WO2008074346A2 - Adn polymérase chimère - Google Patents

Adn polymérase chimère Download PDF

Info

Publication number
WO2008074346A2
WO2008074346A2 PCT/EP2006/012242 EP2006012242W WO2008074346A2 WO 2008074346 A2 WO2008074346 A2 WO 2008074346A2 EP 2006012242 W EP2006012242 W EP 2006012242W WO 2008074346 A2 WO2008074346 A2 WO 2008074346A2
Authority
WO
WIPO (PCT)
Prior art keywords
dna
dna polymerase
chimeric
polymerase
tth
Prior art date
Application number
PCT/EP2006/012242
Other languages
English (en)
Other versions
WO2008074346A3 (fr
Inventor
Konstantin Ignatov
Vladimir Kramarov
Dimitrij Plachov
Original Assignee
Genecraft Gmbh
Konstantin Ignatov
Vladimir Kramarov
Dimitrij Plachov
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genecraft Gmbh, Konstantin Ignatov, Vladimir Kramarov, Dimitrij Plachov filed Critical Genecraft Gmbh
Priority to PCT/EP2006/012242 priority Critical patent/WO2008074346A2/fr
Publication of WO2008074346A2 publication Critical patent/WO2008074346A2/fr
Publication of WO2008074346A3 publication Critical patent/WO2008074346A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase

Definitions

  • the present invention relates to thermostable DNA polymerases, polynucleotide sequences encoding them, methods for their synthesis and manufacture, and methods for their use.
  • Thermostable DNA polymerases are well known, and are useful in a wide range of laboratory processes, especially in molecular biology. Primer extension techniques, nucleic acid sequencing and the polymerase chain reaction (PCR) all employ such enzymes.
  • DNA polymerases which catalyze the template-directed polymerization of deoxyribonucleoside triphosphates (dNTPs) to form DNA 1 are used in a variety of in vitro DNA synthesis applications, such as primer extension techniques, DNA sequencing and DNA amplification.
  • Thermostable DNA polymerases are particularly useful in a number of these techniques, as thermostable enzymes are able to be used at relatively high temperatures. This has benefits with respect to fidelity of primer binding, for example, owing to the high stringency of the conditions employed.
  • the DNA polymerases isolated from Thermus aquaticus (Taq) and Thermus thermophilus (Tth) are perhaps the best characterized.
  • Taq and Tth DNA polymerases differ from each other in the following practically significant properties:
  • Tth DNA polymerase is more effective than Taq DNA polymerase for amplification of long (over 2 kb) DNA sequences in PCR [Ohler L.D., and Rose E. A., PCR Methods Appl. V.2 (1992), P. 51-59; Ignatov K.B. et al., MoI. Biol. (Russ.) V.31 (1997), P. 956-961] which is seen as a larger quantity of DNA produced;
  • Taq DNA polymerase is more sensitive than Tth DNA polymerase to the presence of a mismatched (non-complementary to template) nucleotide at the 3'-end of the primer [Ignatov K.B. et al., Bioorg. Khim. (Russ.) V.23 (1997), P. 817-822], which allows to employ Taq DNA polymerase in allele-specific primer extension reactions;
  • Taq DNA polymerase is more specific than Tth DNA polymerase in DNA amplification in the course of PCR [ignatov K.B. et al., Bioorg. Khim. (Russ.) V.23 (1997), P. 817-822], and thus yields a higher ratio of target product to total synthesized DNA 2 HT- *R0/EP
  • a creation of a novel DNA polymerase that would possess at least some advantages and lack at least some of the drawbacks of these enzymes is deemed very useful.
  • primer extension techniques such as allele-specific primer extension
  • PCR-amplification of DNA would need a thermostable DNA polymerase combining the efficiency of DNA synthesis of Tth DNA polymerase and the specificity of PCR-based DNA amplification characterisitic of Taq DNA polymerase.
  • the N-terminal region of Taq DNA polymerase has been shown to exert a significant effect on the efficiency of PCR with DNA templates longer than 2 kb.
  • deletion of the first 235 amino acids of Taq DNA polymerase reduces the enzyme's ability to amplify long DNA sequences [Barnes W.M., Gene V.112 (1992), P. 29-35].
  • the ability of Taq and Tth DNA polymerases to amplify long DNA sequences has also been attributed to sequences between the corresponding amino acid positions 498 and 554 for Taq DNA polymerase and 500 and 556 for Tth DNA polymerase [Blanco L. et al., Gene V.100 (1991 ), P. 27-28; Ignatov K.B.
  • the present invention provides a chimeric thermostable DNA polymerase which has the properties of high efficiency of long (over 2 kb) DNA sequences amplification in PCR, high sensitivity to the presence of a mismatched (non-complementary to template) nucleotide at the 3'-end of the primer, and high specificity in DNA amplification in the course of PCR. Said properties being derived from at least two different sources, wherein the properties are preferably in combination.
  • the chimeric DNA polymerases of the present invention have the N-terminal region from the Tth DNA polymerase and a C-terminal region from the Taq DNA polymerase.
  • the N-terminal region contains at least a region of amino acids 280-555 of Tth DNA polymerase.
  • the C- terminal region contains at least a region of amino acids 600-832 of Taq DNA polymerase.
  • Tth Thermus thermophilic
  • Another aspect of the present invention relates to the DNA (chimeric gene) of the invention which encodes the chimeric thermostable DNA polymerase of the invention, recombinant DNA vector which contains the chimeric gene, and host cells transformed with the recombinant DNA vector.
  • the DNA polymerase can be easily and efficiently expressed to a high level in a recombinant expression system, thereby facilitating commercial production of the enzyme.
  • the combination of properties possessed by the DNA polymerase of the present invention represents a significant advantage over thermostable DNA polymerases previously described in the literature.
  • the Taq-DNA-Polymerase preferably is Taq-DNA-Polymerase I.
  • the Tth-DNA-Polymerase preferably is Tth-DNA-Polymerase I.
  • FIG. 1 provides a scheme illustrating steps in construction of chimeric gene encoding the chimeric polymerase of the invention and an expression vector.
  • FIG. 2 provides a photograph of an agarose gel, which compares the yield of 2500-bp DNA fragment obtainable by PCR amplification with Taq DNA polymerase, Tth DNA polymerase and the chimeric DNA polymerase of this invention.
  • FIG. 3 provides a photograph of an agarose gel, which compares the specificity of PCR amplification reactions performed with Taq DNA polymerase, Tth DNA polymerase and the chimeric DNA polymerase of this invention.
  • TABLE 1 provides data of radioactive label incorporation into the 500-bp DNA fragment synthesized with Taq, or Tth, or the chimeric DNA polymerase by PCR with primers containing or not containing 3 ' -mismatching nucleotides
  • the present invention provides a chimeric thermostable DNA polymerase and means for producing the enzyme.
  • a number of terms are defined below.
  • “cell”, “cell line”, and “cell culture” can be used interchangeably and all such designations include progeny.
  • progeny includes the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same functionality as screened for in the originally transformed cell are included.
  • expression clone refers to DNA sequences containing a desired coding sequence and control sequences in operable linkage, so that hosts transformed with these sequences are capable of producing the encoded proteins.
  • expression system refers to a host transformed with an expression clone. To effect transformation, the expression clone may be included on a vector; however, the relevant DNA may also be integrated into the host chromosome.
  • gene refers to a DNA sequence that comprises control and coding sequences necessary for the production of a recoverable bioactive polypeptide or precursor.
  • oligonucleotide as used herein is defined as a molecule comprised of two or more deoxyribonucleotides or ribonucleotides. The exact size will depend on many factors, which in turn depends on the ultimate function or use of the oligonucleotide. Oligonucleotides can be prepared by any suitable method, including, for example, cloning and restriction of appropriate sequences and direct chemical synthesis by a method such as the phosphotriester method, the diethylphosphoramidite method, and the solid support method. A review of synthesis methods is provided in [Goodchild J., Bioconjug. Chem. V.1 (1990), P. 165-187].
  • primer refers to an oligonucleotide, which is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is RO/EP
  • a primer extension product which is complementary to a nucleic acid strand, is initiated in the presence of the requisite four different nucleoside triphosphates and a thermostable DNA polymerase in an appropriate buffer at a suitable temperature.
  • a "buffer” includes cofactors (such as divalent metal ions) and salt (to provide the appropriate ionic strength), adjusted to the desired pH.
  • a primer that hybridizes to the non-coding strand of a gene sequence (equivalently, is a subsequence of the coding strand) is referred to herein as an "upstream" primer.
  • a primer that hybridizes to the coding strand of a gene sequence is referred to herein as a "downstream” primer.
  • restriction endonucleases and “restriction enzymes” refer to enzymes, typically bacterial in origin, which cut double-stranded DNA at or near a specific nucleotide sequence.
  • thermostable enzyme refers to an enzyme which is stable to heat and has an elevated temperature reaction optimum.
  • the thermostable enzyme of the present invention catalyzes primer extension optimally at a temperature between 60 and 90. degree. C 1 and is usable under the temperature cycling conditions typically used in cycle sequence reactions and polymerase chain reaction amplifications (described in U.S. Pat. No. 4,965,188).
  • a "chimeric" protein refers to a protein whose amino acid sequence represents a fusion product of subsequences of the amino acid sequences from at least two distinct proteins.
  • a chimeric protein preferably is not produced by direct manipulation of amino acid sequences, but, rather, is expressed from a "chimeric" gene that encodes the chimeric amino acid sequence.
  • the chimeric protein of the present invention consists of an amino-terminal (N-terminal) region derived from a Thermus thermophilus (Tth) DNA polymerase I and a carboxy-terminal (C-terminal) region derived from Thermus aquaticus (Taq) DNA polymerase I.
  • the N-terminal region refers to a region extending from the N-terminus (amino acid position 1 ) to an internal amino acid.
  • the C-terminal region refers to a region extending from an internal amino acid to the C-terminus.
  • the N-terminal region extends from the N-terminus (amino acid position 1 ) to the beginning of the C-terminal region, which extends to the C-terminus.
  • the N-terminal and C-terminal regions encompass the entire amino acid sequence.
  • a chimeric protein may be constructed in a number of ways, most easily via the construction of a recombinant DNA molecule, followed by expression of the * RO/EP 6 [-F -
  • DNA fragments from different genes may be joined together by ligation, to form DNA encoding a chimeric polymerase.
  • DNA fragments from different DNA polymerase genes may be obtained by DNA purification, followed by restriction enzyme digestion, PCR, or even direct DNA synthesis, for example.
  • the protein may then be expressed from the DNA, using expression vectors maintained within host cells.
  • DNA cloning, manipulation and protein expression are all standard techniques in the art, and details of suitable techniques may be found in Sambrook et al, ' Molecular cloning - A Laboratory Manual ' , 1989.
  • the present invention therefore, also provides DNA encoding the chimeric thermostable DNA polymerase, along with vector containing this DNA, host cells containing this vector, and cultures of such cells, as well as methods for making the enzyme.
  • the invention also includes nucleic acid species, which hybridize to DNA encoding the protein of the invention, hybridization being carried out under standard conditions, preferably 60. degree. C. and 6X SSC.
  • the present invention includes kits containing the enzyme of the invention in combination with other reagents, suitable for use in laboratory experiments.
  • DNA and vectors encoding all or part of an enzyme of the invention may suitably incorporate such control elements, such as start/stop codons, promoters etc. as are deemed necessary or useful, as the skilled person desires. Suitable constructs are illustrated in the accompanying Examples.
  • thermostable DNA polymerase of the present invention is a chimeric DNA polymerase in which the N-terminal region comprises an N-terminal region of Tth DNA polymerase and the C-terminal region comprises a C-terminal region of Taq DNA polymerase.
  • the N-terminal region from the Tth DNA polymerase encompasses a portion of, or all of, the 5'-nuclease domain and a portion of the DNA polymerase domain.
  • the C-terminal region from Taq DNA polymerase encompasses a portion of the DNA polymerase domain.
  • the portion of the DNA polymerase domain of Taq DNA polymerase encompassed by the C-terminal region of the chimeric protein will correspond functionally and/or structurally to that portion of the DNA polymerase domain of the Tth DNA polymerase not encompassed by the N-terminal region of the chimeric protein.
  • the chimeric DNA polymerase can preferably additionally contain substitution of Asp for GIu (amino acid position 2) and substitution of Leu for Ala (amino acid position 3) in the N- terminal region from the Tth DNA polymerase.
  • the DNA polymerase of the invention is a chimeric enzyme that comprises of a portion derived from Tth DNA polymerase and a portion derived from Taq DNA polymerase.
  • the chimeric enzyme is preferably prepared from a chimeric gene, i.e., a DNA that encodes the chimeric enzyme and consists of a portion derived from the Tth DNA polymerase gene and a portion derived from the Taq DNA polymerase gene.
  • the chimeric gene can be produced 7 t- ⁇ - RO/EP
  • Tth DNA polymerase the nucleotide sequence of the Tth DNA polymerase gene, as well as the full amino acid sequence of the encoded protein
  • U.S. Pat. No. 5,618,711 The gene encoding Taq DNA polymerase, the nucleotide sequence of the Taq DNA polymerase gene, as well as the full amino acid sequence of the encoded protein, are described in [Lawyer, F. C. et al., J. Biol. Chem., 261 , 11 , 6427-6437] and U.S. Pat. No. 5,079,352.
  • amino acid sequence of the chimeric DNA polymerase of the invention is given in SEQ ID No. 1.
  • a part of the amino acid sequence of the chimeric DNA polymerase consisting of amino acids 4 through 600 is identical to the sequence of amino acids 4-600 of Tth DNA polymerase.
  • a part of the amino acid sequence of the chimeric DNA polymerase consisting of amino acids 556 through 834 is identical to the sequence of amino acids 554- 832 of Taq DNA polymerase.
  • the sequence of amino acids 556-600 of the chimeric DNA polymerase is identical to both the sequence of amino acids 556-600 of Tth DNA polymerase and the sequence of amino acids 554-598 of Taq DNA polymerase.
  • the sequence of amino acids 1-3 of the chimeric DNA polymerase arose from recombinant expression vector construction (described in example 1 ).
  • the chimeric polymerase of the invention can comprise deletions substitutions or additives of one or more amino acids, which do not significantly change the biological properties of the resulting polymerase.
  • the invention also relates to nucleic acid sequences encoding such polymerase. These nucleic acids can comprise nucleic acid substitutions, deletions or additions compared to the sequence depicted in SEQ ID No. 2.
  • the invention comprises amino acid sequences and nucleic acid sequences which are at least 80%, favourably 90% or at least 95% identical to SEQ ID No. 1 or SEQ ID No. 2, respectively, without changing the biological properties of the chimeric protein of the invention, in particular its efficiency and specificity.
  • nucleotide sequence of the nucleic acid encoding the chimeric DNA polymerase is given in SEQ ID No. 2.
  • the nucleic acid encoding the chimeric DNA polymerase was obtained as described in Example 1.
  • the nucleotide sequence of the nucleic acid encoding the chimeric DNA polymerase consists of subsequences: the sequence of nucleotides 1 - 8, which arose from recombinant expression vector construction (described in Example 1 ); the sequence of nucleotides 9 - 1786, which was taken from gene of Tth DNA polymerase, and which is identical to the nucleotide sequence 9 - 1786 of Tth DNA polymerase gene; the sequence of nucleotides 1787 - 2505, which was taken from gene of Taq DNA polymerase, and which is identical to the nucleotide sequence 1781 - 2499 of Taq DNA polymerase gene.
  • thermostable DNA polymerase of the invention represents an improvement over thermostable DNA polymerases described in the literature.
  • the DNA polymerase of the invention provides the following combination of properties:
  • the efficiency of the chimeric enzyme is at least 5 times as high as that of Taq DNA polymerase and is no less than that of Tth DNA polymerase (Example 3).
  • the chimeric enzyme is at least 6-fold more sensitive to the presence of a mismatch at the 3'-end of the primer than Tth DNA polymerase and is no less sensitive than Taq DNA polymerase (Example 4).
  • the chimeric enzyme shows much higher specificity in PCR-based amplification of DNA than Tth DNA polymerase and no less specificity than Taq DNA polymerase (Example 5). Furthermore, (4) the DNA polymerase can be easily and efficiently expressed to a high level in a recombinant expression system, thereby facilitating commercial production of the enzyme (Example 2).
  • the Examples relate to the production and testing of chimeric polymerase of the invention.
  • the Examples are illustrative of, but not binding on, the present invention. Any methods, preparations, solutions and such like, which are not specifically defined, may be found in Sambrook et al. All solutions are aqueous and made up in sterile, deionized water, unless otherwise specified. All enzymes were obtained from the Bioline Limited (London, GB)
  • a chimeric gene was constructed, comprising a portion of the Tth DNA polymerase gene and a portion of the Taq DNA polymerase gene.
  • the procedure was as follows, in this Example.
  • Tth DNA polymerase gene [U.S. Pat. No. 5,618,711], representing amino acids 4 to 597, was obtained by PCR amplification of total Thermus thermophilus DNA, primed by * RO/EP 13 [-_ ⁇ t ⁇ _
  • PrTTHI and PrTTH2 (below).
  • Total DNA from Thermus thermophilus was isolated by the phenol deproteinization method.
  • the primers used were: PrTTHI 5 1 - ATAGATCTGATGCTTCCGCTCTTTGA -3'[SEQ ID NO 3] PrTTH2 5'- GGCCCGGCGGATCCTCTGGCCCAA -3'[SEQ ID NO 4]
  • Upstream primer PrTTHI is homologous to wild type DNA starting at codon 4; this primer is designed to incorporate a BgI Il site into the amplified DNA product.
  • Downstream primer PrTTH2 is homologous to codons 592-599 on the non-coding strand of the wild-type gene encoding Tth DNA polymerase and includes a BamH I site.
  • PCR was performed using a DNA Thermal Cycler 480 (Perkin-Elmer-Cetus).
  • the reaction mixture (50 mkl_) contained 67 mM Tris-HCI (pH 8.8), 16.6 mM (NH 4 ) 2 SO 4 , 0.01% Tween- 20, 0.2 mM of each dNTP's, 1.5 mM MgCI 2 , 10 pmol of each primer, 100 ng of DNA as a template, and 5 U of Taq DNA polymerase.
  • the reaction included 25 cycles: 94. degree. C-- 30 s; 58. degree. C.--30 s; 72. degree. C.--100 s.
  • a DNA fragment of Taq DNA polymerase gene [Lawyer, F. C. et al., J. Biol. Chem., V.261 , P.
  • Thermus aquaticus YT 1 DNA primed by the two synthetic DNA primers PrTAQI and
  • PrTAQ2 (below). Total DNA from Thernus aquaticus YT 1 was isolated by the phenol deproteinization method [Sambrook et al.]. The primers used were:
  • Upstream primer PrTAQI is homologous to wild type Thermus aquaticus YT 1 DNA [Lawyer et al.] starting at codon 592 of the DNA polymerase gene and includes a BamH I site.
  • Downstream primer PrTAQ2 is homologous to codons 827-832 on 1 the other strand of the wild-type gene encoding Thermus aquaticus DNA polymerase and is designed to incorporate a SaIG I site and a stop codon into the amplified fragment.
  • PCR was performed using a DNA Thermal Cycler 480 (Perkin-Elmer-Cetus).
  • the reaction mixture (50 mkL) contained 67 mM Tris-HCI (pH 8.8), 16.6 mM (NH 4 ) 2 SO 4) 0.01 % v/v Tween-
  • the amplified fragments (from Tth and Taq genes) were purified by 2% w/v agarose-gel electrophoresis, phenol extraction and were precipitated by ethanol. They were then digested with restriction endonuclease BamH I and ligated. The chimeric DNA fragment consisting of the Tth and Taq DNA fragments was obtained as a result of the manipulations. The chimeric DNA fragment was purified by 1.5% w/v agarose-gel electrophoresis and phenol extraction, and was then precipitated by ethanoi. The fragment was digested with restriction endonucleases BgI Il and SaIG I and ligated into plasmid pCQV2 [Queen, C, J. MoI. Appl. Genet., V.2, P.1-10] which had been digested with the BamH I and SaIG I restriction enzymes and previously treated with calf intestinal alkaline phosphatase 14 Mg - *RO/EP
  • Ligation was conducted with T4 DNA ligase in a 50 mkl_ volume containing 200 ng vector (plasmid pCQV2) and 200 ng of the insert.
  • E. coli JM 109 cells were transformed with the ligation mixture according to the method of Dower et al. [Dower et al., Nucl. Acid. Res., V.16 (1988), P. 1 127].
  • Transformed cells were grown on LB medium at 30. degree. C. Clones were selected from ampicillin resistant colonies and checked to determine which ones contained the chimeric DNA polymerase gene insert.
  • Selected positives clones were assayed for production of protein of the corresponding MW by 12% SDS-polyacrylamide gel electrophoreses [Laemmli U., Nature V.227 (1970), P.680- 685].
  • Cells (0.5 g) were suspended in 2 ml of buffer A (20 mM K-phosphate pH 7.0, 2 mM DTT, 0.5 mM EDTA) containing 0.2M NaCI and 0.1 mM phenylmethylsulphonylfluoride (PMSF).
  • the cells were disrupted by ultrasonic disintegration (MSE, 150 wt) at maximum amplitude for 15 sec (3 impulses, each for 5 sec) with cooling on ice.
  • MSE ultrasonic disintegration
  • the suspension was centrifuged at 20,000 g, the supernatant collected, and 5% v/v polyethylenimine was added to a final concentration of 0.1 % v/v. The resulting precipitate was separated by centrifugation, and the supernatant removed.
  • the supernatant proteins were then precipitated by solid ammonium sulfate at 75% saturation.
  • the polymerase- containing precipitate was collected by centrifugation at 20,000 g, dissolved in 3 ml of buffer A, containing 0.1 M NaCI and 0.2% Tween-20, then heated for 5 minutes at 75. degree. C. and centrifuged (10 min, 20,000 g). Denatured proteins were discarded and supernatant was assayed by its ability to perform PCR.
  • a plasmid was isolated and purified from cells in which truncated chimeric polymerase was active in PCR.
  • PCR assays were conducted using a DNA thermal cycler 480 (Perkin Elmer-Cetus).
  • the reaction mixture (50 mkL) contained 67 mM Tris-HCI (pH 8.8 at 25. degree. C), 16.6 mM (NhU) 2 SO 4 , 0.01% Tween-20, 0.2 mM each dNTP, 1.5 mM MgCI 2 , 10 pmol each primer (Pr.lambda.1 : 5'-GATGAGTTCGTGTCCGTACAACTGG-3'[SEQ ID NO 7] and Pr.lambda.2: 5'-GGTTATCGAAATCAGCCACAGCGCC-3'[SEQ ID NO 8]), 50 ng template lambda DNA and 2 .mkl of the above supernatant containing the enzyme. 30 cycles of the following cycle was carried out; 94. degree. C. for 30 seconds, 57. degree. C. for 40 seconds and 72 .degree. C. for 30
  • Plasmid DNA was isolated from cells which produced a chimaeric enzyme that was active in PCR.
  • the plasmid was purified, and designated pTTT.
  • the nucleotide sequence encoding the chimaeric enzyme was verified by sequencing.
  • the construction of pTTT is shown in FlG. 1.
  • E. coli JM 109 cells were transformed with the plasmid pTTT according to the method of Dower et al. [1988, Nucl. Acid. Res., V.16, P.6127].
  • Expression of the chimeric gene encoding the chimeric polymerase was induced by heating to 42. degree C. The cells were further incubated for 7 h at 42. degree. C. Cells were harvested by centrifugation
  • the cells (35g) were suspended in 70 ml of buffer A (20 mM K-phosphate pH 7.0, 2 mM DTT, 0.5 mM EDTA) containing 0.2M NaCI and 0.1 mM PMSF.
  • the cellular walls were disrupted with an ultrasonic disintegrator (MSE, 150 wt) at maximum amplitude for 15 minutes (30 impulses, each for 30 sec) and with cooling on ice.
  • MSE ultrasonic disintegrator
  • the suspension was then centrifuged at 40,000 g, the pellet discarded, and 5% polyethylenimine was added to the supernatant to a final concentration of 0.1%.
  • the precipitate was separated by centrifugation, and the remaining proteins precipitated with ammonium sulfate at 45% saturation.
  • the resulting polymerase-containing precipitate was collected by centrifugation at 20,00Og and dissolved in buffer A (30 ml) containing 0.1 M NaCI and 0.2% Tween-20, heated for 15 minutes at 75. degree. C. in the presence of 10 mM MgCI 2 , and centrifuged for 10 minutes at 40,000 g.
  • the supernatant was loaded on to a (2.5 X 20 cm) phosphocellulose P-1 1 column (Whatman) equilibrated in buffer A containing 0.1 M NaCI, and washed out with the same buffer.
  • the proteins were eluted with a linear gradient of NaCI concentrations ranging from 100 to 500 mM in buffer A.
  • the gradient volume was 800 ml, and the flow rate was 60 ml/h.
  • Polymerase was eluted at NaCI concentrations ranging from 280 to 330 mM.
  • the fractions were tested for Polymerase activity, assayed via inclusion of the radioactive- labeled nucleotide 32 P(dATP) into the acid-insoluble pellet [Myers T. W., Gelfand D. H., (1991 ) Biochemistry, v30, N31 , p7661-7666].
  • the amount of the enzyme that incorporated 10 nmol of deoxynucleotide triphosphates into the acid-insoluble fraction within 30 minutes under conditions described below was taken as one unit of activity.
  • the reaction mixture (50 mkL) contained 25 mM N- Tris [Hydroxymethyl] methyl-3-aminopropanesulphonic acid (TAPS), pH 9.3, 50 mM KCI, 2 mM MgCI 2 ; 1 mM ⁇ -mercaptoethanol; 0.2 mM of each dNTP's, 1 mkCi 32 P(dATP), and 12.5 mkg of activated salmon sperm DNA.
  • the polymerase activity was determined at 73. degree. C.
  • NaCI concentrations ranging from 50 to 250 mM in buffer A.
  • the gradient volume was 150 ml, and the flow rate was 15 ml/h.
  • the polymerase was eluted at 150-200 mM NaCI.
  • the purified enzymes were stored at -2O.degree. C. in the following buffer: 100 mM NaCI; 10 mM Tris HCI pH 7.5; 1 mM DTT; 0.2% Tween 20 and 50% (v/v) glycerol.
  • Homogeneity of the polymerase preparations was not less than 95% according to SDS electrophoresis data on a 10% polyacrylamide gel.
  • PCR reactions were performed using a DNA thermal cycler 480 (Perkin Elmer-Cetus).
  • the reaction mixture (50 mkl_) contained 67 mM Tris-HCI (pH 8.8 at 25. degree. C), 16.6 mM (NhU) 2 SO 4 , 0.01% Tween-20, 0.2 mM each dNTP, 1.5 mM MgCI 2 , 10 pmol each primer (Pr.lambda.1: 5'-GATGAGTTCGTGTCCGTACAACTGG-3'[SEQ ID NO 7] and Pr.lambda.3: 5 1 - TGTTGACCTTGCCTGCAGCAACGC -3'[SEQ ID NO 9]), 5 ng template lambda DNA.
  • the reactions were performed with 0.5 U of Tth polymerase; or 0.5 U of the Chimeric polymerase; or 0.5 U, 1.5 U, 2.5 U of Taq polymerase. 26 cycles of the following cycle was carried out: 94. degree. C. for 30 seconds, 57. degree. C. for 40 seconds and 72 .degree. C. for 100 seconds.
  • Enzyme sensitivity of the Chimeric, Taq and Tth DNA polymerases to the presence of a mismatch at the 3'-end of a primer was estimatid by comparing the amounts of DNA synthesized in PCR with the primers either containing or not the 3 ' -mismatching nucleotide.
  • Pr.lambda.1 [SEQ ID NO 7] / Pr.lambda.2 [SEQ ID NO 8]; Pr.lambda.12 (5 ' - GATGAGTTCGTGTCCGTACAACTGC) [SEQ ID NO 10] / Pr.lambda.2 [SEQ ID NO 8]; Pr.lambda.13 ( ⁇ ' -GATGAGTTCGTGTCCGTACAACTGA) [SEQ ID NO 1 1] / Pr.lambda.2 [SEQ ID NO 8]; Pr.lambda.14 ( ⁇ ' -GATGAGTTCGTGTCCGTACAACTGT) [SEQ ID NO 12] / Pr.lambda.2 [SEQ ID NO 8].
  • the primers Pr.lambda.1 and Pr.lambda.2 were complementary to the corresponding fragment of phage lambda DNA; the primers Pr.lambda12, Pr.lambda13 * RO/EP 17 HP -
  • the reaction mixture (50 ⁇ l) contained 67 mM Tris-HCI (pH 8.8), 16.6 mM (NhU) 2 SO 4 , 0.01 % Tween-20, 0.2 mM of each dNTPs, 1.5 mM MgCI 2 , 17 pmol of each primer, 15 ng of phage lambda DNA as a template, and 1.5 U of the Chimeric, or Taq, or Tth DNA polymerase.
  • the reaction proceeded in 25 cycles: 94°C for 45 s; 59°C for 30 s; 72°C for 30 s.
  • [alpha- 32 P]dATP was added to the reaction mixture (2 ⁇ Ci/50 ⁇ l reaction mixture), and radioactivity of the acid-insoluble fraction was then determined.
  • the reaction was performed, and 20 ⁇ l of the resulting mixture was applied on a GF/B filter (Whatman). The filter was washed with 10% trichloroacetic acid and dried. The radioactivity was determined with a Beckman LS 9800 scintillation counter using Ready-Solv HP scintillation liquid (Beckman).
  • PCR DNA amplification Specificity of PCR DNA amplification is a ratio of target product of amplification to total synthesized DNA. Enzyme specificity of the Chimeric, Taq and Tth DNA polymerases was estimatid by amplification of 2500-bp phage lambda DNA fragment in the presense of considerable quantity of E. coli DNA.
  • PCR reactions were performed using a DNA thermal cycler 480 (Perkin Elmer-Cetus).
  • the reaction mixture (50 mkL) contained 67 mM Tris-HCI (pH 8.8 at 25. degree. C), 16.6 mM (NH ⁇ ) 2 SO 4 , 0.01% Tween-20, 0.2 mM each dNTP, 1.5 mM MgCI 2 , 20 pmol each primer (Pr.lambda.1 [SEQ ID NO 7] and Pr.lambda.3 [SEQ ID NO 9]), 5 ng template lambda DNA, and 300 ng of E. coli DNA.
  • the reactions were performed with 3.5 U of Tth, Chimeric or Taq DNA polymerase.
  • FIG. 1 Scheme illustrating steps in construction of plasmid pTTT, which contains the chimeric gene of the chimeric polymerase of the invention (described in detail in Example 1).
  • FIG. 2 Electrophoretic analysis of PCR products, which compares the yield of 2500-bp DNA fragment obtainable by PCR amplification with Taq DNA polymerase, Tth DNA polymerase and the chimeric DNA polymerase of this invention and indicates that 0.5 U of the chimeric enzyme has the efficiency of PCR amplification similar to 0.5 U of Tth polymerase and 2.5 U of Taq polymerase.
  • 2500-bp DNA fragment was amplified with 0.5 U of Tth (lane 1 ); 0.5 U of the chimeric enzyme (lane 2); 0.5 U, 1.5 U, 2.5 U of Taq polymerase (lanes 3, 4, 5 correspondingly) (described in detail in Example 3).
  • FIG. 3 Electrophoretic analysis of PCR products obtained in the presense of considerable quantity of E. coli DNA, which compares the specificity of PCR amplification reactions performed with Taq DNA polymerase, Tth DNA polymerase and the chimeric DNA polymerase and indicates that chimeric enzyme shows much higher specificity in PCR than Tth and no less specificity than Taq polymerase.
  • the reactions were performed with 3.5 U of Tth (lane 1 ), 3.5 U of the chimeric enzyme (lane 2) and 3.5 U of Taq DNA polymerase (lane 3) (described in detail in Example 5).
  • Thermus aquaticus DNA polymerase Escherichia coli DNA polymerase I and
  • DNA polymerases // Gene V.100 (1991 ), P. 27-28.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention porte sur une ADN polymérase thermostable chimère, sur la séquence d'ADN codant pour l'enzyme, et sur des méthodes de production et d'utilisation de l'enzyme.
PCT/EP2006/012242 2006-12-19 2006-12-19 Adn polymérase chimère WO2008074346A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/EP2006/012242 WO2008074346A2 (fr) 2006-12-19 2006-12-19 Adn polymérase chimère

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2006/012242 WO2008074346A2 (fr) 2006-12-19 2006-12-19 Adn polymérase chimère

Publications (2)

Publication Number Publication Date
WO2008074346A2 true WO2008074346A2 (fr) 2008-06-26
WO2008074346A3 WO2008074346A3 (fr) 2009-01-08

Family

ID=39536773

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/012242 WO2008074346A2 (fr) 2006-12-19 2006-12-19 Adn polymérase chimère

Country Status (1)

Country Link
WO (1) WO2008074346A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016033315A3 (fr) * 2014-08-27 2016-06-02 New England Biolabs, Inc. Formation de synthon
US9963687B2 (en) 2014-08-27 2018-05-08 New England Biolabs, Inc. Fusion polymerase and method for using the same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001090337A2 (fr) * 2000-05-24 2001-11-29 Third Wave Technologies, Inc. Detection d'arn
WO2006010887A1 (fr) * 2004-07-26 2006-02-02 Bioline Limited Adn polymerase chimere

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001090337A2 (fr) * 2000-05-24 2001-11-29 Third Wave Technologies, Inc. Detection d'arn
WO2006010887A1 (fr) * 2004-07-26 2006-02-02 Bioline Limited Adn polymerase chimere

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016033315A3 (fr) * 2014-08-27 2016-06-02 New England Biolabs, Inc. Formation de synthon
US9447445B2 (en) 2014-08-27 2016-09-20 New England Biolabs, Inc. Synthon formation
US9963687B2 (en) 2014-08-27 2018-05-08 New England Biolabs, Inc. Fusion polymerase and method for using the same
EP3450558A3 (fr) * 2014-08-27 2019-05-15 New England Biolabs, Inc. Formation de synthon
EP3778891A1 (fr) * 2014-08-27 2021-02-17 New England Biolabs, Inc. Formation de synthon
CN113584015A (zh) * 2014-08-27 2021-11-02 新英格兰生物实验室公司 合成子的形成

Also Published As

Publication number Publication date
WO2008074346A3 (fr) 2009-01-08

Similar Documents

Publication Publication Date Title
Lawyer et al. High-level expression, purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5'to 3'exonuclease activity.
DK2079834T3 (en) Mutant DNA polymerases and related methods
US5968799A (en) Purified thermostable nucleic acid polymerase enzyme from thermosipho africanus
CA2071196C (fr) Vecteurs d'expression recombinants et methodes de purification de l'adn-polymerase de thermus thermophilus
US5455170A (en) Mutated thermostable nucleic acid polymerase enzyme from Thermus species Z05
US5618711A (en) Recombinant expression vectors and purification methods for Thermus thermophilus DNA polymerase
CA2858264C (fr) Adn polymerases presentant une activite amelioree
CA2888148C (fr) Adn polymerases a activite amelioree
CA2831180C (fr) Adn polymerases avec une activite amelioree
US20040197800A1 (en) DNA polymerase blends and uses thereof
US20040005599A1 (en) Thermostable or thermoactive DNA polymerase molecules with attenuated 3'-5' exonuclease activity
US20160312195A1 (en) Thermus thermophilus nucleic acid polymerases
CA2802000A1 (fr) Adn polymerases presentant une discrimination accrue des mesappariements a l'extremite 3'
CA2801998C (fr) Polymerases d'adn a discrimination accrue des non-concordances en 3'
US10544404B2 (en) DNA polymerases with increased 3′-mismatch discrimination
WO2008074346A2 (fr) Adn polymérase chimère
US20090209005A1 (en) Chimeric dna polymerase
US6630319B1 (en) Thermostable DNA polymerase
US20110294168A1 (en) Dna polymerases and related methods
WO2007127893A2 (fr) Adn polymérase thermostable provenant de thermotoga naphthophila et de thermotoga petrophellia
Chalov et al. Thermostable DNA-polymerase from the thermophilic archaeon microorganism Archaeoglobus fulgidus VC16 and its features
CA2801997A1 (fr) Adn polymerases presentant une discrimination accrue des mesappariements a l'extremite 3'
Lawyer et al. High-level expression, purification, and enzymatic characterization

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 06851958

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A OF 21-10-09)

122 Ep: pct application non-entry in european phase

Ref document number: 06851958

Country of ref document: EP

Kind code of ref document: A2