WO2008089970A1

WO2008089970A1 - Sporeformers and screening for sporeformers

Info

Publication number: WO2008089970A1
Application number: PCT/EP2008/000498
Authority: WO
Inventors: Ghislain Schyns; Adriano O. Henriques
Original assignee: Dsm Ip Assets B.V.
Priority date: 2007-01-26
Filing date: 2008-01-23
Publication date: 2008-07-31

Abstract

The present invention relates to microbial spores capable for displaying of bioactive molecules at the surface of the spores for both in vitro and in vivo applications and to a method for screening of such sporeformers. Spore formation during fermentation of potentially endospore-forming microorganisms like Bacillus subtilis is generally not welcome. But, from an industrial viewpoint, there are also situations where maximizing spore production could become interesting, for example in the formulation of probiotics and vaccines. Consequently, the invention relates to a sporulation-enhanced microorganism being capable of overproducing dormant spores, or of attaining high spore titers earlier than a reference microorganism. The invention further relates to a method for identifying a sporeformer strain which shows an enhanced sporulation capacity compared to the wildtype microorganism comprising identifying - on the genome level - at least one signal gene involved in the regulation of the activity of the sporulation activator and selecting the sporeformer candidate which has at least one mutation in the signal gene, which accounts for an increased activity of the sporulation activator.

Description

Sporeformers and Screening for Sporeformers

The present invention relates to microbial spores capable for displaying of bioactive molecules at the surface of the spores for both in vitro and in vivo applications and to a method for screening for such sporeformers.

During the last ten years microbial surface display has increasingly become a tool of choice to display peptides or proteins of biotechnological interest bn natural nanostructures for commercial purposes. Biological applications include the development of bio-adsorbents, the presentation of antigens for vaccines, or the preparation of combinatorial epitope libraries. Surface display requires the synthesis of a hybrid protein that consists of a passenger protein of interest, commercial or other, fused to a carrier protein, which anchors it onto the biological surface (cell wall or cell membrane). •

Spore systems, as described in general herein, can be used in the food and feed industry, for example as a probiotic feed additive or as genetically modified or genetically engineered viable spore systems expressing bioactive polypeptides at their surface, for example bacteriocins and/or enzymatically active feed enzymes, or as genetically modified or "genetically engineered" inert spore systems expressing affinity ligands or immobilized enzymes at their surface which have a great potential use in biocatalysis and in downstream purification processes.

The term "probiotic" generally refers to a non-pathogenic bacterium fed to animals, including birds, as a way to prevent colonization by pathogenic microorganisms, e.g. protazoa. Probiotics may also be defined as live, or livable, micro-organisms which beneficially affect the intestinal balance of healthy and normally functioning humans and animals.

The term "genetically modified" or "genetically engineered" means the scientific alteration of the structure of genetic material in a living organism. It involves the production and use of recombinant DNA. More in particular it is used to delineate the genetically engineered or modified organism from the naturally occurring organism by forming a genetic DNA construct, wherein the genetic DNA construct comprises a first DNA portion encoding the desired target protein (including but not limited to affinity ligand, bioactive polypeptide, or enzyme) and a second DNA portion encoding a spore surface protein (e.g., a spore coat protein), which construct, when transcribed and translated, expresses a fusion protein between the carrier and the target protein or peptide. Genetic engineering may be done by a number of techniques known in the art, such as gene replacement, gene amplification, gene disruption, transfection, transformation using plasmids, viruses, or other vectors. A genetically modified organism, e.g. genetically modified microorganism, is also often referred to as a recombinant organism, e.g. recombinant microorganism.

The terms "spore" and "spore system" as used herein are equivalent expressions and denote differentiated resistant structures that come from differentiation of microbial vegetative cells under nutritional stress or other hostile conditions (physical or chemical) such as, but not limited to, extreme pH, heat, pressure, desiccation or an extract/mixture containing said structures, wherein the spore is derived from a parent spore-forming organisms.

Products of sporulation are dormant spores, which still maintain full capability of regenerating vegetative cells (through the process of germination) when environmental conditions become friendly again. Spores have a number of properties quite different from those of vegetative cells. Included among those differences are increased resistance of spores to chemical stresses like exposure to small noxious molecules, extreme pH conditions or enzymatic degradation, and physical stresses like heat, pressure, and UV irradiation. Spores also confer protection against phagocytosis by predatory microorganisms.

Because spore formation during fermentation of potentially endospore-forming microorganisms like Bacillus subtilis is generally not welcome, patent applications have been filled to render microorganisms incapable of sporulation during fermentative processes (e.g. riboflavin production - US5,837,528; biotin production - US6,057,136; pantothenate production - WO2004/113510). But, from an industrial viewpoint, there are also situations where maximizing spore production could become interesting or even essential.

Although several publications have described fermentative process optimizations which result in a higher spore production (Monteiro et al., 2005, A Procedure for High- Yield Spore Production by Bacillus subtilis, Biotechnology Progress 21: 1026-1031; and Flores et al., 1997, Scale-up of Bacillus thuringiensis fermentation based on oxygen transfer, Journal of Fermentation and Bioengineering, 83(6), 561-564), there is no prior art showing how to screen genetically for high sporulation-efficient microorganisms, whose spores could be used in vitro as surface display system or in vivo for formulation as probiotics or as vaccines.

The process of endospore formation (sporulation) in B. subtilis and other related Gram- positive bacteria consists of several stages. The entry into sporulation is governed by the phosphorylated SpoOA (Spo0A~P), a DNA-binding sporulation activator (Fawcett et al., 2000; The transcriptional profile of early to middle sporulation in Bacillus subtilis, Proc. Natl. Acad. Sci. USA 97: 8063-8068; and Fujita and Losick, 2005, Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator SpoOA. Genes Develop. 19: 2236-2244). Entry into sporulation is controlled by the gradual increase in the levels and activity of SpoOA. This effect allows for the sequential expression of genes that respond to low or high levels of SpoOA. Soon after entry into sporulation, the cell divides asymmetrically to generate two compartments of unequal size and dissimilar developmental fates. The smaller compartment, the forespore, develops into the spore, whereas the larger compartment, the mother cell, nurtures the developing spore. When the spore morphogenesis is complete the mother cell lyses to liberate the mature spore.

The population of cells entering sporulation shows a bimodal distribution with respect to the expression of SpoOA and SpoOA -dependent genes. While a fraction of the cells shows low levels of activity in which Spo0A~P represses transcription of abrB that leads to lifting AbrB-dependent regulation of transition-state-associated gene expression-, another fraction shows high levels of SpoOA activity. At this higher critical level, SpoOA~P concentration activates genes (sinl, spoIIG, spoIIE, spoIIA, etc.) required for the entry and commitment to sporulation. Since Spo0A~P represses transcription of abrB and AbrB represses transcription of sigH, SpoOA~P indirectly activates genes that are in the σH regulon an alternative sigma factor governing the transcription of genes (spoOA, spoOF, spoIIA, phrC, phrE, etc.) involved in stationary growth phase and the early stages of sporulation (Britton et al., 2002, Genome- wide analysis of the stationary-phase factor (sigma-H) regulon of Bacillus subtilis. J. Bacteriol. 184:4881 -4890).

It is the object of the present invention to provide sporulation -efficient microorganisms that can be further used in vitro or in vivo. It is a further object of the invention to provide a method for the screening for robust sporeformers at the genome level, which method is particularly suitable for Bacillus subtilis.

By robust sporeformers, the inventors mean strains in which the efficiency of sporulation (total cell counts versus spore counts) may be higher than that observed for standard strains of the same species, strains in which the efficiency of sporulation is not changed relative to standard representatives, however attain higher spore (and cell) titers, strains in which high spore titers are attained significantly faster than in a reference strain, or whose properties are combinations of the factors described above. Any of these factors, alone or in combination can be translated into higher concentration of spores per volume of culture and/or and a significant reduction in the time required to complete the process of spore formation, properties which are both economically attractive.

Consequently, the invention relates to a sporulation-enhanced microorganism being capable of overproducing dormant spores compared to the wildtype microorganism, wherein the microorganism exhibits an increased activity of a sporulation activator, and/or decreased activity of factors known to inhibit or delay entry into sporulation at the cell or population level.

Microorganism being capable of producing spores are for example Bacillus spp., Clostridium spp., Sporosarcina spp.,Sporolactobacillus spp. Sporohalobacter spp. Desulfotomaculum spp. Amphibacillus spp., Oscillospora spp. Sulfobacillus spp. Syntophospora spp.

The term "wildtype" as used herein encompasses standard laboratory strains and othe isolates of the same species which do not show a pronounced sporulation activity.

The term "increase" of activity as used herein encompasses increasing activity of the sporulation activator.

There are a number of methods available in the art to accomplish increase of activity of a given protein. To facilitate such an increase according to the present invention, the copy number of the genes encoding the sporulation activator may be increased. Alternatively, a strong promoter may be used to direct the expression of the corresponding gene. In another embodiment, the promoter, regulatory region and/or the ribosome binding site upstream of the gene can be altered to increase the expression. The expression may also be enhanced or increased by increasing the relative half-life of the messenger RNA. In another embodiment, the activity of the sporulation activator itself may be increased by employing one or more mutations in the polypeptide amino acid sequence, which increases the activity. For example, altering the affinity of the polypeptide for its corresponding substrate may result in improved activity. Likewise, the relative half-life of the polypeptide may be increased. In just another embodiment a repressor is blocked or suppressed which either blocks or inhibits the activity of the sporulation activator on the protein level or the expression of the gene encoding the sporulation activator.

"Improved activity" as used herein means an increase of at least 5%, 10%, 25%, 50%, 75%, or even 100%, compared to the activity of the protein. In a preferred embodiment, the microorganism according to the invention is capable of producing a population of dormant spores which is 2 to 10 times the size of the spore population produced by the wild type microorganisms under the same physical and chemical conditions.

The invention further relates to a method for identifying a sporeformer strain which shows an enhanced sporulation capacity compared to the wildtype microorganism comprising identifying at least one signal gene involved -directly or indirectly - in the regulation of the activity of a DNA-binding sporulation activator on the genome level and selecting the sporeformer candidate which has at least one mutation in the signal gene which exhibits an increased activity of the sporulation activator.

Further advantageous embodiments of the invention become evident from the dependent claims.

In a specific embodiment, it is desired to knockout or suppress a signal gene encoding a protein, which protein inhibits or reduces the activity of the sporulation activator on the protein level, i.e. wherein the gene of the said signal protein is artificially suppressed in order to improve the efficiency of the sporulation activator. Methods of providing knockouts are well known in the art. The suppression of the gene may be induced by deleting at least a part of the gene sequence or the regulatory region thereof. As used herein, "suppression of the gene expression" includes complete and partial suppression.

In a preferred embodiment, the DNA-binding sporulation activator is SpoOA. The pool of phosphorylated SpoOA can be at least modulated by the activity of the response regulator phosphatases Rap, which normally act to drain phosphate from SpoOA. Examples of genes and gene products that decrease the level of SpoOA~P and/or AbrB include, but are not limited to, abrB, kapB, kbaA, kinA, kinB, kinC, kinD, kinE, kipA, kipl, obg, phrC, phrE, rapA, rapB, rapE, rapl, rapK, sigH, spoOA, spoOB, spoOE, spoOF, scoC, sinR, sinl, spoOJA and spoOJB. Note that gain of function alleles such as of the spoOA gene itself may be found. Examples of signals that increase or decrease the level of SpoOA~P and AbrB include, but are not limited to, nutritional, metabolic, DNA status, cell density (pheromones and quorum-sensing molecules) and cell cycle signals.

Therefore, in a particular embodiment of the invention, the microorganism has at least one mutation, which affects at least one signal gene selected from the group consisting of kapB, kbaA, kinA, kinB, kinC, kinD, kinE, kipA, kipl, obg, phrC, phrE, rapA, rapB, rapE, rapl, rapK.

The term "mutation" as used herein encompasses insertion, deletion or point mutation of parts of the said gene. In one aspect, at least one mutation leads to the loss of the related protein or to a protein whose function and/or activity compared to the wild type counterpart is reduced. Methods for introducing such mutations are well known in the art. In the present invention, the preferred target high sporeformer microorganism presents naturally a pool of activated SpoOA significantly higher than that of wild type benchmark strain Bacillus subtilis 168 (1 A7474). Increased SpoOA activity may be caused by the increase of its phosphorylation status. This can be reflected by the genomic absence or inactivation of genes directly or indirectly involved into phosphatase activities like, but not limited, to B. subtilis rap genes for example. The genome of strain 168 (1A747) has been shown to contain seven Rap phosphatases (A, C, E, F, G, I and K). In the present invention we demonstrate how to screen for efficient sporeformers by screening for the absence of rap phosphatase genes, individually or in combination.

The present invention will now be illustrated in more detail by the following examples, which are not meant to limit the scope of the invention. These examples are described with reference to the attached drawing.

EXAMPLES

General Methodology

Strains and plasmids:

Bacillus subtilis strains of the present invention are derived from strain 1 A747 (Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA), which is a prototrophic derivative of B. subtilis 168 (trpC2). The genome of strain 1 A747 has been sequenced (Kunst et al., 1997, The complete genome sequence of the gram -positive bacterium Bacillus subtilis, Nature 390:249-56) as is herein used to derive the sequences of all primers, as well as the basis for all sequence comparisons, and inferences related to genome structure.

Media:

Standard minimal medium (MM) for B. subtilis contains IX Spizizen salts, 0.04 % sodium glutamate, and 0.5% glucose. Standard solid complete medium is Tryptone Blood Agar Broth (TBAB, Difco). Standard liquid complete medium is Veal Infusion -Yeast Extract broth (VY). The compositions of these media are described below: - TBAB medium: 33g Difco Tryptone Blood Agar Base (Catalog # 0232), 1 L water. Autoclave.

- VY medium: 25g Difco Veal Infusion Broth (Catalog # 0344), 5g Difco Yeast Extract (Catalog #0127), IL water. Autoclave. - Minimal Medium (MM): 100ml 1OX Spizizen salts; 10 ml 50% glucose; 1 ml 40% sodium glutamate, qsp IL water.

- WX Spizizen salts: 140g K₂HPO₄; 2Og (NH₄)2SO₄; 6Og KH₂PO₄; 1Og Na₃ citrate.2H₂O; 2g MgSO₄.7H₂O; qsp IL with water.

- WX VFB minimal medium (WX VFB MM): 2.5g Na-glutamate; 15.7g KH₂PO₄; 15.7g K₂HPO₄; 27.4 g Na₂HPO₄.12H₂O; 4Og NH₄Cl; 1 g citric acid; 68 g (NH₄)2SO₄; qsp 1

L water.

- Trace elements solution: 1.4g MnSO₄- H2O; 0.4g CoCl₂- 6H₂O; 0.15g (NaO₆Mo₇O₂₄- 4H₂O; O.lg AlCl₃-OH₂O; 0.075g CuCl₂- 2H₂O; qsp 200 ml water

- Fe solution: 0.2 Ig FeSO₄.7H₂O; qsp 10 ml water. - CaCl₂ solution: 15.6g CaCl₂.2H₂O; qsp 500 ml water. ^•

- Mg/Zn solution: 10Og MgSO₄JH₂O; 0.4g ZnSO₄.7H₂O; qsp 200 ml water.

- VFB MM medium: 100 ml 1OX VFB MM; 10 ml 50% glucose; 2 ml Trace elements solution; 2 ml Fe solution; 2 ml CaC12 solution; 2 ml Mg/Zn soluti on; 882 ml sterile distilled water. - VFB MMGT medium: 100 ml 1OX VFB MM; 100 ml 0,5 M Tris (pH 6.8); 44 ml 50% glucose; 2 ml Trace elements solution; 2 ml Fe solution; 2 ml CaCl ₂ solution; 2 ml Mg/Zn solution; 748 ml sterile distilled water.

Molecular and genetic techniques.

Standard genetic and molecular biology techniques, including polymerase chain reaction procedures are generally know in the art and have been previously described. DNA extraction and other standard B. subtilis genetic techniques are also generally known in the art and have been described previously (Harwood and Cutting, 1992, Molecular Biological Methods for Bacillus, 1990, John Wiley & Sons, New York). Sporulation assay.

1 ml of sample was taken from the B. subtilis cultures and 10 -fold dilution series was prepared in sterile distilled water. After a 20 min heat -treatment at 80⁰C, dilutions were plated on TBAB agar, incubated for 20 h at 37°C and then the number of 'heat-resistant' colony forming units (cfu) in 1 ml of the original culture was determined. Sporulation frequency was calculated by dividing the titer (cfu/ml) of heat resistant spores by the titer (cfu/ml) of bacterial cells before heat treatment.

EXAMPLE 1

This example describes the screening for the presence/ absence of four rap genes in B. subtilis 1A747 and BSPl strains by polymerase chain reaction amplification using the pair of primers listed in Table 1 (1+2, 3+4; 5+6; 7+8).

Table 1 : Primers used to screen for rap genes

Name Nucleotide sequence (5'>3') SEQ ID NO: rapA+250F GTTAGAAGACATCGAAGGG 1 rapA+658R ATAGGGCAGAACTGATCAGG 2 rapE+300F CTTCTTCCGCGGGATGTATGAG 3 rapE+820R GAAGCAATCCATTGCTTGTCC 4 rapI+194F GACATGAGATAATGCTGAGTTATATG 5 rapI+1071R CTCATACGATAATATTCATTAGAGAGCCATT 6 rapK+383F GTTGCTGC ATTCTTC ACGAGGAGA GC 7 rapK+1092R TCATAAGATTCCCTCCACCTGATTC 8

The results are shown in the attached Figure 1 (Ethidium bromide stained 0.7% agar gel electrophoresis of rap genes PCR amplified fragments using pairs of primers described in Table 1. Theoretical expected PCR fragment sizes: rapA, 408 bp; rape, 520 bp; rapl, 877 bp; rapK, 1252 bp) and Table 2, wherein the four rap genes are present in B. subtilis 168 (strain 1A747 from the Bacillus Genetic Stock Center) and absent in B. subtilis BSPl.

In order to avoid false negative results and in order to confirm the absence of rapE, rapl, and rapK genes, Table 2 presents sequencing data around the rapE, rapl, rapK loci (obtained from the complete genome sequencing of strain BSPl). The missing rap genes correspond to missing islands on the BSPl chromosome. rapK absence corresponds to prophage 6 missing, rapl to prophage 2 missing, rapE to the skin element missing.

Table 2: Genetic details on missing islands including rap genes.

Name Missing element 5 'gene missing 3' gene missing Deletion size rapK Prophage 6 yobE yobO 18.5 kb rapl Prophage 2 ydcL yddS 26.5 kb rapE skin yqcK yqaD 43 kb

EXAMPLE 2 This example describes the spore titers of strains 1A747 and BSPl after 24h incubation in Difco Sporulating medium. Viable cells were measured before and after incubation at 80oC for 20 min prior to plating for heat-resistant survivors. Experiments were performed three times and the average is shown. The BSPl strain, missing the rapK, rapl and rapE genes presents a significantly higher sporulation titer.

Table 3: Sporulation titers

Strain names No of spores ml^"1 No of viable cells ml^"1

1A747 3 x lO⁸ 5.2 x lO⁸

BSPl 9.I x IO⁸ 8.4 x lO⁸

Claims

1. A sporulation-enhanced microorganism being capable of overproducing dormant spores and/or capable of premature or constitutive sporulation compared to a reference strain of that same species of microorganism, wherein said microorganism exhibits an increased activity of at least one sporulation activator.

2. A microorganism according to claim 1 which is genetically modified or genetically engineered.

3. A microorganism according to claim 1 or 2, wherein the sporulation activator is SpoOA.

4. A microorganism according to claim 3, wherein the microorganism has at least one mutation which affects at least one signal gene selected from the group consisting of kapB, kbaA, kinA, kinB, kinC, kinD, kinE, kipA, kipl, obg, phrC, phrE, rapA, rapB, rapE, rapl, rapK, wherein the at least one mutation leads to the loss of the signal protein or to a protein whose function and/or activity compared to the wild type counterpart is reduced.

5. A microorganisms according to claim 4, wherein at least two of the said signal genes are missing and/or altered so that the expression level of the gene is decreased.

6. A microorganism according to any one of claims 1 to 5 wherein the microorganism belongs to the genus Bacillus or Clostridia.

7. A microorganism according to claim 6 wherein the microorganism belongs to the species Bacillus subtilis.

8. A microorganism according to claim 7, which is derived from B. subtilis 1 A747 from the Bacillus Genetic Stock Center.

9. A microorganism according to any one of claims 1 to 8 wherein said microorganisms is capable of producing a population of dormant spores which is 2 to 10 times the size of the spore population produced by the wildtype microorganisms under the same conditions.

10. A method for identifying a sporeformer strain which shows an enhanced capacity to sporulate (i.e., to attain higher titers of spores than a reference strain, or high titers of spores earlier than a reference strain) compared to the a reference strain of the same species of microorganism comprising identifying on the genome level at least one signal gene involved in the regulation of the activity of a sporulation activator and selecting the sporeformer candidate which has at least one mutation in the at least one signal gene, which accounts for an increased activity of the sporulation activator.

11. A method according to claim 10, wherein the DNA -binding sporulation activator is SpoOA.

12. A method according to claim 11, comprising screening for Bacillus strains missing signal genes involved into reducing the pool of phosphorylated SpoOA.

13. A method according to claim 11 or 12, comprising the step of selecting sporeformer candidates which have at least one mutation which affects at least one signal gene selected from the group consisting of kapB, kbaA, kinA, kinB, kinC, kinD, kinE, kipA, kipl, obg, phrC, phrE, rapA, rapB, rapE, rapl, rapK.

***