WO2008073624A2 - Quantitative nucleic acid hybridization using magnetic luminescent particles - Google Patents

Abstract

A magnetic luminescent nanoparticle-based assay is provided. Specifically, the assay is used for the detection or quantification of target nucleic acid sequences in a sample through the use of magnetic luminescent nanoparticles and oligonucleotide probes.

Description

TITLE

QUANTITATIVE NUCLEIC ACID HYBRIDIZATION USING MAGNETIC

LUMINESCENT PARTICLES. CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application Nos. 60/864,384, filed November 3, 2006; 60/896,842, filed March 23, 2007; and 60/909,350, filed March 30,

2007.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR

DEVELOPMENT

[0002] The U.S. Government has certain rights in this invention pursuant to Grant No. 5P42

ES04699 awarded by the National Institutes of Health, National Institute of Environmental

Health Sciences Super Fund Program; NSF Grant No. DBI-02662 as part of the Nanoscale

Science and Engineering program; and the National Research Initiative of the USDA

Cooperative State Research, Education and Extension Service, Grant No. 2005-35603-16280.

BACKGROUND

Field of the Invention [0003] This invention relates to the fields of chemistry and biology.

Description of the Related Art

[0004] Progress has been made toward more sensitive analysis of nucleic acids using several types of nanomaterials, such as: metal, dye-doped silica, and semiconductor quantum dots. Improved sensitivity offers numerous advantages for nucleotide detection and quantification assays, such as microarray and in situ hypbridization, including increased detection potential for nucleic acids present in a sample at low copy number and reduced experimental error. Mirkin and co-workers have demonstrated the application of gold nanoparticles for DNA detection. Csaki, A, et al. The optical detection of individual DNA-conjugated gold nanoparticle labels after metal enhancement, Nanotechnology 2003, 14, (12), 1262-1268.; Park, H. G., Nanoparticle-based detection technology for DNA analysis, Biotechnology and Bioprocess Engineering 2003, 8, (4), 221-226.; Mirkin, C. A., et al., Nanostructures in biodefense and molecular diagnostics, Expert Review of Molecular Diagnostics 2004, 4, (6), 749-751.; Storhoff, J. J., et al., Gold nanoparticle-based detection of genomic DNA targets on microarrays using a novel optical detection system. Biosensors and Bio electronics 2004, 19, (8), 875-883.; Cao, Y. C; et al., A two-color-change, nanoparticle-based method for DNA detection, Talanta 2005, 67, (3), 449-455; Festag, G. et al, Optimization of gold nanoparticle-based DNA detection for microarrays, Journal of Flourescence 2005, 15, (2), 161-170. Gold particles were used for signal amplification with silver enhancement when the DNA strand hybridized its target. This technique often relied on a silver coating on the gold nanoparticle and is complex, possibly resulting in reduced reproducibility. [0005] Conventional fluorophores that have been encapsulated into a silica particle have also been used for detection and imaging of DNA (Zhao, X. J. et al., Development of organic-dye- doped silica nanoparticles in a reverse microemulsion, Advanced Materials 2004, 16, (2), 173-176.; Zhou, X.; Zhou, J., Improving the Signal Sensitivity and Photostability of DNA Hybridizations on Microarrays by Using Dye-Doped Core-Shell Silica Nanoparticles, Anal.Chem 2004, 76, 5302-5312.; Lian, W., et al., Ultrasensitive detection of biomolecules with flourescent dye-doped nanoparticles, Analytical Biochemistry 2004, 334, (1), 135-144.; He, X. X. et al., A novel fluorescent label based on organic dye-doped silica nanoparticles for HepG liver cancer cell recognition, Journal ofNanoscience and Nanotechnology, 2004, 4, (6), 585-589.; Bagwe, R. P.et al, Optimization of dye-doped silica nanoparticles prepared using a reverse microemulsion method, Langmuir 2004, 20, (19), 8336-8342.; Tan, W. H. et al, Bionanotechnology based on silica nanoparticles, Medicinal Research Reviews 2004, 24, (5), 621-638.). The encapsulation of fluorophores into silica can result in poor solubility, migration, aggregation of the fluorophores and leaking; accordingly decreased fluorescent efficiency and large variability of fluorescence in each nanoparticle has been observed (Tapec et al. 2002 and Zhao et al. 2003, supra).

[0006] Semiconductor quantum dots can be used for DNA bioanalysis. (Fortina P, K. L. et al., Nanobiotechnology: the promise and reality of new approaches to molecular recognition, Trends in Biotechnology 2005, 23, (4), 168-173.; Gerion D, et al., Room-temperature single- nucleotide polymorphism and multiallele DNA detection using fluorescent nanocrystals and microarrays, Anal.Chem 2003, 75, 4766-4772.; Han MY, et al., Quantum-dot-tagged microbeads for multiplexed optical coding of biomolecules, Nature Biotechnology 2001, 19, (7), 631-635.; Santra S, X. J., et al., Luminescent nanoparticle probes for bioimaging, Journal ofNanoscience and Nanotechnology 2004, 4, (6), 590-599) Quantum dots can have narrow and symmetrical emission bands allowing minimal spectral overlaps, ignorable photobleaching, good quantum efficiency and brightness. Quantum dots have been incorporated into larger particles, and in that form can be used as a type of encoded label (Han MY, et al., Quantum-dot-tagged microbeads for multiplexed optical coding of biomolecules, Nature Biotechnology 2001, 19, (7), 631-635.) and have demonstrated in fluorescent in situ hybridization (FISH) assay and DNA microarray analysis {supra).

Quantum dots can be limited in utility by photoblinking, high-cost production, and luminescent dependence on particle size. Furthermore, there are general environmental concerns regarding the use of highly toxic cadmium and lead compounds and this may limit their application to laboratory research and prevent their application to patient diagnostics and environmental sensing or food security monitoring.

[0007] The above noted assays for DNA detection and/or quantification are hindered by several disadvantages. These disadvantages can include: a lack of sensitivity, high cost, toxicity, being unamenable to scale-up to a high degree of multiplexing, environmental hazards, and slow and possibly difficult synthesis procedures of the nanoparticles themselves.

The present invention addresses these and other limitations of the prior art.

SUMMARY

[0008] The present invention is defined by the following claims, and nothing in this section should be taken as a limitation on those claims.

[0009] Disclosed herein is an assay for quantifying a target nucleic acid sequence in a sample using an oligonucleotide capture probe. The assay includes: binding a luminescent magnetic particle with a nucleic acid sequence under conditions appropriate for binding, preferably the luminescent magnetic particle is capable of light emission or absorption at a first wavelength, and preferably the nucleic acid sequence is selected from the group consisting of: the target nucleic acid sequence and the oligonucleotide capture probe; contacting the sample including the target nucleic acid sequence with the oligonucleotide capture probe under conditions in which the oligonucleotide capture probe specifically binds at a first region with the target nucleic acid sequence to form a capture-target conjugate, preferably the oligonucleotide capture probe includes a sequence complementary to at least a portion of the target nucleic acid sequence; and making a first measurement of the light emission or absorption at the first wavelength.

[0010] Preferably the oligonucleotide capture probe is bound to the luminescent magnetic particle at a first position.

[0011] Preferably a label capable of light emission or absorption at a second wavelength is associated with the target nucleic acid sequence. [0012] Preferably a label capable of light emission or absorption at a second wavelength is associated with the oligonucleotide capture probe at a position other than the first position at which the luminescent magnetic particle is bound.

[0013] Preferably the assay further includes: contacting the target nucleic acid sequence with an oligonucleotide detection probe including a sequence complementary to at least a portion of the target nucleic acid sequence under conditions in which the oligonucleotide detection probe specifically binds with the target nucleic acid sequence to form a detection- target conjugate, preferably the oligonucleotide detection probe includes a label capable of light emission or absorption at a second wavelength, and preferably the oligonucleotide detection probe binds to the target nucleic acid sequence in a region different than the first region where the oligonucleotide capture probe binds the target nucleic acid sequence to form the capture-target conjugate.

[0014] Preferably the assay further includes: separating the capture-target conjugate bound to the luminescent magnetic particle from the sample by magnetic separation to form a secondary sample.

[0015] Preferably the assay further includes: making a second measurement of the light emission or absorption at the second wavelength; and calculating a ratio of the first and second measurements to quantify the target nucleic acid sequence in the secondary sample. [0016] Preferably the oligonucleotide capture probe is bound to a solid support, and the target nucleic acid sequence is bound to the luminescent magnetic particle. [0017] Preferably the luminescent magnetic particle is a nanoparticle including a magnetic core and a shell, the shell including one or more metal ions doped into a metal oxide host. [0018] Preferably the nanoparticle further includes a rare earth element doped in the metal oxide host.

[0019] Preferably the binding of the luminescent magnetic particle with the nucleic acid sequence is via a surface molecule on the luminescent magnetic particle, preferably the surface molecule is selected from the group consisting of: a biological molecule or a polyionic polymer.

[0020] Preferably the surface molecule is an avidin compound.

[0021] Preferably the nucleic acid sequence further includes a binding molecule that interacts with the surface molecule. [0022] Preferably the binding molecule is biotin. [0023] Preferably the luminescent magnetic particle is a nanoparticle including a magnetic core and a shell, the shell including one or more metal ions doped into a metal oxide host, and preferably the nanoparticle further includes a rare earth element doped in the metal oxide host, and preferably a plurality of oligonucleotide capture probes are bound to a plurality of nanoparticles, the plurality of oligonucleotide capture probes including a plurality of distinct sequences of nucleic acids, and the plurality of nanoparticles including a distinct composition and concentration of at least one rare earth element doped into the metal oxide host.

[0024] Preferably, the assay is a multiplex assay.

[0025] Preferably the rare earth element includes a lanthanide.

[0026] Preferably the assay is a single nucleotide polymorphism assay.

[0027] Preferably the assay is a microorganism identification assay.

[0028] Preferably the assay is a diagnostic assay.

[0029] Preferably the assay is a prognostic assay.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0030] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description, and accompanying drawings, where:

[0031] Figure 1. (a) Pictures shown for magnetic pullout before and after a magnet was applied to Fe3θ4/Eu:Gd2θ3 core/shell nanoparticles in solution, (b) TEM image taken for these particles represents their size and morphology, (c) Nanoparticle coating with

Streptavidin-Alexa555. The fluorescence (Alexa555/NPs) reached the saturation deviations based on four measurements of fluorescence intensity by spectrafluorometer. RFU=Relative

Fluorescence Unit; NPs=Nanoparticles.

[0032] Figure 2. Schematic illustrations of DNA hybridization-in-solution using

Fe₃O₄ZEuIGd₂O₃ core/shell nanoparticles.

[0033] Figure 3. Schematic illustration of DNA microarray hybridization using NeutrAvidin functionalized Eu:Gd₂O₃ nanoparticles.

[0034] Figure 4. PMl 16S rDNA target quantification in hybridization-in-solution. A linear relation was observed between normalized fluorescence values (R²=0.98) and the amount of

16S target rDNA. The signal and error bars represent average and standard deviations based on four measurements of fluorescence intensity by a spectrafluorometer. [0035] Figure 5. Kinetics of hybridization measured using a spectrofluorometer. The concentration of target DNA was varied 10 pM- 500 pM for 0.5, 1, 2, 4, 6 hours reaction duration.

[0036] Figure 6. Determination of assay specificity: DNA targets with two-mismatches were hybridized with probe DNA-nanoparticle complexes in parallel with perfect target

DNA. The average and standard deviations are based on four measurements.

[0037] Figure 7. Fluorescence comparison between Quasar570 and europium nanoparticles.

(A) Schematic illustration of DNA/dye complex for Quasar570 and EuIGd₂Os nanoparticles.

Fluorescent image of (B) Quasar570 and (C) EuIGd₂Os nanoparticles scanned by laser microarray scanner. (D) Fluorescent signal measured and analyzed for Quasar570 and europium nanoparticles. The signal and error bars represent average and standard deviations based on measurements of fluorescence intensity of 9 spots.

[0038] Figure 8. Quantification of PMl bacterial 16S rDNA in microarrays using Eu:Gd₂θ₃ nanoparticles. Fluorescent measurement and standard deviation were based on 9 spots of each target concentration.

[0039] Figure 9. (a) The schematic diagram for Bradford protein quantification assay and calculation of adsorbed amount of NA on NPs. (b) Percentage of adsorbed protein on NPs and free protein in solution. The optimum NA amount was selected to 50 μg/mg NPs. PB:

Phosphate Buffer. NA: Neutravidin.

[0040] Figure 10. Fluorescence emission spectra of Eu:Gd₂θ3 NPs (λ_ex = 260 nm),

Alexa488 organic dye (λ_ex = 495 nm), Tb:Gd₂O₃ NPs (Kx = 260 nm), and Alexa647 (λ_ex =

650 nm). NPs: nanoparticles.

[0041] Figure 11. PKD SNP detection assay using multiple synthetic ssDNA probes in hybridization-in-solution approach for (a) exon29 and (b) exon38 polymorphism.

Eu:Gd₂O₃/Fe₃O₄ - Alexa488 and Tb:Gd₂O₃/Fe₃O₄ - Alexa647 were used for exon29 and exon38 SNP detection, respectively. The 1 bp difference in the nucleotide sequences of PKD

+ and PKD - synthetic DNA are shown. The signal and error bars represent average and standard deviations based on triplicate reactions. PKD: Polycystic Kidney Disease, SNP:

Single Nucleotide Polymorphism, RFU: Relative Fluorescence Units, NPs: Nanoparticles.

[0042] Figure 12. PKD SNP detection assay using PCR-amplified gDNA (feline exon29,

550 bp). The signaling probe was used to provide fluorescence by Alexa488 label. The underlined sequences of target DNA depict the complementary DNA sequences of probe and signaling probe. The signal and error bars represent average and standard deviations based on triplicate reactions. The band on the agarose gel photo indicates 550 bp PCR product amplified from feline gDNA.

[0043] Figure 13. (a) Schematic diagram for PKD SNP detection in direct hybridization-in- solution using feline gDNA and gel image for denatured gDNA. In the gel image, the smeared gDNA on the right side of gel represents the efficient denaturation by sonication in contrast to the result by 95 ⁰C incubation only on the left side of gel. Rapid and quantitative PKD SNP detection without PCR amplification was shown for (b) feline kidney tissue and (c) feline blood WBC (White Blood Cells). Both specimens show the successful discrimination of 1 bp nucleotide polymorphism in exon29. The signal and error bars represent average and standard deviations based on triplicate reactions. [0044] Figure 14. Spray pyrolysis of multiple-doped lanthanide oxide nanoparticles. [0045] Figure 15. Examples of luminescent spectra of lanthanide doped Gd₂O₃ nanoparticles synthesized by spray pyrolysis; (a) - spectrum OfEuIGd₂O₃, (b) - spectrum of Tb:Gd₂O₃, (c) - spectrum of Sm:Gd₂O₃, (d) - spectrum of mixed Eu (10%) and Tb (10%) doped Gd₂O₃.

[0046] Figure 16. Schematic diagram of hybridization in solution assay with linear probes. [0047] Figure 17. (a) A uniquely doped lanthanide nanoparticle is functionalized with a unique probe DNA. In the modified molecular beacon approach, an LRET acceptor is attached to the end of the probe DNA as an emitting beacon, (b) Sample target DNA binds to(c) remove the acceptor from the vicinity of the lanthanide emitter. The beacon signal decreases and can be measured in time-gated fashion to avoid background. The magnetic core of the particle will permit separation from solution.

[0048] Figure 18. (a) Schematic diagram of hybridization in solution assay with linear probes, (b) designed DNA oligonucleotide probes, and (c) hybridization result for perfect target and 2 SNPs mutations. DNA probes were designed for perfect target (wild type cell line), 1 mismatch target and deletion mutational target. Neutravidin™- functionalized Eu:Gd₂O₃ - magnetic core nanoparticles and different amount of target DNA were used in solution hybridization. The hybridization result shows the successful discriminated mutations for p53 gene. Fluorescence of FITC and Europium was measured in spectrofluorometer and error bars represent standard deviations based on 4 measurements.

[0049] Figure 19. Schematic diagram of hybridization in solution assay with linear probes in the PKD model. DETAILED DESCRIPTION

[0050] Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0051] The term "conjugate" includes any fully or partially complementary nucleic acid fragments (including DNA sequences, RNA sequences, and peptide nucleic acid sequences). [0052] The terms "oligonucleotide", "nucleic acid sequence," or "probe," refers to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to polyribonucleotides (containing D-ribose) and to any polynucleotide, which is a ribo sugar-phosphate backbone consisting of an N-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base. There is no intended distinction between the length of a "nucleic acid sequence," "polynucleotide," "probe," or an "oligonucleotide."

[0053] The term percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared. [0054] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters. [0055] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al, infra). [0056] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al, J. MoL Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information

(www.ncbi.nlm.nih.gov/).

[0057] It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0058] Briefly, and as described in more detail below, described herein is an assay for the detection or quantification of target nucleic acid sequences in a sample through the use of nanoparticles and oligonucleotide probes.

[0059] In general, the nanoparticle compositions of the present invention comprise a metal oxide particle having a desirable optical property that has been coated with a functionalizing reagent according to one embodiment. The functionalizing reagent may comprise a silane as disclosed in co-owned, abandoned U.S. Patent Publication 2003/0180780, incorporated herein by reference for all purposes, or may comprise a protein or peptide such as, e.g., BSA, or may be a polyionic polymer, such as, e.g., poly-L-lysine hydrobromide (PL). The functionalizing reagent also may comprise a biological molecule such as, e.g., avidin or

NeutrAvidin™. Avidin is one example of a surface molecule according to the present invention.

[0060] Preferred particle diameters are in the range of between about 10 and 1000 nm, more preferably between about 10 and 200 nm and even more preferably between about 10 and

100 nm, or between about 20 and 50 nm. In preferred embodiments, the metal oxide particles have the generic formula Me_xOy, wherein 1 < x < 2, and 1 < y < 3, and wherein preferably,

Me is a rare earth element selected from the lanthanide series and includes, but is not limited to, europium (Eu), cerium (Ce), neodymium (Nd), samarium (Sm), terbium (Tb), dysprosium

(Dy), gadolinium (Gd), holmium (Ho), thulium (Tm), or Me may be chromium (Cr), yttrium

(Y), iron (Fe). Other suitable metal oxide particles include silicon oxide (SiO₂), and aluminum oxide (AI₂O₃) mixed with Eu₂Os- or Eu³⁺-.

[0061] In other preferred embodiments, the metal oxide particle comprises a doped metal oxide particle by which is meant a metal oxide, and a dopant comprised of one or more rare earth elements. Suitable metal oxides include, but are not limited to, yttrium oxide (Y2O3), zirconium oxide (ZrO₂), zinc oxide (ZnO), copper oxide (CuO or Cu₂O), gadolinium oxide (Gd₂Os), praseodymium oxide (Pr₂Os), lanthanum oxide (La₂Os), and alloys thereof. The rare earth element comprises an element selected from the lanthanide series and includes, but is not limited to, europium (Eu), cerium (Ce), neodymium (Nd), samarium (Sm), terbium (Tb), gadolinium (Gd), holmium (Ho), thulium (Tm), an oxide thereof, and a combination thereof. Nanoparticles of such oxides may be manufactured according to the methods of co- owned pending U.S. Patent Publication 2007/0212542, incorporated herein by reference, purchased from commercial suppliers, or fabricated using methods known to those of ordinary skill in the art as set forth in, e.g., Patra, A., et al., "Sonochemical Preparation and Characterization of Eu₂Osand Tb₂O₃ Doped in and Coated on Silica and Alumina Nanoparticles," J. Phys. Chem., (1999) 103, 3361-3365 and Leppert, V. J., et al., Paper 4809- 49 SPIE 45th Annual Meeting, Seattle Wash., July 2002, the disclosures of which are herein incorporated by reference.

[0062] The desirable optical properties of the particles for the assays of the present invention include optical properties that allow the compositions to be useful as labeling agents, such as, e.g., fluorescence, fluorescence resonance energy transfer ("FRET"), luminescence, and phosphorescence. Thus, the particles for the assays of the present invention may be used by one of skill in the art in the same manner as fluorescent dyes, FRET pairs and other labeling reagents, but with the advantages that nanoparticles bring to labeling technology in terms of larger Stokes shift, longer emission half-life (for lanthanide-containing nanoparticles), diminished emission bandwidth, and less photobleaching as compared with, e.g., traditional fluorescent dyes. Preferably, the particles are capable of light emission or absorption at a measurable wavelength.

[0063] In addition to surface modification methods disclosed in U.S. Patent Application Publication 2003/0180780, additional methods may be used in the practice of the invention for surface modification (i.e., functionalization) and conjugation of the nanoparticles of the invention. In one embodiment, surface modification and conjugation comprises direct coating of the nanoparticles with a protein such as, e.g., BSA, ovalbumin or immunoglobulin. In another embodiment, surface modification is accomplished by physical adsorption and functionalizing with a polyionic polymer such as, e.g., poly-L-lysine hydrobromide, PL. PL is a polycationic polymer that adsorbs spontaneously from aqueous solutions onto the negatively charged metal oxide surfaces via electrostatic interactions. The excess of PL is washed off by centrifugation. The formed layer of PL is stable under the most commonly used buffers. The introduced amino groups on the surface of the particles permit their conjugation to a variety of small molecules (haptens) and biomolecules with appropriate functionalizations. In yet another embodiment, surface modification is accomplished by physical adsorption and functionalizing with a biological molecule such as, e.g., avidin or NeutrAvidin™.

[0064] Using appropriate buffer conditions (pH and concentration), a variety of molecules can be adsorbed spontaneously on the surface of the nanoparticles without affecting their fluorescence properties. The adsorbed molecules are generally those known to one of ordinary skill in the art, as noted above and in the art, and preferably function as a functionalizing agent for the nanoparticles of the assays of the instant invention. The coated particles are often purified by three rounds of centrifugation and can be stable for more than 1 month in a buffer solution.

[0065] Chemical or biological assays of the present invention may make use of the specific interaction of binding pairs or conjugates, one member of the pair is a probe, or grammatically similar terms, and the other member of the pair is often located in a sample (referred to as the "target," or grammatically similar terms). The probe is one example of an oligonucleotide capture probe and the target is one example of a target nucleic acid sequence according to the present invention. Generally, the target carries at least one so-called "determinant" or "epitopic" site, which is unique to the target and has enhanced binding affinity for a complementary probe site. Upon binding, the probe and the target form a conjugate. The conjugate is one example of a capture-target conjugate or a detection-target conjugate according to the present invention. Additionally, the present invention may comprise the use of multiple probes capable of binding the target. Preferably, the multiple probes bind to distinct regions of the target.

[0066] In one preferred embodiment, the probes of the invention are polynucleotides or oligonucleotides comprising naturally occurring nucleotide sequences, for e.g. cloned genes or gene fragments.

[0067] In another preferred embodiment, the probes are polynucleotides or oligonucleotides comprising partially naturally occurring nucleotide sequences and partially randomized nucleotide sequences.

[0068] Generally, probes are designed to provide a nucleotide sequence complementary to a target sequence such that the binding of target is a measurable event and contributes to the characterization or screening of a sample. Preferably, binding is by complementary base pairing, and need not be perfect. As is known in the art, the stringency of such binding is controllable by varying assay conditions. Probes may consist of any combination of naturally occurring and synthetic nucleotide sequences, with the possibility of randomizing all or part of the sequence according to the needs of the specific assay, e.g., identification of single nucleotide polymorphisms (SNPs) in targets.

[0069] Surface preparation of nanoparticles (i.e., functionalizing, as described above) useful for this invention for the attachment of probes and/or targets may include for example linker chemistry, affinity capture by hybridization or by biotin/avidin affinity, combinatorial chemistry, and others known in the art and as described above. [0070] In another related embodiment, the probes and/or targets of the invention can comprise "labels." The term "label" can refer to any atom or molecule that can be attached to a nucleic acid, or member of a binding-pair. A label may be coupled to a conjugate or nucleic acid through a chemically reactive group. A label may be attached to an oligonucleotide during chemical synthesis or incorporated on a labeled nucleotide during nucleic acid replication. Labels will include but are not limited to fluorescent moieties, chemiluminescent moieties, particles, enzymes, radioactive tags, quantum dots, light emitting moieties, light absorbing moieties, and intercalating dyes including propidium iodide (PI) and ethidium bromide (EB) and the cyanine dyes. Preferably, the label will be capable of light emission or absorption at a wavelength distinction from the wavelength of the nanoparticle. [0071] In another related embodiment, the wavelength of the nanoparticle and the wavelength of the label may be used to calculate a ratio using methods known to one of ordinary skill in the art. Preferably, the ratio may be used to quantify the target in the sample.

[0072] Nucleic acids or polynucleotides are of interest in many diagnostic or prognostic tests. Using nucleic acids or polynucleotides as probes may find many applications in the detection of complementary targets in a sample, detection of messenger (m)RNA or cDNA for gene expression, detection of microRNA or small interfering (si)RNA expression, genomic and proteomic microarray applications, detection of PCR products, DNA sequencing, clinical and non-clinical diagnostics or prognostics, hydridization-in solution applications, medical screening procedures, polymorphism screening, forensic screening, detection of proteins specifically binding to nucleic acids, and others as known in the art.

[0073] Assays can be done using various specific protocols known in the art. For detection or quantitation of a target, a sample can be combined and hybridized in a solution containing the nanoparticles and probes. Alternatively, a sample can be combined and hybridized in a solution containing a probe followed by subsequent addition of the nanoparticles. Alternatively, the sample can be applied in an array format to a membrane with the probe and subsequently detected with the addition of the nanoparticles. The membrane of the array format is one example of of a solid support according to the present invention. Alternatively, multiple distinct nanoparticles, each bearing a distinct probe sequence, can be applied simultaneously or in series to detect or quantitate a target or multiple targets in a solution or array. Various additional steps may be carried out, such as incubations, washings, the addition of miscellaneous reagents, magnetic separation, etc. as required by the specific assay. If a target of interest is present, that target will preferably bind to the probe and be subsequently detected by means of the nanoparticle, label, or combination thereof, as described above. Conversely, if a target complementary to a specific probe is not present, there will be no binding on that probe and no subsequent detection by the nanoparticle, or label, or combination thereof.

[0074] Practical applications for such assays include for example monitoring health status, predicting future health status, detection of drugs of abuse, pregnancy and pre-natal testing, donor matching for transplantation, therapeutic dosage monitoring, detection of contamination, detection of disease, e.g. cancer antigens, pathogens, microbes, viruses, sensors for biodefense, medical and non-medical diagnostic tests, and similar applications known in the art. The detection of microbes provides one example of a microorganism identification assay according to the present invention.

[0075] Assays using particles of the invention can be carried out in a large variety of sample matrices including separated or unfϊltered biological fluids such as urine, peritoneal fluid, cerebrospinal fluid, synovial fluid, cell extracts, gastric fluid, stool, blood, serum, plasma, lymph fluid, interstitial fluid, amniotic fluid, tissue homogenate, fluid from ulcers, blisters, and abscesses, saliva, tears, mucus, sweat, milk, semen, vaginal secretions, and extracts of tissues including biopsies of normal, malignant, and suspect tissues, and others known in the art. The sample can also be obtained from an environmental source such as soil, water, or air; or from an industrial source such as taken from a waste stream, a production line, reactors, fermentation apparatus, cell culture medium, or from consumer products, foodstuffs, and others known in the art. The test sample can be pre-treated prior to use depending on the details of the assay, techniques for which would be well known by those in the art. EXAMPLES

[0076] Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0077] The practice of the present invention will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3^rd Ed. (Plenum Press) VoIs. A and B (1992).

Methods [0078] Materials and instrumentation.

TM

[0079] NeutrAvidin , purchased from Pierce (Rockford, IL), was used to coat the nanoparticles and to interact with biotinylated DNA. Streptavidin-Alexa555 (Molecular Probes, Eugene, OR) was used to determine the amount of strepavidin required to saturate the nanoparticles' surfaces. Linear DNA oligoprobes were commercially synthesized (Biosource-

TM

Invitrogen, Carlsbad, CA). NeutrAvidin is one example of a surface molecule according to the present invention.

[0080] PBS (1Ox) was obtained from Sigma-Aldrich (St. Louis, MO) and DIG easy Hyb buffer (Roche Diagnostic, Basel, Switzerland) was used for DNA hybridization. Hybridiser HBl-D Hybridization incubator (Techne, Burlington, NJ) was used for nanoparticle encapsulation and DNA hybridization to maintain constant temperature and gentle mixing. [0081] A Spectramax M2 cuvette/microplate reader (Molecular Devices, Sunnyvale, CA) and black 96-well plates from Nunc (Roskilde, Denmark) were used for fluorescence quantitative measurements. A magnet MPC-S (Dynal-Invitrogen, Carlsbad, CA) was used to pull nanoparticle-DNA complexes out of the solution. Another magnet (Promega, Madison, WI) was used to demonstrate the magnetic separation of nanoparticles in solution, as shown in

Figure 1.

[0082] Synthesis and characterization of Fe O /Eu:Gd O core-shell nanoparticles.

[0083] The core-shell nanoparticles used in this work were synthesized by the spray pyrolysis process. Magnetic core, Fe 3 O 4 nanoparticles were dispersed in a precursor solution of 20 % Eu(NO ) and 80 % Gd(NO ) in methanol and the solution was then was sprayed through a hydrogen flame. Consequently, Eu:Gd O formed the luminescent layer on the surface of the magnetic core. For this work, Fe O nanoparticles were synthesized via a co- precipitation method. An ultrasonic bath 75D (VWR, Brisbane, CA) was used to aid particle dispersion in solution. The size and morphology of the nanoparticles were determined using a Philips CM- 12 Transmission Electron Microscope (TEM). [0084] Preparation of biofunctionalized Fe O /Eu:Gd O core-shell nanoparticles.

TM

[0085] Bio-functionalization of nanoparticles was performed using with NeutrAvidin by passive adsorption, in the manner already described for avidin-nanoparticles encapsulation.

TM

To quantify the efficiency of bio-functionalization for nanoparticles with NeutrAvidin (equivalent to Streptavidin) by passive adsorption, Streptavidin (SA)-Alexa555 was used to

TM bind with the NeutrAvidin on the nanoparticles and was detected via the fluorescence of Alexa555. 0.5 mg of Fe O /Eu:Gd O core-shell nanoparticles were suspended in 300 μL phosphate buffer (PB, 25 mM, pH=7.5) using an ultrasonic bath for 10 minutes. Various amounts of SA-Alexa555 solution, corresponding to the range of 50 - 400 μg of SA- Alexa555 per 0.5 mg nanoparticles, were added to the nanoparticle suspension. PB was used to adjust the final reaction volume to 1 mL. The mixture was incubated in a rotating hybridization oven for 6 hours at room temperature. Nanoparticle-SA-Alexa555 complexes were washed three times by centrifugation (5 min, 12,000 rpm) and were resuspended in 100 μL PB then transferred to a 96 well microplate for subsequent fluorescence measurement by a spectrofluorometer. Fluorescence intensities were measured for Alexa555 excited at 550 nm; the emission was measured at 575 nm. Europium nanoparticles were excited at 260 nm and were detected at 616 nm. [0086] Fluorescence analysis.

[0087] A Spectramax M2 cuvette/microplate reader was used as a spectrofluorometer for the fluorescence measurement of the bio-functionalization of nanoparticles, a coating stability test, and DNA quantification of in solution hybridization. End-point measurements were chosen with sensitivity 6, automatic PMT, and 6 seconds of shaking time before reading for homogenous measurement of the particles.

TM

[0088] Optimization of NeutrAvidin amount for nanoparticles coating.

TM

[0089] 0.5 mg of nanoparticles were coated with various amounts of NeutrAvidin corresponding to 0 - 400 μg. 100 μL of resuspended nanoparticles were mixed with 400 μL DIG easy Hyb buffer and with biotinylated probe DNA labeled with FITC (0, 50, 100, 200 pM). The mixture was incubated with gentle mixing in hybridization oven at 37 ⁰C for 8 hours. After incubation, nanoparticles were washed with PB by centrifugation (5 min, 12000 rpm) and resuspended in PB. The FITC (excitation 488 nm and emission 520 nm) and Europium fluorescence were measured by a spectrofluorometer. [0090] Quantification of DNA using a hybridization-in-solution format.

TM

[0091] 200 μg of NeutrAvidin was selected as the optimum amount of coating of nanoparticles (Figure 1). Encapsulated nanoparticles were mixed with 400 μL DIG easy Hyb buffer and 500 pM of biotinylated probe DNA. The mixture was incubated for 8 hours at 37 ⁰C temperature with gentle mixing. After washing three times, biotinylated probe DNA -

TM

NeutrAvidin - nanoparticle complexes were resuspended in 100 μL PB. 400 μL Hyb buffer and various amounts of target DNA (0, 1, 10, 50, 100, 250, 500, 1000 pM) labeled with FITC were added to the reaction mixture. Target DNA was hybridized to probe DNA, which was already attached to nanoparticles. The hybridized probe and target DNAs is one example of a capture-target conjugate according to the present invention. Target DNA hybridization was performed in the same manner as the probe DNA. The FITC and europium fluorescence were measured by the spectrofluorometer as described above. The schematic diagram of the hybridization-in-solution approach is shown in Figure 2. [0092] Quantification of DNA using an array format.

[0093] The schematic diagram of our DNA assay is illustrated in Figure 3. Linear DNA oligoprobes were designed and commercially synthesized (Biosource, Carlsbad, CA). Aminated probe DNA (20 μM) was spotted on the Nexterion™ HiSense E Epoxysilane coated glass (Schott, Elmsford, NY) by Lucidea Microarrayer (GE, Piscataway, NJ). The glass is one example of a solid support according to the present invention. After stabilization, non-spot area was passivated with solution containing NaBH₄, SSC, and SDS for 20 minutes at 42 ⁰C and washed twice with 1 x and 0.2x SSC. Hybridization with target DNA was carried out in a hybridization cassette (Corning Inc., Corning, NY). 30 μL of pre- hybridization (5* SSPE/6M Urea/0.5% Tween20/10* Denhardts) buffer was added and incubated for 1 hour at 42 ⁰C to prevent non-specific binding of nanoparticles onto glass. Different amount of target biotinylated DNA was diluted in DIG Easy Hyb buffer (Roche Diagnostic, Basel, Switzerland) and denatured by heating at 95°C for 5 minutes before hybridization. Hybridization between target and probe DNA was carried out for 8 hours at 42 ⁰C followed by washing with 2x SSC/0.1% SDS; Ix SSC; 0.5x SSC each at ambient temperature and drying in nitrogen stream.

Example 1: Quantification of target DNA using a hybridization in solution approach with magentic/luminescent core-shell nanoparticles. [0094] Fe O /Eu: Gd O core/shell nanoparticles and bio-functionalization.

[0095] To demonstrate the magnetic properties of the particles, 1 mg of nanoparticles were well dispersed in PB with sonication and then positioned in the vicinity of the magnet as shown in Figure 1. In two minutes, the brownish nanoparticle pellets were attracted to the magnet and separated from solution. TEM images taken for the particles show the range of particle size is 200 nm - 400 nm. The particle had an irregular form, indicating different sizes and numbers of magnetic cores that were embedded during synthesis. (Figure 1) [0096] Streptavidin-Alexa555 was coated on nanoparticles via physical (passive) adsorption for surface bio-functionalization during 6 hours incubation. The Alexa555 fluorescence for various amounts of adsorbant (streptavidin) is shown in Figure 1. Since each assay contained an inherently different number of particles in 0.5 mg nanoparticles that used in the experiment, Alexa555 fluorescence was normalized by the europium fluorescence of nanoparticles. The fluorescence ratio (Alexa555/NPs) attained saturation above 100 μg of streptavidin-Alexa555. Based on this result, for subsequent experiments we chose to use 200

TM μg NeutrAvidin (equivalent to streptavidin) per 0.5 mg nanoparticles. [0097] Stability test for nanoparticle bio-functionalization.

[0098] The stability of the protein encapsulation was examined under DNA hybridization conditions. Since temperature (37 ⁰C) and buffer composition were optimized only for DNA interaction, the stability of the coating protein needed to be confirmed throughout DNA hybridization process. Fe O /Eu:Gd O core-shell nanoparticles (0.5 mg) encapsulated with

200 μg SA-Alexa555 were suspended in 100 μL PB. 400 μL DIG easy Hyb buffer was added to particle suspension and the mixture was incubated at 37 ⁰C for 2 hours. The particles were washed three times with PB; the particle-SA-Alexa555 complex was then re-suspended in

100 μL PB and transferred to 96 well microplate for fluorescence measurement. Both.

Alexa555 and Europium nanoparticles fluorescence signals were measured by spectra fluorometer before and after hybridization to gauge the SA-encapsulation stability under the hybridization conditions.

[0100] The results are presented in Table 1. Streptavidin coated nanoparticles (F_Alexa555/NPs) showed similar fluorescence before (1.068 RFU) and after 2h hybridization at 37 C (1.211 RFU). In parallel to the measurement of nanoparticles functionalized with SA-Alexa555, the same amount of non-functionalized nanoparticles was measured as a control to calibrate possible variational error in the spectrofluorometer. Thus the fluorescence (F_Alexa555/NPs=

1.097 RFU) of the control was similar to that (1.068 RFU) of nanoparticles before hybridization, indicating that the streptavidin coated nanoparticles are stable under DNA hybridization conditions. Table 1

Before hybridization at 37 °C After hybridization at 37 "C

FA-_HUSS*

Nanoparticles encapsulated

805 754 1.068 745 615 1.211 with SA-Aϊexa 100 μg

Nanoparticles encapsulated with SA-Alexa 100 μg ^o incubation 770 702 1.097

(control: no hybridization }

Phosphate buffer (control) 0 0 NA* 46 C N A.

* SA: Streptavidin; T of hybridization - 37 °C . hybridization buffer - DIG easy Hyfe buffer. ** : the ratio (Alexa555/NPs) is not possible to be calculated for phosphate boiler as a control due to zero values and does not have any perspective since fluorescence of control represents the background of measurement

[0101] Probe DNA immobilization and sensitivity.

[0102] Preliminary immobilization of single linear DNA oligonucleotide was performed on

TM the surface of NeutrAvidin - coated nanoparticles to optimize hybridization conditions (data not shown). Different concentrations (0, 50, 100, 200 pM) of biotinylated probe DNAs

TM were hybridized with different amounts (0, 50, 100, 200, 400 μg) of NeutrAvidin - encapsulated nanoparticles. The biotinylated probes are one example of an oligonucleotide capture probe according to the present invention. 100 pM and 200 pM of probe DNA reached saturation (similar intensity), when those probe DNAs were hybridized with 100,

TM

200, or 400 μg of NeutrAvidin (per 0.5 mg nanoparticles). Therefore, more than 100 pM of

TM probe DNA and 100 μg of NeutrAvidin were sufficient to immobilize probe DNA on nanoparticles.

[0103] We performed titration hybridization-in-solution experiments by targeting probe

DNA-nanoparticles to their complementary DNA labeled with FITC (Figure 4). FITC fluorescence was normalized with the nanoparticles' fluorescence (FITC/NPs), since each reaction contained intrinsically different numbers of nanoparticle-DNA complexes. A linear

2 quantitative relation (R = 0.98) between target DNA and normalized fluorescence value ( ^VF FITC/NPs )⁷ was revealed over a dy ^Jnamic rang ^&e of targ ^&et DNA concentrations ( ^\0,, 1,, 10,, 50,,

100, 250, 500, 1000 pM). The detection limit in this approach was 10 pM of target DNA. [0104] Hybridization kinetics.

[0105] Rate constants of hybridization reactions were obtained from the linear regression analysis based on first-order kinetics models. This was determined by hybridizing different target DNA concentrations with nanoparticle-probe DNA complexes. Normalized signal intensities of FITC of the target DNA were converted to DNA concentration by using the calibration curve shown in Figure 4. The target DNA is one example of a target nucleic acid sequence according to the present invention. Fluorescence intensities were measured at 0.5, 1, 2, 3, 4, 6 hours-reactions. The rate constants were calculated by linear regression analysis using SigmaPlot software.

[0106] The results are presented in Figure 5 and Table 2. While the probe DNA concentration was constant, the rate of hybridization increased as the target concentration

-1 increased (0.0379 → 0.1268 → 0.1915 → 0.2033 h ). The reaction of 10 pM target DNA (the smallest concentration) reached a maximum earlier than the other target DNAs. (after 2 hours). The increase in the rate of hybridization with the concentration of DNA shows that the concentration of probe and target is a determining factor in the hybridization reaction. This finding provides supportive information to aid in the design of a DNA biosensor in terms of range of target DNA and reaction time. With a view to engineering a miniaturized biosensor using micro- and nano-fabrication techniques, the extent of the reaction time along with the reaction rate should be considered.

[0107] Assay selectivity: Discrimination of DNA sequence with mismatches. [0108] We have evaluated the capability of our DNA-nanoparticle conjugates to discriminate mismatched target DNA in a hybridization-in-solution format. DNA with two base pairs - mismatch sequence to probe DNA was designed to represent an example of 16S rDNA gene sequence from a closely related to strain PMl bacterium (Table 3). First, solution hybridization was performed with the same range of DNA concentration (10, 50, 100, 150, 200, 250 pM) of perfectly complementary target DNA in a series of 1.5 mL eppendorf tubes. In parallel, DNA molecules with two-base pairs mismatch sequence were hybridized according to the hybridization procedure mentioned above. Secondly, both perfect target and mismatched DNA incubated in a hybridization oven were simultaneously brought to the magnet to be washed with PB for three times. Finally, the fluorescence detection was performed by spectrofluorometer as described above. Table 3

Name Sequence (from 5' to 3')

p_rob_e 5' - Biotin - ACA CGA GCT GAC GAC GGC CAT G - 3'

Complementary ⁵' ^{~ FITC ~ AGA ACA CAG GTG CTG CAT GGC CGT CGT CAG cτc GTG TCG TGA GAT Gττ ~} target

Target with two- ⁵' ^{~ FITC ~ AGA ACA CA}£.^{GTG CTG CAT GGC c}£τ ^CGT CACCTC GTG TCG TGA GAT GTT - base pairs mismatch sequence

[0109] In our experiments, DNA targets with two-base mismatch sequence were hybridized with probe DNA-nanoparticle conjugates in parallel with perfectly complementary sequence (Figure 6). 16S rDNA with two-base mismatches, representing a phylogenetically close bacterium to our MTBE degrading organism, was clearly discriminated from perfectly complementary target at concentrations of over 100 pM of target. The identification of the MTBE degrading organism is one example of a microorganism identification assay according to the present invention. The fluorescence signal of perfectly complementary target and two- base mismatch sequence was statistically compared using p-values obtained from t-test (Table 4). The fluorescence signals of perfectly complementary sequence are statistically different from the signals from two-base mismatch sequence at the 95 percent confidence interval. At the 95 percent confidential interval, p < 0.1 is significant in a two-sided analysis. Small (significant) p-values suggest that the null hypothesis is unlikely to be true. Since all p- values are less than 0.1 , this result indicates that two-base mismatch sequence was discriminated from perfectly complementary target for all tested concentration ranges (10- 250 pM). Furthermore, the smaller p-value at the higher concentration (> 100 pM) indicates that there was a higher probability of discriminating mismatched target DNA.

Example 2: Quantification of target DNA using an array approach with magentic/luminescent core-shell nanoparticles.

[0110] This example provides a demonstration of the feasibility of using nanoparticle labels for quantifying MTBE-degrading bacteria and their direct application for environmental assays.

[0111] Subsequent to particle synthesis by spray pyrolysis, the Eu:Gd₂O₃ particles were sized by ccntrifugation to collect particles with diameters from 5 to 60 nm. 200 μg of NeutrAvidin™ (Pierce, Rockford, IL) dissolved in phosphate buffer (PB, 25 mM, pH=7) was used for biofunctionalization of 0.5 mg nanoparticles. Passive adsorption of NeutrAvidin ^1M to particles was achieved in a rotating mill for 6 hours at ambient temperature. Twice washed particle-NeutrAvidin™ complex was suspended in 100 μL incubation buffer (0.05% Tween- 20/0.1% BSA in Ix PBS) and incubated with hybridized biotinylated target DNA on the glass for 1 hour at ambient temperature. For comparison, Quasar570 (Cy3 replacement) labeled target DNA was hybridized in parallel spots on the glass. Fluorescent images for nanoparticles and Quasar570 were captured with Axon laser scanner Genepix 4000B (Molecular Devices, Sunnyvale, CA) at 650 levels of photomultiplier (PMT) and 5μm scanning steps. Fluorescent signal for each spot was measured by Axio vision software (Zeiss, Thornwood, NY).

[0112] After hybridization with 100 pmoles of target DNA, the fluorescence spot intensities showed that europium nanoparticle labels had stronger fluorescence than Quasar570 (Figure 7). Quasar570 and europium nanoparticles labeled microarrays showed average relative fluorescence intensities of 138 ± 7 and 205 ± 40 RFU, respectively. [0113] The results with different target DNA concentrations represent a successful quantitative hybridization of nanoparticle-probes to target DNA. Europium oxide nanoparticle spot intensities show a linear relation of PMl 16S rDNA over the tested target DNA concentration range, while the fluorescence of background remains a constant 30-40 RTU (Figure 8).

Example 3: Single Nucleotide Polymorphism (SNP) detection using a nanotechnology-based DNA assay.

[0114] This example provides a demonstration of the feasibility of using nanoparticle labels for detecting SNPs.

[0115] Magnetic/luminescent nanoparticles

[0116] Nanoparticles ("NPs") were biofunctionalized with Neutravidin ("NA") and DNA oligoprobes were attached as described above. The linear DNA oligoprobes were designed based on the sequences of feline PKD exon 29 and 38 genes (Genbank accession for exon29: AY612847, exon38: AY612849) and commercially synthesized (IDT, Coralville, IA, USA). The optimum concentrations of coating reagent (50 μg NA/mg NPs) and pH buffer were determined by the quantification of NA (Figure 9). The absorbance of NA in solution was determined and calculated in μg and pmoles before and after incubation to passively adsorb NA on the surfaces of NPs. Hence, subtraction of B from A indicated the actual adsorbed NA amount on NPs. A varying amount of NA (10, 20, 50, 100, 200 μg) per 1 mg NPs was added to the incubation solution. The adsorbed NA was 4.514 μg (50 μg added NA) and 4.426 μg (100 μg NA), while the others had lesser amounts of adsorption (0.2-2.3 μg). Although the actual adsorbed amount of NA was similar for 50 and 100 (μg NA/mg NPs), the optimum coating amount of NA was selected to be 50 μg per 1 mg NPs, due to the higher efficiency of adsorption of 50 μg NA (~ 50 %) compared to 100 μg NA (~ 30 %) (Figure 9). In the same manner, PB (Phosphate buffer) was the optimum buffer among those tested: PB, PBS and PBST.

[0117] Hybridization for NP-probe and target ssDNA

[0118] Two point mutations for PKD in feline model were examined to prove the possibility of our technology to discriminate single nucleotide polymorphism as well as to ensure that SNP detection is feasible for more than one spot, which demonstrates the potential of multiplexing analysis using this technology. In order to examine two mutational points in feline model, two different lanthanide-doped (Europium and Terbium) nanoparticles were paired with reporter organic dyes (Alexa488 and Alexa647, respectively) for SNP detection. The emission spectra of lanthanide NPs and reporter dyes were shown in Figure 10. Fifty micrograms of NA was selected as the optimum coating amount of 1 mg of NPs. NA- encapsulated NPs were mixed with 1000 μL DIG easy Hyb buffer (Roche, Basel, Switzerland) and biotinylated probe DNA. The mixture was incubated for 2 hours at 37 ⁰C with gentle rotation. Following washing three times, both Eu:Gd2θ3/Fe3θ4 and Tb !Gd₂(VF 63O₄ NPs-probe DNA conjugates were hybridized with various amounts of target DNAs labeled with Alexa488 and Alexa647 for 8 hours at 37 ⁰C. The fluorescence of Alexa488 (K_x = 495 nm, Km = 519 nm), Alexa647 (Kx = 650 nm, λe_m = 665 nm), Europium (Kx = 260 nm, λβ_m = 616 nm), Terbium (λ_ex = 260 nm, λ_em = 544 nm) were measured in a microplate reader.

[0119] A hybridization-in-solution assay (Figure 11) using synthetic ssDNA (single stranded DNA) oligonucleotides attached to NPs was performed, and the hybridized DNA were pulled out of solution by a magnet. DNA sequences were discriminated by a difference in fluorescence signal of PKD negative (Cytosine) and positive (Adenine) DNA targets in exon29 (Figure 3a) and negative (Cytosine) and positive (Thymine) in exon38 (Figure 11). Following measurement by spectra fluorometer, the Alexa fluorescence of the target DNAs was normalized with the phosphorescence of the NP -probes (i.e. Alexa488/Eu NPs, Alexa647/Tb NPs) for each reaction. PKD (exon29) SNP discrimination is possible over a range of target DNA concentrations (1, 10, 50, 500 pM), while negative DNA control shows the background fluorescence (0.2-0.5 RFU, Relative Fluorescence Units) (Figure 11). [0120] PKD SNP detection assay for blood and tissue specimens [0121] gGenomic DNA (gDNA) was utilized to take advantage of its relative ease of procurement in patient samples, for example from a blood draw or buccal smear or even potentially from cells sloughed into the urine. We first examined gDNA extracted from kidney tissue. Feline kidney tissue and blood (Persian cats of ADPKD positive/negative) were obtained from Dr. Leslie Lyons' lab in the School of Veterinary Medicine at UC Davis. Prior to gDNA extraction, kidney tissue was incubated with RNase A, in order to remove RNA which exists in a high level in a transcriptionally active kidney tissue. White Blood Cells (WBC) were separated from whole blood by centrifugation (5000 rpm, 15 min) at room temperature. Genomic DNA was extracted by using QIAamp^® DNA mini kit (Qiagen, Valencia, CA) and subsequently denatured by 95 ⁰C incubation for 5 minutes and sonication for 30 seconds. Exon29 polymorphism (C>A transversion) was selected for following experiments due to the significance of exon29 mutation causing a stop codon that results in a production of an abnormal, truncated protein, while exon38 polymorphism (C>T) links to only amino acid change without protein alteration.

[0122] Following gDNA extraction from feline kidney tissue, PCR (Polymerase Chain Reaction) was carried out to verify that exon29 exists in extracted gDNA and to use the amplified PKD gene (-550 bp) as a target during the assay optimization with the signaling DNA probe detection. Touchdown PCR (59 ⁰C → 50 ⁰C, decreasing 0.5 ⁰C per cycle) was performed using a primer set targeting feline PKD gene exon29 (FW 5 ' CAGGT AGACGGG ATAGACGA 3', RV 5' TTCTTCCTGGTCAACAGCTG 3').⁸ PCR amplicons were purified using Qiagen PCR purification kit and confirmed by 1.5 % agarose gel electrophoresis. In a gel photo of Figure 12, the 550 bp of PCR product was obtained for both PKD+ and PKD- tissue, while negative control (no PCR template) does not generate any amplicon. To avoid labeling of target DNA, a signaling DNA probe labeled with Alexa488 was used as a reporter of hybridization. The point mutation in feline PKD PCR products was successfully discriminated in a dynamic range of target concentrations (0.01 - 10 ng/mL, Figure 12). [0123] Feline blood specimens were examined for PKD SNP detection in parallel with tissue in subsequent experiments. Hybridization protocols such as the buffer composition and gDNA denaturation conditions were optimized. Concentrations vary from 30 mM to 250 mM (NaCl) and from 0 % to 70 % (formamide). Following to hybridization of gDNA without PCR amplification using NP -probe DNA and signaling probe DNA labeled with Alexa488, three times of washing was performed by using 10 mM PB, 300 mM NaCl buffer in a magnet-separation platform. Variations in the concentrations of formamide and NaCl showed that a combination of 30 % of formamide and 75 mM of NaCl was the optimal buffer composition (graph not shown). While 95 ⁰C incubation (5 min) without sonication was not always effective, resulting in non-denatured gDNA (left side of gel photo in Figure 13), the combination of sonication and 95 ⁰C incubation (5 min) transformed gDNA to the denatured and smeared DNA fragments (right side of gel). The denatured DNA fragments were subsequently used for gDNA hybridization as a target. By using a direct hybridization with gDNAs from blood as well as tissue, detection of PKD SNPs in both samples was successful as shown in Figures 13. The detection range of the optimized assay was over 200 ng/mL reaction for both tissue and blood gDNA.

Example 4: p53 oncogene biomarker detection using a nanotechnology-based

DNA assay.

[0124] Particles with multiple lanthanide dopants are synthesized, all of which emit efficiently and independently of other dopants (Figure 14). Co-doping provides an enormous number of encoded particle substrates for DNA assay with unique probe sequences attached during the processing to each encoded particle.

[0125] The nanoparticle synthesis process is sustained in part by the solvent itself. The size of the nanoparticles is controlled by selecting a narrow size range of spray droplets through the use of an aerosol impactor (not shown), producing a product with a sufficiently narrow size distribution. Pyro lysis of the precursors within the flame forms lanthanide (RE) oxide:Y₂θ₃ nanoparticles. A cold finger is used for collecting the RE:Y₂θ₃ particles thermophoretically. The production rate by this synthesis procedure is about 400 - 500 mg/h. It is possible to make particles with diameters in the range from 20 nm to 500 nm. [0126] Particle sizes are determined using a Philips CM- 12 transmission electron microscope. Optical characterization of the lanthanide :Y₂θ3 nanoparticles is carried out using laser-induced spectroscopy.

[0127] Spray pyro lysis is suitable for the synthesis of metal oxides. Oxides of iron are known for their magnetic properties. Magnetic nanoparticles based on iron oxide, and other elements such as cobalt and neodymium, can be easily synthesized using spray pyrolysis. Such magnetic nanoparticles can be used as "seeds" in a two-step spray pyrolysis synthesis of phosphorescent Eu:Y₂θ3 nanoparticles. In this way, a phosphorescent shell is built around the magnetic core. We have synthesized particles with multiple lanthanide dopants, all of which emit efficiently and independently of other dopants (Figure 15). The encoding is achieved readily by changing relative flow rates of precursors into our spray. The detection of individual particles is optimized by making use of time-gated detection and long time excitation.

[0128] A rapid synthesis method is employed for constructing core-shell nanophosphors with a magnetic center. Probe DNA captures target DNA in samples. Readout of the assay proceeds by one of two methods: (1) a sandwich construct with a second linear probe DNA detected by a second silica bead with embedded fluorescent label (Figure 16) or (2) hybridization detected in a variation of the molecular beacon that uses luminescent resonance energy transfer (LRET) from the phosphor to an acceptor (Figure 17). The phosphors allow use of time-gated detection to avoid background. Temporal and spectral separation between the second fluorescence label or LRET acceptor, and the encoded lanthanide/magnetic core particle improve sensitivity.

[0129] Magnetic particles with bar coding shell are covered with DNA oligoprobes based on the streptavidin-biotin chemistry. After hybridization between DNA probe-particle conjugates, target DNA, and a second probe labeled with silica bead + Cy3, the signal of Cy 3 normalized to Eu signal is measured (Figure 18). In a multiplexed assay, additional measurements of the ratio of different lanthanides imbedded in the shell of the nanoparticles indicate which probe is hybridized. Silica nanoparticles that contain fluorescent dye, rather than simply individual dye molecules, can be used as labels on our second DNA probe. The inclusion of many thousands of dye molecules can increase the fluorescence signal dramatically. The sequestration of the dye within the silica matrix can reduce quenching by dissolved oxygen and may stabilize the dye against photo-bleaching.

[0130] The target DNA based on p53 gene is hybridized with both DNA probe (attached on magnetic bar coded-particles) and secondary signaling probe, labeled with Cy3 dye imbedded in silica particle, by the sandwich hybridization method. After hybridization a magnet is used to pull out the Eu-particles with hybridized DNA while non- or incomplete hybridized DNA remain in the solution and is removed. If molecular beacons are used as probes this additional step may not be necessary. In the case of dual labeled MBs (Eu particle and Alexa 680) ta pulsed laser to excite the probe with time -resolved fluorescence measurements to detect Alexa 680 emission (730 nm bandpass emission filter, 10 nm bandwidth). AlexaFluor 680 has an emission maximum at 702 nm where europium has a local emission minimum. The lanthanide emissions are usually much longer- lived (1 μs to several ms) than fluorophore emissions (10 μs). [0131] We used commercially synthesized perfect DNA targets as a control (with no mismatches to the probes) and targets with single base pair mutations (Figure 18). As a second step, DNA is extracted from different cell lines and the SNPs of p53 gene are measured with the described approaches.

Example 5: PKD mutational biomarker detection using a nanotechnology-based

DNA assay.

[0132] Particles are synthesized with paramagnetic Fe₃O₄ cores that are co-doped with multiple lanthanides, all of which emit efficiently and independently of other dopants. The emission lifetimes will be controlled by the concentration of the dopants in the host - high concentrations reduce the lifetime.

[0133] DNA probes are synthesized based on known sequences and mutations of the PKDl gene (which is mutated in 85% of ADPKD patients) in both humans and the feline disease model (which is also characterized by different mutations in the PKDl ortholog). Synthesized probe DNAs are immobilized on the surface of bio-functionalized nanoparticles by passive adsorption of biotin (probe DNA) to neutravidin (functionalized nanoparticles). Covalent bonding is also another common method for surface bio-functionalization of nanoparticles for an interaction with DNA. The amount of coated protein (neutravidin) on the covered particles is measured by the fluorescence of organic dye that is labeled in the protein. Subsequently, the amount of biotinylated probe DNA is determined by both 1) a theoretical approach (biotin:neutravidin = 1 :4 interaction ratio) and 2) an experimental approach (determined by fluorescence measurement).

[0134] A rapid synthesis method is employed for constructing core-shell nanophosphors with a magnetic center and will attach linear DNA probes. Probe DNA captures target DNA in samples. As shown in Figure 19, a sandwich construct with a second linear probe DNA with fluorescent label and readout of the assay proceeds by one of two methods: (1) readout by plate reader; and (2) readout by time-gated detection.

[0135] The phosphors allow us to make use of time-gated detection to avoid background. Temporal separation as well as spectral separation between the second fluorescence label, and the encoded lanthanide/magnetic core particle, can improve sensitivity. In the time domain, we design our particles so that the lanthanide emission is weaker than the secondary fluorescence label. Measurements within 10 ns of an excitation pulse can be dominated by the secondary label. The later emission is then only due to the lanthanides. In the frequency domain with modulated LED or laser diode excitation the secondary label dominates the very small phase-shift signal, while the signal at larger phase shift can be due to the lanthanides. [0136] As shown in Figure 19, a nanoparticle-probe-target-signal probe DNA configuration is used. The binding of the target and signal probe is one example of a detection-target conjugate according to the present invention. Following immobilization of biotinylated probe DNA on the particles' surfaces, synthetic ssDNA target and signal probe DNA labeled with organic dye are simultaneously hybridized. The hybridized DNA complexes are separated from solution by a magnet, while non-hybridized DNA remain in solution. To assess the magnetic property of the particles to separate the DNA-particle complex from solution, the remaining solution is characterized by fluorescence measurement (Europium excited at 260 nm with emission at 616 nm). The conditions for efficient magnetic separation, such as time of separation, are determined. A 95% particle recovery is considered to be a successful magnetic separation for DNA quantification.

[0137] The normalized fluorescence (signal ratio of Alexa488/Europium in nanoparticles) is measured by a spectrofluorometer and a subsequent calibration curve is generated by plotting those values versus target DNA concentration (pM level). In a multiplexed assay, additional measurements of the ratio of different lanthanides imbedded in the shell of the nanoparticles give us an indication of which probe is hybridized. Using synthetic DNA targets we develop single and multiplex DNA-assays in micro-well format. We target 2 mutations (C>A transversion causing a stop codon in exon 29 and C>T transition at position 127 of exon 38) and 7 SNPs at exon 29 of feline PKD and perform hybridization experiments in multiplex reaction. We can cover 200 SNPs and mutations in PKDl and PKD2 genes. PKD 1 gene mutations, which cause 85 % of autosomal dominant polycystic kidney disease (ADPKD), have been identified in at least 66 locations (nonsense, deletion or insertion, missense). At least 75 mutations of the PKD 2 gene have been identified. The assay is performed initially as single reactions with multiple synthetic DNA targets.

[0138] Followed by feline model application, human blood samples are used for higher density multiplexing application. We demonstrate our ability to measure different nanoparticle-probe DNAs in micro-wells by initially running consecutive assays with different types of particles, followed by measurement with a plate reader. Multiplexed assays are performed in a microchannel.

[0139] While the invention has been particularly shown and described with reference to a preferred embodiment and various alternate embodiments, it will be understood by persons skilled in the relevant art that various changes in form and details can be made therein without departing from the spirit and scope of the invention.

[0140] All references, issued patents, and patent applications cited within the body of the instant specification are hereby incorporated by reference in their entirety, for all purposes.

Claims

1. An assay for quantifying a target nucleic acid sequence in a sample using an oligonucleotide capture probe, comprising: binding a luminescent magnetic particle with a nucleic acid sequence under conditions appropriate for binding, wherein the luminescent magnetic particle is capable of light emission or absorption at a first wavelength, and wherein the nucleic acid sequence is selected from the group consisting of: the target nucleic acid sequence and the oligonucleotide capture probe; contacting the sample comprising the target nucleic acid sequence with the oligonucleotide capture probe under conditions in which the oligonucleotide capture probe specifically binds at a first region with the target nucleic acid sequence to form a capture-target conjugate, wherein the oligonucleotide capture probe comprises a sequence complementary to at least a portion of the target nucleic acid sequence; and making a first measurement of the light emission or absorption at the first wavelength.

2. The assay of claim 1 , wherein the oligonucleotide capture probe is bound to the luminescent magnetic particle at a first position.

3. The assay of claim 2, wherein a label capable of light emission or absorption at a second wavelength is associated with the target nucleic acid sequence.

4. The assay of claim 2, wherein a label capable of light emission or absorption at a second wavelength is associated with the oligonucleotide capture probe at a position other than the first position at which the luminescent magnetic particle is bound.

5. The assay of claim 2, further comprising: contacting the target nucleic acid sequence with an oligonucleotide detection probe comprising a sequence complementary to at least a portion of the target nucleic acid sequence under conditions in which the oligonucleotide detection probe specifically binds with the target nucleic acid sequence to form a detection-target conjugate, wherein the oligonucleotide detection probe comprises a label capable of light emission or absorption at a second wavelength, and wherein the oligonucleotide detection probe binds to the target nucleic acid sequence in a region different than the first region where the oligonucleotide capture probe binds the target nucleic acid sequence to form the capture-target conjugate.

6. The assay of claims 3, 4, or 5 further comprising: separating the capture -target conjugate bound to the luminescent magnetic particle from the sample by magnetic separation to form a secondary sample.

7. The assay of claim 6, further comprising: making a second measurement of the light emission or absorption at the second wavelength; and calculating a ratio of the first and second measurements to quantify the target nucleic acid sequence in the secondary sample.

8. The assay of claim 1 , wherein the oligonucleotide capture probe is bound to a solid support, and wherein the target nucleic acid sequence is bound to the luminescent magnetic particle.

9. The assay of claim 1 , wherein the luminescent magnetic particle is a nanoparticle comprising a magnetic core and a shell, the shell comprising one or more metal ions doped into a metal oxide host.

10. The assay of claim 9, wherein the nanoparticle further comprises a rare earth element doped in the metal oxide host.

11. The assay of claim 1, wherein the binding of the luminescent magnetic particle with the nucleic acid sequence is via a surface molecule on the luminescent magnetic particle, wherein the surface molecule is selected from the group consisting of: a biological molecule or a polyionic polymer.

12. The assay of claim 11 , wherein the surface molecule is an avidin compound.

13. The assay of claim 11 , wherein the nucleic acid sequence further comprises a binding molecule that interacts with the surface molecule.

14. The assay of claim 13, wherein the binding molecule is biotin.

15. The assay of claim 1 , wherein the luminescent magnetic particle is a nanoparticle comprising a magnetic core and a shell, the shell comprising one or more metal ions doped into a metal oxide host, and wherein the nanoparticle further comprises a rare earth element doped in the metal oxide host, and wherein a plurality of oligonucleotide capture probes are bound to a plurality of nanoparticles, the plurality of oligonucleotide capture probes comprising a plurality of distinct sequences of nucleic acids, and the plurality of nanoparticles comprising a distinct composition and concentration of at least one rare earth element doped into the metal oxide host.

16. The assay of claim 1 , wherein the assay is a multiplex assay.

17. The assay of claim 10, wherein the rare earth element comprises a lanthanide.

18. The assay of claim 1 , wherein the assay is a single nucleotide polymorphism assay.

19. The assay of claim 1 , wherein the assay is a microorganism identification assay.

20. The assay of claim 1 , wherein the assay is a diagnostic assay.

21. The assay of claim 1 , wherein the assay is a prognostic assay.