WO2008070460A9

WO2008070460A9 - The use of soluble e-cadherin as a novel serum marker

Info

Publication number: WO2008070460A9
Application number: PCT/US2007/085426
Authority: WO
Inventors: Ayyappan K Rajasekaran; Landon J Inge
Original assignee: Univ California; Ayyappan K Rajasekaran; Landon J Inge
Priority date: 2006-11-27
Filing date: 2007-11-21
Publication date: 2009-01-22
Also published as: WO2008070460A3; WO2008070460A2

Abstract

The invention provides a method of assessing the level of an activated form of a cell survival-related signaling molecule. This method entails assaying a biological sample for soluble E-cadherin (SECAD), wherein the level of SECAD is positively correlated with the level of the activated form of the cell survival-related signaling molecule. Also provided are SECAD polypeptides, antibodies, and related test kits.

Description

THE USE OF SOLUBLE E-CADHERIN AS A NOVEL

SERUM MARKER

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No.

60/ 867,365, filed November 27, 2006, which is hereby incorporated by reference in its entirety.

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0002] This invention was made with government support under NIH grant nos. DK56216 and GM068985. The Government may have certain rights in the invention.

FIELD OF THE INVENTION

[0003] The invention relates to the use of soluble E-cadherin as a serum marker of an activated form of a cell survival-related signaling molecule, more particularly, one in the EGFR-ERK1/2 pathway or in the PI3kinase-AKT pathway.

BACKGROUND OF THE INVENTION

[0004] The epithelial cell adhesion molecule E-cadherin mediates cell-cell adhesion in epithelial tissues (Takeichi 1990). In addition, E-cadherin also functions as a signaling molecule (Behrens 1999). The expression and function of E-cadherin is closely associated with cancer progression (Birchmeier 1995; Behrens 1999). Invasive carcinomas (cancer originating from the epithelial tissues) generally have low levels of E-cadherin (Frixen, Behrens et al. 1991).

SUMMARY OF THE INVENTION

[0005] The invention provides a method of assessing the level of an activated form of a cell survival-related signaling molecule. The method entails assaying a biological sample for soluble E-cadherin (SECAD), wherein the level of SECAD is positively correlated with the level of the activated form of the cell survival-related signaling molecule. In particular embodiments, the cell survival-related signaling molecule comprises a molecule in the EGFR-ERK1/2 pathway or in the PBkinase- AKT pathway.

[0006] Also provided is a method of determining whether a patient is a candidate for a therapy based on inhibition of a cell survival-related signaling molecule, wherein the cell survival-related signaling molecule comprises a molecule in the EGFR-ERKl /2 pathway or in the PDkinase-AKT pathway. The method entails assaying a biological sample from the patient for soluble E-cadherin (SECAD), wherein the presence of an elevated level of SECAD indicates that the patient is a candidate for said therapy.

[0007] Another aspect of the invention is a method of assessing the response of a patient to a therapy based on inhibition of cell survival-related signaling molecule, wherein the cell survival-related signaling molecule comprises a molecule in the EGFR-ERKl/2 pathway or in the PI3kinase-AKT pathway. The method entails assaying a biological sample from the patient for soluble E-cadherin (SECAD), wherein a decrease in SECAD level indicates that the patient is responding to the therapy.

[0008] hi each of these methods, the cell survival-related molecule can be, for example, (EGFR), extracellular regulated kinase (ERKl/2), PB kinase, or AKT.

[0009] The invention also provides an isolated polypeptide consisting essentially of the amino acid sequence of SECAD (SEQ ID NO:2), and an antibody that specifically binds to an epitope in an IgG domain of SECAD, as well as related test kits for assaying for SECAD.

BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 : SECAD prevents Cell death due to serum withdrawal. A)

Sub-confluent plates of Madin-Darby Canine Kidney (MDCK) cells were incubated in serum-free conditions for 6 hours. SECAD was then added to one set of plates at lOμg/ml and incubated for 24 hours, at which point, fresh serum- free media or fresh serum-free media containing SECAD (concentration- lOμg/ml) were added to control or SECAD plates and incubated an additional 48 hours. Photographs are representative images of samples at 24 and 48 hours. Magnification: 48 hours-400X, 24 hours- 100OX. Note formation of large vacuoles in control at 24 hours and cell debris at 48 hours. SECAD treated cells appeared normal at both 24 and 48 hour time points. B) Analysis of lactate dehydrogenase (LDH) activity in culture media at 48 hours. LDH is released into the culture media when cells rupture and die. Percent cytoxicity is calculated by comparing levels of LDH activity to levels of LDH activity in viable cells attached to plate. At 48 hours, control MDCK cells have a high level of LDH activity in culture media compared to SECAD-treated cells, reflecting cell death in control cells at 48 hours. MDCK cells grown in serum were used as a negative control. Bars represent standard error. C) Immunoblot for cleaved, active Caspase 3. Caspase 3 is a protease, which is activated during apoptosis or programmed cell death. Activation of Caspase 3 occurs through cleavage of the full- length protein into the smaller active form, hnmunoblot of total cell lysates from control, SECAD-treated and serum MDCK cells shows increased levels of cleaved, active Caspase 3, with a corresponding decrease in full-length, inactive Caspase 3 in control cells. Neither SECAD-treated MDCK cells nor serum-treated MDCK cells displayed the cleaved, active form of Caspase 3.

[0011] Figure 2: SECAD activates ERK through EGFR. A) Immunoblot analysis of phosphorylated, active Extracellular Regulated Kinase (ERK). MDCK cells were serum-starved and treated with lOμg/ml SECAD for the indicated time points. MDCK cells were treated with SECAD in the presence of the ERK inhibitor, PD98059, at lOμM as a control, while MDCK cells grown in serum were used as a positive control. MDCK cells treated with SECAD show increased activation of ERK after thirty minutes. For a loading control, blots were stripped and immunoblotted for total ERK. B) Immuno fluorescence staining of phosphorylated ERK in SECAD treated MDCK cells. Serum-starved MDCK cells were treated with lOμg/ml of SECAD for ten minutes, fixed and stained for phosphorylated ERK. MDCK cells were also treated with SECAD in the presence of lOμM PD98059 to inhibit ERK activation as a control, while MDCK cells treated with lOng/ml EGF were used as a positive control. C) Inhibition of Epidermal Growth Factor Receptor (EGFR) prevents ERK activation by SECAD. Serum-starved MDCK cells were treated with either lOμg/ml of SECAD or 10ng/ml of Epidermal Growth Factor (EGF) in the presence of the specific EGFR inhibitor, AG1478, at the indicated concentrations for thirty minutes. Total cell lysates were immunoblotted for phosphorylated ERK, then stripped and immunblotted for total ERK as a loading control. Inhibition of EGFR activity prevented SECAD activation of ERK, similar to the inhibition of ERK activation by EGF.

[0012] Figure 3: Nucleotide sequence of human SECAD (SEQ ID NO: 1).

[0013] Figure 4: Amino acid sequence of human SECAD (SEQ ID NO:2).

The SECAD amino acid sequence extends from amino acid residues 155 to 708 in full-length E-cadherin.

[0014] Figure 5: The endpoints of the 5 SECAD IgG domains (EC-I to EC-

5). The numbering of the IgG domains is based on full-length E-cadherin. The first IgG domain begins with amino acid residue 155, which is also the first amino acid residue of SECAD (SEQ ID NO:3). The last IgG domain ends with amino acid residue 708, which is the last amino acid residue of SECAD (SEQ ID NO:4).

DETAILED DESCRIPTION

[0015] Several studies have identified a soluble form of E-cadherin (SECAD)

(molecular mass 80 kD) in sera of patients diagnosed with skin, colon, lung, ovarian, gastric, bladder and prostate cancers. SECAD has now been found to function as a survival factor. In particular, addition of SECAD to epithelial cells prevents cell death by activation of PI3 kinase- AKT and Ras-ERKI/2 signaling pathways. Further, SECAD activity is mediated by activation of these pathways through the Epidermal Growth Factor receptor (EGFR), a clinically important molecule in cancer therapy. Aberrant activation of EGFR is closely associated with carcinoma progression, and several inhibitory compounds (Irressa, Tarceva) are currently in clinical trials for use as therapeutics in treating carcinoma.

[0016] The present invention provides, inter alia, the first method to determine patient responsiveness to EGFR inhibitory therapies. SECAD levels in blood, serum, or plasma, urine and saliva can predict the sensitivity and clinical response of patients to EGFR inhibitors, as well as the status of EGFR, PI3 kinase, MAPK, and AKT activation in cancer patients. A simple serum-based assay, for example, will tremendously improve the ability to evaluate patients for therapeutic decision-making and monitoring of progress specifically using compounds that target EGFR, PI3 kinase, ERK1/2, and AKT. Such an assay can also be used in the evaluation of new compounds targeting EGFR, PI3 Kinase, ERK1/2, and AKT. [0017] Since E-cadherin is predominantly expressed in human epithelial tissues, these approaches can also be utilized to assess the extent and progression of epithelial diseases, such as inflammatory bowel disease and ulcerative colitis, and infectious diseases affecting epithelial tissues.

Definitions

[0018] Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0019] As used herein, a "cell survival-related signaling molecule" is a molecule that is part of a signaling pathway that plays a role in cell survival. In certain embodiments, a cell survival-related signaling molecule is a molecule that plays a role in a signaling pathway that promotes cell survival.

[0020] An "activated form" of a cell survival-related signaling molecule is a form that exerts one or more biological actions on one or more other molecules in the signaling pathway. Activated forms of epidermal growth factor receptor (EGFR), extracellular regulated kinase ERK1/2, PD kinase, and AKT are phosphorylated and have tyrosine kinase or serine/threonine kinase activity.

[0021] "Biological samples" that can be assayed using the methods of the present invention include biological fluids, such as whole blood, serum, plasma, urine and saliva..

[0022] As used herein, the term "soluble E-cadherin" (SECAD) refers to a soluble form of the epithelial cell adhesion molecule E-cadherin, which, in particular embodiments, has a molecular mass of approximately 80 kiloDaltons.

[0023] As used herein with reference to SECAD, the term "elevated level" refers to to a level in a biological sample that is higher than a normal level or range. The normal level or range for SECAD is defined in accordance with standard practice. Thus, the level measured in a particular biological sample will be compared with the level or range of levels determined in similar normal samples, hi this context, "normal tissue" is tissue from an individual with no detectable cancer or epithelial pathology. The level of SECAD is said to be "elevated" where the analyte is normally undectable (i.e, the normal level is zero, but is detected in a test sample, as well as where the SECAD is present in the test sample at a higher than normal level. [0024] As used with respect to polypeptides or polynucleotides, the term

"isolated" refers to a polypeptide or polynucleotide that has been separated from at least one other component that is typically present with the polypeptide or polynucleotide. Thus, a naturally occurring polypeptide is isolated if it has been purified away from at least one other component that occurs naturally with the polypeptide or polynucleotide. A recombinant polypeptide or polynucleotide is isolated if it has been purified away from at least one other component present when the polypeptide or polynucleotide is produced.

[0025] The terms "polypeptide" and "protein" are used interchangeably herein to refer a polymer of amino acids, and unless otherwise limited, include atypical amino acids that can function in a similar manner to naturally occurring amino acids.

[0026] The terms "amino acid" or "amino acid residue," include naturally occurring L-amino acids or residues, unless otherwise specifically indicated. The commonly used one- and three-letter abbreviations for amino acids are used herein (Lehninger, A. L. (1975) Biochemistry, 2d ed., pp. 71-92, Worth Publishers, N. Y.). The terms "amino acid" and "amino acid residue" include D-amino acids as well as chemically modified amino acids, such as amino acid analogs, naturally occurring amino acids that are not usually incorporated into proteins, and chemically synthesized compounds having the characteristic properties of amino acids (collectively, "atypical" amino acids). For example, analogs or mimetics of phenylalanine or proline, which allow the same conformational restriction of the peptide compounds as natural Phe or Pro are included within the definition of "amino acid."

[0027] As used herein, an "antibody" refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.

[0028] A typical immunoglobulin (antibody) structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kD) and one "heavy" chain (about 50 - 70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms "variable light chain (VL)" and "variable heavy chain (VH)" refer to these light and heavy chains respectively.

[0029] Antibodies exist as intact immunoglobulins or as a number of well- characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'2, a dimer of Fab which itself is a light chain joined to VH-CHl by a disulfide bond. The F(ab)'2 may be reduced under mild conditions to break the disulfide linkage in the hinge region thereby converting the (Fab')2 dimer into a Fab' monomer. The Fab' monomer is essentially a Fab with part of the hinge region (see, Fundamental Immunology, W.E. Paul, ed., Raven Press, N. Y. (1993), for a more detailed description of other antibody fragments). While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such Fab' fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology. Thus, the term antibody, as used herein also includes antibody fragments either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA methodologies. Preferred antibodies include single chain antibodies (antibodies that exist as a single polypeptide chain), more preferably single chain Fv antibodies (sFv or scFv) in which a variable heavy and a variable light chain are joined together (directly or through a peptide linker) to form a continuous polypeptide. The single chain Fv antibody is a covalently linked VH-VL heterodimer which may be expressed from a nucleic acid including VH- and VL- encoding sequences either joined directly or joined by a peptide-encoding linker. Huston, et al. (1988) Proc. Nat. Acad. Sci. USA, 85: 5879-5883. While the VH and VL are connected to each as a single polypeptide chain, the VH and VL domains associate non-covalently. The scFv antibodies and a number of other structures converting the naturally aggregated, but chemically separated light and heavy polypeptide chains from an antibody V region into a molecule that folds into a three dimensional structure substantially similar to the structure of an antigen-binding site are known to those of skill in the art (see e.g., U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778). [0030] The term "specific binding" is defined herein as the preferential binding of binding partners to another (e.g., two polypeptides, a polypeptide and nucleic acid molecule, or two nucleic acid molecules) at specific sites. The term "specifically binds" indicates that the binding preference (e.g., affinity) for the target molecule/sequence is at least 2-fold, more preferably at least 5-fold, and most preferably at least 10- or 20-fold over a non-specific target molecule (e.g. a randomly generated molecule lacking the specifically recognized site(s)).

In General

[0031] The invention provides a method of assessing the level of an activated form of a cell survival-related signaling molecule. This method entails assaying a biological sample for soluble E-cadherin (SECAD), wherein the level of SECAD is positively correlated with the level of the activated form of the cell survival-related signaling molecule.

[0032] The invention also provides a method of determining whether a patient is a candidate for a therapy based on inhibition of a cell survival-related signaling molecule. This method entails assaying a biological sample from the patient for soluble E-cadherin (SECAD), wherein the presence of an elevated level of SECAD indicates that the patient is a candidate for this therapy. In certain embodiments, an "elevated level" of SECAD is about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 μg/ml or more.

[0033] Another aspect of the invention is a method of assessing the response of a patient to a therapy based on inhibition of cell survival-related signaling molecule. This method entails assaying a biological sample from the patient for soluble E-cadherin (SECAD), wherein a decrease in SECAD level indicates that the patient is responding to the therapy.

[0034] In particular embodiments of the above-described methods, the cell survival-related signaling molecule is a molecule in the EGFR-ERK 1/2 pathway or in the PI3kinase-AKT pathway, hi examples of such embodiments, the cell survival- related signaling molecule is epidermal growth factor receptor (EGFR), extracellular regulated kinase (ERKl /2), PI3 kinase, or AKT. [0035] The methods of the invention are useful inter alia for assessing samples from human patients, such as cancer patients or those having an epithelial disease. Human cancer patients to which the methods are applicable include those with an epithelial cancer, such as for example, skin, colon, lung, ovarian, gastric, kidney, bladder, and/or prosate cancers. Examples of epithelial diseases to which the invention applies include inflammatory diseases such as inflammatory bowel disease, ulcerative colitis, Crohn's disease, and infectious diseases affecting an epithelial tissue (e.g., bacterial infections).

[0036] In illustrative embodiments, the method entails an immunoassay using an antibody that specifically binds to an epitope in an IgG domain of SECAD. In variations of such embodiments, the method employs at least two, at least three, at least four, or at least five antibodies, wherein each antibody specifically binds to an epitope in a different IgG domain of SECAD. The invention thus allows the detection of SECAD fragment containing individual domains and/or combinations of two to all five domains.

Sample Collection and Processing

[0037] The assay methods of the invention are generally carried out on biological samples derived from an animal, preferably a mammal, and more preferably a human.

[0038] The methods of the invention can carried out using any sample that may contain soluble E-cadherin. Convenient samples include, for example, blood, serum, plasma, urine and saliva.

[0039] The sample may be pretreated as necessary by dilution in an appropriate buffer solution or concentrated, if desired. Any of a number of standard aqueous buffer solutions, employing any of a variety of buffers, such as phosphate, Tris, or the like, at physiological pH, can be used.

Assaying for SECAD

[0040] SECAD can be detected and quantified by any of a number of methods well known to those of skill in the art for polypeptide detection. These may include analytic biochemical methods such as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like, or various immunological methods such as fluid or gel precipitin reactions, immunodiffusion (single or double), immunohistochemistry, affinity chromatography, immunoelectrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, Western blotting, and the like.

[0041] In one embodiment, SECAD is detected/quantified in an electrophoretic polypeptide separation (e.g. a 1- or 2-dimensional electrophoresis). Means of detecting polypeptides using electrophoretic techniques are well known to those of skill in the art (see generally, R. Scopes (1982) Polypeptide Purification, Springer-Verlag, N. Y.; Deutscher, (1990) Methods in Enzymology Vol. 182: Guide to Polypeptide Purification, Academic Press, Inc., N. Y.).

[0042] A variation of this embodiment utilizes a Western blot (immunoblot) analysis to detect and quantify the presence of SECAD(s) in the sample. This technique generally comprises separating sample polypeptides by gel electrophoresis on the basis of molecular weight, transferring the separated polypeptides to a suitable solid support (such as a nitrocellulose filter, a nylon filter, or derivatized nylon filter), and incubating the sample with antibodies that specifically bind the analyte. Antibodies that specifically bind to the analyte may be directly labeled or alternatively may be detected subsequently using labeled antibodies (e.g., labeled sheep anti-mouse antibodies) that specifically bind to a domain of the primary antibody.

[0043] hi a preferred embodiment, SECAD is detected and/or quantified in the biological sample using any of a number of well-known immunoassays (see, e.g., U.S. Patents 4,366,241; 4,376,110; 4,517,288; and 4,837,168). For a general review of immunoassays, see also Methods in Cell Biology Volume 37: Antibodies in Cell Biology, Asai, ed. Academic Press, Inc. New York (1993); Basic and Clinical Immunology 7th Edition, Stites & Terr, eds. (1991).

[0044] Conventional immunoassays often utilize a "capture agent" to specifically bind to and often immobilize the analyte on a solid phase, hi preferred embodiments, the capture agent is an antibody.

[0045] Immunoassays also typically utilize a labeled detection agent to specifically bind to and label the binding complex formed by the capture agent and the analyte. The labeled detection agent may itself be one of the moieties making up the antibody/analyte complex. Alternatively, the labeled detection agent may be a third moiety, such as another antibody, that specifically binds to the capture agent/analyte complex. Other polypeptides capable of specifically binding immunoglobulin constant regions, such as polypeptide A or polypeptide G may also make up the labeled detection agent. These polypeptides are normal constituents of the cell walls of streptococcal bacteria. They exhibit a strong non-immunogenic reactivity with immunoglobulin constant regions from a variety of species (see, generally Kronval, et al. (1973) J. Immunol, 111: 1401-1406, and Akerstrom (1985) J. Immunol., 135: 2589-2542).

[0046] Preferred immunoassays for detecting the target polypeptide(s) are either competitive or noncompetitive. Noncompetitive immunoassays are assays in which the amount of captured analyte is directly measured. In competitive assays, the amount of analyte in the sample is measured indirectly by measuring the amount of an added (exogenous) labeled analyte displaced (or competed away) from a capture agent by the analyte present in the sample. In one competitive assay, a known amount of, in this case, labeled SECAD is added to the sample, and the sample is then contacted with a capture agent. The amount of labeled SECAD bound to the antibody is inversely proportional to the concentration of SECAD present in the sample.

[0047] The assays of this invention are scored (as positive or negative or quantity of analyte) according to standard methods well known to those of skill in the art. The particular method of scoring will depend on the assay format and choice of label. For example, a Western Blot assay can be scored by visualizing the colored product produced by the enzymatic label. A clearly visible colored band or spot at the correct molecular weight is scored as a positive result, while the absence of a clearly visible spot or band is scored as a negative. The intensity of the band or spot can provide a quantitative measure of analyte concentration.

Antibodies

[0048] Antibodies useful in the immunoassay methods of the invention include polyclonal and monoclonal antibodies. Polyclonal antibodies are raised by injecting (e.g., subcutaneous or intramuscular injection) an immunogen into a suitable non-human mammal (e.g., a mouse or a rabbit). Generally, the immunogen should induce production of high titers of antibody with relatively high affinity for the target antigen.

[0049] If desired, the antigen may be conjugated to a carrier protein by conjugation techniques that are well known in the art. Commonly used carriers include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid. The conjugate is then used to immunize the animal.

[0050] The antibodies are then obtained from blood samples taken from the animal. The techniques used to produce polyclonal antibodies are extensively described in the literature (see, e.g., Methods of Enzymology, "Production of Antisera With Small Doses of Immunogen: Multiple Intradermal Injections," Langone, et al. eds. (Acad. Press, 1981)). Polyclonal antibodies produced by the animals can be further purified, for example, by binding to and elution from a matrix to which the target antigen is bound. Those of skill in the art will know of various techniques common in the immunology arts for purification and/or concentration of polyclonal, as well as monoclonal, antibodies see, for example, Coligan, et al. (1991) Unit 9, Current Protocols in Immunology, Wiley Interscience.

[0051] For many applications, monoclonal antibodies (mAbs) are preferred.

The general method used for production of hybridomas secreting mAbs is well known (Kohler and Milstein (1975) Nature, 256:495). Briefly, as described by Kohler and Milstein, the technique entailed isolating lymphocytes from regional draining lymph nodes of five separate cancer patients with either melanoma, teratocarcinoma or cancer of the cervix, glioma or lung, (where samples were obtained from surgical specimens), pooling the cells, and fusing the cells with SHFP-I. Hybridomas were screened for production of antibody that bound to cancer cell lines. Confirmation of specificity among mAbs can be accomplished using routine screening techniques (such as the enzyme-linked immunosorbent assay, or "ELISA") to determine the elementary reaction pattern of the mAb of interest.

[0052] As used herein, the term "antibody" encompasses antigen-binding antibody fragments, e.g., single chain antibodies (scFv or others), which can be produced/selected using phage display technology. The ability to express antibody fragments on the surface of viruses that infect bacteria (bacteriophage or phage) makes it possible to isolate a single binding antibody fragment, e.g., from a library of greater than 10¹⁰ nonbinding clones. To express antibody fragments on the surface of phage (phage display), an antibody fragment gene is inserted into the gene encoding a phage surface protein (e.g., pill) and the antibody fragment-pill fusion protein is displayed on the phage surface (McCafferty et al. (1990) Nature, 348: 552-554; Hoogenboom et al. (1991) Nucleic Acids Res. 19: 4133-4137).

[0053] Since the antibody fragments on the surface of the phage are functional, phage-bearing antigen-binding antibody fragments can be separated from non-binding phage by antigen affinity chromatography (McCafferty et al. (1990) Nature, 348: 552-554). Depending on the affinity of the antibody fragment, enrichment factors of 20-fold - 1,000,000-fold are obtained for a single round of affinity selection. By infecting bacteria with the eluted phage, however, more phage can be grown and subjected to another round of selection, hi this way, an enrichment of 1000-fold in one round can become 1,000,000-fold in two rounds of selection (McCafferty et al. (1990) Nature, 348: 552-554). Thus, even when enrichments are low (Marks et al. (1991) J. MoI. Biol. 222: 581-597), multiple rounds of affinity selection can lead to the isolation of rare phage. Since selection of the phage antibody library on antigen results in enrichment, the majority of clones bind antigen after as few as three to four rounds of selection. Thus only a relatively small number of clones (several hundred) need to be analyzed for binding to antigen.

[0054] Human antibodies can be produced without prior immunization by displaying very large and diverse V-gene repertoires on phage (Marks et al. (1991) J. MoI. Biol. 222: 581-597). Li one embodiment, natural VH and VL repertoires present in human peripheral blood lymphocytes are isolated from unimmunized donors by PCR. The V-gene repertoires can be spliced together at random using PCR to create a scFv gene repertoire which can be cloned into a phage vector to create a library of 30 million phage antibodies (Id.). From a single "naϊve" phage antibody library, binding antibody fragments have been isolated against more than 17 different antigens, including haptens, polysaccharides, and proteins (Marks et al. (1991) J. MoI. Biol. 222: 581-597; Marks et al. (1993). Bio/Technology. 10: 779-783; Griffiths et al. (1993) EMBO J. 12: 725-734; Clackson et al. (1991) Nature. 352: 624-628). Antibodies have been produced against self proteins, including human thyroglobulin, immunoglobulin, tumor necrosis factor, and CEA (Griffiths et al. (1993) EMBO J. 12: 725-734). The antibody fragments are highly specific for the antigen used for selection and have affinities in the 1 nM to 100 nM range (Marks et al. (1991) J. MoI. Biol. 222: 581-597; Griffiths et al. (1993) EMBO J. 12: 725-734). Larger phage antibody libraries result in the isolation of more antibodies of higher binding affinity to a greater proportion of antigens.

[0055] As those of skill in the art readily appreciate, antibodies can be prepared by any of a number of commercial services (e.g., Berkeley antibody laboratories, Bethyl Laboratories, Anawa, Eurogenetec, etc.).

[0056] In particular embodiments, the antibody is one that specifically binds to an epitope in an IgG domain of SECAD.

Solid Phase

[0057] For embodiments of the invention that employ a solid phase as a support for the capture agent, the solid phase can be any suitable porous material with sufficient porosity to allow access by reagents and a suitable surface affinity to bind a capture agent. Microporous structures are generally preferred, but materials with gel structure in the hydrated state may be used as well. Useful solid supports include: natural polymeric carbohydrates and their synthetically modified, crosslinked, or substituted derivatives, such as agar, agarose, cross-linked alginic acid, substituted and cross-linked guar gums, cellulose esters, especially with nitric acid and carboxylic acids, mixed cellulose esters, and cellulose ethers; natural polymers containing nitrogen, such as proteins and derivatives, including cross-linked or modified gelatins; natural hydrocarbon polymers, such as latex and rubber; synthetic polymers which may be prepared with suitably porous structures, such as vinyl polymers, including polyethylene, polypropylene, polystyrene, polyvinylchloride, polyvinylacetate and its partially hydrolyzed derivatives, polyacrylamides, polymethacrylates, copolymers and terpolymers of the above polycondensates, such as polyesters, polyamides, and other polymers, such as polyurethanes or polyepoxides; porous inorganic materials such as sulfates or carbonates of alkaline earth metals and magnesium, including barium sulfate, calcium sulfate, calcium carbonate, silicates of alkali and alkaline earth metals, aluminum and magnesium; and aluminum or silicon oxides or hydrates, such as clays, alumina, talc, kaolin, zeolite, silica gel, or glass (these materials may be used as filters with the above polymeric materials); and mixtures or copolymers of the above classes, such as graft copolymers obtained by initializing polymerization of synthetic polymers on a pre-existing natural polymer. All of these materials may be used in suitable shapes, such as firms, sheets, or plates, or they may be coated onto, bonded, or laminated to appropriate inert carriers, such as paper, glass, plastic films, fabrics, or the like.

[0058] The porous structure of nitrocellulose has excellent absorption and adsorption qualities for a wide variety of reagents including monoclonal antibodies. Nylon also possesses similar characteristics and also is suitable.

[0059] Porous solid phases useful in the invention can be in the form of sheets of thickness from about 0.01 to 0.5 mm, e.g., about 0.1 mm. The pore size may vary within wide limits, and is preferably from about 0.025 to about 15 microns, especially from about 0.15 to about 15 microns.

[0060] Preferred solid phase materials for flow-through assay devices include filter paper such as a porous fiberglass material or other fiber matrix materials. The thickness of such material is not critical and will be a matter of choice, largely based upon the properties of the sample or analyte being assayed, such as the fluidity of the biological sample.

[0061] Alternatively, the solid phase can constitute microparticles.

Microparticles useful in the invention can be selected by one skilled in the art from any suitable type of particulate material and include those composed of polystyrene, polymethylacrylate, polypropylene, latex, polytetrafluoroethylene, polyacrylonitrile, polycarbonate, or similar materials.

[0062] Microparticles can be suspended in the mixture of soluble reagents and biological sample or can be retained and immobilized by a support material. In the latter case, the microparticles on or in the support material are not capable of substantial movement to positions elsewhere within the support material.

[0063] The methods of the present invention can be adapted for use in systems that utilize microparticle technology including automated and semi-automated systems wherein the solid phase comprises a microparticle. Such systems include those described in pending U.S. App. No. 425,651 and U.S. Patent No. 5,089,424, which correspond to published EPO App. Nos. EP 0 425 633 and EP 0 424 634, respectively, and U.S. Patent No. 5,006,309. [0064] In particular embodiments, the solid phase includes one or more electrodes. Capture agent(s) can be affixed, directly or indirectly, to the electrode(s). In one embodiment, for example, capture agents can be affixed to magnetic or paramagnetic microparticles, which are then positioned in the vicinity of the electrode surface using a magnet. Systems in which one or more electrodes serve as the solid phase are useful where detection is based on electrochemical interactions. Exemplary systems of this type are described, for example, in U.S. Patent No. 6,887,714 (issued May 3, 2005). The basic method is described further below with respect to electrochemical detection.

[0065] The capture agent can be attached to the solid phase by adsorption on the porous material, where it is retained by hydrophobic forces. Alternatively, the surface of the solid phase can be activated by chemical processes that cause covalent linkage of the capture agent to the support.

[0066] To change or enhance the intrinsic charge of the solid phase, a charged substance can be coated directly onto the solid phase material or onto microparticles which then are retained by a solid phase material. Ion capture procedures for immobilizing an immobilizable reaction complex with a negatively charged polymer, described in U.S. App. No. 150,278, corresponding to EP Publication No. 0326100, and U.S.App. No. 375,029 (EP Publication No. 0406473), can be employed according to the present invention to affect a fast solution-phase immunochemical reaction, hi these procedures, an immobilizable immune complex is separated from the rest of the reaction mixture by ionic interactions between the negatively charged polyanion/immune complex and the previously treated, positively charged porous matrix and detected by using any of a number of signal-generating systems, including, e.g., chemiluminescent systems, as described in U.S. App. No. 921,979, corresponding to EPO Publication No. 0 273,115.

[0067] If the solid phase is silicon or glass, the surface must generally be activated prior to attaching the specific binding partner. Activated silane compounds such as triethoxy amino propyl silane (available from Sigma Chemical Co., St. Louis, Mo.), triethoxy vinyl silane (Aldrich Chemical Co., Milwaukee, Wis.), and (3- mercapto-propyl)-trimethoxy silane (Sigma Chemical Co., St. Louis, Mo.) can be used to introduce reactive groups such as amino-, vinyl, and thiol, respectively. Such activated surfaces can be used to link the capture directly (in the cases of amino or thiol), or the activated surface can be further reacted with linkers such as glutaraldehyde, bis (succinimidyl) suberate, SPPD 9 succinimidyl 3-[2-pyridyldithio] propionate), SMCC (succinimidyl-4-[Nmaleimidomethyl] cyclohexane-1- carboxylate), SIAB (succinimidyl [4iodoacetyl] aminobenzoate), and SMPB (succinimidyl 4-[lmaleimidophenyl] butyrate) to separate the capture agent from the surface. Vinyl groups can be oxidized to provide a means for covalent attachment. Vinyl groups can also be used as an anchor for the polymerization of various polymers such as poly-acrylic acid, which can provide multiple attachment points for specific capture agents. Amino groups can be reacted with oxidized dextrans of various molecular weights to provide hydrophilic linkers of different size and capacity. Examples of oxidizable dextrans include Dextran T-40 (molecular weight 40,000 daltons), Dextran T-110 (molecular weight 110,000 daltons), Dextran T-500 (molecular weight 500,000 daltons), Dextran T-2M (molecular weight 2,000,000 daltons) (all of which are available from Pharmacia, Piscataway, N. J.), or Ficoll (molecular weight 70,000 daltons; available from Sigma Chemical Co., St. Louis, Mo.). Additionally, polyelectrolyte interactions can be used to immobilize a specific capture agent on a solid phase using techniques and chemistries described U.S. App. No. 150,278, filed Jan. 29, 1988, and U.S. App. No. 375,029, filed M. 7, 1989, each of which is incorporated herein by reference.

[0068] Other considerations affecting the choice of solid phase include the ability to minimize non-specific binding of labeled entities and compatability with the labeling system employed. For, example, solid phases used with fluorescent labels should have sufficiently low background fluorescence to allow signal detection.

[0069] Following attachment of a specific capture agent, the surface of the solid support may be further treated with materials such as serum, proteins, or other blocking agents to minimize non-specific binding.

Labeling Systems

[0070] As discussed above, many immunoassays according to the invention employ a labeled detection agent.

[0071] Detectable labels suitable for use in the detection agents of the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means. Useful labels in the present invention include magnetic beads (e.g., Dynabeads™), fluorescent dyes (e.g., fluorescein, texas red, rhodamine, green fluorescent protein, and the like, see, e.g., Molecular Probes, Eugene, Oregon, USA), chemiluminescent compounds such as acridinium (e.g., acridinium-9-carboxamide), phenanthridinium, dioxetanes, luminol and the like, radiolabels (e.g., ³H, ¹²⁵1, ³⁵S, ¹⁴C, or ³²P), catalysts such as enzymes (e.g., horse radish peroxidase, alkaline phosphatase, beta-galactosidase and others commonly used in an ELISA), and colorimetric labels such as colloidal gold (e.g., gold particles in the 40 -80 nm diameter size range scatter green light with high efficiency) or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads. Patents teaching the use of such labels include U.S. Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.

[0072] The label can be attached to the detection agent prior to, or during, or after contact with the biological sample. So-called "direct labels" are detectable labels that are directly attached to or incorporated into detection agents prior to use in the assay. Direct labels can be attached to or incorporated into detection agents by any of a number of means well known to those of skill in the art.

[0073] In contrast, so-called "indirect labels" typically bind to the detection agent at some point during the assay. Often, the indirect label binds to a moiety that is attached to or incorporated into the detection agent prior to use. Thus, for example, an antibody used as a detection agent (a "detection antibody") can be biotinylated before use in an assay. During the assay, an avidin-conjugated fluorophore can bind the biotin-bearing detection agent, to provide a label that is easily detected.

[0074] hi another example of indirect labeling, polypeptides capable of specifically binding immunoglobulin constant regions, such as polypeptide A or polypeptide G, can also be used as labels for detection antibodies. Such polypeptides can thus be labeled and added to the assay mixture, where they will bind to the detection antibody.

[0075] Some labels useful in the invention may require the use of an indicator reagent to produce a detectable signal, hi an ELISA, for example, an enzyme label (e.g., beta-galactosidase) will require the addition of a substrate (e.g., X-gal) to produce a detectable signal. Exemplary Formats

Fluorescence Polarization Immunoassay (FPIA)

[0076] In an exemplary embodiment, a fluorescent label is employed in a fluorescence polarization immunoassay (FPIA) according to the invention. Generally, fluorescent polarization techniques are based on the principle that a fluorescent label, when excited by plane-polarized light of a characteristic wavelength, will emit light at another characteristic wavelength (i.e., fluorescence) that retains a degree of the polarization relative to the incident light that is inversely related to the rate of rotation of the label in a given medium. As a consequence of this property, a label with constrained rotation, such as one bound to another solution component with a relatively lower rate of rotation, will retain a relatively greater degree of polarization of emitted light than when free in solution.

[0077] This technique can be employed in immunoassays according to the invention, for example, by selecting reagents such that binding of the fluorescently labeled entities forms a complex sufficiently different in size such that a change in the intensity light emitted in a given plane can be detected.

[0078] Fluorophores useful in FPIA include fluorescein, aminofluorescein, carboxyfluorescein, and the like, preferably 5 and 6-aminomethylfluorescein, 5 and 6- aminofluorescein, 6-carboxyfluorescein, 5 -carboxyfluorescein, thioureafluorescein, and methoxytriazinolyl-aminofluorescein, and similar fluorescent derivatives. Examples of commercially available automated instruments with which fluorescence polarization assays can be conducted include: IMx.RTM. system, TDx.RTM. system, and TDxFLx.TM. system (all available from Abbott Laboratories, Abbott Park, 111.).

Scanning Probe Microscopy (SPM)

[0079] The use of scanning probe microscopy (SPM) for immunoassays also is a technology to which the immunoassay methods of the present invention are easily adaptable, hi SPM, in particular in atomic force microscopy, the capture agent is affixed to a solid phase having a surface suitable for scanning. The capture agent can, for example, be adsorbed to a plastic or metal surface. Alternatively, the capture agent can be covalently attached to, e.g., derivatized plastic, metal, silicon, or glass according to methods known to those of ordinary skill in the art. Following attachment of the capture agent, the biological sample is contacted with the solid phase, and a scanning probe microscope is used to detect and quantify solid phase- affixed complexes. The use of SPM eliminates the need for labels which are typically employed in immunoassay systems. Such a system is described in U.S. App. No. 662,147, which is incorporated herein by reference.

MicroElectroMechanicaI Systems (MEMS)

[0080] Immunoassays according to the invention can also be carried out using a MicroElectroMechanicaI System (MEMS). MEMS are microscopic structures integrated onto silicon that combine mechanical, optical, and fluidic elements with electronics, allowing convenient detection of an analyte of interest. An exemplary MEMS device suitable for use in the invention is the Protiveris' multicantilever array. This array is based on chemo-mechanical actuation of specially designed silicon microcantilevers and subsequent optical detection of the microcantilever deflections. When coated on one side with a binding partner, a microcantilever will bend when it is exposed to a solution containing the complementary molecule. This bending is caused by the change in the surface energy due to the binding event. Optical detection of the degree of bending (deflection) allows measurement of the amount of complementary molecule bound to the microcantilever.

Electrochemical Dectection Systems

[0081] In other embodiments, immunoassays according to the invention are carred out using electrochemical detection. A basic procedure for electrochemical detection has been described by Heineman and coworkers. This entailed immobilization of a primary antibody (Ab, rat-anti mouse IgG), followed by exposure to a sequence of solutions containing the antigen (Ag, mouse IgG), the secondary antibody conjugated to an enzyme label (AP-Ab, rat anti mouse IgG and alkaline phosphatase), and p-aminophenyl phosphate (PAPP). The AP converts PAPP to p- aminophenol (PAP_R, the "R" is intended to distinguish the reduced form from the oxidized form, PAPo, the quinoneimine), which is electrochemically reversible at potentials that do not interfere with reduction of oxygen and water at pH 9.0, where AP exhibits optimum activity. PAP_R does not cause electrode fouling, unlike phenol whose precursor, phenylphosphate, is often used as the enzyme substrate. Although

PAP_R undergoes air and light oxidation, these are easily prevented on small scales and short time frames. Picomole detection limits for PAP_R and femtogram detection limits for IgG achieved in microelectrochemical immunoassays using PAPP volumes ranging from 20 .mu.l to 360 μL have been reported previously. In capillary immunoassays with electrochemical detection, the lowest detection limit reported thus far is 3000 molecules of mouse IgG using a volume of 70 μL and a 30 min or 25 min assay time.

[0082] Various electrochemical detection systems are described in U.S. Patent

Nos. 7,045,364 (issued May 16, 2006; incorporated herein by reference), 7,045,310 (issued May 16, 2006; incorporated herein by reference), 6,887,714 (issued May 3, 2005; incorporated herein by reference), 6,682,648 (issued January 27, 2004; incorporated herein by reference); 6,670,115 (issued December 30, 2003; incorporated herein by reference).

SECAD Polyptides

[0083] The invention also provides an isolated polypeptide consisting essentially of the amino acid sequence of SEQ ID NO:2. As used herein, a polypeptide "consists essentially of the amino acid sequence of SEQ ID NO:2 if it is an allelic or species variant of this sequence, and/or if it contains one or more conservative amino acid substitutions of this sequence, and the polypeptide has the biological activities described herein. SECAD polypeptides according to the invention do not generally encompass any other domains from E-cadherin, but can include one or more amino acid sequences from a heterologous protein (i.e., in a SECAD fusion protein).

[0084] SECAD polypeptides can be produced by standard techniques, e.g., chemical synthesis or recombinant techniques. Accordingly, the invention also encompasses a polynucleotide encoding a polypeptide consisting essentially o SEQ ID NO:2, a vector (e.g., an expression vector) comprising the polynucleotide, and a host cell comprising this vector.

[0085] SECAD polypeptides are useful, for example, as standards in test kits for assaying for SECAD. Test Kits

[0086] The invention also provides a test kit for assaying for SECAD. Test kits according to the invention include one or more reagents useful for practicing one or more immunoassays according to the invention. A test kit generally includes a package with one or more containers holding the reagents, as one or more separate compositions or, optionally, as admixture where the compatibility of the reagents will allow. The test kit can also include other material(s) that may be desirable from a user standpoint, such as a buffer(s), a diluent(s), a standard(s), and/or any other material useful in sample processing, washing, or conducting any other step of the assay.

[0087] In particular embodiments, the tst kit includes an antibody that specifically binds SECAD, and a SECAD polypeptide. In variations of such embodiments, the SECAD polypeptide consists essentially of the amino acid sequence of (SEQ E) NO:2).

[0088] In certain embodiments, the test kit includes at least two, at least three, at least four, or at least five antibodies, wherein each antibody specifically binds to an epitope in a different IgG domain of SECAD.

[0089] Test kits according to the invention preferably include instructions for carrying out one or more of the immunoassays of the invention. Instructions included in kits of the invention can be affixed to packaging material or can be included as a package insert. While the instructions are typically written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term "instructions" can include the address of an internet site that provides the instructions.

EXAMPLES

[0090] The following examples are offered to illustrate, but not to limit, the claimed invention. Example 1

SECAD: A novel serum marker to assess activated oncogenic signaling in human cancers and inflammatory epithelial diseases

Introduction

[0091] Several studies have identified a soluble form of E-cadherin (SECAD)

(molecular mass 80 kD) in sera of patients diagnosed with skin, colon, lung, ovarian, gastric, bladder and prostate cancers (Katayama, Hirai et al. 1994; Gofuku, Shiozaki et al. 1998; Cioffi, Gazzerro et al. 1999; Sundfeldt, Ivarsson et al. 2001). In general, patients' serum contains a concentration of SECAD at about lOμg/ml. To test whether SECAD might have bioactivity, a recombinant form of SECAD, which could be easily purified, was designed.

[0092] For generation of the canine SECAD, primers were designed to the extracellular domain of canine E-cadherin (Genebank ID:XM_546767) which spans 541 to 2169 of the canine E-cadherin sequence (Sense primer: gactgggttatccctcctatc; Antisense primerxctcttgcagctgttgacgac). In addition, sequences for HindIII and Xhol were added to the sense and antisense primers to allow for cloning of the canine SECAD into the pSECtag2 expression vector.

Purification of the canine SECAD

[0093] The pSECTag2 containing canine SECAD sequence was transfected into HEK-293T embryonic kidney cells, and stable clones were selected by treatment with Zeocin (50 μg/ml). Conditioned media from clones were screened by immunoblot for canine SECAD using an anti-Myc tag antibody (Cell Signaling Technologies, MA). One of these clones, clone 3, was found to secrete high levels of canine SECAD. To purify canine SECAD, the clone 3 was grown to 70-80% confluency on 15cm tissue culture plates. Plates were briefly washed with sterile PBS, and 30ml of UltraDOMA-PF protein free media (Cambrex, MD) was added to the plates. Plates were incubated for 48 hours, at which point the conditioned medium was spun down and filtered (0.2μM) under sterile conditions. For purification, 200 to 240ml of conditioned medium was generated. The filtered conditioned medium was equilibrated to 5mM imidazole and brought to a pH 7.4. Canine SECAD was purified by binding of the fusion protein to nickel sepharose columns. The conditioned medium was passed over a 5ml HisTrap HP nickel affinity column (Amersham/GE, NJ) at a rate of lml/min, and the medium (flow through) was saved. The column was washed with 50ml of wash 1 (5mM imidazole, 2OmM sodium phosphate, 0.5M NaCl, pH 7.4), followed by an additional wash with 50ml of wash 2 (5mM imidazole, 2OmM sodium phosphate, 0.5M NaCl, pH 7.4), and both washes were saved. The protein was eluted from the column by washing with 50ml of Elution buffer (10OmM imidiazole, 2OmM sodium phosphate, 0.5M NaCl, pH 7.4). 50μl of the flow through, wash 1, wash 2 and the eluted protein were separated by SDS-PAGE, and the presence of SECAD was analyzed by immunoblot with the Myc tag antibody. The eluted protein was then dialyzed against PBS at 4 degrees Celsius and concentrated with Centriplus (MW cutoff 30,000 KD) concentrators (Amicon/Millapore, CA). The concentration of the concentrated protein was determined by protein estimation, and the purity of the protein was checked by Coumassie staining.

SECAD inhibited cell death due to serum withdrawal

[0094] Madin-Darby Canine kidney (MDCK) cells were used to test the functional role of SECAD. Treatment of MDCK cells with lOμg/ml of SECAD in serum-free conditions prevented cell death due to serum withdrawal. After 24 hours of serum withdrawal (Figure IA), untreated control cells displayed large vacuoles within the cytoplasm, which were absent in SECAD treated cells. After serum withdrawal for 48 hours (Figure IA), untreated control cells showed massive cell death indicated by cell debris in the culture media, while SECAD-treated cells looked more like cells in the presence of serum. The levels of cell death were quantified in control and SECAD-treated cells at 48 hours by measuring the activity of lactate dehydrogenase (LDH), which is released into the culture media from ruptured, dead cells. As shown in Figure 1 B, untreated, control cells showed a high level of cell death (percent cytoxicity) at 48 hours, while SECAD-treated cells had a comparable level to MDCK cells grown in serum.

[0095] To further confirm that SECAD inhibited cell death due to serum withdrawal, untreated control and SECAD-treated cells were analyzed for Caspase 3, which is a marker for apoptotic cell death (Nunez, Benedict et al. 1998; Porter and Janicke 1999). Under normal conditions Caspase 3 exsists as a full length inactive protein. Activation of cell death by apoptosis results in the cleavage of Caspase 3 into a smaller active form, which is responsible for inducing events leading to cell death. As shown in figure 1C, after 48 hours of serum withdrawal, untreated control cells had increased levels of the cleaved active form of Caspase 3, with a corresponding decrease in the full-length form. SECAD-treated cells did not display cleaved active Caspase 3, despite 48 hours of serum withdrawal (Figure 1C). MDCK cells grown in serum for the same period also did not show any cleaved Caspase 3 (figure 1 C). These data show that SECAD is capable of preventing cell death due to serum withdrawal at clinically relevant concentrations and suggest that presence of SECAD in patient's serum might be involved in protecting cancer cells against death. This facilitates cancer cell survival and cancer progression.

SECAD activates ERK1/2

[0096] E-cadherin ligation results in activation of Extracellular Regulated

Kinase (ERK1/2) (Pece and Gutkind 2000), a protein involved in cell growth, proliferation, and survival. Since treatment of MDCK cells with SECAD prevented cell death due to serum withdrawal, it was hypothesized that SECAD might activate ERKl /2, resulting in cell survival. MDCK cells in serum-free conditions were treated with lOμg/ml SECAD, and the level of phosphorylated (activated) ERK in total cell lysates was analyzed. At ten minutes, treatment with SECAD resulted in activation of ERK, which was still active after thirty minutes (Figure 2A), compared to untreated controls. In addition, the level of active ERK in SECAD-treated cells was comparable to cells grown in serum, while inhibition of the ERK upstream activator with lOμM PD98059, MEK, prevented activation of ERK by SECAD. To confirm the activation of ERK by SECAD in the MDCK cell line, MDCK cells were treated in serum-free conditions with lOμg/ml SECAD or lOng/ml of Epidermal Growth Factor (EGF; a known activator of ERK) and performed immunofluorescence staining for phosphorylated ERK. As controls, serum-starved cells were untreated or treated with SECAD and lOμM PD98059 to inhibit ERK activation. After ten minutes, SECAD- treated cells showed a high level of ERK activation, comparable to EGF treatment (Figure 2B). In contrast, controls and cells treated with both SECAD and PD98059 had little staining compared to SECAD and EGF-treated cells (Figure 2B). Taken together, these findings suggest that SECAD treatment results in the activation of ERK, which consequently inhibits cell death. SECAD activates EGFR

[0097] EGF activates ERK by binding to and activating the Epidermal Growth factor receptor (EGFR), which induces several cellular responses, such as cell survival. E-cadherin associates with EGFR and E-cadherin-E-cadherin ligation activates EGFR (Hoschuetzky, Aberle et al. 1994; Pece and Gutkind 2000). It was hypothesized that SECAD activation of ERK might be due to activation of EGFR. To test this hypothesis, MDCK cells in serum-free conditions were treated with either lOμg/ml of SECAD or lOng/ml of EGF in the presence of AGl 478, a specific inhibitor of EGFR activity. As shown in Figure 2C, inhibition of EGFR by AG 1478 prevented activation of ERK by SECAD or EGF. Further, AG 1478 was inhibited SECAD activation of ERK even at low (1OnM) concentrations. In all, these findings suggest that SECAD activation of ERK is through activation of EGFR. These findings indicate that presence of SECAD in the serum serves as a surrogate serum marker to ascertain the level of activated EGFR and ERK1/2 in cancer tissues. EGFR and ERKl/2 are activated in several cancers, hi general they are detected only by immunohistochemical analysis of tissues.

References

[0098] Behrens, J. (1999). "Cadherins and catenins: role in signal transduction and tumor progression." Cancer Metastasis Rev 18(1): 15-30.

[0099] Birchmeier, W. (1995). "E-cadherin as a tumor (invasion) suppressor gene." Bioessays 17(2): 97-9.

[0100] Cioffi, M., P. Gazzerro, et al. (1999). "Serum-soluble E-cadherin fragments in lung cancer." Tumori 85(1): 32-4.

[0101] Frixen, U. H., J. Behrens, et al. (1991). "E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells." J Cell Biol 113(1): 173- 85. Gofuku, J., H. Shiozaki, et al. (1998). "Characterization of soluble E-cadherin as a disease marker in gastric cancer patients." Br J Cancer 78(8): 1095-101.

[0102] Hoschuetzky, H., H. Aberle, et al. (1994). "Beta-catenin mediates the interaction of the cadherin-catenin complex with epidermal growth factor receptor." J Cell Biol 127(5): 1375-80. [0103] Katayama, M., S. Hirai, et al. (1994). "Soluble E-cadherin fragments increased in circulation of cancer patients." Br J Cancer 69(3): 580-5.

[0104] Nunez, G., M. A. Benedict, et al. (1998). "Caspases: the proteases of the apoptotic pathway." Oncogene 17(25): 3237-45.

[0105] Pece, S. and J. S. Gutkind (2000). "Signaling from E-cadherins to the

MAPK pathway by the recruitment and activation of epidermal growth factor receptors upon cell-cell contact formation." J Biol Chem 275(52): 41227-33.

[0106] Porter, A. G. and R. U. Janicke (1999). "Emerging roles of caspase-3 in apoptosis." Cell Death Differ 6(2): 99-104.

[0107] Sundfeldt, K., K. Ivarsson, et al. (2001). "Higher levels of soluble E- cadherin in cyst fluid from malignant ovarian tumours than in benign cysts." Anticancer Res 21(1A): 65-70.

[0108] Takeichi, M. (1990). "Cadherins: a molecular family important in selective cell-cell adhesion." Annu Rev Biochem 59: 237-52.

Claims

What is claimed is:

1. A method of assessing the level of an activated form of a cell survival-related signaling molecule, the method comprising assaying a biological sample for soluble E-cadherin (SECAD), wherein the level of SECAD is positively correlated with the level of the activated form of the cell survival-related signaling molecule, wherein the cell survival-related signaling molecule comprises a molecule in the EGFR-ERKl /2 pathway or in the PI3kinase-AKT pathway.

2. The method of claim 1, wherein the cell survival-related signaling molecule is selected from the group consisting of epidermal growth factor receptor (EGFR), extracellular regulated kinase (ERKl /2), PD kinase, and AKT.

3. The method of claim 1 or 2, wherein the sample comprises a sample from a human cancer patient.

4. The method of claim 3, wherein the cancer patient comprises a patient having an epithelial cancer.

5. The method of claim 4, wherein the cancer patient comprises a patient having a cancer selected from the group consisting of skin, colon, lung, ovarian, gastric, kidney, bladder, and prosate cancers.

6. The method of claim 1 or 2, wherein the sample comprises a sample from a human patient having an epithelial disease.

7. The method of claim 6, wherein the patient comprises a patient having an inflammatory disease selected from the group consisting of inflammatory bowel disease, ulcerative colitis, Crohn's disease, and an infectious disease affecting an epithelial tissue.

8. The method of any of the preceding claims, wherein the sample comprises a sample selected from a blood sample, a serum sample, a plasma sample, a saliva sample, and a urine sample.

9. A method of determining whether a patient is a candidate for a therapy based on inhibition of a cell survival-related signaling molecule, wherein the cell survival-related signaling molecule comprises a molecule in the EGFR-ERK 1/2 pathway or in the PI3kinase-AKT pathway, the method comprising assaying a biological sample from the patient for soluble E-cadherin (SECAD), wherein the presence of an elevated level of SECAD indicates that the patient is a candidate for said therapy.

10. The method of claim 9, wherein the cell survival-related signaling molecule is selected from the group consisting of epidermal growth factor receptor (EGFR), extracellular regulated kinase (ERKl/2), PB kinase, and AKT.

11. The method of claim 9 or 10, wherein the sample comprises a sample from a human cancer patient.

12. The method of claim 11, wherein the cancer patient comprises a patient having an epithelial cancer.

13. The method of claim 11 , wherein the cancer patient comprises a patient having a cancer selected from the group consisting of skin, colon, lung, ovarian, gastric, kidney, bladder, and prosate cancers.

14. The method of claim 9 or 10, wherein the sample comprises a sample from a human patient having an epithelial disease.

15. The method of claim 14, wherein the patient comprises a patient having an inflammatory disease selected from the group consisting of inflammatory bowel disease, ulcerative colitis, Crohn's disease, and an infectious disease affecting an epithelial tissue.

16. The method of any of claims 9-15, wherein the sample comprises a sample selected from a blood sample, a serum sample, a plasma sample, a saliva sample, and a urine sample.

17. The method of claim 16, wherein the sample comprises a serum sample, and said elevated level of SECAD is about 5 μg/ml or more.

18. A method of assessing the response of a patient to a therapy based on inhibition of cell survival-related signaling molecule, wherein the cell survival-related signaling molecule comprises a molecule in the EGFR-ERK1/2 pathway or in the PI3kinase-AKT pathway, the method comprising assaying a biological sample from the patient for soluble E-cadherin (SECAD), wherein a decrease in SECAD level indicates that the patient is responding to the therapy.

19. The method of claim 18, wherein the cell survival-related signaling molecule is selected from the group consisting of epidermal growth factor receptor (EGFR), extracellular regulated kinase (ERK1/2), PB kinase, and AKT.

20. The method of claim 18 or 19, wherein the sample comprises a sample from a human cancer patient.

21. The method of claim 20, wherein the cancer patient comprises a patient having an epithelial cancer.

22. The method of claim 20, wherein the cancer patient comprises a patient having a cancer selected from the group consisting of skin, colon, lung, ovarian, gastric, kidney, bladder, and prosate cancers.

23. The method of claim 18 or 19, wherein the sample comprises a sample from a human patient having an epithelial disease.

24. The method of claim 23, wherein the patient comprises a patient having an inflammatory disease selected from the group consisting of inflammatory bowel disease, ulcerative colitis, Crohn's disease, and an infectious disease affecting an epithelial tissue.

25. The method of any of claims 18-24, wherein the sample comprises a sample selected from a blood sample, a serum sample, a plasma sample, a saliva sample and a urine sample.

26. The method of any of the preceding claims, wherein the method comprises an immunoassay using an antibody that specifically binds to an epitope in an IgG domain of SECAD.

27. The method of claim 26, wherein the method employs at least two antibodies, wherein each antibody specifically binds to an epitope in a different IgG domain of SECAD.

28. An isolated polypeptide consisting essentially of the amino acid sequence of (SEQ ID NO:2).

29. An antibody that specifically binds to an epitope in an IgG domain of SECAD.

30. A test kit comprising: an antibody that specifically binds SECAD; and a SECAD polypeptide.

31. The test kit of claim 28, wherein the SECAD polypeptide consists essentially of the amino acid sequence of (SEQ ID NO:2).

32. A test kit comprising at least two antibodies, wherein each antibody specifically binds to an epitope in a different IgG domain of SECAD.