, the induction or expansion of Tregs for the treatment of autoimmune diseases or other undesired immunoreactions has been an aspect of immunological research in the last years.

US Patent application 2006-0002932 describes a method of enhancing an immune response in a subject, comprising administering to the subject a reagent that targets a cell having immunosuppressive activity, in an amount effective in reducing the immunosuppressive activity of the cell, thereby enhancing an immune response in the subject.

The methods for the induction of Tregs as described above require the knowledge of the antigen against which the immune response is directed. However, this knowledge is not available for most of the autoimmune diseases. In addition, the exact underlying molecular mechanism for the induction and expansion, respectively, of Tregs is not yet clarified. The in vitro induction of Tregs through treatment with different cytokines leads to the development of Tregs having a broad antigenic spectrum. In addition, in this approach the cells have to be removed from the subject and have to be cultivated and treated ex vivo, leading to problems which are due to the in vitro culture.

Thus, there is a need in the art to provide a target suitable to be used in order to identify compounds which could be effectively used for the induction of Tregs, whereby a knowledge regarding the specific antigen(s) would not be required. It was found during experiments in the context of the present invention that CD83 overexpressing T cells displayed a reduced proliferative capacity, a reduced IL-2 secretion and a suppressive effect in vitro and in a contact hypersensitivity mouse model in vivo. These data suggest that CD83 besides its function as an additional marker molecule for the identification of Tregs is also involved in the suppressive function of Tregs in vitro and in vivo. Thus, the present inventors were able to show that CD83 plays a crucial role in the generation of Tregs. Further, the activation or overexpression or inactivation of CD83 seems to be an essential step for the induction or suppression for the development of Tregs.

In view of the above, it is an object of the present invention to provide means and methods for overexpressing CD83 as well as methods for identifying compounds interacting with the CD83 polypeptide and for compounds capable to function as immunomodulators in mammals, and in particular in humans. In addition, it is an further object of the present invention to provide methods of treatment of a human suffering from an undesired immunoreaction.

SUMMARY OF THE INVENTION

The object of the present invention, in one preferred embodiment thereof, is solved by a method for identifying a compound capable of interacting with a CD83 polypeptide, comprising the steps of a) contacting said CD83 polypeptide or a functional fragment thereof or a host cell recombinantly expressing said CD83 polypeptide or a functional fragment thereof with a candidate compound, and b) determining whether said candidate compound interacts with said CD83 polypeptide.

The object of the present invention, in further preferred embodiment thereof, is solved by compound capable of interacting with the CD83 polypeptide, identified through a method according to the present invention.

In an additional embodiment of the present invention a method for identifying a compound capable to function as an immunomodulator is provided, comprising the steps of a) contacting a cell expressing a CD83 polypeptide or a functional fragment thereof with a candidate compound, in particular a candidate compound as defined above, and b) detecting a response of said cell compared to a control response as detected in the absence of said candidate compound, wherein said response indicates that said candidate compound is capable of functioning as an immunomodulator.

In another preferred embodiment of said method according to the invention, said host cell recombinantly expresses said CD83 polypeptide or a functional fragment thereof, hi another preferred embodiment of said method according to the invention, said response of said cell is a change in expression of said CD83 polypeptide or a change of the biological activity of CD83.

In yet another preferred embodiment, the present invention provides an immunomodulator as identified through a method according to the present invention as above. Preferably, said immunomodulator is selected from a nucleic acid expressing or overexpressing CD83 polypeptide or a functional fragment thereof, in particular an expression vector.

In a further preferred embodiment thereof, the present invention provides a method for identifying a compound capable of converting conventional T-cells into regulatory T-cells, comprising the steps of a) contacting conventional T-cells with a candidate compound, in particular with a candidate compound according to the present invention as above, b) detecting the level of conversion of conventional T-cells into regulatory T-cells, and c) comparing said level of conversion to a control level of conversion as detected in the absence of said candidate compound, wherein the altered conversion into regulatory T-cells indicates that the candidate compound is capable of converting conventional T-cells into regulatory T-cells.

In another preferred embodiment of said method according to the invention, said host cell recombinantly expresses said CD83 polypeptide or a functional fragment thereof.

In another preferred embodiment thereof, the present invention provides an immunomodulator as identified through a method according to the present invention. In a further embodiment thereof, the present invention provides a pharmaceutical composition, comprising an effective amount of an immunomodulator according to the present invention as defined above, or a host cell recombinantly expressing a CD83 polypeptide or a functional fragment thereof, together with a pharmaceutically acceptable carrier.

In a further preferred embodiment thereof, the present invention provides a method of treatment of a human suffering from an undesired immunoreaction, comprising administering to said human an effective amount of a pharmaceutical composition according to the present invention.

In a further embodiment the present invention concerns a method of treatment of a human suffering from an autoimmune disease, allergy and/or a transplant rejection, comprising the steps of a) culturing peripheral blood cells of said human comprising conventional T-cells, b) converting said conventional T-cells in vitro into regulatory T-cells by overexpression of a CD83 polypeptide in said conventional T-cells or by contacting said T-cells with an immunomodulator according to the present invention, and c) re-introducing said converted regulatory T-cells into a human.

DETAILED DESCRIPTION OF THE INVENTION

Before the present invention is described in more detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

As outlined above, the present invention is based on the findings about the role of CD83 for the induction of Tregs. The present inventors have shown that overexpression of CD83 in conventional T cells results in the conversion of these conventional T cells into Tregs Therefore, according to a first aspect of the present invention, provided is a method for identifying a compound capable of interacting with a CD83 polypeptide, comprising the steps of a) contacting said CD83 polypeptide or a functional fragment thereof or a host cell recombinantly expressing said CD83 polypeptide or a functional fragment thereof with a candidate compound, and b) determining whether said candidate compound interacts with said CD83 polypeptide.. Preferably, said method according to the present invention further comprises the step of c) selecting those candidate compounds that interact with said CD83 polypeptide or a functional fragment thereof.

In the context of the present invention, "CD83 peptides" shall mean the mammalian, preferably human CD83 (database entry CAG33300) isoforms a (NP_004224) or b (NP_001035370) as described in the databases and by, for example, by Zhou et al. (Zhou,L.J., Schwarting, R., Smith, H.M. and Tedder, T. F. A novel cell-surface molecule expressed by human interdigitating reticulum cells, Langerhans cells, and activated lymphocytes is a new member of the Ig superfamily, J. Immunol. 149 (2), 735-742 (1992)).

The term "functional fragment" of the CD83 polypeptide, in accordance with the present invention, shall mean a peptide, a protein, or a polypeptide which encompasses amino acid chains of a given length and which still exhibits essentially the same biological activity as the mature CD83 membrane protein. Preferably the polypeptide provides at least 20% (e.g., at least: 20%; 30%; 40%; 50%; 60%; 70%; 80%; 90%; 95%; 98%; 99%; 99.5%; or 100% or even more) of the biological activity of the full-length CD83 membrane protein. A fragment within the meaning of the present invention as above refers to one of the GPCR proteins bearing at least one N-terminal, C-terminal and/or internal deletion. The resulting fragment has a length of at least about 50, preferably of at least about 100, more preferably of at least about 150, more preferably of at least about 200, more preferably of at least about 250, more preferably of at least about 300, more preferably of at least about 350 and most preferably of at least about 400 amino acids. The same applies to the different isoforms of CD83.

The polypeptides useable in the method of the invention include all those as disclosed herein and functional fragments of these polypeptides. The terms "polypeptide" and "protein" are used interchangeably and mean any peptide-linked chain of amino acids, regardless of posttranslational modification. The polypeptides can also include fusion proteins that contain either a full-length CD83 polypeptide or a functional fragment of it, fused to an unrelated amino acid sequence. The unrelated sequences can add further functional domains or signal peptides. The same applies to the different isoforms of CD83.

The CD83 of the invention and its gene or cDNA can be used in screening assays for identification of compounds that modulate its activity and/or expression, and which may therefore be potential drugs. As above, useful proteins include wild-type and polymorphic

CD83s or fragments thereof in a recombinant form or endogenously expressed. Drug screens to identify compounds acting on a normally occurring or an exogenously expressed CD83 may employ any functional feature of the protein, hi addition, drug screening assays may be based upon the ability of the protein to transduce a signal across a membrane (directly or indirectly) or upon the ability to activate another molecule.

Methods for identifying compounds (e.g., agonists or antagonists) using the CD83 polypeptides, and for treating conditions associated with the CD83 polypeptides, polynucleotides, or identified compounds are extensively described and can be derived from the state of the art as cited above, e.g., US 6,913,882, herewith incorporated by reference, and can be suitably modified in order to be used for the present invention.

Drug screening assays can also be based upon the ability of the CD83 to interact with other proteins. Such interacting proteins can be identified by a variety of methods known in the art, including, for example, radioimmunoprecipitation, co-immunoprecipitation, co-purification, and yeast two-hybrid screening. Such interactions can be further assayed by means including but not limited to fluorescence polarization or scintillation proximity methods. Drug screens can also be based upon putative functions of a CD83 polypeptide deduced from structure determination (e.g., by x-ray crystallography) of the protein and comparison of its 3-D structure to that of proteins with known functions. Molecular modeling of compounds that bind to the protein using a 3-D structure may also be used to determine drug candidates. Drug screens can be based upon a function or feature apparent upon creation of a transgenic or knock-out mouse, or upon overexpression of the protein or protein fragment in mammalian cells in vitro. Moreover, expression of the CD83 in yeast or C. elegans allows for screening of candidate compounds in wild-type and polymorphic backgrounds, as well as screens for polymorphisms that enhance or suppress the CD83-dependent phenotype. Modifier screens can also be performed in a CD83 transgenic or knock-out mouse. Assays of CD83 activity include binding to interacting proteins. Furthermore, assays may be based upon the molecular dynamics of macromolecules, metabolites, and ions by means of fluorescent-protein biosensors. Alternatively, the effect of candidate modulators on expression or activity may be measured at the level of CD83 production using the same general approach in combination with standard immunological detection techniques, such as western blotting or immunoprecipitation with a CD83 polypeptide-specific antibody. Again, useful modulators are identified as those that produce a change in CD83 polypeptide production. Modulators may also affect CD83 activity without any effect on expression level.

The test/candidate compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the One-bead one-compound' library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad Sci. USA. 90:6909; Erb et al. (1994) Proc.

Natl. Acad Sci. USA 91 :11422; Zuckermann et al. (1994) J. Med. Chem. 37:2678; Cho et al.

(1993) Science 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J Med. Chem.

37:1233. Libraries of compounds may be presented in solution (e.g, Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993)

Nature 364:555-556), bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No.

409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390); (Devlin (1990) Science 249:404-406); (Cwirla et al.

(1990) Proc. Natl. Acad. Sci. 87:6378-6382); (Felici (1991) J. MoI. Biol. 222:301-310).

Specific binding molecules, including natural ligands and synthetic compounds, can be identified or developed using isolated or recombinant CD83 products, CD83 variants, or preferably, cells expressing such products as above. Binding partners are useful for purifying CD83 products and detection or quantification of CD83 products in fluid and tissue samples using known immunological procedures. Binding molecules are also manifestly useful in modulating (i.e., blocking, inhibiting or stimulating) biological activities of a CD83 polypeptide, especially those activities involved in signal transduction (directly or indirectly). The DNA and amino acid sequence information provided by the present invention also makes possible identification of binding partner compounds with which a CD83 polypeptide or polynucleotide will interact. Methods to identify binding partner compounds include solution assays, in vitro assays wherein CD83 polypeptides are immobilized, and cell-based assays. Identification of binding partner compounds of CD83 polypeptides provides candidates for therapeutic or prophylactic intervention in pathologies associated with CD83 normal and aberrant biological activity.

As stated above, in a further aspect the present invention provides a method of isolating compounds interacting with a protein of the present invention comprising the steps of: a) contacting one or more of the CD83 proteins of the present invention, preferably one, with at least one potentially interacting compound, and b) measuring binding of said compound to said protein. This method is suitable for the determination of compounds that can interact with the proteins of the present invention and to identify, for example, inhibitors, activators, competitors or modulators of proteins of the present invention, in particular inhibitors, activators, competitors or modulators of the enzymatic activity of the proteins of the present invention.

The potentially interacting substance, whose binding to the protein of the present invention is to be measured, can be any chemical substance or any mixture thereof. For example, it can be a substance of a peptide library, a combinatory library, a cell extract, in particular a plant cell extract, a "small molecular drug", a protein and/or a protein fragment as described herein.

The term "contacting" in the present invention means any interaction between the potentially binding substance(s) with the proteins of the invention, whereby any of the two components can be independently of each other in a liquid phase, for example in solution, or in suspension or can be bound to a solid phase, for example, in the form of an essentially planar surface or in the form of particles, pearls or the like. In a preferred embodiment a multitude of different potentially binding substances are immobilized on a solid surface like, for example, on a compound library chip and the protein of the present invention is subsequently contacted with such a chip. In another preferred embodiment the host cells recombinantly expressing the CD83 polypeptide or a functional fragment thereof, express the CD83 peptide on the cell surface and are contacted separately in small containers, e. g., micro titre plates, with various compounds. The same is achieved using the different iso forms of CD83.

The proteins of the present invention employed in a method of the present invention can be a full length protein or a fragments thereof with N/C-terminal and/or internal deletions as described above.

Measuring of binding of the compound to the protein can be carried out either by measuring a marker that can be attached either to the protein or to the potentially interacting compound.

Suitable markers are known to someone of skill in the art and comprise, for example, fluorescence or radioactive markers. The binding of the two components can, however, also be measured by the change of an electrochemical parameter of the binding compound or of the protein, e.g. a change of the redox properties of either the protein or the binding compound, upon binding. Suitable methods of detecting such changes comprise, for example, potentiometric methods. Further methods for detecting and/or measuring the binding of the two components to each other are known in the art, e.g. as described above, and can also be used to measure the binding of the potential interacting compound to the protein or protein fragments of the present invention. The effect of the binding of the compound or the activity of the protein can also be measured indirectly, for example, by assaying the activity of the protein after binding.

As a further step after measuring the binding of a potentially interacting compound and after having measured at least two different potentially interacting compounds at least one compound can be selected, for example, on grounds of the measured binding activity or on grounds of the detected increase or decrease of protein activity, upon binding.

The thus selected binding compound is then, in a preferred embodiment, modified in a further step. Modification can be effected by a variety of methods known in the art, which include without limitation the introduction of novel side chains or the exchange of functional groups like, for example, introduction of halogens, in particular F, Cl or Br, the introduction of lower alkyl groups, preferably having one to five carbon atoms like, for example, methyl, ethyl, n- propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl or iso-pentyl groups, lower alkenyl groups, preferably having two to five carbon atoms, lower alkynyl groups, preferably having two to five carbon atoms or through the introduction of, for example, a group selected from the group consisting of NH₂, NO₂, OH, SH, NH, CN, aryl, heteroaryl, COH or COOH group.

The thus modified binding substances are than individually tested with the method of the present invention, i.e. they are contacted with the protein and subsequently binding of the modified compounds to the protein is measured. In this step both the binding per se can be measured and/or the effect of the function of the protein like. If needed the steps of selecting the binding compound, modifying the binding compound, contacting the binding compound with a protein of the invention and measuring the binding of the modified compounds to the protein can be repeated a third or any given number of times as required. The above described method is also termed "directed evolution" since it involves a multitude of steps including modification and selection, whereby binding compounds are selected in an "evolutionary" process optimizing its capabilities with respect to a particular property, e.g. its binding activity, its ability to activate, inhibit or modulate the activity of the CD83 according to the present invention.

The binding and/or interacting of candidate compounds may also be identified using yeast- two-hybrid systems.

The assays according to the present invention in general may be designed to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). The screening methods according to the present invention can be easily designed by the person skilled in the art on the basis of methods as described here, and the extensive literature in the field of screening. For instance, the activity of the polypeptide described herein can be assessed using a variety of in vitro and in vivo assays to determine functional, chemical, and physical effects, e.g., measuring ligand binding, secondary messengers (e.g., cAMP, cGMP, IP₃, DAG, or Ca²⁺) ion flux, phosphorylation levels, transcription levels, of reporter constructs, and the like.

Samples or assays that are treated with a potential receptor agonist may be compared to control samples without the test compound (agonist or antagonist), to examine the extent of modulation. Control samples (treated with agonists only) are assigned a relative activity value of 100. Inhibition of protein activity is achieved when the protein activity value relative to the control is lower, and conversely receptor activity is enhanced when activity relative to the control is higher in the presence of identical amounts of the respective agonist.

The effects of the immunomodulator upon the function of the protein can be measured by examining any of the parameters described above. Any suitable physiological change that affects CD83 activity and/or expression can be used to assess the influence of a test compound on the proteins of this invention. When the functional consequences are determined using intact cells or animals, one can measure a variety of effects such as changes in intracellular secondary messengers such as Ca²⁺, IP₃ or cAMP.

Activation of cells typically initiates subsequent intracellular events, e.g. increases in second messengers such as IP₃, which releases intracellular stores of calcium ions. Thus, a change in cytoplasmic calcium ion levels, or a change in second messenger levels such as IP₃ can be used to assess protein function.

As used herein, "conventional T-cells" include cells defined by the presence of the cell surface marker CD4 and the absence of the surface marker CD25, as well as any other T-cells and/or cells that could be converted into Tregs.

In a third aspect the present invention provides a method for identifying a compound capable of functioning as an immunomodulator, comprising the steps of a) contacting a cell expressing a CD83 polypeptide or a functional fragment thereof with a candidate compound, in particular a candidate compound as defined above, and b) detecting a response of said cell compared to a control response as detected in the absence of said candidate compound, wherein said response indicates that said candidate compound is capable of functioning as an immunomodulator.

In another preferred embodiment of said method according to the invention, said host cell recombinantly expresses said CD83 polypeptide or a functional fragment thereof. In another preferred embodiment of said method according to the invention, said response of said cell is a change in expression of said CD83 polypeptide or a change of the biological activity of CD83.

As used herein, the term "response" shall mean the activation and/or inactivation of CD83. Such activation or inactivation of CD83 can be detected by measuring any changes of the biological activity and/or expression of CD83. Methods for measuring the biological activity of CD83 in vivo or in vitro are commonly known in the art and in addition, are described above and below.

In another important aspect thereof, the present invention provides a compound capable of interacting with the CD83 polypeptide, identified through a method according to the present invention as above. The compound identified according to the present invention can serve as a lead compound in order to further develop compounds that are capable of functioning as immunomodulators, or can directly be used as a compound capable of functioning as an immunomodulator.

As used herein, the term "immunomodulator" comprises a substance, a compound or a composition which is of chemical or biological origin, and which has an influence on the induction or conversion of Tregs. Such influence on the induction or conversion of Tregs is based on the ability of the immunomodulator, to bind and/or to interact with the CD83 according to the present invention. The binding and/or interacting of the immunomodulator with the CD83 results in a change of the biological activity and/or the expression of CD83, leading to the induction or suppression of an immunoreaction. Thus, an immunomodulator according to the present invention comprises inducers or suppressors of an immunoreaction. An immunomodulator which functions as an inducer of an immunoreaction activates CD83, which finally results in the induction of Tregs during an ongoing immunoreaction. An immunomodulator which functions as a suppressor of an immunoreaction blocks the activity and/or expression of CD83, which finally results in little or no induction/production of Tregs during an ongoing immunoreaction and thus leads to a decrease of an undesired suppression of an immunoreaction.

An "immunomodulator" according to the present invention is a substance, a compound or a composition which is of chemical or biological origin, and which naturally occurs and/or which is synthetically, recombinantly and/or chemically produced. Thus, an immunomodulator may be a protein, a protein-fragment, a peptide, an amino acid and/or derivatives thereof or other compounds, such as ions, which bind to and/or interact with the mature CD83 as identified according to the present invention. Preferably, said immunomodulator is selected from a nucleic acid expressing or overexpressing CD83 polypeptide or a functional fragment thereof, in particular an expression vector.

In a preferred embodiment of the method according to present invention, an immunomodulator comprises compounds selected from inducers or suppressors of an immunoreaction. An immunomodulator which functions as an inducer of an immunoreaction activates the CD83 (for example through increasing the expression thereof) which finally results in an induction of Tregs during an ongoing immunoreaction. An immunomodulator which functions as a suppressor of an immunoreaction blocks the CD83 activity leading to a decrease of an undesired suppression of an immunoreaction, since Tregs will not be produced.

In another aspect thereof, the present invention provides a host cell that recombinantly expresses the CD83 polypeptide or an isoform or a functional fragment thereof. The host cells that may be used for purposes of the invention include, but are not limited to, prokaryotic cells, such as bacteria (for example, E. coli and B. subtilis), which can be transformed with, for example, recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing the polynucleotide molecules encoding the CD83 polypeptide or said isoform or a functional fragment thereof; eukaryotic cells like yeast (for example, Saccharomyces and Pichiά), which can be transformed with, for example, recombinant yeast expression vectors containing the nucleic acid molecule encoding the CD83 polypeptide or isoform or a functional fragment thereof; insect cell systems like, for example, Sf9 of Hi5 cells, which can be infected with, for example, recombinant virus expression vectors (for example, baculovirus) containing the nucleic acid molecules encoding the CD83 polypeptide or isoform or a functional fragment thereof; Xenopus oocytes, which can be injected with, for example, plasmids; plant cell systems, which can be infected with, for example, recombinant virus expression vectors (for example, cauliflower mosaic virus (CaMV) or tobacco mosaic virus (TMV)) or transformed with recombinant plasmid expression vectors containing a nucleic acid sequence encoding the CD83 polypeptide or isoform or a functional fragment thereof; or mammalian cell systems (for example, COS, CHO, BHK, HEK293, VERO, Jurkat, HeLa, MDCK, Wi38, and NIH 3T3 cells), which can be transformed with recombinant expression constructs containing, for example, promoters derived, for example, from the genome of mammalian cells (for example, the metallothionein promoter) from mammalian viruses (for example, the adenovirus late promoter and the vaccinia virus 7.5K promoter) or from bacterial cells (for example, the tet-repressor binding its employed in the tet-on and tet- off systems). Also useful as host cells are primary or secondary cells obtained directly from a mammal and transfected with a plasmid vector or infected with a viral vector. Depending on the host cell and the respective vector used to introduce the nucleic acid of the invention the nucleic acid can integrate, for example, into the chromosome or the mitochondrial DNA or can be maintained extrachromosomally like, for example, episomally or can be only transiently comprised in the cells.

In a preferred embodiment, the CD83 polypeptide as expressed by such cells is functional and has the expected CD83 activity, i.e., upon binding to one or more molecules triggers an activation pathway inside the (T-)cell. The same applies to the different isoforms of CD83. The cells are preferably mammalian (e.g., human, non-human primate, equine, bovine, sheep, pig, dog, cat, goat, rabbit, mouse, rat, guinea pig, hamster, or gerbil) cells, insect cells, bacterial cells, or fungal (including yeast) cells.

In a further aspect the present invention concerns a pharmaceutical composition, comprising an effective amount of an immunomodulator according to the present invention as defined above, or a host cell recombinantly expressing a CD83 polypeptide or a functional fragment thereof, together with a pharmaceutically acceptable carrier.

Polypeptides and fragments of the polypeptides useable in the method of the present invention can be modified, for example, for in vivo use by the addition of blocking agents, at the amino- and/or carboxyl-terminal ends, to facilitate survival of the relevant polypeptide in vivo. This can be useful in those situations in which the peptide termini tend to be degraded by proteases prior to cellular uptake. Such blocking agents can include, without limitation, additional related or unrelated peptide sequences that can be attached to the amino and/or carboxyl terminal residues of the peptide to be administered. This can be done either chemically during the synthesis of the peptide or by recombinant DNA technology by methods familiar to artisans of average skill.

The production of pharmaceutical compositions, e.g. in form of medicaments with an effective amount of an immunomodulator according to the present invention as defined above, or a host cell recombinantly expressing a CD83 polypeptide or a functional fragment thereof (in the following designated as "active ingredients") and their uses according to the present invention generally occurs in accordance with standard pharmaceutical technology and methods. For this, the active ingredients, together with pharmaceutical acceptable carriers and/or other suitable pharmaceutical auxiliary agents, are produced into medical forms that are suitable for the different indications, and places of administration.

Thereby, pharmaceutical compositions can be produced having a release rate as desired, e.g. wherein a quick onset and/or a retard- or depot-effect is achieved. Thereby, the pharmaceutical compositions can be an ointment, gel, patch, emulsion, lotion, foam, creme or mixed-phase or amphiphilic emulsion systems (oil/water-water/oil-mix-phase), liposome, transfersome, paste or powder.

According to the present invention, the term "auxiliary agent" shall mean any, non-toxic, solid or liquid filling, diluting or packaging material, as long as it does not adversely react and/or interacts with the active ingredients or the patient. Liquid galenical auxiliary agents, for example, are sterile water, physiological saline, sugar solutions, ethanol and/or oils. Galenical auxiliary agents for the production of tablets and capsules, for example, can contain binders and filling materials.

Furthermore, the active ingredients according to the invention can be used in the form of systemically employed medicaments. These include parenterals belonging to which are injectables and infusions. Iηjectables are either present in the form of ampoules or as so-called ready-to-use injectables, e.g. as ready-to-use syringes or disposable syringes, and, in addition, are provided in puncture-sealed bottles. The administration of the injectables can take place in form of subcutaneous (s.c), intramuscular (i.m.), intravenous (i.v.) or intracutaneous (i.e.) application. In particular the suitable forms for injection can pe produced as crystal suspensions, solutions, nanoparticular or colloidal-disperse systems, such as, for example, hydrosoles.

The injectable compositions can further be produced as concentrates that are dissolved or dispersed with aqueous isotonic diluents. The infusions can also be prepared in form of isotonic solutions, fatty emulsions, liposome compositions, micro emulsions. Like the injectables, also infusion compositions can be prepared in form of concentrates for dilution. The injectable compositions can also be applied in form of continuous infusions, both in the stationary as well as in the ambulant therapy, e.g. in form of mini pumps.

The active ingredients according to the invention can be bound to a micro carrier or nanoparticle, for example to finely dispersed particles on the basis of poly(meth)acrylates, polylactates, polyglycolates, polyaminoacids or polyetherurethanes. The parenteral compositions can also be modified into a depot preparation, e.g. based on the "multiple unit principle", if an active ingredient according to the invention is embedded in finely divided or dispersed, suspended form or as crystal suspension, or based on the "single unit principle", if an active ingredient according to the invention is included in a medicinal form, e.g. in a tablet or a stick that is subsequently implanted. Often, these implants or depot medicaments in the case of ,,single unit"- and ,,multiple unif'-medicaments consist of so-called biodegradable polymers, such as, for example polyesters of lactic and glycolic acid, polyether urethanes, polyaminoacids, poly(meth)acrylates or polysaccharides.

As suitable auxiliary agents for producing of parenterals, aqua sterilisata, substances influencing the value of the pH, such as, for example, organic and inorganic acids and bases as well as their salts, buffer substances for adjusting the value of the pH, isotoning agent, such as, for example, sodium chloride, sodium hydrogen carbonate, glucose and fructose, tensides or surface active substances and emulgators, such as, for example, partial fatty acid esters of polyoxyethylene sorbitane (Tween®) or, for example, fatty acid esters of polyoxyethylene (Cremophor®), fatty oils, such as, for example, peanut oil, soy bean oil, and castor oil, synthetic fatty acid esters, such as, for example, ethyloleate, isopropylmyristate and neutral oil (Miglyol®), as well as polymeric auxiliary agents, such as, for example, gelatine, dextran, polyvinylpyrrolidone, solubility enhancing additives, organic solvents, such as, for example, propyleneglycol, ethanol, N,N-dimethylacetamide, propylenglycole or complex-forming substances, such as, for example, citrate and urea, preservatives, such as, for example, benzoic acid hydroxypropylesters and -methylesters, benzylalcohol, antioxidants, such as, for example, sodiumsulfite and stabilisators, such as, for example, EDTA, can be considered.

In suspensions, the addition of thickening agents in order to avoid the setting of the an active ingredient according to the invention, or the addition of tensides, in order to ensure the admixing of the sediment, or of complex forming agents such as, for example, EDTA is possible. Active ingredient complexes can be achieved with different polymers, such as, for example, polyethylene glycoles, polystyrenes, carboxymethyl cellulose, Pluronics® or polyethylene glycolsorbite fatty acid esters. For producing lyophilisates, scaffold forming agents, such as, for example, mannit, dextran, sucrose, human albumin, lactose, PVP or gelatine are used.

The medical forms that are each suitable can be produced in accordance with manuals and procedures known to the person of skill on the basis of pharmaceutical/physical technologies.

A further aspect of the present invention then relates to the respectively produced pharmaceutical composition, comprising an effective amount of an immunomodulator according to the present invention as defined above, or a host cell recombinantly expressing a CD83 polypeptide or a functional fragment thereof, together with a pharmaceutically acceptable carrier. This pharmaceutical composition can be characterized in that the active ingredient is present in form of a depot substance or as precursor together with a suitable, pharmaceutically acceptable diluent or carrier substance as above.

According to the present invention, the above pharmaceutical composition can be present in the form of tablets, dragees, capsules, droplets, suppositories, compositions for injection or infusion for peroral, rectal or parenteral use. Such administration forms and their production are known to the person of skill.

In a further important aspect the present invention relates to a method of treatment of a human suffering from an undesired immunoreaction, comprising administering to said human an effective amount of a pharmaceutical composition according to the present invention. An undesired immunoreaction in a human according to the present invention comprises any reaction of the immune system, wherein the homeostasis of the immune system is not maintained. Undesired immunoreactions are for instance any auto-immune diseases such as diabetes type I, rheumatoid arthritis, and Crohn's disease. Further undesired immunoreaction are any forms of allergy or asthma but also any adverse transplant reactions. Further undesired immunoreactions are the undesired suppression of the immune reaction against tumor cells and/or any infections.

Pharmaceutical compositions are generally administered in an amount that is effective for the treatment or prophylaxis of a specific condition or conditions. The initial dose in a human is accompanied by a clinical monitoring of the symptoms, that is, the symptoms of the selected condition.

The suitable and effective dose can be presented as a single dose or as divided doses, in suitable intervals, for example, as two, three, four or more subdoses per day. Suitable dosages can readily be obtained by the person of skill through routine experimentation, and can be based on factors, such as, for example, the concentration of the active drug, the body weight and age of the patient, and other patient- or active drug-related factors.

In another aspect thereof, the present invention relates to a method of treatment of a human suffering from an autoimmune disease, allergy and/or a transplant rejection, comprising the steps of a) culturing peripheral blood cells of said human comprising conventional T-cells, b) converting said conventional T-cells in vitro into regulatory T-cells by overexpression of a CD83 polypeptide in said conventional T-cells or by contacting said T-cells with an immunomodulator according to the present invention, and c) re-introducing said converted regulatory T-cells into a human.

Methods for converting T-cells are known to the person of skill and can, for example, performed similarly to the expansion of bone marrow cells (CD34+) for transplantation. For an overexpression of CD83, in addition to retroviral gene transfer, the commercially available nucleofector technology (Amaxa, Germany) could be used.

The converted regulatory T-cells that are re-introduced can be autologous or allogeneic. If desired, treatment with a modulator of CD83 of the invention may be combined with any other suitable therapy, preferably immune-related therapy, as is known to the person of skill.

The invention shall now be described further in the following examples with respect to the accompanying drawings, without being limited thereto. For the purposes of the present invention, all references as cited herein are incorporated by reference in their entireties.

Figure 1 shows realtime RT-PCR analysis for CD83 expression. cDNA of CD4⁺CD25^* and CD4⁺CD25⁺ T cells from BALB/c, 6.5⁺CD4⁺CD25^" and 6.5⁺CD4⁺CD25⁺ T cells from TCR- HA and TCR-HA x IgHA and 16h and 3days activated 6.5⁺CD4⁺CD25^" TCR-HA cells were used for quantitative Realtime RT-PCR of CD83. RPS9 served as housekeeping gene. Mean values from at least 2 different experiments are shown. T_N = naϊve T cell, T_R = regulatory T- cells.

Figure 2 shows polyclonal inhibition assays of CD83 overexpressing CD4⁺ T cells. CD83- or empty vector overexpressing cells (1 x 10⁵) and CD4⁺CD25^" or CD4⁺CD25⁺ BALB/c T cells were incubated with irradiated APCs (4 x 10⁵) plus CD3 stimulus (1 μg/ml) and CD4⁺CD25^" responder cells (1 x 10⁵) for 72 hours. Proliferation was determined by ³[H] thymidine incorporation during the last 8 hours of culture. The results are representative out of 4 independent experiments.

Figure 3 shows the realtime RT- PCR analysis of CD83 overexpressing cells. Realtime RT- PCR anaysis for Nrpl, IL-IO, TGF-/3, Foxp3, IL-21, CD83, Integrin αE/37, CTLA-4 was performed using reverse transcribed RNA isolated from sorted CD83- or control vector transduced CD4⁺CD25^" T cells 5 days after infection. Expression levels of CD83 transduced T cells were normalized for each gene analyzed with respect to expression levels in control virus transduced cells. RPS9 mRNA expression served as housekeeping gene control. Mean values from at least two independent experiments are shown.

Figure 4 shows CD83 Realtime RT-PCR. cDNA of sorted CD4⁺CD25⁺ and CD4⁺CD25^" T cells isolated of BALB/c or OTII mice was used for Realtime RT-PCR. CD83 expression levels were normalized with respect to RPS9 expression. Results are representative of at least 2 individual experiments. Figure 5 shows an OVA-specific proliferation and inhibition assay. CD83 or empty vector transduced OTII T cells (1 x 10⁵) or freshly isolated CD4⁺CD25⁺ or CD4⁺CD25^" OTII T cells were incubated with irradiated bone marrow derived DCs (ratio 1 :5) and 5μg/ml OVA- peptide in the presence of irradiated APCs (4 x 10⁵) for 72 hours (a). For inhibition assay, CD4⁺CD25^" OTII responder T cells (1 x 10⁵) were added to the culture (b). Proliferation was determined by ³[H] thymidine incorporation during the last 8 hours of culture. Results are shown as mean values of triplicates of at least 2 individual experiments.

Figure 6 shows intracellular Foxp3 expression of CD83- and GFP transduced CD4⁺ T cells and CD4⁺CD25^" or CD4⁺CD25⁺ T cells. CD4⁺CD25^" T cells isolated from BALB/c mice were transduced with retroviral CD83 encoding or control retrovirus and cell sorted after 5 days, CD4⁺CD25^" and CD4⁺CD25⁺ T cells were freshly isolated from BALB/c mice and cell sorted. Cells were permeabilized, stained with the Foxp3 staining kit (eBioscience) and analyzed by FACS.

Figure 7 shows the DNFB mediated contact hypersensitivity as in vivo model. Mice in groups of 5 animals were shaved on the back and sensitized with DNFB (day 0). On day 4, CD83 or empty vector transduced T cells or non- infected T cells (CD4⁺CD25^~) were injected i.v. at a cell number of 1 x 10⁶ per mouse. One day later the animals were challenged with a smaller dose of DNFB on the right ear. On day 7 the ear swelling is measured and compared to the untreated ear. Ear swelling was evaluated at day 7 and is expressed as difference between the challenged right ear and the unchallenged left ear. As negative control, mice were not sensitized and challenged without injecting any cells. The results are shown as mean values out of 3 independent experiments.

Figure 8 shows that isolated Treg cells of different origin expressed up to 11 -fold higher levels of CD83 mRNA that naive T cells. CD4⁺CD25⁺ Treg cells express high levels of CD83 mPvNA and upon inactivation Treg cells express surface CD83 with greater magnitude and faster kinetic than CD4⁺CD25^" T cells.

Figure 9 shows that exclusive up-regulation of CD83 is only observed in human Treg cells. EXAMPLES

Mice

BALB/c mice were obtained from Harlan (Borchen, Germany). TCR-HA transgenic mice expressing a T-cell receptor (TCR)-otβ specific for the peptide 110-120 from influenza hemagglutinin (HA) presented by I-E^d have been described previously (Kirberg et al., 1994). OTII mice express the TCR-cqS that pairs with the CD4 coreceptor and is specific for chicken ovalbumin 323-339 in the context of I-A^b (Barnden et al., 1998). Ig-HA mice express the HA transgene under the control of the Ig-kappa promotor and enhancer elements in hematopoetic cells (Lanoue, 1997). TCR-HA, TCR-HA x IgHA mice and OTII mice were bred in the animal facility at the Helmholtz center for infection research. Mice aged 8 to 20 weeks were used for experiments which were all performed according to National and Institutional Guidelines. Extensive microbial and serological studies were performed to exclude the presence of pathogenic bacteria, viruses, fungi and parasites.

Antibodies

The monoclonal antibody 6.5 (anti-TCR-HA) was purified from hybridoma supernatant and was used in fluorescein isothiocyanate (FITC)-labelled or biotinylated form. PE-streptavidin- or APC-(Allophycocyanin)-streptavidin-conjugates were used as secondary reagents (BD Bioscience, San Jose, CA). For intracellular stainings PE coupled Foxp3 (FJK- 16s) staining kit from eBioscience (San Diego, CA) was used according to manufacturers recommendations .

List of antibodies:

FACS Analysis

Flow cytometric analyses were done on a FACSCalibur (BD Bioscience, Heidelberg, Germany). Data were analyzed with CellQuestPro software (BD Biosciences, Heidelberg, Germany). Intracellular FACS Staining

Sorted cells were washed twice with ice cold PBS before permeabiliszed with Fix/Perm (eBioscience) for 2-18 hours at 4° C in the dark. Permeabilised cells were then washed twice with permeabilising buffer (eBioscience) and stained for 30 minutes on ice with anti- mouse/rat Foxp3 (FJK- 16s) in the dark. After washing with permeabilising buffer cells are resuspended in FACS buffer and used for FACS analysis.

Cell isolation and /// vitro T cell activation

Erythrocyte depleted splenocytes isolated from BALB/c mice were cell sorted by AutoMACS using a CD4⁺ T cell isolation kit (Milteny Biotec) plus additional biotinylated anti-CD25

(1 :500) antibody (BD Pharmingen). CD4⁺CD25^" T cells were cultivated in 12 well plates in the presence of 0.75 μg/ml anti- CD3 (plate bound) and 1 μg/ml anti- CD28 (soluble) for 48 hours. For the isolation of 6.5⁺CD4⁺CD25^" or 6.5⁺CD4⁺CD25⁺ TCR-HA, TCR-HA x Ig-HA or CD4⁺CD25^" / CD4⁺CD25⁺ OTII T cells, spleen cells were isolated, erythrocyte depleted and stained with according antibodies that enabled isolation by Cell Sorting. For activation of

TCR-HA, TCR-HA x Ig-HA and OTII CD4⁺ T cells, erythrocyte depleted splenocytes were stimulated with 10 μg/ml of HA-peptide or 10 μg/ml of OVA-peptide for 48 hours. Cells were then applied on a Ficoll gradient (Amersham Biosciences) for 20 min. at 400 x g at room temperature to separate lymphocytes from the rest of cells. Lymphocytes were stained and cell sorted on the MoFlow cell sorter.

Cell Sorting

CD4⁺CD25^" and CD4⁺CD25⁺ T cells from different mice or retrovirally transduced CD4⁺ T cells expressing GFP were sorted with the MoFlow cell sorter (Cytomation, Fort Collins, CO).

Retroviral infection of CD4⁺CD25^" T cells

The cDNA encoding murine CD83 was amplified by RT-PCR from BALB/c spleen using specific primers (5 C ATGTCGC AAGGCCTCC AGCTCCTG (SEQ ID No. 3); 3 TCTGATGTGCCCTTGGCTTTGTAA (SEQ ID NO. 4)), cloned into pCR2.1 TOPO (Invitrogen, Karlsruhe, Germany), sequenced and inserted into an MCSV based retroviral vector encoding eGFP under control of an internal ribosomal entry site (IRES). This construct was used to stably transfect the ecotropic GPE86+ packaging cell line as described previously. Retrovirus-containing culture supernatant was collected after 24hous and passed through a 0.45μm filter before used for infection of CD4⁺CD25^" T cells. MACS sorted CD4⁺CD25^" splenocytes were activated as described above and after a 48 hour cultivation incubated with virus-containing supernatant supplemented with 2OmM Hepes (PAA, Linz, Austria) and 8μg/ml polybrene (Sigma- Aldrich, Taufkirchen, Germany) following centrifugation for 90 min at 500xg. Control infections were carried out using the empty eGFP vector. 24 hours post infection fresh medium was added supplemented with 20 U/ml recombinant IL-2 in total. GFP⁺ cells were sorted after 5-7 days.

Proliferation assays

Freshly isolated CD4⁺CD25^" T cells and GFP⁺CD4⁺CD25^" sorted T cells infected with pRV- IRES-CD83 or control virus were cultured in triplicate in 96-well plates at a cell number of 1 x 10⁵ alone or in addition with freshly isolated CD4⁺CD25^" responder T cells at a ratio of 1:1. For stimulation 1 μg/ml soluble anti-CD3 (2c 11) and irradiated APCs (4 x 10⁵) were used.

OVA-specific proliferation assays were done using 1 x 10⁵ CD4⁺CD25⁺ or CD4⁺CD25^" T cells isolated from OTII mice or sorted CD4⁺CD25^" OTII T cells infected with pRV-IRES- CD83 or control virus, supplemented with 5 μg/ml OVA- peptide, irradiated bone marrow derived DCs (1 x 10⁴) and 4 x 10⁵ irradiated APCs. hi case of HA- specific proliferation assays, 2.5 x 10⁴ sorted 6.5⁺CD4⁺CD25⁺ and 6.5⁺CD4⁺CD25^" T cells isolated from TCR-HA mice as well as from TCR-HA x Ig-HA mice were cultured in the presence of 2.5 x 10⁵ irradiated BALB/c splenocytes with or without 10 μg of the MHC class II hemagglutinin peptide HA Uo_-12O for 72 hours, alone or in the presence of 2.5 x 10⁴ CD4⁺CD25^" responder T cells (2.5 x 10⁴) isolated from TCR-HA mice. Proliferation assays were performed in a final volume of 200 μl and 1 μCi/well ³[H]- thymidine was added for the last 8 hours. Thymidine incorporation was measured by liquid scintillation counting.

Real-time RT-PCR Total RNA was prepared from transduced and sorted T cells using RLT buffer supplemented with 1% beta-mercaptoethanol. The RNA was isolated with the RNeasy Kit (Qiagen, Hilden, Germany) following cDNA synthesis using the superscript II reverse transcriptase (Invitrogen). Quantitative real-time RT-PCR was performed in an ABI PRISM cycler (Applied Biosystems) using a SYBR Green PCR kit from Applied Biosystems or Stratagene and specific primers optimized to amplify 90-250 bp fragments from the different genes analyzed. Primer sequences see table below. A threshold was set in the linear part of the amplification curve, and the number of cycles needed to reach it was calculated for every gene. Relative mRNA levels were determined by using included standard curves for each individual gene and further normalization to RPS9. Melting curves established the purity of the amplified band.

Primer sequences

Extensive gene expression profiling of Tregs cells of different origin reveal that CD83 is differentially expressed by Treg cells. CD83 is described as maturation marker for human dendritic cells (DCs). The soluble form of CD83 was described to inhibit DC-T cell clustering and plays an important role in CD4⁺ T cell development in the thymus. To confirm these results qualitative Realtime RT-PCR analysis were performed. CD83 expression is upregulated in all the CD4⁺CD25⁺ T cell subsets isolated from BALB/C, TCR-HA and TCR- HA x Ig-HA mice. To gain further insights in the role of CD83 in Tregs cells, CD83 was overexpressed in naive CD4+CD25- T cells using a retroviral vector system followed by different in vitro and in vivo analysis of the CD83 transduced T cells.

Contact Hypersensitivity BALB/c mice were sensitized by painting 80 μl of 0.5 % DNFB (2,4 dinitrofluorobenzene solution, Sigma- Aldrich) in acetone/olive oil (4/1) on the shaved back on day 0. On day 4, 1 x 10⁶ CD4⁺CD25^" T cells untreated or infected with control virus or CD83 virus were injected i.v. into each recipient mouse. For elicitation of CHS responses, 20 μl of 0.3% DNFB was painted on both sides of the right ear on day 5. CHS was determined by the degree of ear swelling of the challenged right ear compared to the ear thickness on the non-challenged left ear and measured with a micrometer (Mitutoyo, Tokyo, Japan) 36 h after challenge.

Cloning of CD83

First, the CD83 encoding sequences were amplified from cDNA pools of BALB/c spleen. The PCR products were Ii gated to the pCR2.1 TOPO vector. Resulting vectors were called pCR2.1-CD83. After sequencing, the CD83 coding region was cloned into MCSV-based pRV-IRES-GFP retroviral vector. As result, two retroviral vectors that express murine CD83 together with an enhanced GFP marker under the control of an IRES site were generated. The resulting retroviral vectors were stably transfected into the ecotropic packaging cell line GPE86+ by calcium phosphate precipitation. Transfected cells were kept in culture to produce retrovirus into their supernatant.

Infection of CD4⁺CD25^' T cells with retroviral supernatants and analyses

For further analysis, an experimental setting to overexpress CD83 via retroviral gene transfer into CD4⁺CD25^" T cells needed to be established.

Due to the fact that retroviruses only infect dividing cells, CD4⁺CD25^* T cells needed to be activated after their isolation, therefore different activation periods were tested. The highest infection and viability rate of CD4⁺CD25^" T cells was obtained after an activation with 0.75 μg/ml anti-CD3 plate bound (p.b.) and 1 μg/ml anti-CD28 for 48 hours in vitro.

Next, the supernatant of GPE86+ cells transfected with pRV-IRES-CD83 and -GFP that contains the retroviral constructs was tested according to infection rate. The highest infection rate was achieved when concentrated supernatant was used to infect activated splenic

CD4⁺CD25^" T cells. Infection was performed by replacing T cell medium by concentrated virus followed by centrifugation in 6 well plates, giving the retrovirus enough surface to infect

CD4⁺CD25^" T cells. After a cultivation period from 5-7 days, GFP expressing cells were cell sorted and used for further experiments.

Next, the suppressive capacity of CD83 transduced BALB/c CD4⁺ T cells was analyzed. BALB/c CD83- and GFP overexpressing cells were stimulated in vitro with 1 μg/ml anti-CD3 in the presence of APCs (irradiated BALB/c splenocytes) and cocultured with freshly isolated CD4⁺CD25^' BALB/c responder T cells (ratio 1 : 1) for 3 days.

As shown in Figure 2, CD83 overexpressing cells inhibit the proliferation of CD4⁺CD25^" responder cells to 20%.

Antigen-specific proliferation and inhibition assay

Overexpression of CD83 clearly reduced the proliferative capacity of CD4⁺CD25^" T cells in vitro in a polyclonal proliferation assay. Considering a possible therapeutic application, it is important to analyze the influence of CD83 overexpression also in an antigen- specific system. Therefore, the OTII mouse model was used, these mice express the mouse TCRa- and /3-chain that pairs with the CD4 co-receptor and is specific for chicken ovalbumin 323-339 in the context of I-A^b (Barnden et al., 1998). The percentage of transgenic CD4⁺ T cells in this mouse is much higher (about 80 %, data not shown) compared to the TCR-HA mouse, where the transgenic CD4⁺ T cells comprise only about 5%. To be able to use OTII T cells for functional analysis, first their natural expression profile of CD83 needs to be established.

The gene regulation of CD83 in OTII CD4⁺CD25⁺ or CD4⁺CD25^" T cells is comparable to CD83 expression in BALB/c CD4⁺CD25⁺ or CD4⁺CD25^" T cells as is shown in Figure 3. Therefore, an antigen-specific proliferation and inhibition assay was performed to confirm the results of analysis with polyclonal T cells (Figure 2). To test the proliferative and suppressive capacity of T cells in an antigen- specific manner, different conditions like antigen concentration or the ratio of DCs to antigen-specific T cells should be titrated. Therefore, OVA-peptide concentration of 1 μg/ml to 5 μg/ml and various T cell : DC ratios were tested. The highest proliferation of OVA-specific T cells was achieved with mature BM-derived DCs at a ratio of 5:1 and 5 μg/ml of OVA- peptide. With these established conditions, the proliferative and suppressive capacity of CD83 transduced OVA- specific CD4⁺CD25^" T cells was assessed:

CD83 over-expressing CD4⁺CD25^" OTII T cells show a clear reduction in proliferation and are able to suppress the proliferation of responder CD4⁺CD25^" OTII T cells upon antigenic stimulation (Fig.4). The reduction in proliferation and the inhibitory capacity of CD83 overexpressing OTII T cells is comparable to the polyclonal system where CD83 transduced BALB/c CD4⁺CD25^" T cells were used (Fig. 2).

In summary, CD83 transduced T cells were able to suppress the proliferation of naive T cells upon stimulation in vitro. In contrast to this, IL-21 transduced T cells were not able to interfere with proliferative response of freshly isolated CD4⁺CD25^" T cells.

Regulation of gene expression in retrovirally transduced CD4⁺CD25^" T cells

Several genes differentially expressed by T_reg cells were described over the last few years, like CTLA-4, Integrin ciEβl, Foxp3, TGF-0, IL-IO and Nrpl. To characterize CD83 transduced T cells in more detail, the expression in these T cells in comparison to control vector infected T cells was analyzed. For exact quantification of gene expression Realtime RT-PCR is superior to conventional PCR (see also above). Therefore, GFP- or CD83- overexpressing T cells and CD4⁺CD25^" or CD4⁺CD25⁺ T cells were cell sorted and RNA was extracted using RNAeasy (Qiagen). After reverse transcription the expression of selected genes were analyzed by Realtime RT-PCR and normalized to the expression of the house keeping gene RPS9 (Figure 5). Realtime RT-PCR analysis of CD83 transduced T cells reveals an upregulation of IL-21, CD83, CTLA-4 and to a smaller extent of Foxp3 and Integrin aEb7 as shown in Fig. 5).

Intracellular Expression levels of Foxp3

The forkhead-family transcription factor Foxp3 is important for the development and function of CD4⁺CD25⁺ regulatory T cells. To analyze the effect of CD83 overexpression on Foxp3 expression, CD83 or empty vector transduced CD4⁺ T cells, and freshly isolated CD4⁺CD25⁺ or CD4⁺CD25^" T cells were permeabilized and analyzed for Foxp3 expression by FACS using the Foxp3 staining kit from eBioscience.

As shown in Figure 6, overexpression of CD83 leads to the induction of Foxp3 expression in about 20% of the transduced T cells, in comparison only 2.8% of empty vector transduced CD4⁺ T cells show intracellular Foxp3 expression. These data confirm the Realtime RT-PCR data, which reveal also an upregulation of Foxp3 in CD83 transduced T cells. As controls, freshly isolated CD4⁺CD25⁺ T_reg cells and CD4⁺CD25^" were included in the analysis.

In summary, infection of naive T cells with retroviral vector encoding CD83 confers a regulatory phenotype in vitro, e.g. suppressive capacity and Foxp3 expression. Therefore representing a promising molecule to go into further detail.

CD83 overexpressing cells in vivo

The results presented in this study have shown that CD83 overexpression in CD4⁺CD25^" T cells confers a regulatory phenotype in vitro, which could be demonstrated by reduced proliferative capacity, suppressive capacity towards responder T cells in vitro and an increased Foxp3 expression.

However, the in vivo situation is much more complex as in in vitro systems, because one will never achieve to mimic the real physiological situation where a lot of still unknown mechanisms participate. Therefore it is important to test the in vitro results in an in vivo setting. For this purpose a selection of different mouse models can be used, like i.e. experimental autoimmune encephalitis (EAE) or diabetic mouse models, in which the adoptively transferred T cells need to be antigen-specific. As the number of antigen-specific transduced T cells is limited, the contact hypersensitivity system in which polyclonal T cells are adoptively transferred was chosen for the underlying experiment.

Therefore, mice were sensitized with DNFB (dinitrofluorbenzene) on the shaved back and 4 days later, CD83 and empty vector transduced CD4⁺ T cells were injected intravenously into sensitized mice. One day later the mice are challenged with the sensitizing agent on their right ear. After 48 hours, the peaktime for contact hypersensitivity reactions, the effect of CD83 was measured according to the difference in ear swelling between untreated and sensitized ear.

The results depicted in Figure 7 demonstrate that mice receiving no cells (pos. control) did show the strongest ear swelling, whereas mice that just got DNFB sensitized on the shaved back did not show any ear swelling (neg. control). The administration of CD4⁺CD25^~ noninfected T cells was not able to significantly reduce the ear swelling, the same is true for control vector transduced T cells. Only CD83 overexpressing T cells were able to decrease the CHS response as measured ear swelling is significantly reduced to 50% compared to mice that received control virus or non-infected T cells. Thus, CD83 overexpression in naive T cells does not only confer a regulatory phenotype in vitro but also in vivo as their strong influence on suppressing inflammatory processes could be demonstrated during CHS response.

CD4⁺CD25⁺ regulatory T cells differentially express CD83

Based on the findings that CD83 is expressed by different populations of immune cells and that a soluble form of CD83 is able to suppress immune responses, we examined whether CD83 is expressed by regulatory T cells and linked to their suppressive function. Therefore, we isolated CD4⁺CD25⁺ Treg cells from wildtype (WT) mice, antigen-specific CD4⁺CD25⁺ Treg cells from OT-Il and TCR-HA mice and analyzed the CD83 mRNA expression in comparison to their naive CD4⁺CD25^" counterparts by Real-time RT-PCR. Isolated Treg cells of different origin expressed up to 11 fold higher levels of CD83 mRNA than naive T cells (Fig. 8). Next, CD83 expression was investigated on protein level. Several reports have shown that T cells up-regulate CD83 upon activation. Therefore, we isolated CD4⁺CD25⁺ Treg cells and CD4⁺CD25^" T cells from BALB/c mice and stimulated them in vitro for different time periods prior to the analysis of the CD83 expression in both T cell populations. Despite the high levels of CD83 mRNA in unstimulated CD4⁺CD25⁺ Treg cells, only a small proportion of cells expressed CD83 on their surface similar to unstimulated CD4⁺CD25^" T cells (Fig. 8). Upon activation for 48h up to 65% of stimulated CD4⁺CD25^" T cells expressed CD83. However, Treg cells up-regulated CD83 surface expression more rapidly and to a higher extent, reaching the maximum of about 85% 48h post activation (Fig. 8). In the course of activation we observed decreasing CD83 expression on both T cell subsets at 72h post activation (12% and 2% for CD4⁺CD25⁺ Treg cells and CD4⁺CD25^" T cells, respectively). These data indicate that CD4⁺CD25⁺ Treg cells express high levels of CD83 mRNA and upon activation Treg cells express surface CD83 with greater magnitude and faster kinetic than CD4⁺CD25^" T cells.

We next ask whether the Same differential expression of CD83 could be observed in human CD4+CD25hi-derived Treg cells. For that we used CD4+CD25- derived allo-antigen stimulated helper T (Th) cells and CD4+CD25hi-derived allo-antigen stimulated Treg cells (Ocklenburg et al. 2006). After stimulation using allogeneic EBV B cells and IL2 for three days, analysis of CD83 cell surface expression corroborated our observations in mice in that exclusive up-regulation of CD83 was only observed in human Treg cells (Fig. 9). Similar results were obtained using non-specific stimulation with PMA/Ionomycin.

Claims

1. A method for identifying a compound capable of interacting with a CD83 polypeptide, comprising the steps of a) contacting said CD83 polypeptide or a functional fragment thereof or a host cell recombinantly expressing said CD83 polypeptide or a functional fragment thereof with a candidate compound, and b) determining whether said candidate compound interacts with said CD83 polypeptide.

2. A compound capable of interacting with a CD83 polypeptide, identified through a method according to claim 1.

3. A method for identifying a compound capable of functioning as an immunomodulator, comprising the steps of a) contacting a cell expressing a CD83 polypeptide or a functional fragment thereof with a candidate compound, in particular a candidate compound according to claim

2, and b) detecting a response of said cell compared to a control response as detected in the absence of said candidate compound, wherein said response indicates that said candidate compound is capable of functioning as an immunomodulator.

4. The method according to claim 3, wherein said host cell recombinantly expresses said CD83 polypeptide or a functional fragment thereof.

5. The method according to claim 3 or 4, wherein said response of said cell is a change in expression of said CD83 polypeptide or a change of the biological activity of CD83.

6. The method according to any of claims 3 to 5, wherein said immunomodulator comprises a compound selected from inducers or suppressors of an immunoreaction.

7. An immunomodulator identified through a method according to any of claims 3 to 6.

8. The immunomodulator according to claim 7, which is a nucleic acid expressing or overexpressing CD83 polypeptide or a functional fragment thereof, in particular an expression vector.

9. A method for identifying a compound capable of converting conventional T-cells into regulatory T-cells, comprising the steps of a) contacting conventional T-cells with a candidate compound, in particular with a candidate compound according to claim 7 or 8, b) detecting the level of conversion of conventional T-cells into regulatory T-cells, and c) comparing said level of conversion to a control level of conversion as detected in the absence of said candidate compound, wherein the altered conversion into regulatory T-cells indicates that the candidate compound is capable of converting conventional T-cells into regulatory T-cells.

10. The method according to claim 9, wherein said conventional T-cell recombinantly expresses said CD83 polypeptide or a functional fragment thereof.

11. The method according to claim 9 or 10, wherein said immunomodulator comprises a compound selected from inducers or suppressors of an immunoreaction.

12. An immunomodulator identified through a method according to any of claims 9 to 11.

13. The immunomodulator according to claim 12, which is a nucleic acid expressing or overexpressing CD83 polypeptide or a functional fragment thereof, in particular an expression vector.

14. A pharmaceutical composition, comprising an effective amount of an immunomodulator according to claim 7, 8, 12 or 13, or a host cell recombinantly expressing a CD83 polypeptide or a functional fragment thereof, together with a pharmaceutically acceptable carrier.

15. A method of treatment of a human suffering from an undesired immunoreaction, comprising administering to said human an effective amount of a pharmaceutical composition according to claim 14.

16. A method of treatment of a human suffering from an autoimmune disease, allergy and/or a transplant rejection, comprising the steps of a) culturing peripheral blood cells of said human comprising conventional T-cells, b) converting said conventional T-cells in vitro into regulatory T-cells by overexpression of a CD83 polypeptide in said conventional T-cells or by contacting said T-cells with an immunomodulator according to claim 7, 8, 12 or

13, and c) re-introducing said converted regulatory T-cells into a human.