WO2008077511A1 - Human polyomavirus and methods of diagnosis and treatment - Google Patents

Abstract

Human polyomavirus, designated KI polyomavirus (KIPyV) isolated from nasopharyngeal aspirates. KIPyV genome including capsid proteins VPl VP2 and VP3, small t antigen and large T antigen. KIPyV nucleic acid molecules and polypeptides, and use for production of diagnostic materials such as antibodies for identifying presence of the KIPyV or for production of vaccines against KIPyV. Methods and kits for diagnosing presence of KIPyV, and method of treating KIPyV infection.

Description

Human Polyomavirus and Methods of Diagnosis and Treatment

This invention relates to polyomaviruses, and in particular to a human polyomavirus and its use in diagnosis and treatment.

Polyomaviruses are small DNA viruses. Polyomaviruses are capable of chronic infections, have oncogenic potential and are known to cause disease in immunosuppressed individuals. They have been found in many mammals and birds. The routes of acquisition and site of primary infection are largely unknown.

Two polyomaviruses are known to naturally infect humans, JC virus (JCV) and BK virus (BKV) [1,2] . They are closely related and both viruses show 70-80% seroprevalence in adults [3] .

Both viruses can establish a latent infection in the kidneys and the central nervous system [4] . JCV, and occasionally also BKV, can be detected in the urine of healthy adults [3] and BK virus has been detected in the feces of children [5] . JC and BK viruses are highly oncogenic in experimental animals, and although a role in the development of human tumors has not been established evidence has been mounting recently that JCV, BKV as well as SV40 are potential oncogenic viruses in humans as well [6] .

Disease caused by human polyomaviruses has also been observed in immunosuppressed individuals. JC virus is the causative agent of progressive multifocal leukoencephalopathy, a demyelinating disease of the brain and a feared complication of AIDS [7] . BK virus has been associated with post-transplant nephropathy and hemorrhagic cystitis in hematopoetic stem cell transplant (HSCT) recipients [8,9] .

The previously known primate polyomaviruses are not considered to be agents of respiratory tract disease. JCV and BKV have nevertheless been detected in human tonsil tissue and respiratory route of transmission has been hypothesized [10-12] . In addition to the human JC and BK viruses, there are reports on the presence of the primate polyomavirus SV40 in humans [13] . SV40 genomic sequences have been detected in human malignant mesothelioma tumors.

We have isolated and identified a new polyomavirus, which we designate KI polyomavirus (KIPyV) . Our analysis of KIPyV indicates that this is the first discovered member of a new sub- family of the Polyomaviridae family.

KIPyV was detected in nasopharyngeal aspirates and feces . It was not detected in the urine, whole blood, leukocyte or serum samples that were tested in this study. The study of nasopharyngeal aspirates suggests that the prevalence is at least 1% in Stockholm.

The presence of KIPyV in nasopharyngeal aspirates indicates that KIPyV may be involved in respiratory tract diseases and/or may be transmitted via the respiratory route.

Considering the oncogenic potential of other polyomaviruses, KIPyV may be associated with other clinical manifestations, such as cancer. There are putative binding sites for p53 as well as the Rb family of tumor suppressor proteins in the large T antigen of KIPyV, which is of particular significance in the light of the oncogenic potential of polyomaviruses.

As known human polyomaviruses, e.g. JCV, are linked to diseases of the nervous system such as demyelinating disease of the brain, KIPyV may also be associated with diseases of the nervous system.

As disease caused by human polyomaviruses has also been observed in immunosuppressed individuals, KIPyV may also be involved in complications in immunosuppressed patients. The DNA sequences of the KIPyV genome, and its encoded polypeptides, are disclosed herein. KIPyV nucleotide sequences SEQ ID NOs: 1 to 3 , primer SEQ ID NOs : 15 to 22 and KIPyV amino acid sequences SEQ ID NOs : 4 to 14 are shown in the appended sequence listing. Isolated nucleic acid molecules comprising one or more of the KIPyV nucleotide sequences, or their complementary sequences or fragments thereof, are aspects of the present invention. KIPyV amino acid sequences and fragments thereof, and isolated nucleic acid molecules encoding one or more of the KIPyV amino acid sequences or fragments thereof are also aspects of the present invention. Nucleic acid molecules according to the invention may for example be DNA or RNA.

KIPyV sequences can be used to produce diagnostic materials for identifying or demonstrating the presence of the virus in a sample. Binding members e.g. antibodies to KIPyV polypeptides may be produced, and used e.g. for diagnosis or treatment of KIPyV associated disease. Inhibitors of KIPyV proteins, e.g. binding members, may be used for treatment of a KIPyV associated disease.

KIPyV nucleic acids and polypeptides may also be used to produce vaccines against KIPyV, which may be administered to individuals, especially humans, such as babies, infants and children.

Brief description of the Drawings

Figure 1 Genome organization of KIPyV. Putative coding regions for VPl, VP2 , VP3 , small t antigen and large T antigen are marked by arrows .

Figure 2 Alignment of the origin of replication of 9 polyomavirus species. Putative binding sites for large T antigen are boxed. KIPyV, KI polyomavirus, MPyV, Murine polyomavirus; MPtV, Murine pneumotropic virus; BPV, Bovine polyomavirus; LPV, Lymphotropic papovavirus . Figure 3 Sequence of the non-coding regulatory region with predicted binding sites for human transcription factors and the putative A/T rich domain indicated. Putative Large T antigen binding sites are boxed, other transcription factor binding sites and the A/T rich domain are underlined.

Figure 4 Schematic representation of putative domains of the KIPyV large T antigen. Amino acid numbers are shown on top. crl, conserved region 1, a motif found in most polyomaviruses as well as the ElA protein of adenovirus; HPDKGG , the HPDKGG box, a highly conserved motif of LT of polyomaviruses; NLS, nuclear localization signal; Rb, retinoblastoma protein-binding domain; DNA, DNA-binding domain; Zn, Zinc finger region; p53, p53-binding domain.

Figure 5 Phylogenetic analysis of large T antigen amino acid sequences (A) and VPl amino acid sequences (B) . Bootstrap values are indicated at each branching point. GHPV, Goose hemorrhagic polyomavirus ; CPyV, Crow polyomavirus; FPyV, Finch polyomavirus; APV, Avian polyomavirus; BPV, Bovine polyomavirus; MPtV, Murine pneumotropic virus; KIPyV, KI polyomavirus; LPV, Lymphotropic papovavirus,- HaPyV, Hamster polyomavirus; MPyV, Murine polyomavirus .

Detailed Description of the Invention

KIPyV was identified from human respiratory tract samples using a system for large-scale molecular virus screening of clinical samples based on host DNA depletion, random PCR amplification, large-scale sequencing, and bioinformatics . Details of the methodology are described in [14] and [15] , the contents of which are incorporated herein by reference. A screening library was constructed from cell-free supernatants of 20 randomly selected, anonymized, nasopharyngeal aspirates submitted to Karolinska University Laboratory, Stockholm, Sweden for diagnostics of respiratory tract infections. After pooling the samples and dividing them into two aliquots, four sub-libraries were generated, and ninety-six clones from each library were sequenced, i.e. 384 clones in total. A single clone of 363 bp showed weak amino acid similarity (30% identity, E = 0.011) to the VPl gene of SV40 and was selected for further studies.

The source sample containing the SV40-like sequence was identified by PCR analysis of saved aliquots of the original patient samples. The positive sample was named Stockholm 60 (ST60) . A second PCR product reaching around the circular DNA genome was used as a template for determination of the complete genome sequence . The complete consensus genomic sequence of isolate Stockholm 60 (ST60) was found to be circular and 5040 nt in length, and is disclosed herein as SEQ ID NO: 1. Two additional isolates were identified during a subsequent prevalence study and sequenced using the same approach. They were named Stockholm 350 and Stockholm 380. Their genomes were determined using the same approach. The genome of Stockholm 350 (ST350) is 5040 nt , disclosed herein as SEQ ID NO: 2. The genome of Stockholm 380 (ST380) is 5040 nt, disclosed herein as SEQ ID NO: 3. The three genomes are highly similar. Both isolate

Stockholm 350 and Stockholm 380 differ from the prototype isolate by 10 nucleotide substitutions, and they differ from each other at 7 single bases. The variable positions show some clustering in the regulatory region. There is also at least one isolate- specific difference of the deduced amino acid sequences in each of the four major genes. The differences in the amino acid sequences are: VPl: An A->T substitution in isolate 350 at amino acid position 368; VP2 : A T->S substitution in isolate 350 at amino acid position 246; VP3 : An S->T substitution in isolate 350 at amino acid position 103; Small t: A D- >E substitution in isolate 350 at amino acid position 104; Large T: A V->L substitution in isolate 60 at amino acid position 365 and a Q->H substitution in isolate 380 at amino acid position 494.

Thus, we isolated three highly similar isolates of KIPyV, which indicates a small genetic variability of the virus. The nucleotide sequences of KIPyV, and amino acid sequences encoded by these nucleotide sequences, are provided herein in the appended sequence listing.

The genomic organization of KIPyV (Figure 1) is typical for a member of the Polyomaviridae . The KIPyV genome comprises an early region encoding regulatory proteins, namely small t antigen and large T antigen, and a late region coding for structural proteins VPl, VP2 and VP3. The early region and the late region are separated by a non-coding regulatory region. The genome size is within the known range of polyomaviruses . Sizes of the deduced proteins of ST60, their calculated molecular weights and amino acid similarities to JCV, BKV and SV40 are shown in Table 2. As isolates ST350 and ST380 are highly similar to isolate ST60, it would be expected that the calculated molecular weights and the amino acid similarities to JCV, BKV and SV40 are the same for ST350 and ST380. The coding regions are the same for all three isolates. While the non-structural proteins have substantial amino acid sequence similarity to those of the other primate polyomaviruses, the structural proteins have a very low degree of similarity to those of other known polyomaviruses.

Nucleotide sequences of the KIPyV genome are shown in the appended sequence listing. Each of SEQ ID NOS 1 to 3 for the genomic DNA starts with a nucleotide in the origin of replication, i.e. a nucleotide in the origin of replication is numbered nucleotide 1. This system of numbering of a circular viral genome, starting with the presumed origin or replication and proceeding clockwise through the late region, is consistent with the numbering systems that have been used for most primate polyomaviruses, such as JCV, SV40, SA12 and some strains of BKV.

Early region

In the early region of the genome there are putative open reading frames for the two regulatory proteins small t antigen (ST) and large T antigen (LT) (Figure 1) . Consensus sequences and alignments with LT of other polyomaviruses indicate that there is a donor splice site for LT at position 4716 and an acceptor site at position 4328.

Our analysis indicates that KIPyV does not express a middle t antigen (MT) . Known polyomaviruses that express MT (MPyV, HaPyV) use all three reading frames for synthesis of ST, LT and MT, while all other polyomaviruses use either one, KI polyomavirus included, or in some cases two. Also, in both MPyV and HaPyV, the middle t antigen mRNA is produced through splicing and no corresponding splice sites have been found in KI polyomavirus. Most polyomaviruses, including the primate polyomaviruses, lack expression of the middle t antigen protein. Assuming there is no expression of MT, it is likely that tiny T antigen is not expressed either [16] .

The coding region of small t antigen (ST) is nucleotides 4967- 4392 of SEQ ID NO: 1, SEQ ID NO : 2 and SEQ ID NO: 3. KIPyV ST of ST60 and ST380 have the amino acid sequence shown in SEQ ID NO: 8, KIPyV ST of ST350 has the amino acid sequence shown in SEQ ID NO: 13.

The coding region of large T antigen (LT) is nucleotides 4967- 4716 and 4328-2655 of SEQ ID NO:1, SEQ ID NO: 2 and SEQ ID NO: 3. The two regions are joined by mRNA splicing to encode the LT protein. KIPyV LT of ST60 has the amino acid sequence shown in

SEQ ID NO: 7, KIPyV LT of ST350 has the amino acid sequence shown in SEQ ID NO: 12 and KIPyV LT of ST380 has the amino acid sequence shown in SEQ ID NO : 14.

ST and LT proteins show similarities to other members of the polyomavirus family, primarily BKV, JCV, SV40 and SA12, and an alignment with LT of other polyomaviruses shows that most regions characteristic of LT are present also in KIPyV. The N terminal 82 amino acids of ST are common to LT. This region encompasses the J domain carrying the conserved region 1 (crl) sequence and the

HPDKGG box. In the C terminal part that is unique to ST, there is a cysteine rich domain typical of polyomaviruses. In LT the HPDKGG box is followed by a putative Rb binding domain (LRCNE) , a nuclear localization signal, a DNA binding domain, a Zn finger region including the zinc finger motif (C-312, C-315, H-327, H- 331) , and finally an ATPase-p53 binding domain containing the highly conserved GPXXXGKT sequence (a. a. 436-443). Unlike BKV, JCV, SV40 and SA12 , the host range domain seems to be missing. The structure of the large T antigen is schematically shown in Figure 4.

Late region

In the late region of the genome there are open reading frames for the capsid proteins VPl, VP2 and VP3 (Figure 1) .

KIPyV VPl of ST 60 is encoded by nucleotides 1498-2634 of SEQ ID NO: 1, and has the amino acid sequence shown in SEQ ID NO: 6.

KIPyV VP2 of ST 60 is encoded by nucleotides 441-1634 of SEQ ID NO: 1, and has the amino acid sequence shown in SEQ ID NO: 4. KIPyV VP3 of ST 60 is encoded by nucleotides 870-1634 of SEQ ID NO: 1, and has the amino acid sequence shown in SEQ ID NO: 5.

KIPyV VPl of ST 350 is encoded by nucleotides 1498-2634 of SEQ ID NO: 2, and has the amino acid sequence shown in SEQ ID NO: 11. KIPyV VP2 of ST 350 is encoded by nucleotides 441-1634 of SEQ ID NO: 2, and has the amino acid sequence shown in SEQ ID NO: 9. KIPyV VP3 of ST 350 is encoded by nucleotides 870-1634 of SEQ ID NO: 2, and has the amino acid sequence shown in SEQ ID NO: 10.

KIPyV VPl of ST 380 is encoded by nucleotides 1498-2634 of SEQ ID NO: 3, and has the amino acid sequence shown in SEQ ID NO: 6. KIPyV VP2 of ST 380 is encoded by nucleotides 441-1634 of SEQ ID NO: 3, and has the amino acid sequence shown in SEQ ID NO: 4. KIPyV VP3 of ST 380 is encoded by nucleotides 870-1634 of SEQ ID NO: 3, and has the amino acid sequence shown in SEQ ID NO: 5.

As in all polyomaviruses, VP3 is encoded by the same ORF as VP2 by the use of an internal start codon. There is an overlap between the C terminus of VP2/3 and the N terminus of VPl, as is the case in other polyomaviruses . It can be noted that both VP2 and VP3 of KIPyV are large in comparison with other members of the polyomavirus family (400 and 256 aa, respectively) .

For VPl there is only one possible start codon, in contrast to VPl of BKV, JCV and SV40. The degree of homology with other VPl proteins is remarkably low (Table 2) . VPl has only 30% identity with its closest counterparts JCV and MPyV.

The VP2/VP3 gene showed even lower similarity to its counterparts in other polyomaviruses (Table 2) . Neither a nucleotide sequence nor a translated amino acid sequence BLAST search using this gene sequence generated any significant matches in the public databases. Thus, the identity of this ORF is only indicated by its position in the genome. VP2/3 of all other polyomaviruses contain a conserved VPl-binding domain (located at approximately aa 281-295 in MPyVP2) . No corresponding sequence is found in KIPyV. In KIPyV VPl, the only region that shows a relatively high degree of similarity to other polyomaviruses is the sequence that in murine polyomavirus VPl has been shown to bind calcium, corresponding to approximately aa 237-248 in VPl of KIPyV. Otherwise, there is very limited homology to other polyomaviruses also in VPl.

Several polyomaviruses such as BKV, JCV and SV40 express an agnoprotein from the late mRNA. In KIPyV the region between the start codons of VP2 and ST/LT, respectively, is large (513 bp) and this could possibly indicate presence of an agno gene. However, there is no corresponding ORF present in this region. The lack of an open reading frame for agnoprotein is interesting, since this protein is expressed by the two previously known human polyomaviruses, as well as SV40 and SAl2. The functional implications of this are unclear, since the function of the agnoprotein still remains to be fully elucidated. Regulatory region

The non-coding regulatory region contains the promoters for early and late gene transcription, origin of replication as well as transcriptional enhancers. The regulatory region comprises nucleotides 4968 to 440 (as explained elsewhere herein, the numbering of the circular KIPyV genome starts with the origin of replication in the regulatory region) . An alignment of the origin of replication of different polyomaviruses is shown in Figure 2. In the core ori of KI polyomavirus there are three potential large T antigen binding sites, compared with four in most polyomaviruses. Two of these have the classical sequence GAGGC while the third one has the sequence GGGGC. An A/T rich domain, probably harboring a TATA-box for the early mRNA, lies to the late side of these binding sites. To the early side, polyomaviruses normally contain an imperfect palindrome followed by additional LT binding sites but the corresponding sequence in KI polyomavirus does not show the palindrome pattern. Following this sequence there are three additional potential binding sites for large T antigen.

Putative binding sites for transcription factors were predicted in silico. Transcription factors with more than one putative binding site were c-Ets-1, Oct-1 and NF-I (Figure 3). In addition, there were transcription factors with a single putative binding site. No binding sites for SpI could be found.

Phylogenetic trees were constructed based on alignments of the first isolate Stockholm 60 with known viruses of the genus Polyomaviridae . The complete genomes and the amino acid sequences of the early and late proteins, respectively, were aligned and neighbor-joining trees generated using ClustalX version 1.83. The data were bootstrapped with 1000 replicates and trees were viewed using NJplot . For whole-genome analysis, the non-coding control regions were removed in accordance with established conventions and nucleotide 1 was assigned to the first nucleotide in the T antigens . Analysis of early protein genes (small t antigen, large T antigen) consistently clustered KIPyV with JCV, BKV, SV40 and SA12 but as an outlier in this clade (Figure 5) . Analysis of the complete genome yielded highly similar results. In contrast, analysis of the late protein genes (VPl, VP2, VP3) consistently classified KIPyV as the most distant group member (Figure 5) .

A possible explanation for the divergent results of the phylogenetic analysis could be that the virus once emerged by recombination of two phylogenetically distant viruses, each contributing half of the genome. Alternatively, the early region may be conserved due to functional constraints not applicable to the late genes, which have therefore diverged at a more rapid rate. It is possible that future discoveries of additional polyomavirus species, e.g. in other primates, could make the phylogenetic tree more complete and provide additional clues to the evolution of KIPyV. Several new members of the polyomavirus family besides KIPyV have been discovered in the last few years [17, 18] . The unique late region of KIPyV indicates that it may be the first discovered member of a new subfamily of polyomaviruses .

KIPyV polypeptides, including VPl, VP2 and VP3 polypeptides and small t antigen and large T antigen polypeptides, as well as polypeptides with amino acid sequences at least 70, 80, 90, 95, 98 or 99 % amino acid sequence identity to the said VPl, VP2 , VP3 , small t antigen and large T antigen polypeptides, form part of the invention, as do fragments e.g. peptide fragments of the polypeptides. Algorithms that can be used to calculate % identity of two amino acid sequences include e.g. BLAST [34] ,

FASTA [35], or the Smith-Waterman algorithm [36], e.g. employing default parameters. Fragments of the VPl, VP2 , VP3 and large T antigen polypeptides are typically at least or about 10 amino acids in length, e.g. at least or about 15, 20, 25, 30, 35, 40, 50, 75, 100, 150 or 200 amino acids in length. For example, a fragment may be up to 200 amino acids in length, e.g. between 50 and 200 amino acids. Fragments of small t antigen polypeptide are typically at least or about 10, 50, 75, 100, 125 or 150 amino acids in length. For example a fragment of small t antigen polypeptide may be up to 150 amino acids in length, e.g. between 50 and 150 amino acids. Polypeptides comprising such fragments, and polypeptides and fragments that differ at one or more residues through substitution, addition or deletion, are also included in the invention.

KIPyV nucleic acid molecules, nucleic acid molecules encoding polypeptides and fragments according to the invention, and nucleic acid molecules that specifically hybridise to nucleotide sequences disclosed herein are all aspects of the invention. The nucleic acid molecules may be provided as plasmids and vectors comprising the KIPyV sequences (e.g. expression vectors, viral and non-viral vectors) .

The nucleic acid and polypeptide sequences of KIPyV may be used to diagnose the presence of the virus. Nucleic acids and polypeptides of the virus described herein can be used as the basis for designing and/or producing diagnostic materials for determining whether an individual is or has been infected with KIPyV, for example by testing for, identifying or demonstrating the presence of the virus in a sample, or by testing for the presence of anti-KIPyV antibody in a sample.

Diagnostic assays can be performed to test for the presence of KIPyV, or an antibody to KIPyV, in a sample. Samples may be derived from individuals to be tested, especially individuals with cancer, immunosuppression, CNS disease, unexplained disease of suspected infectious origin, or blood donors. Samples may be taken from individuals suspected to be infected with polyomavirus , especially KIPyV, and/or individuals with symptoms or conditions associated with polyomavirus infection. For diagnostic assays, a test sample may be provided in liquid form or as a tissue sample. A sample may be from the respiratory tract, e.g. a nasopharyngeal aspirate sample or bronchoalveolar lavage, or it may be a faecal sample, urine, blood, cerebrospinal fluid, or a surgically obtained biopsy sample. The test sample may be, for example, a tissue section. Tissue may for example be obtained from a tumor.

In some embodiments of the invention, a sample is tested for KIPyV by determining whether KIPyV nucleic acid or polypeptide is present in the sample. Various methods are available to the skilled person for testing the sample, for example testing for hybridisation of KIPyV nucleic acid to a specific primer or probe, or testing for binding of KIPyV polypeptide to a binding member such as an antibody. Detection of the presence of KIPyV nucleic acid or KIPyV polypeptide in the sample indicates that the sample is positive for KIPyV.

For example, the sample may be tested by being contacted with a binding member such as an antibody under appropriate conditions for binding. The binding member may optionally be labelled with a detectable label. Examples of suitable labels are described elsewhere herein. For example, the label may be a fluorescent label or an enzyme producing a detectable, e.g. coloured, product when a substrate is added. Binding may then be determined, e.g. using a reporter system. Where a panel of antibodies is used, different reporting labels may be employed for each antibody so that binding of each can be determined. Testing for binding of KIPyV polypeptide to an antibody may employ e.g. immunofluorescence (IF) , immunohistochemistry, immunochromatography, or an enzyme immunoassay (EIA) .

For example, a method of testing a sample for the presence of a KIPyV polypeptide by determining binding to a binding member, e.g. antibody, may comprise:

(i) providing a test sample, e.g. on a support e.g. an inert solid support such as a glass slide; (ii) contacting the test sample with binding members labelled with a detectable label e.g. a fluorescent label, under conditions in which the binding member binds to a KIPyV polypeptide (if present) to form a binding member-polypeptide complex,-

(iii) washing the sample or support to remove any unbound binding member ; and (iv) testing for the presence of the detectable label, wherein the presence of the detectable label indicates that the presence of KIPyV polypeptide in the sample, i.e. that the sample is positive for KIPyV.

For example, this method may be used in immunohistochemistry, the test sample being a tissue section. A method of testing a tissue section for the presence of a KIPyV polypeptide by determining binding of said polypeptide to a binding member may comprise detection of said KIPyV polypeptide with a fluorescently or enzyme labelled antibody.

Alternatively, a method of testing a sample for the presence of a KIPyV polypeptide by determining binding to a binding member, e.g. antibody, may comprise: (i) providing a test sample, e.g. on a support e.g. an inert solid support such as a glass slide,-

(ii) contacting the test sample with a binding member against a KIPyV polypeptide under conditions in which the binding member binds a KIPyV polypeptide, if present, to form a binding member- polypeptide complex,-

(iii) washing the sample to remove any unbound binding member; (iv) contacting the sample with a second binding member, wherein the second binding member binds the said binding member against a KIPyV polypeptide, if present, and wherein the second binding member is labelled with a detectable label, e.g. the second binding member may be a labelled anti-Ig antibody; (v) washing the sample to remove any unbound binding member,- and (iv) testing for the presence of the detectable label, wherein the presence of the detectable label indicates the presence of KIPyV polypeptide in the sample. A sample may be fixed to the support for example by allowing the sample to dry on to the support .

Where the label is a fluorescent label, methods may comprise testing for fluorescence, e.g. by fluorescence microscopy.

Alternatively, detection of the label may be by eye, where the label is visually detectable e.g. coloured latex, colloidal gold or colloidal selenium. Detection by enzyme-linked assay is also possible, where the binding member is labelled with an enzyme that produces a detectable, e.g. coloured, product when a substrate is added.

A method using EIA normally comprises: providing a binding member, e.g. an antibody, against KIPyV on a support, wherein the binding member may be immobilised on the support, and wherein the support is typically an inert solid such as a polystyrene plate (e.g. microtitre plate), a nitrocellulose membrane or microparticles e.g. latex microparticles or paramagnetic beads,- contacting the binding member with the test sample under conditions in which the binding member binds to a KIPyV polypeptide (if present) to form a binding member-polypeptide complex; washing the complex to remove any unbound protein and/or other compounds from the sample,- contacting the complex with a second binding member, e.g. antibody, against KIPyV, wherein the second binding member is linked to an enzyme that catalyses conversion of a substrate to a detectable product, thereby forming a binding member - polypeptide-binding member-enzyme complex if polypeptide is present ,- washing away any unbound second binding member; and contacting the enzyme with the substrate and assaying for the presence of the detectable product; wherein detection of the detectable product indicates the presence of KIPyV polypeptide in the sample. Alternatively, immunochromatography-type methods may be used to test a sample for the presence of a KIPyV polypeptide. A method may comprise providing a device comprising a body, e.g. an absorbent membrane, on which one or more binding members, e.g. antibodies, against KIPyV are supported, wherein a test sample is passable through the body by capillary flow such that the sample contacts the one or more binding members . The device may comprise a detection area for detection of binding member- polypeptide complexes. The device may be designed such that KIPyV polypeptide present in the sample can bind a said binding member to form a binding member-polypeptide complex, wherein the complex accumulates in a designated area of the body of the device where it may be detected. A method may comprise allowing a test sample to pass through the body of the device by capillary flow, and determining whether a binding member-polypeptide complex is present in the detection area, wherein presence of the complex in the detection area indicates that KIPyV polypeptide is present in the sample .

The device also forms an aspect of the present invention. The device may be disposable, e.g. it may be a single-use test device .

The binding members supported on the body of the device may be labelled or unlabelled. Where the binding members are labelled, the complex may be detected in the detection area by detecting the label. Accordingly, a method may comprise determining whether the label is present in the detection area. Where the binding members are unlabelled, the complex may be detected in the detection area by contacting the complex with a second binding member, wherein the second binding member is labelled with a detectable label, and wherein the second binding member binds to the complex e.g. to the KIPyV polypeptide or to the binding member against KIPyV.

Detectable labels are described elsewhere herein. Detection of the label may be by eye, where the label is visually detectable e.g. coloured latex, colloidal gold or colloidal selenium. Detection by enzyme-linked assay is also possible, where the binding member is labelled with an enzyme that produces a detectable, e.g. coloured, product when a substrate is added. The label may be a fluorescent label, detectable by detecting fluorescence e.g. by fluorescence microscopy.

A binding member such as an antibody may be used to isolate and/or purify its binding partner polypeptide from a test sample, to allow for sequence and/or biochemical analysis of the polypeptide to determine whether it has the sequence and/or properties of the polypeptide of interest, or if it is a mutant or variant form. Amino acid sequencing is routine in the art using automated sequencing machines.

Probes and primers can be used to identify KIPyV nucleic acid in a sample. A method may include hybridisation of one or more (e.g. two) probes or primers to target nucleic acid in the sample. A test sample may be probed under conditions for selective hybridisation and/or subjected to a specific nucleic acid amplification reaction such as the polymerase chain reaction (PCR) . A method may include hybridisation of one or more (e.g. two) probes or primers to target nucleic acid. The hybridisation may be as part of a PCR procedure e.g. as described in more detail below, or as part of a probing procedure not involving PCR.

Binding of a probe to target nucleic acid (e.g. DNA) may be measured using any of a variety of techniques at the disposal of those skilled in the art. For instance, probes may be radioactively, fluorescently or enzymatically labelled. Other methods not employing labelling of probe include examination of restriction fragment length polymorphisms, amplification using PCR or nucleic acid sequence based amplification (NASBA) , ligase chain reaction (LCR) , RNAase cleavage and allele specific oligonucleotide probing. Any of these methods, or any other suitable method, may be used to test a sample for the presence of KIPyV nucleic acid.

NASBA is a method designed for amplification of RNA targets. An exponential amplification is achieved at stable 41°C temperature by the activities of the enzymes AMV-RT, RNase H, and T7 DNA- dependent RNA polymerase. NASBA will amplify also DNA and can be modified by the skilled person for use in the detection of KIPyV DNA. Alternatively, NASBA can be used to identify replicating KIPyV by identification of mRNA transcripts. NASBA is described in [19] .

LCR is an established method for molecular diagnostics and is an alternative to PCR. For LCR, the sample, or extracted DNA from the sample, is mixed with four oligonucleotide probes, which are complementary to a specific target region of KIPyV, and thermostable ligase. The probes are designed to hybridize adjacently to each other on the target DNA, one pair to the sense strand, and the other pair to the antisense strand. In the presence of the template molecule they will be ligated to a longer molecule. By cycling the temperature this hybridization and ligation reaction will be repeated and the ligated product accumulated exponentially, and can be detected by a range of techniques, as for PCR.

Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes. Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the DNA fragments on the filter and binding determined. DNA for probing may be prepared from RNA preparations from cells. Those skilled in the art can employ suitable conditions of the desired stringency for selective hybridisation, taking into account factors such as oligonucleotide length and base composition, temperature and so on.

The skilled person is readily able to design suitable probes, label them and devise suitable conditions for the hybridisation reactions, assisted by textbooks such as Sambrook et al [37] and Ausubel et al [38] . Those skilled in the art can employ suitable conditions of the desired stringency for selective hybridisation, taking into account factors such as oligonucleotide length and base composition, temperature and so on. Hybridisation may be performed under highly stringent conditions, such as 6xSSC at a temperature of 65 °C. For oligonucleotide primers, hybridisation may be performed under hybridising conditions for PCR, e.g. at 54°C.

Nucleic acid probes and oligonucleotide primers may be produced that specifically hybridise to KIPyV nucleic acids including nucleic acid molecules comprising nucleotide sequences described herein. The KIPyV genome may be present as a circular double- stranded DNA molecule in virus particles or infected cells or as DNA integrated in the genome of infected cells. The probe or primer may hybridise to a nucleic acid molecule with a nucleotide sequence described herein or to a nucleic acid molecule with a nucleotide sequence that is the complement of any of the sequences described herein. Assays may be for detecting mRNA or genomic DNA of KIPyV, where genomic DNA may comprise nucleotide sequences shown herein or the complement thereof. For example, oligonucleotide or polynucleotide fragments of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO 3 or the complementary sequence thereof can be used as primers or probes . Such primers and probe sequences may be modified by addition, substitution, insertion or deletion of one or more nucleotides, and the skilled person will be able to design suitable modified sequences that retain ability to hybridise with the target sequence.

PCR may be used to test for, identify or demonstrate the presence of KIPyV nucleic acid in a sample. Such an assay may be used diagnostically to determine whether an individual is infected with KIPyV. PCR involves use of a pair of primers, termed "forward" and "reverse" primers, which hybridise specifically to two complementary target nucleic acid strands, respectively. Thus, one primer may specifically hybridise to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO 3 and the second primer may specifically hybridise to the complement of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO 3.

PCR techniques for the amplification of nucleic acid are described in [20-24] . PCR comprises steps of denaturation of template nucleic acid (where necessary, for a double-stranded template) , annealing of primers to target nucleic acid, and polymerisation of target nucleic acid to produce a specific DNA product corresponding to the nucleic acid located between (and including) the forward and reverse primers. The product is amplified through repetition of these steps. PCR can thus be used to amplify specific sequences from genomic DNA or specific RNA sequences.

KIPyV has a circular double-stranded DNA genome. PCR of KIPyV nucleic acid involves (i) denaturing the double-stranded DNA to separate the strands of KIPyV nucleic acid (ii) first primer hybridisation, in which one primer binds to KIPyV nucleic acid, (iii) polymerisation from first primer to produce DNA strand complementary to initial KIPyV nucleic acid strand, (iv) denaturation to separate complementary strands and primers, (v) hybridisation of first and second primer to complementary target nucleic acid strands, whereby second primer hybridises to complementary strand synthesised from first primer, (vi) polymerisation from first and second primer, (vii) repetition of steps (iv) - (vi) for a suitable number of cycles.

Primers may hybridise specifically to KIPyV nucleic acid encoding VPl, e.g. to a sequence of nucleotides 1498 to 2634 shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Example primer sequences are shown in SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20.

The skilled person can select a suitable length nucleic acid to use as a PCR primer. For example, an oligonucleotide primer may be at least 10, 12 or 15 nucleotides in length. Preferably an oligonucleotide primer has a length of 30, 27 or 24 nucleotides or less. For example, it may be about 12, 15, 18, 20, 21 or 24 nucleotides in length.

Preferably, the forward and reverse primers hybridise within a distance of 500 nucleotides from each other, and thereby define a region of 500 nucleotides or less for amplification by PCR. Thus, the specific nucleotide sequence to which the forward primer hybridises is within 500 nucleotides of the specific nucleotide sequence to which the reverse primer hybridises on the complementary strand.

An assay may detect KIPyV nucleic acid, e.g. nucleic acid comprising a nucleotide sequence as shown herein, using one or more nucleic acid probes or primers that hybridise specifically to KIPyV nucleic acid.

In a preferred embodiment, an assay method comprises providing a test sample, and testing for the presence of KIPyV nucleic acid in the sample using PCR with oligonucleotide primers that hybridise to KIPyV nucleotide sequences. Primers may hybridise to any region within SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. For example, the first and/or second primeer may hybridise within the sequence of nucleotides 1498-2634 of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO: 3 encoding VPl, nucleotides 441-1643 of SEQ ID NO:1, SEQ ID NO: 2 or SEQ ID NO: 3 encoding VP2 , nucleotides 870-1643 of SEQ ID NO:1, SEQ ID NO : 2 or SEQ ID NO : 3 encoding VP3 , nucleotides 4967-4716 and 4328-2655 of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 encoding large T antigen, or within the sequence of nucleotides 4967-4392 of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3 encoding small t antigen. Primers may target the non-coding regulatory region, i.e. the first and/or second primer may hybridise within the sequence of nucleotides 4968 to 440. The assay may comprise adding oligonucleotide PCR primers to the sample, placing the sample in conditions for PCR, and then testing the sample for the presence of a PCR product. Conditions for PCR preferably include at least 20, 25, 30 or 35 PCR cycles.

The assay method may comprise a first and a second PCR, the first PCR being performed with a first set of primers and the second PCR being performed with a second set of primers. The specific nucleotide sequence to which the second primer pair hybridises may be within the nucleotide sequences to which the first set of primer hybridises. The second primer pair would then be called "nested primers". For example, primer POLVP1-118F (SEQ ID NO: 19) and primer POLVP1-324R (SEQ ID NO: 20) are nested primers relative to primer POLVP1-39F (SEQ ID NO: 17) and primer POLVPl- 363F (SEQ ID NO: 18) .

Detection of PCR product, e.g. by visualisation of a band of the expected size following gel electrophoresis of the sample, indicates that the sample is positive for KIPyV nucleic acid. As an additional check, the PCR-product may be sequenced in order to confirm that it is KIPyV nucleic acid. Absence of a PCR product indicates that the sample is negative for KIPyV nucleic acid.

Preferably, the assay is capable of detecting multiple isolates of KIPyV.

Example 3 describes in detail the performance of PCR assay methods according to an embodiment of the invention.

Methods of the invention may comprise detecting the presence of KIPyV polypeptide or nucleic acid in a sample and thus concluding that the sample is positive for KIPyV, indicating that the individual from whom the sample was obtained is infected with KIPyV. Further aspects of the invention are kits for testing a sample for the presence of KIPyV, e.g. testing for KIPyV nucleic acid or KIPyV polypeptide in a sample. For example, a kit for testing a sample for a KIPyV polypeptide may be for use in a method of determining whether a polypeptide in a sample binds to a binding member, as described above.

A kit may comprise binding members for one or more KIPyV polypeptides e.g. antibody molecules, which may be labelled with a detectable label, or may be unlabelled. Examples of suitable detectable labels are described elsewhere herein. The binding members may be provided in solution, e.g. packaged in a container e.g. a phial. A kit may comprise unlabelled binding members, e.g. antibodies, for a KIPyV polypeptide, and labelled binding members that bind the unlabelled binding members, e.g. anti Ig antibodies. Labelled and unlabelled binding members may be provided in separate containers e.g. phials. Where the label is an enzyme that catalyses conversion of a substrate to a detectable product, a kit may further comprise a suitable enzyme substrate for detection of the label. For example, the kit may comprise a container e.g. a bottle or phial comprising substrate for the enzyme, typically a solution, which may be provided at a suitable concentration for use in EIA.

A kit may comprise a device for testing a sample for KIPyV, the device comprising a body on which one or more binding members for a KIPyV polypeptide are supported, wherein a test sample is passable through the body by capillary flow such that the sample contacts the one or more binding members to form a binding-member polypeptide complex if KIPyV polypeptide is present in the sample, and wherein the body also comprises a detection area for detection of the binding member-polypeptide complexes. The binding members may be labelled or unlabelled. The device may be a single-use test device for an immunochromatography assay, on which a sample is to be provided, and containing e.g. labelled or unlabelled binding members for KIPyV polypeptides. The kit may further comprise phials of diluents, and/or labelled or unlabelled binding members for KIPyV polypeptides e.g. antibody molecules, e.g. provided in solution, as described above.

A kit may comprise binding members for one or more KIPyV polypeptides, wherein the binding members are immobilised on a support. The support is preferably an inert solid such as a polystyrene plate (e.g. microtitre plate), a nitrocellulose membrane or microparticles e.g. latex microparticles or paramagnetic beads. Normally the binding members bound to the support are unlabelled.

Washing solution or solutions, for washing away unbound protein, other compounds from the sample, or unbound binding member, may also be included in kits, normally in one or more containers e.g. bottles or phials. Normally the elements of a kit e.g. support; labelled binding member; unlabelled binding member; substrate and/or washing solution are separately contained in the kit e.g. provided in separate packages or containers from one another. A kit may also include one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g. a swab for removing cells from the buccal cavity or a syringe for removing a blood sample (such components generally being sterile) . A kit may further comprise a support, e.g. an inert solid support such as a glass slide, on which a sample is to be provided. As will be apparent to the skilled person, components included in the kit will depend on the nature of the method for which it is intended.

Nucleic acid primers may be provided as part of a kit, e.g. in a suitable container. The primers are typically provided in separate containers within a kit package, and are normally in the form of sterile solutions. The kit may include instructions for use of the nucleic acid, e.g. in PCR and/or a method for determining the presence of nucleic acid of interest in a test sample. A kit wherein the nucleic acid is intended for use in PCR may include one or more other reagents required for the reaction, such as polymerase, nucleosides, buffer solution etc. The nucleic acid may be labelled. A kit for use in determining the presence or absence of nucleic acid of interest may include one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g. a swab for removing cells from the buccal cavity or a syringe for removing a blood sample (such components generally being sterile) .

KIPyV polypeptides can also be used to investigate whether an individual has antibodies for KIPyV. The presence of antibodies for KIPyV indicates that the individual is or has been infected with KIPyV. Accordingly, an aspect of the invention relates to testing of a sample for the presence of antibody to one or more KIPyV polypeptides by determining whether antibodies in the sample bind to one or more KIPyV polypeptides. Thus, a sample may be tested for the presence of antibodies to VPl, VP2 , VP3 , small t antigen or large T antigen polypeptide. As is recognized by the skilled person a KIPyV polypeptide used in such methods should be provided in its native conformation. For example, VPl, VP2 and/or VP3 may be provided in the form of virus-like particles (VLP) . For example, the sample may be tested for the presence of antibodies to VPl by determining whether antibodies in the sample bind to VPl polypeptide, for example, in the form of a VLP. The VLP may comprise VP2 and/or VP3 in addition to VPl. VLPs are described in more detail elsewhere herein.

The method typically comprises providing a KIPyV polypeptide on a support. Normally the polypeptide is immobilised on the support. The support is typically an inert solid such as a polystyrene plate (e.g. microtitre plate), a nitrocellulose membrane or microparticles e.g. latex microparticles or paramagnetic beads. The method generally further comprises contacting the KIPyV polypeptide with the test sample under conditions in which the KIPyV polypeptide binds to an antibody for KIPyV (if present) to form a polypeptide-antibody complex; and determining or testing for formation of a polypeptide-antibody complex. Normally, the support is washed after contacting the KIPyV polypeptide with the sample, to remove any unbound protein and/or other compounds from the sample .

Determining or testing for formation of the complex may comprise contacting the complex with a detectably-labelled antibody, which may be specific for immunoglobulin, e.g. directed against the Fc domain of IgG. Any unbound anti-Ig antibody is then normally washed away, before assaying for the presence of the detectably- labelled antibody bound to the complex. Detection of the labelled antibody indicates the presence of antibody against KIPyV polypeptide in the sample.

Normally, an enzyme immunoassay EIA is used to detect the labelled antibody. Thus, the anti-Ig antibody may be linked to an enzyme that catalyses conversion of a substrate to a detectable product. There is a range of detection systems for EIA and other immunoassays available to the skilled person, such as alkaline phosphatase, peroxidase and chemoilluminescent assays. Assaying for the presence of the labelled antibody may comprise contacting the enzyme with the substrate and assaying for the presence of the detectable product . The product can be detected by eye or in an instrument designed for the purpose, for example a spectrophotometer designed for microtitre plates or a large multipurpose clinical laboratory assay instrument.

For analysis of human samples, the anti-Ig antibody is normally specific for the Fc region of human immunoglobulins, e.g human IgG or IgM.

Materials for detecting anti-KIPyV antibody in a sample may be provided in kit form. Preferably the kit is for use in a method comprising EIA, e.g. as described above. A kit may comprise a KIPyV polypeptide e.g. KIPyV VPl, VP2 , VP3 , small t antigen or large T antigen polypeptide or more than one KIPyV polypeptide, bound to a support. Normally the polypeptide is immobilised on the support. The support is preferably an inert solid such as a polystyrene plate (e.g. microtitre plate), a nitrocellulose membrane or microparticles e.g. latex microparticles or paramagnetic beads. The kit may also comprise antibody specific for immunoglobulin, e.g. the Fc domain of anti-IgG, wherein the anti-Ig antibody is detectably labelled. For example it may be linked to an enzyme that catalyses conversion of a substrate to a detectable product. The kit may comprise a container e.g. a bottle or phial comprising substrate for the enzyme, typically a solution, and preferably at a suitable concentration for use in EIA, e.g. ELISA. Washing solution or solutions, for washing away unbound protein, other compounds from the sample, or unbound anti-Ig antibody, may also be included in the kit, normally in one or more containers e.g. bottles or phials. Normally the elements of the kit e.g. polypeptide on support; anti-Ig antibody; substrate and/or washing solution are separately contained in the kit e.g. provided in separate packages or containers from one another.

Binding members for KIPyV can be produced by the skilled person. A binding member for KIPyV binds specifically to an epitope on KIPyV, typically to a KIPyV polypeptide. For example, a binding member may be an antibody molecule or a non-antibody protein that comprises an antigen-binding site.

Preferably, the binding member is for a KIPyV polypeptide encoded by a nucleic acid molecule shown herein, such as VPl, VP2 , VP3 , small t antigen or large T antigen. Preferably, the binding member is for KIPyV capsid protein e.g. VPl, VP2 and/or VP3.

Typically, the binding member is an antibody molecule. The term "antibody" describes an immunoglobulin whether natural or partly or wholly synthetically produced. The term also covers any polypeptide or protein comprising an antibody antigen-binding site. The term "antigen-binding site" describes the part of a molecule that binds to and is complementary to all or part of the target antigen. In an antibody molecule it is referred to as the antibody antigen-binding site, and comprises the part of the antibody that specifically binds to and is complementary to all or part of the target antigen. Where an antigen is large, an antibody may only bind to a particular part of the antigen, which part is termed an epitope. An antibody antigen-binding site may be provided by one or more antibody variable domains. Preferably, an antibody antigen-binding site comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH) . Antibody molecules and fragments that comprise an antibody antigen-binding site include Fab, scFv, Fv, dAb, Fd, minibodies and diabodies. As antibodies can be modified in a number of ways, the term "antibody molecule" should be construed as covering any binding member or substance having an antibody antigen-binding site with the required specificity. Thus, this term covers antibody fragments and derivatives, including any polypeptide comprising an antibody antigen-binding site, whether natural or wholly or partially synthetic. Chimeric molecules comprising an antibody antigen-binding site, or equivalent, fused to another polypeptide are therefore included. Cloning and expression of chimeric antibodies are described in EP-A-0120694 and EP-A-0125023 , and a large body of subsequent literature.

Binding members, e.g. antibodies, to KIPyV polypeptides may be used for treating a KIPyV associated disease. Binding members, e.g. antibodies, to KIPyV polypeptides may be used for the preparation of a medicament for the treatment of a KIPyV associated disease. A KIPyV associated disease treated with said binding members or said medicament may, for example, be cancer, a disease of the nervous system, or a complication in immunosuppressed patients. An individual to be treated with said binding members or medicament may be an individual infected with KIPyV, an individual which is suspected to be infected with KIPyV, an individual suffering from cancer or a disease of the nervous system, or an immunosuppressed individual. Individuals infected with KIPyV may be identified by using the diagnostic methods disclosed herein. For therapeutic use the binding member is preferably a human or humanized antibody molecule. Various techniques for generating human or humanized antibodies are available [25, 26, 27] . Binding members for diagnostic use are normally monoclonal or polyclonal antibodies derived from laboratory animals.

Alternatively, an antigen binding site may be provided by means of arrangement of complementarity determining regions (CDRs) on non-antibody protein scaffolds such as fibronectin or cytochrome B, or by randomising or mutating amino acid residues of a loop within a protein scaffold to confer binding specificity for a desired target [28, 29] . The scaffold may be a human or non- human protein.

A binding member of the invention may carry a detectable label, such as an enzyme that catalyses a reaction producing a detectable product, e.g. for use in EIA. Other detectable labels include for example fluorescent labels, radiolabels, biotin, coloured latex, colloidal gold or colloidal selenium.

Compounds that bind to KIPyV polypeptides, including binding members for KIPyV polypeptides, and inhibitors of KIPyV polypeptides, may be identified by screening candidate agents e.g. from compound libraries. For example, a method of identifying a compound that binds a KIPyV polypeptide may comprise exposing a KIPyV polypeptide or a fragment thereof to a test agent, and determining whether the test agent binds to the KIPyV polypeptide or fragment thereof. Preferably the KIPyV polypeptide is VPl, VP2 , VP3 , small t antigen or large T antigen, or a fragment thereof. The method may further comprise determining whether the test agent inhibits the function of the KIPyV polypeptide, for example whether the agent inhibits the ability of KIPyV to infect a cell e.g. in an in vitro assay. Compounds that bind KIPyV polypeptide, including binding members and inhibitors, may be useful as antiviral therapeutics for treating or preventing KIPyV infection. Such a compound may be formulated into a composition comprising a pharmaceutically acceptable excipient .

A KIPyV nucleic acid, polypeptide or fragment according to the invention may be used for raising an immune response in an individual, for example for generating antibodies against KIPyV polypeptides. Alternatively, KIPyV particles, or purified fragments thereof, may be used for raising an immune response in an individual, for example for generating antibodies against KIPyV polypeptides. For example live e.g. live attenuated, or killed, e.g. formalin inactivated, KIPyV may be used. KIPyV particles may be composed of a single copy of the KIPyV genomic DNA, surrounded by the virus capsid. The capsid may comprise VPl, VP2 , and/or VP3 , of which VPl may be the main component.

A KIPyV particle or purified fragment thereof and/or a KIPyV nucleic acid molecule, polypeptide or fragment thereof may be formulated into a composition comprising a pharmaceutical excipient, e.g. formulated for administration by injection. Adjuvant may also be included in the composition. The nucleic acid may be packaged e.g. in a liposome or may be free in solution. KIPyV nucleic acid molecules, polypeptides or fragments thereof may be provided by, contained as part of, or isolated from KIPyV particles e.g. attenuated or killed KIPyV e.g. formalin inactivated KIPyV, or may be recombinantly produced. For example, VPl, VP2 and/or VP3 may be expressed in a recombinant system to produce virus-like particles (VLPs) , and VLPs may be formulated into a composition comprising a pharmaceutical excipient, e.g. formulated for administration by injection. The compositions may be used for inducing an immune response, for example for raising antibodies and/or for vaccination of individuals against KIPyV.

KIPyV particles and fragments thereof, and virus-like particles comprising VPl, VP2 and/or VP3 are all aspects of the invention. A virus-like particle (VLP) is a multimer of one or more recombinant virus capsid proteins, and may comprise VPl, VP2 and/or VP3. Methods are known in the art for making VLPs , and any suitable method may be used to produce VLPs from KIPyV polypeptides VPl, VP2 and/or VP3. For polyomaviruses, VLPs usually form spontaneously when VPl is expressed at high quantities. For KIPyV VLPs, the other capsid proteins VP2 and/or VP3 could also be expressed or co-expressed, although this may not be required. The three-dimensional structure of a VLP resembles that of the native virus particle, and therefore VLPs are very effective reagents for raising or detecting antibody responses in humans or animals, including experimental animals. Based on what is known about other polyomaviruses, VPl, preferably in the form of virus-like particles, is likely to be particularly useful for raising an immune response against KIPyV. Thus, one aspect of the invention is a virus-like particle comprising VPl, and optionally further comprising VP2 and/or VP3.

Binding members, polypeptides, nucleic acid molecules and fragments according to the invention are normally provided in isolated form. The term "isolated" means that they are normally free or substantially free of material with which they are naturally associated such as other polypeptides or nucleic acids with which they are found in their natural environment, or the environment in which they are prepared (e.g. cell culture) when such preparation is by recombinant DNA technology practised in vitro or in vivo. They may be formulated with diluents or adjuvants and still for practical purposes be isolated - for example binding members will normally be mixed carriers if used to coat microtitre plates for use in immunoassays, or will be mixed with pharmaceutically acceptable carriers or diluents when used in diagnosis or therapy. Binding members may be glycosylated or unglycosylated.

The following non- limiting examples are for purposes of illustration only. Example 1: Molecular virus screening

A screening library was constructed from cell-free supernatants of 20 randomly selected, anonymized, nasopharyngeal aspirates submitted to Karolinska University Laboratory, Stockholm, Sweden for diagnostics of respiratory tract infections. The samples were collected from March to June of 2004 and were stored at - 80° C until analyzed. In brief, samples were pooled and the pool was divided into two aliquots, which were filtered through a 0.22 μm or 0.45 μm disc filter (Millex GV/HV, Millipore) respectively. Both aliquots were then ultracentrifuged at 41,000 rpm in an sw41 rotor (Beckman) for 90 min. The resulting pellet was recovered, resuspended and treated with DNase before DNA and RNA were extracted [14] . Extracted DNA and RNA were amplified separately by "random PCR" [15, 30] . The amplification products were separated on an agarose gel and fragments between approximately 600 and 1500 bp length were cloned. A total of four libraries were generated, derived from DNA or RNA and filtered through 0.22 μm or 0.45 μm respectively. Ninety-six clones from each library were sequenced bi-directionally, i.e. totally 384 clones. A set of specially designed C++ and Perl programs were used for automated quality trimming, clustering, BLAST searches, sorting and formatting of the sequence reads. The output was a sorted list of the best database hits for nucleotide and translated sequences .

After vector sequence and low-quality sequence were automatically discarded, sequence reads from 374 (97%) clones remained for database searches. By automated nucleotide and translated BLAST searches [15, 34] , the sequences were categorized into human, bacterial, phage, virus, and unknown sequence (Table 1) . In total, 20% of clones analyzed showed significant (E<10^~5) similarity to viral sequences. Most viral sequences matched human rhinovirus or enterovirus species. An additional five clones closely matched respiratory syncytial virus. A single clone of 363 bp showed weak amino acid similarity (30% identity, E = 0.011) to the VPl gene of SV40 and was selected for further studies . Example 2: Identification and genomic analysis of KI polyomavirus in ST60, ST350 and ST380

A 4808 bp long PCR product reaching around the circular DNA genome was generated by primers directed "outward" from the cloned fragment (Pol-82R: TTGACTTCTTGGCCTTGTTAG (SEQ ID NO: 15) and Pol-315F: AGATGCTGACACAACTGTATG (SEQ ID NO: 16) and using a long-range enzyme mix (Platinum Taq High Fidelity, Invitrogen) . A second PCR product of 500 bp overlapping both ends of the long product and closing the circle was generated by the primers PolconF (GGATTTTGTATGTGCTAGAAC, SEQ ID NO: -21), and PolconR (TTAACTAGAGGTACAACAAGC, SEQ ID NO: 22) . Both PCR products were directly sequenced in order to obtain a consensus sequence for the complete genome. The same procedure was applied for determining the full-length sequences of three isolates (ST60, ST350, ST380) . The complete genomic sequence identified in all three isolates was 5040 nt in length. Putative open reading frames were identified and sequences aligned using Clone Manager Suite 6 (version 6.00) and Align Plus (version 4.10) (Scientific and Educational Software, Durham, NC) . Prediction of putative binding sites for transcription factors was performed by comparison with consensus sequences and with the help of Alibaba Software (version 2.1) [31] .

Example 3 : PCR for the detection of KI polyomavirus

The experiments were performed in a diagnostic laboratory setting, ensuring that necessary precautions to avoid contamination were taken. Positive and negative controls were included in each experiment. DNA was extracted by commercially available kits as described under the respective samples type. Five μl extracted DNA was used as template for the nested PCR reaction. The 50 μl reaction mix used for the first and second PCR reaction consisted of IX GeneAmp PCR buffer II (Applied Biosystems) (10OmM Tris-HCl pH 8.3, 500 mM KCl), 2.5 mM MgCl₂, 0.2 mM each dNTP, 2.5 U of AmpliTaq Gold DNA polymerase (Applied

Biosystems), and 20 pmol each of the primers. First PCR primers were POLVPl-39F (AAG GCC AAG AAG TCA AGT TC) (SEQ ID NO: 17) and POLVP1-363R (ACA CTC ACT AAC TTG ATT TGG) (SEQ ID NO: 18) . Second PCR primers were POLVP1-118F (GTA CCA CTG TCA GAA GAA AC) (SEQ ID NO: 19) and POLVPl-324R (TTC TGC CAG GCT GTA ACA TAC) (SEQ ID NO: 20). Cycling conditions for first and second PCR reactions were: 10 min at 94° C followed by 35 cycles of amplification (94° C 1 min, 54 °C 1 min, 72° C 2 min). Products were visualized on an agarose gel. The product size after second PCR was 207 bp. All PCR-products were sequenced in order to confirm that they were specific for KIPyV.

Example 4 : Prevalence study populations

In order to investigate possible replication sites and suitable sample materials for prevalence studies, several sample sets were investigated for the presence of KIPyV DNA by PCR.

Nasopharyngeal aspirates: 637 stored nasopharyngeal aspirates submitted to Karolinska University Laboratory for diagnostics of respiratory virus infections from July 2004 to June 2005 were studied. Sampling month, age and sex of the patient, and findings by routine diagnostics (Immunofluorescence and virus culture) were recorded before samples were anonymized. The median age of the sampled patients was 7 years (range 0 months-90 years) . 271 samples came from children <2 years old. Total nucleic acids were extracted from 200μl sample by MagAttract

Virus Mini M48 kit (Qiagen) and nucleic acids were eluted in 100 μl . Eluted nucleic acids were initially analyzed in pools of ten samples, and five μl of the pool was used as template for the PCR reaction. Single samples were analyzed from PCR-positive pools.

Feces: 192 fecal samples submitted to Karolinska University Laboratory for diagnostics of virus infections from 2005-07-01 to 2005-11-30 were studied. Samples were mainly submitted for diagnostics of gastroenteritis. Basic sampling data were recorded before samples were anonymized. The median age of the sampled patients was 1 year (range 0 months-17 years) . 119 samples came from children <2 years old. Nucleic acids were extracted from 400 μl of frozen 20% feces suspension by MagAttract Virus Mini M48 kit and the Biorobot M48 instrument (Qiagen) and eluted in 100 μl , and 5 μl were used for subsequent individual PCR assays.

Urine of HSCT recipients : 150 urine samples collected from HSCT recipients for the study of BKV and JCV were analyzed [32] . Fifty of the samples were selected based on previous analysis results: 20 samples were previously shown to be posistive for BKV, 8 for JCV, 2 samples for both BKV and JCV, and 20 samples were negative for both viruses . JCV and BKV status was unknown for the remaining 100 samples. As described previously, samples were analyzed by PCR without preceding DNA extraction [33] .

Serum of HSCT recipients: 33 serum samples drawn from 17 HSCT recipients 2-6 weeks after transplantation were studied. Total nucleic acids were extracted from 200μl serum by QIAamp Virus Spin Kit (Qiagen) and eluted in 50 μl .

Whole blood: Whole EDTA blood was analyzed from 192 healthy volunteer blood donors in Stockholm. DNA was extracted from 200 μl sample using the MagAttract DNA Mini M48 kit and the Biorobot M48 instrument (Qiagen) and eluted in 50 μl .

Leukocytes: 96 frozen preparations of Ficoll-separated leukocytes were studied. Samples were originally sent to the laboratory for diagnostics of CMV by PCR and virus culture, and therefore mainly originated from immunosuppressed patients. DNA was extracted from of 10⁵ cells by MagAttract DNA Mini M48 kit and the Biorobot M48 instrument (Qiagen) and eluted in lOOμl.

Results are summarized in Table 3. KIPyV was detected in nasopharyngeal aspirates and feces, but not in urine, whole blood, leukocyte or serum samples.

Six out of 637 nasopharyngeal aspirates (1%) and one out of 192 fecal samples (0.5%) were positive for KIPyV DNA by PCR targeting the VP-I gene. The identity of the PCR products was confirmed by- sequencing. The results were also confirmed by a second PCR assay targeting the large T gene. Two isolates obtained from nasopharyngeal aspirates were fully sequenced. The ages of the six subjects positive for KIPyV in the nasopharynx ranged from 1 month to 26 years (median 2 years) , and the subject positive in feces was 3 months old. In five of the six nasopharyngeal aspirates, a respiratory virus infection was co-detected in the same sample by standard diagnostics (IF and virus culture) (3 respiratory syncytial virus, 1 human metapneumovirus, 1 influenza A virus) .

Tables

Table 1. Categorization by BLAST search of the sequenced clones derived from 20 pooled respiratory tract samples.

Table 2. Putative proteins encoded by KIPyV (isolate Stockholm 60) .

aMolecular weight was calculated by means of the ProtParam web tool (http://www.expasy.ch/ tools/protparam.html) bAmino acid identity (%) .

Table 3. Summary of results from screening selected human samples for KIPyV by PCR

References

1. Gardner, S. D., Field, A. M., Coleman, D. V. & Hulme, B.

(1971) Lancet 1, 1253-7.

2. Padgett, B. L., Walker, D. L., ZuRhein, G. M., Eckroade, R. J. & Dessel, B. H. (1971) Lancet 1, 1257-60.

3. Knowles, W. A. (2006) Adv Exp Med Biol 577, 19-45.

4. Randhawa, P., Vats, A. & Shapiro, R. (2006) Adv Exp Med Biol 577, 148-59.

5. Vanchiere, J. A., Nicome, R. K., Greer, J. M., Demmler, G. J. & Butel, J. S. (2005) J Infect Dis 192, 658-64.

6. Lee, W. & Langhoff, E. (2006) Adv Exp Med Biol 577, 310-8.

7. Khalili, K., Gordon, J. & White, M. K. (2006) Adv Exp Med Biol 577, 274-87.

8. Bogdanovic, G., Priftakis, P., Giraud, G. & Dalianis, T.

(2006) Anticancer Res 26, 1311-8.

9. Hirsch, H. H. (2002) Am J Transplant 2, 25-30.

10. Goudsmit, J., Wertheim-van Dillen, P., van Strien, A. & van der Noordaa, J. (1982) J Med Virol 10, 91-9.

11. Monaco, M. C, Jensen, P. N., Hou, J., Durham, L. C. & Major, E. O. (1998) J Virol 72, 9918-23.

12. Eash, S., Tavares, R., Stopa, E. G., Robbins, S. H., Brossay, L. & Atwood, W. J. (2004) Am J Pathol 164, 419-28.

13. Barbanti-Brodano, G., Sabbioni, S., Martini, F., Negrini, M., Corallini, A. & Tognon, M. (2006) Adv Exp Med Biol 577, 319-41

14. Allander T. et al, PNAS USA 2001; 98:11609-14

15. Allander T. et al, PNAS USA 2005; 102 (36) : 12891-12896.

16. Riley, M. I., Yoo, W., Mda, N. Y. & Folk, W. R. (1997) J Virol 71, 6068-74.

17. Johne, R., Enderlein, D., Nieper, H. & Muller, H. (2005) J Virol 79, 3883-7.

18. Johne, R., Wittig, W., Fernandez-de-Luco, D., Hofle, U. & Muller, H. (2006) J Virol 80, 3523-31.

19. Deiman B, van Aarle P & Sillekens P, Molecular Biotechnology 2002, 20:163-178.

20. US Patent No. 4,683,195 21. Mullis et al, Cold Spring Harbor Syrnp. Quant. Biol., 51:263, 1987

22. Ehrlich (ed) , PCR technology, Stockton Press, NY, 1989

23. Ehrlich et al , Science, 252:1643-1650, 1991

24. "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, Academic Press, New York, 1990.

25. Kontermann, R & Dubel, S, Antibody Engineering, Springer- Verlag New York, LLC; 2001, ISBN: 3540413545.

26. WO92/01047

27. Mendez, M. et al . (1997) Nature Genet, 15(2): 146-156

28. Nygren et al . (1997) Current Opinion in Structural Biology, 7: 463-469.

29. WO/0034784

30. Froussard P. (1992) Nucleic Acids Res 20, 2900

31. Grabe N. (2002) In Silico Biol 2, 1-15

32. Giraud, G., Bogdanovic, G., Priftakis, P., Remberger, M., Svahn, B. M., Barkholt, L., Ringden, O., Winiarski, J., Ljungman, P. & Dalianis, T. (2006) Haematologica 91, 401-4.

33. Bogdanovic, G., Brytting, M., Cinque, P., Grandien, M., Fridell, E., Ljungman, P., Lonnqvist, B. & Hammarin, A. L. (1994) Clin Diagn Virol 2, 211-20.

34. Altschul et al . (1990) J. MoI. Biol. 215: 405-410

35. Pearson and Lipman (1988) PNAS USA 85: 2444-2448

36. Waterman (1981) J. MoI Biol. 147: 195-197

37. Sambrook et al (1989)

38. Ausubel et al (1992)

Claims

Claims

1. An isolated polyomavirus comprising a DNA genome encoding: small t antigen polypeptide with an amino acid sequence as shown in SEQ ID NO: 8 or SEQ ID NO: 13 a large T antigen polypeptide with an amino acid sequence as shown in SEQ ID NO: I₁ SEQ ID NO: 12 or SEQ ID NO: 14, capsid protein VPl with an amino acid sequence as shown in SEQ ID NO: 6 or SEQ ID NO: 11, capsid protein VP2 with an amino acid sequence as shown in SEQ ID NO: 4 or SEQ ID NO: 9, and capsid protein VP3 with an amino acid sequence as shown in SEQ ID NO: 5 or SEQ ID NO: 10.

2. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide with an amino acid sequence having at least 90 % sequence identity to KIPyV polypeptide VPl as shown in SEQ ID NO: 6 or SEQ ID NO: 11.

3. An isolated nucleic acid molecule according to claim 2, comprising a sequence of nucleotides 1498 to 2634 as shown in SEQ ID NO:1, SEQ ID NO : 2 or SEQ ID NO: 3.

4. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide with an amino acid sequence having at least 90 % sequence identity to KIPyV polypeptide VP2 as shown in SEQ ID NO: 4 or SEQ ID NO: 9.

5. An isolated nucleic acid molecule according to claim 4, comprising a sequence of nucleotides 441 to 1643 as shown in SEQ ID N0:l, SEQ ID NO : 2 or SEQ ID NO: 3.

6. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide with an amino acid sequence having at least 90 % sequence identity to KIPyV polypeptide VP3 as shown in SEQ ID NO: 5 or SEQ ID NO: 10.

7. An isolated nucleic acid molecule according to claim 6, comprising a sequence of nucleotides 870 to 1643 as shown in SEQ ID N0:l.

8. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide with an amino acid sequence having at least 90 % sequence identity to KIPyV small t antigen polypeptide as shown in SEQ ID NO: 8 or SEQ ID NO: 13.

9. An isolated nucleic acid molecule according to claim 8, comprising a sequence of nucleotides 4967 to 4392 as shown in SEQ ID N0:l, SEQ ID NO : 2 or SEQ ID NO: 3.

10. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide with an amino acid sequence having at least 90 % sequence identity to KIPyV large T antigen polypeptide as shown in SEQ ID NO: 7, SEQ ID NO: 12 or SEQ ID NO: 14.

11. An isolated nucleic acid molecule according to claim 10, comprising a sequence of nucleotides 4967 to 4716 and 4328 to 2655 as shown in SEQ ID NO:1, SEQ ID NO: 2 or SEQ ID NO: 3.

12. A nucleic acid molecule according to any of claims 2 to 11, which is a vector comprising the nucleotide sequence.

13. A cell containing a vector according to claim 12.

14. An isolated polypeptide encoded by nucleic acid according to any of claims 2 to 11.

15. An isolated binding member for a polypeptide according to claim 14.

16. A binding member according to claim 15, which is an antibody molecule .

17. A binding member according to claim 16, which is a human or humanised antibody molecule.

18. A binding member according to any of claims 15 to 17, which is labelled with a detectable label.

19. A binding member according to claim 18, wherein the label is a fluorescent label.

20. An isolated nucleic acid molecule that specifically hybridises to the nucleotide sequence set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3, or to the complement thereof.

21. A nucleic acid molecule according to claim 20, which is an oligonucleotide primer between 10 and 30 nucleotides in length.

22. A nucleic acid molecule according to claim 20 or claim 21, wherein the nucleic acid molecule specifically hybridises to a sequence of nucleotides 1498 to 2634 of SEQ ID NO:1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3, or a complement thereof.

23. A pair of oligonucleotide primers for PCR, wherein the first primer is an isolated nucleic acid molecule between 10 and 30 nucleotides in length that specifically hybridises to the nucleotide sequence set forth in SEQ ID N0:l and/or SEQ ID NO: 2 and/or SEQ ID NO: 3; and the second primer is an isolated nucleic acid molecule between 10 and 30 nucleotides in length that specifically hybridises to the complement of the nucleotide sequence set forth in SEQ ID NO:1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3.

24. A pair of oligonucleotide primers according to claim 23, wherein the first and second primers specifically hybridise to a sequence of nucleotides 1498 to 2634 of SEQ ID NO:1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3, or a complement thereof.

25. A kit for testing a sample for a KIPyV, comprising a pair of oligonucleotide primers according to claims 23 or claim 24 in sterile solution.

26. A method of testing a sample for the presence of a KIPyV in a sample, comprising testing the sample for the presence of a polypeptide according to claim 14 and/or a nucleic acid molecule according to any of claims 2 to 11 and/or claim 20.

27. A method according to claim 26, comprising determining whether nucleic acid in the sample hybridises to a nucleic acid molecule according to any of claims 20 to 22.

28. A method according to claim 26, comprising determining whether a polypeptide in the sample binds to a binding member according to any of claims 15 to 19.

29. A method according to claim 28, comprising: (i) providing a test sample,-

(ii) contacting the test sample with a labelled binding member according to claim 18 or claim 19 under conditions in which the binding member binds to an KIPyV polypeptide, if present, to form a binding member-polypeptide complex;

(iii) washing the sample to remove any unbound binding member,- and (iv) testing for the presence of the detectable label, wherein the presence of the detectable label indicates the presence of KIPyV polypeptide in the sample.

30. A method according to claim 29, wherein the binding member is labelled with a fluorescent label, and wherein testing for the presence of the label comprises testing for fluorescence.

31. A method according to claim 28, comprising: (i) providing a test sample; (ii) contacting the test sample with a binding member according to any of claims 15 to 17 under conditions in which the binding member binds an KIPyV polypeptide, if present, to form a binding member- polypeptide complex,-

(iii) washing the sample to remove any unbound binding member; (iv) contacting the sample with a second binding member, wherein the second binding member binds the said binding member according to any of claims 15 to 17, if present, and wherein the second binding member is labelled with a detectable label;

(v) washing the sample to remove any unbound binding member,- and (iv) testing for the presence of the detectable label, wherein the presence of the detectable label indicates the presence of KIPyV polypeptide in the sample .

32. A method according to claim 31, wherein the second binding member is labelled with a fluorescent label, and wherein testing for the presence of the label comprises testing for fluorescence.

33. A method according to claim 28, comprising:

(i) providing a binding member according to any of claims 15 to 17 on a support ;

(ii) contacting the binding member with the sample under conditions in which the binding member binds to an KIPyV polypeptide, if present, to form a binding member-polypeptide complex; (iii) washing the complex to remove any unbound protein and/or other compounds from the sample;

(iv) contacting the complex with a second binding member according to any of claims 15 to 17, wherein the second binding member is linked to an enzyme that catalyses conversion of a substrate to a detectable product, thereby forming a binding member-polypeptide-binding member- enzyme complex if polypeptide is present; (v) washing away any unbound second binding member; and (vi) contacting the enzyme with the substrate and assaying for the presence of the detectable product; wherein detection of the detectable product indicates the presence of KIPyV polypeptide in the sample.

34. A method according to any of claims 29 to 33, comprising detecting the detectable label or product and thereby determining that the sample is positive for KIPyV.

35. A method according to claim 27, comprising: (i) providing a test sample;

(ii) adding first and second oligonucleotide PCR primers according to claim 23 or claim 24 to the sample;

(iii) placing the sample in conditions for performance of PCR; and

(iv) testing the sample for the presence of a PCR product, wherein detection of a PCR product indicates that the sample is positive for

KIPyV.

36. A method according to claim 35, comprising detecting the presence of a PCR product and thereby determining that the sample is positive for KIPyV.

37. A method of testing a sample for antibodies to KIPyV, comprising determining whether antibodies in the sample bind to a polypeptide according to claim 14.

38. A method according to claim 37, wherein the polypeptide is a VPl polypeptide having at least 90 % sequence identity to SEQ ID NO: 6 or SEQ ID NO: 11.

39. A method according to claim 37 or claim 38, wherein the polypeptide is provided as a virus-like particle.

40. A method according to claim 37, comprising performing an enzyme immunoassay to detect binding of antibodies in the sample to the polypeptide.

41. A kit for testing a sample for antibodies to KIPyV, comprising: a polypeptide according to claim 14 attached to a support; an anti-immunoglobulin antibody molecule linked to an enzyme, wherein the enzyme catalyses conversion of a substrate to a detectable product; and a substrate for the enzyme .

42. A composition comprising an isolated nucleic acid molecule according to claim 12 and a pharmaceutical excipient.

43. A composition comprising an isolated polypeptide according to claim 14 and a pharmaceutical excipient.

44. A composition according to claim 43, wherein the polypeptide is a VPl polypeptide having at least 90 % sequence identity to SEQ ID NO:

6 or SEQ ID NO: 11.

45. A composition according to claim 43 or claim 44, wherein the polypeptide is provided as a virus-like particle.

46. A method of generating an immune response against KIPyV, comprising administering KIPyV particles, a composition according to claim 42 and/or a composition according to any one of claims 43 to 45 to an individual .

47. A method of producing a vaccine against KIPyV, comprising formulating KIPyV particles and/or a nucleic acid according to claim 12 in a composition together with a pharmaceutical excipient.

48. A method of producing a vaccine against KIPyV, comprising formulating KIPyV particles and/or a polypeptide according to claim 14 in a composition together with a pharmaceutical excipient.

49. A binding member according to claim 16 or 17 for treating a KIPyV associated disease.

50. A binding member according to claim 49, wherein the KIPyV associated disease is cancer, a disease of the nervous system or a complication in immunosuppressed patients.

51. Use of a binding member according to claim 16 or 17 for the preparation of a medicament for the treatment of a KIPyV associated disease.

52. A use according to claim 51, wherein the KIPyV associated disease is cancer, a disease of the nervous system, or a complication in immunosuppressed patients.