WO2008067061A2 - Compositions and methods for modulating angiogenesis - Google Patents

Abstract

Methods and compositions for identifying therapeutic agents for the treatment of disorders associated with aberrant angiogenesis are provided.

Description

COMPOSITIONS AND METHODS FOR MODULATING ANGIOGENESIS

This application claims priority to US Provisional Application, 60/852,808, filed October 19, 2006, the entire disclosure being incorporated herein by reference as though set forth in full.

Pursuant to 35 U.S.C. §202(c), it is acknowledged that the U.S. Government has certain rights in the invention described, which was made in part with funds from the National Institutes of Health, Grant Numbers KOl CA098581, HL-64402 and POl CA-92644.

FIELD OF THE INVENTION

This invention relates to the fields of vasculogenesis and angiogenesis. More specifically, the invention provides compositions and methods for modulating endothelial cell proliferation, angiogenesis and vascular permeability via regulation of TR3 activity and expression levels.

BACKGROUND OF THE INVENTION

Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full. In order to grow beyond minimal size, tumors must induce the formation of new blood vessels (angiogenesis) (1, 2). They do so by secreting angiogenic factors such as fibroblast growth factor, platelet-derived growth factor B, members of the vascular permeability factor (VPF)/vascular endothelial growth factor (VEGF) family, etc. (3). Among these, VPF/VEGF (VEGF-A) is thought to be the most important for several reasons. It is expressed abundantly by most human and animal tumors. VEGF-A induces typical tumor blood vessel formation. Additionally, the growth of VEGF-A expressing tumors is strikingly inhibited when VEGF-A is neutralized (3, 4). VEGF-A is a multifunctional cytokine that acts through receptors that are expressed on vascular endothelium as well as on some other cell types. Following interaction with VEGF-A, endothelial cells undergo extensive reprogramming of protease, integrin and glucose transporter expression, are stimulated to migrate and divide, and are protected from apoptosis and senescence (4, 5). In addition, VEGF-A and other VPF/VEGF family members are the only angiogenic cytokines identified thus far that render microvessels hyperpermeable to circulating macromolecules, a characteristic property of tumor and other angiogenic blood vessels (3).

Although extensive efforts have been made to delineate the mechanisms by which VEGF induces angiogenesis, little is known about the transcriptional events that regulate this important process.

SUMMARY OF THE INVENTION

In accordance with the present invention, screening methods and compositions useful therefore are provided to identify agents having therapeutic efficacy for the treatment of disorders associated with aberrant angiogenesis. Such disorders include, without limitation, cancer, wound healing and ischemia. The present inventors have discovered that increasing expression levels of TR3/Nur77 results in VEGF-A- independent endothelial cell proliferation, survival, vascular hyperpermeability in vivo and induction of several cell cycle genes. Conversely, a decrease in TR3/Nur77 activity inhibited VEGF-A induced angiogenesis and also inhibited tube formation. Additionally, ablation of TR3/Nur77 activity (e.g., in Nur77 knockout mice) results in inhibition of 1) tumor growth; 2) micro vessel permeability induced by agents such as VEGF, histamine, serotonin and PAF; and 3) histamine and serotonin induced angiogenesis. Thus, the present inventors have discovered a pro-angiogenic factor which is not required for normal vessel development but is required for tumor induced vessel formation in adult animals.

Accordingly, one embodiment of the invention comprises methods for screening agents which modulate angiogenesis. An exemplary assay entails providing cells over-expressing TR3/Nur77, incubating the cells in the presence and absence of test agent and assessing the effect of said agent on angiogenesis. Angiogenic processes to be assessed include without limitation, endothelial cell proliferation, endothelial cell survival, induction of certain cell cycle genes, vessel permeability and endothelial tube formation. The methods also include the assessment of agents which modulate angiogenic processes induced by histamine.

In yet another aspect of the invention, cells having reduced TR3/Nurr77 activity are incubated in the presence and absence of the test agent and the ability of the test agent to restore TR3/Nur77 function determined.

In yet another embodiment of the invention, whole animal models for assessing Nur77 function are disclosed. An exemplary method entails introducing a vector encoding VEGF-A into the skin of a nude mouse to generate a strong local angiogenic response, e.g., the formation of enlarged pericyte-poor mother vessels. Test compounds can be assessed in the mouse for their ability to augment or disrupt these processes.

Another aspect of the screening method of the invention entails the use of transgenic Nur77 knockout mice comprising tumor explants. Such mice exhibit greatly reduced angiogenesis and inhibited tumor growth. Accordingly, test agents may be administered to the mice and their effects on tumor growth and concurrent angiogenesis determined. Also encompassed by the invention are transgenic mice which over express Nur77 specifically in endothelial cells. These mice provide a superior whole animal model for studying Nur77 mediated angiogenesis as well as a screening tool for assessing agents having efficacy of the treatment of disorders associated with aberrant angiogenesis.

Finally, a method for screening agents which modulate TR3/Nur77 promoter function are disclosed. An exemplary method entails the use of DNA constructs comprising the promoter region of TR3 or Nur77 operably linked to a reporter gene which are introduced into host cells. The cells so transformed are then contacted with the agent to be screened and the ability of the agent to modulate promoter function as reflected by reporter gene expression levels determined.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. VEGF-A induces TR3 expression in cultured HUVEC. (A)

Quantitative real time RT-PCR to demonstrate TR3 and control GAPDH mRNA expression following stimulation with 10 ng/ml VEGF-A¹⁶⁵ at times indicated. (B) Immunoblot of TR3 protein expression in VEGF-A¹⁶⁵-stimulated HUVEC (top panel). Lower panel shows MAPK protein loading control. (C) TR3 mRNA expression in HUVEC stimulated with 10 ng/ml VEGF-A¹⁶⁵, VEGF-A¹²⁰, PlGF, PDGF or with 25 ng/ml bFGF over time as determined by quantitative real time RT- PCR (n=2).

Figure 2. TR3 and Nur77 mutants. Expression of TR3/Nur77 sense, antisense and mutant proteins in transfected HUVEC. (A) Schematic structure of TR3 and Nur77 genes and mutants constructed to lack TAD, DBD, or LBD domains. (B) Expression of TR3 protein in control HUVEC and in HUVEC transfected with TR3-S, TR3-AS, or LacZ cDNAs. TR3-S-transfected HUVEC expressed 3-4-fold more TR3 protein than untransfected or LacZ-transfected cells. Endogenous TR3 protein expression was strongly inhibited in cells transfected with TR3-AS. Lower panel shows MAPK protein loading control. (C) Expression of Flag-TR3-ΔTAD, Flag-TR3-ΔDBD and Flag-TR3-ΔLBD in HUVEC. (D) Subcellular localization of GFP-fused TR3 mutants in HUVEC.

Figure 3. Assays measuring functional capabilities of cultured HUVEC transfected with TR3-S, TR3-AS, and TR3 mutant cDNAs, with or without VEGF-A¹⁶⁵ stimulation. (A) ³H thymidine incorporation (6). (n=4). (B) Cell survival assay. (n=4). (C) Tube formation on Matrigel.

Figure 4. TR3 regulation of cell cycle gene expression in HUVEC.

Immunoblots of cell extracts from HUVEC transfected with LacZ, TR3-S, TR3-AS, and TR3 mutant DNAs, with or without VEGF-A¹⁶⁵ stimulation for indicated times. Actin expression serves as a protein loading control.

Figure 5. Increased expression of Nur77 in VEGF- A-induced angiogenesis. (A) Angiogenic response in nude mouse ears 5 days after i.d. injection of Ad-VEGF-A¹⁶⁴ (left ear). Ad-LacZ was injected in right ear as a negative control (7). (B) Fold activation of Nur77 mRNA over time in mouse ears following i.d. injection of Ad-VEGF-A¹⁶⁴ or Ad-LacZ, as determined by quantitative real time RT- PCR. (C) Immunoblots of Nur77 protein expression in uninjected mouse ears or in ears injected with Ad-LacZ or Ad-VEGF-A¹⁶⁴ (top panel). Lower panel shows MAPK protein loading control. (D) Immunoblots of Nur77 protein expression (top panels) in healing skin punch biopsy wounds and in mesenteries of nude mice bearing TA3/St and MOT ascites tumors. Lower panels show MAPK protein loading controls.

Figure 6. Nur77 and VEGF-A expression in Matrigel assays. (A) In situ hybridization performed on Matrigels containing SK-MEL/VEGF cells and PT67 cells packaging either Nur77-S (left panel) or Nur77-AS-expressing retroviruses (right panel) cDNAs. Probes were Nur77-AS (A, C), Nur77-S (B, D), and VEGF- A¹⁶⁵-AS (E, F). (B) In situ hybridization demonstrating Nur77 expression in newly formed blood vessels in Matrigels containing SK-MEL/VEGF cells hybridized with Nur77-anti-sense (A) or sense probes (B). v, vessel.

Figure 7. Angiogenic response induced by Nur77-S or Nur77-AS in Matrigel assays in vivo. (A) Macroscopic (upper panels) and CD-31 -stained microscopic (lower panels) images of the angiogenic response induced 3 days after implantation of Matrigels with indicated contents of VEGF-A¹⁶⁵-secreting SKMEL/VEGF cells and PT67 cells packaging LacZ, Nur77-S or Nur77-AS. (B) Quantitative measurement of intravascular plasma volumes (μl/g) in Matrigels containing indicated cell mixtures at 1 and 3 days after implantation as determined by accumulation of Evan's blue dye administered i.v. 5 min prior to euthanasia.

Figure 8. Growth of B16F1 melanoma is inhibited in Nur77 ^;" mice. (A)

Growth of B 16Fl melanomas in wt and Nur77^';" mice (mean + SD, n=4). (B) (a). Gross appearance of tumors at 11 days. Histology (b,c) and CD31 immunohistochemistry (d,e) of B 16Fl melanomas growing in wild type (b,d) and Nur77^";" (c,e) mice at day 11. Tumors in wild type mice have numerous, large mother vessels (v), whereas vessels in Nur77^"/~ mice are much less numerous and considerably smaller in size. N, necrosis; bar = 100 μm. Figure 9. Nur77 functions downstream of VEGFR-2/KDR in Matrigel assays in vivo. (A) SU1498, a VEGFR-2/KDR kinase inhibitor, inhibited angiogenesis induced by VEGF- A¹⁶⁵-expressing SKMEL/VEGF-A cells (lane 1) but not that induced by Nur77 (lane 2). (B) Quantitative measurement of intravascular plasma volumes (μl/g) in Matrigels containing indicated cell mixtures ± SU1498 as determined by accumulation of Evan's blue dye administered i.v. 5 min prior to euthanasia.

Figure 10. The transactivation and DNA binding domains of Nur77 are required to induce angiogenesis in Matrigel assays in vivo. Quantitative measurement of intravascular plasma volumes (μl/g) in 3 day Matrigels containing indicated cell mixtures as determined by accumulation of Evan's blue dye administered i.v. 5 min prior to euthanasia.

Figure 11. TR3/Nur77 is required for VEGF-A¹⁶⁵-induced microvessel permeability in vivo. A) Different levels of microvessel permeability in Matrigels implanted with cell mixtures as indicated; B) Quantitative measurement of plasma leakage (30 min) in Matrigels containing indicated cell mixtures at 1 and 3 days after implantation.

Figure 12. Nur77 functions downstream of VEGFR-2/KDR to regulate microvessel permeability in vivo. (A) SU1498, a VEGFR-2/KDR kinase inhibitor, inhibited microvessel permeability induced by VEGF-A ¹⁶⁵-expressing SKMEL/VEGF-A cells (lane 1 ) but not that induced by Nur77 (lane 2). (B)

Quantitative measurement of plasma leakage (μl/g) in Matrigels containing indicated cell mixtures ± SU1498 as determined by accumulation of Evan's blue dye administered i.v. 30 min prior to euthanasia.

Figure 13. The transactivation and DNA binding domains of Nur77 are required to induce microvessel permeability in Matrigel assays in vivo. Illustration of microvessel permeability in 3 day Matrigels containing indicated cell mixtures.

Figure 14. Upregulation of TR3 expression in HUVEC by microvessel permeable factors. A) Quantitative real time RT-PCR to demonstrate TR3 mRNA expression following stimulation with histamine (10 μM), PAF (10 pg) and serotonin (5 μM) at times indicated. (B) Immunoblot of TR3 protein expression in histamine-, PAF- and serotonin-stimulated HUVEC (top panel). Lower panel shows MAPK protein loading control.

Figure 15. Microvessel permeability was completely inhibited in Nur77-/- mice. Skin microvessel permeability (Miles Assay) with different doses in wild type in Nur77-/- mice. A) VEGF; B) Histamine; C) PAF; D) serotonin; E) Tumor edema was greatly reduced in Nur77-/- mice.

Figure 16. Histamine induced angiogenesis time-dependently. Pellets that release 0.0 ImM histamine were planted s.c. Tissues were dissected and photographed at different time as indicated (represent of 8 mice).

Figure 17. Histamine directly induced angiogenesis. A) KDR inhibitor could not inhibit his-angiogenesis; B) Histamine-induced angiogenesis was inhibited by antagonist of histamine receptor 2 (H2), not histamine receptor 1 (Hl) nor histamine receptor 4 (H4); C) Histamine-induced HUVEC proliferation was completely inhibited by H2 inhibitor, not Hl inhibitor, nor H4 inhibitor (n=4).

Figure 18. Requirement of TR3/Nur77 for histamine-induced angiogenesis. A) Nur77 was upregulated in histamine-induced angiogenesis (left panel). Membrane was stripped and reprobed with an antibody against β-actin to confirm protein equal loading (right panel); A) Overexpression of TR3 antisense DNA completely inhibited histamine-induced HUVEC proliferation; C) Histamine- induced angiogenesis was completely in Nur77-/- mice. DETAILED DESCRIPTION OF THE INVENTION

In accordance with the present invention, VEGF-A inducible endothelial cell immediate-early response genes which play downstream roles in regulating angiogenesis have been identified and characterized by DNA microarray analysis. One of these genes, TR3 (mouse homologue Nur77, rat homolog NGFI-B), an immediate early response gene and member of the class IV subfamily of the orphan nuclear receptor superfamily of transcription factors (8) was strongly upregulated in cultured human umbilical vein endothelial cells (HUVEC). TR3/Nur77 has been previously identified as an important regulator of cell growth and apoptosis in tumor cells, lymphocytes and neurons (9, 10), but a role in angiogenesis has not been described. We report that TR3/Nur77 is both necessary and sufficient for VEGF-A- induced proliferation and survival of cultured endothelial cells and for angiogenesis in vivo. VEGF-A (human VEGF-A¹⁶⁵, mouse VEGF-A¹⁶⁴) has essential roles in vasculogenesis and angiogenesis, but the downstream steps and mechanisms by which VEGF-A¹⁶⁵ acts are incompletely understood. Overexpression of TR3 in HUVEC resulted in VEGF-A-independent proliferation, survival, micro vascular hyperpermeability and induction of several cell-cycle genes whereas expression of antisense TR3 abrogated the response to VEGF-A in these assays. Nur77 was highly expressed in endothelial cells which exhibit VEGF- A-dependent pathological angiogenesis in vivo. Also, using a novel endothelial cell-selective retroviral targeting system, overexpression of Nur77 DNA potently induced angiogenesis in the absence of exogenous VEGF-A, whereas Nur77 antisense strongly inhibited VEGF- A-induced angiogenesis. B 16Fl melanoma growth and angiogenesis were greatly inhibited in Nur77^";" mice. Mechanistic studies with TR3/Nur77 mutants revealed that TR3/Nur77 biological activity is primarily mediated by the transactivation and DNA binding domains (i.e., through transcriptional activity) of the molecule.

The results presented herein demonstrate that modulation of TR3/Nur77 expression levels can directly influence the process of angiogenesis both in vivo and in vitro. Accordingly, another aspect of the invention comprises the use of TR3/Nur77 promoter sequences operably linked to a reporter gene in screening assays for therapeutic agents or test compounds which suppress or enhance promoter function, thereby modulating TR3/Nur77 protein expression levels.

The GenBank Accession No. of TR3 promoter is U 17590

Another embodiment of the invention entails whole animal models for studying TR3/Nur77 mediated angiogenic processes. Thus, methods of using Nur77 knock-out mice or, alternatively mice which inducibly overexpress Nur77 or mutants thereof are encompassed within the present invention. Such mice provide an in vivo model system for assessing the molecular action of Nur77 and mutants thereof which lack domains important for Nur77 function. The mice may also be used in screening assays for the identification of angiogenesis-modulating agents.

The findings set forth above, provide the basis for the development of efficient screening methods to identify therapeutic agents useful for the treatment of disorders associated with aberrant angiogenesis.

The following definitions are provided to facilitate an understanding of the present invention:

The term "TR3/Nur77" refers to a member of the class IV subfamily of the orphan nuclear receptor superfamily of transcription factors. TR3 (GenBank Accession No. L13740) and Nur77 (GenBank Accession No. J04113) are homologues from human and mouse, respectively. TR3/Nur77 has three functional domains: the N-terminal transactivation domain (TAD), the DNA binding domain (DBD), and the C-terminal ligand binding domain (LBD) (11).

The term "angiogenesis" as used herein refers to the formation of new blood vessels, e.g. in an embryo or as a result of a tumor.

The phrase "TR3/Nur77-mediated angiogenic processes" as used herein refers to endothelial cell proliferation, endothelial cell survival, formation of mother vessels, tube formation, induction of certain cell cycle genes, and vascular hyperpermeability.

The phrase "mother vessel" as used herein refers to enlarged, thin-walled, pericyte-poor vessels observed early in the angiogenic response.

"Altered TR3/Nurr77 expression levels" are levels of expression which differ from those observed in normal cells which normally express TR3/Nur77. Expression levels can be altered via introduction of heterologous nucleic acids encoding TR3/Nur77 to augment endogenous expression levels. Alternatively, levels can be reduced via gene knockout, and/or siRNA or antisense inhibition. In yet another approach, the function of the 5' promoter sequence can be modulated, thereby altering expression levels of the encoded gene product, e.g., TR3/Nur77. "Vascular hyperpermeability" refers to plasma protein leakage from blood vessels.

The term "operably linked" means that the regulatory sequences necessary for expression of the coding sequence are placed in a nucleic acid molecule in the appropriate positions relative to the coding sequence so as to enable expression of the coding sequence. This same definition is sometimes applied to the arrangement of other transcription control elements (e.g. enhancers) in an expression vector. Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell. The terms "promoter", "promoter region" or "promoter sequence" refer generally to transcriptional regulatory regions of a gene, which are typically located 5' to the coding region. Typically, a promoter is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. The typical 5' promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence is a transcription initiation site (conveniently defined by mapping with nuclease Sl), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.

A "vector" is a replicon, such as plasmid, phage, cosmid, or virus to which another nucleic acid segment may be operably inserted or linked so as to bring about the replication or expression of the segment.

The term "nucleic acid construct" or "DNA construct" is sometimes used to refer to a coding sequence or sequences operably linked to appropriate regulatory sequences and inserted into a vector for transforming a cell. This term may be used interchangeably with the term "transforming DNA". Such a nucleic acid construct may contain a coding sequence for a gene product of interest, along with a selectable marker gene and/or a reporter gene.

The term "selectable marker gene" refers to a gene encoding a product that, when expressed, confers a selectable phenotype such as antibiotic resistance on a transformed cell. The term "reporter gene" refers to a gene that encodes a product which is easily detectable by standard methods, either directly or indirectly.

As used herein, "reporter gene" refers to a gene which encodes a readily detectable protein product whose expression may be assayed; such genes include, without limitation, beta-glucuronidase (GUS), the mammalian chloramphenicol transacetylase (CAT) gene, green fluorescent protein (GFP), luciferase, and beta- galactosidase.

The following examples are provided to illustrate certain embodiments of the invention. They are not intended to limit the invention in any way.

EXAMPLE l

In accordance with the present invention, a new molecular target and methods of use thereof for the design of therapeutic agents which modulate angiogenesis is provided. The materials and methods set forth below are provided to facilitate the practice of the present invention. Cell culture. HUVEC culture and proliferation assays were carried out as described (6). In brief, after 24 h serum starvation, culture was continued with or without addition of VEGF-A¹⁶⁵ (10 ng/ml) for an additional 20 h, followed by 4 final h of culture with the addition of ³H thymidine.

Construction of TR3/Nur77 mutants. TR3 and Nur77 cDNAs were obtained by RT-PCR with RNA isolated from HUVEC and mouse mesenteries RNA, respectively. Mutants were generated by PCR-based mutagenesis. After sequence confirmation, DNAs were fused with Flag tag or green fluorescent protein (GFP) to create Flag- or GFP-fusion proteins, respectively.

Endothelial cell tube formation assay. HUVEC (IxIO⁵CeIIs) transduced with LacZ, TR3-S, TR3-AS, TR3-ΔTAD, TR3-ΔDBD and TR3-ΔLBD cDNAs were seeded on Matrigel with endothelial cell growth medium (Clonetics Co., San Diego, CA) and photographed after 16 h. Experiments were repeated three times.

Cell survival assay. HUVEC transduced with LacZ, TR3-S, TR3-AS, TR3- ΔTAD, TR3-ΔDBD or TR3-ΔLBD were seeded on 100 mm tissue culture dishes. After two days, cells were changed to 0.1 % BSA in EBM medium, with or without 50 ng/ml VEGF-A¹⁶⁵, for 3 days. Cells were trypsinized, washed with PBS, and stained with propidium iodide solution (50 μg/ml PI in 0.1% sodium citrate-0.1% Triton X- 100) for 1 hr. Apoptotic cells were quantified by flow cytometry. Experiments were repeated 4 times. Quantitative real time RT-PCR. Applied Biosystems (Foster City, CA) software was used to design optimal primer pairs for real-time RT-PCR and for data calculation. The forward and reverse primers for TR3 were 5'- AGCATTATGGTGTCCGCACAT-3' (SEQ ID NO: 1) and 5'- CTTGGCGTTTTTCTGCACTGT-3' (SEQ ID NO: 2), respectively. 5'- /5TET/TGAGGGCTGCAAGGGCTTCTTCAA/36-TAMNph/-3^l (SEQ ID NO: 3) served as an internal probe for TR3. The primers for Nur77 were 5'- ATGCCTCCCCTACCAATCTTC-3¹ (SEQ ID NO: 4) and 5'-CAGTGCTAGGCC

CGGAGTC-3' (SEQ ID NO: 5) respectively. The Nur77 internal probe was 575TET/C ACTTCCCTC ATCCGGGC AC A CTT/36-TAMNph/-3' (SEQ ID NO: 6). GAPDH served as an internal control. Experiments were repeated 3 times, in duplicate.

In vivo angiogenesis models. Female, 4-5 week Nu/Nu mice (NIH) were injected in ear skin with 1 x 10⁸ pfu of non-replicating adenoviral vectors expressing mouse VEGF-A¹⁶⁴ (Ad-VEGF-A¹⁶⁴) or LacZ (Ad-LacZ) (7). Other nude mice received 4 mm punch biopsies on their flanks or were injected i.p. with 1 x 10 MOT (mouse ovarian tumor) or TA3/St mammary tumor cells (12-14). Ears and mesenteries were collected at indicated times and RNA and protein were isolated with the Qiagen (Valencia, CA) kit or the T-PER tissue protein extraction reagent (Pierce Biotechnology, Inc. Rockford, IL), respectively. Experiments were repeated in triplicate.

In situ hybridization and immunohistochemistry. Tissues were harvested, photographed, and fixed in 4% paraformaldehyde. In situ hybridization was performed as described (7) using Nur77 sense and antisense probes representing the N-terminal 344 nucleotides. Immunohistochemistry was performed on frozen sections as previously described, using rat anti-CD31 antibody (7).

Matrigel angiogenesis assays (modified after (15)). SK-MEL/VEGF cells (1 x 10⁷), alone or mixed with 1x10⁷ PT67 packaging cells infected with retroviruses expressing LacZ, Nur77-sense (S) or Nur77-antisense (AS) cDNAs or Nur77 mutants, were suspended in 0.5 ml of growth-factor reduced Matrigel (BD Biosciences, Bedford, MA) and injected s.c. into Nu/Nu mice. In some experiments the KDR inhibitor SU 1498 (Calbiochem, San Diego, CA) was incorporated into Matrigel plugs (40 μg/ml Matrigel) and was also injected i.p. daily (1 mg/kg) after Matrigel implantation. Each experiment was replicated on 8 mice.

Quantitative analysis of plasma volumes in Matrigel Assays. Mice (4 per group) implanted with various cell combinations in Matrigel were anesthetized with Avertin (tribromoethanol, 200 mg/kg) and injected i.v. via the tail vein with 0.2 ml of Evan's blue dye (5 mg/ml in saline). After 5 min, blood was collected in heparin by cardiac puncture and centrifuged at 14,000 rpm for 10 min. to obtain platelet poor plasma which was diluted in formamide for measurement of Evan's blue dye concentration. Animals were euthanized by CO₂ narcosis and Matrigel plugs were dissected free by cautery to prevent blood loss, weighed, and extracted with 2 ml formamide at r.t. for 3 days. Dye in plasma or extracted from Matrigels was measured at 620 nM in a Thermo Max microplate reader (Molecular Devices, Menlo Park, CA) using Softmax 881 software. Standard curves were generated by measurement of serial dilutions of Evan's blue dye in formamide (μg/ml). Intravascular plasma volumes (μl per gram Matrigel) were calculated on the basis of Evan's blue dye concentrations in blood plasma to provide an absolute measure of the volume of plasma in the vascular bed.

Tumor growth in wild type and Nur77^~Λ mice. Nur77^"A mice were kindly provided by Dr. Jeffrey Milbrandt (Washington University School of Medicine, St. Louis, MO). 5 x 10⁵ B16F1 melanoma cells (American Type Cell Culture) were injected into the flank skin of wild type (C57B1/6) and Nur77^"A mice. Tumor size was measured daily and animals were sacrificed on day 11 when tumors in control animals had reached a size of nearly 1500 mm³. Tumor size was calculated as the product of π/6 times measures of the tumor's length, width and height. Tissues were prepared for 1 μm Giemsa-stained Epon sections and for immunohistochemistry as previously described (7).

Quantitative analysis of cellular permeability in Matrigel Assays: Mice (4 per group) implanted with various cell combinations in Matrigel were anesthetized with Avertin (tribromoethanol, 200 mg/kg) and injected i.v. with 0.2 ml of Evan's blue dye (0.5 mg/ml in saline). After 30 minutes, tissues were dissected and photographed. For quantitative analysis, blood was collected in heparin by cardiac puncture and centrifuged at 14,000 rpm for 10 minutes to obtain platelet poor plasma (PPP) for dilution in formamide. Animals were euthanized by CO₂ narcosis and

Matrigels were dissected free by cautery to prevent blood loss, weighed, and extracted with 2 ml formamide at r.t. for 3 days. Dye in platelet poor plasma (PPP) and in extracted Matrigels was measured at 620 nM in a Thermo Max microplate reader (Molecular Devices, Menlo Park, CA) using Softmax 881 software. Standard curves were generated by measurement of serial dilution of Evan's blue dye in formamide (μg/ml). Plasma volumes (μl per gram) in Matrigels were calculated on the basis of Evan's blue dye concentrations in blood plasma to provide an absolute measure of the volume of plasma that had extravasated (30 min). Analysis of variance and the Tukey-Kramer multiple comparisons test were used to determine statistical significance.

Miles Assay: Hair was depilated (Nair, Carter Products, NY) one day before experimentation. Mice were injected i.v. with Evan's blue dye as above. Different doses of VEGF-A¹⁶⁵, histamine, PAF and serotonin in HBSS (or HBSS alone) were injected i.d. into flank skin in a volume of 20 μl. After 15 minutes, animals were euthanized and injection sites were evaluated and photographed. Data represent one of 8 mice for each group.

Creation of diabetic mice. Mice will be rendered diabetic by intraperitoneal injection of streptozotocin (Sigma- Aldrich, St Louis, MO, USA) at 1.2 mg/30 g weight/day for 5 consecutive days. After 7 days, glycemia was measured and animals with glycemia of 200 to 400 mg/dl will be selected for further studies.

Effect of TR3 of sense and antisense DNA, and TR3 mutants on wound healing. Skin wounds will be created as previously described (16). in Nude/Nude mice or Nude/Nude mice rendered diabetic as described above. Twenty μl of retrovirus expressing TR3 sense and antisense DNA, and TR3 mutants, respectively will be applied on the top of the wound area. Mice will be photographed daily until 11 days. Tissues will be collected for study by light, fluorescence and electron microscopy.

Statistics. Analysis of variance and the Tukey-Kramer multiple comparisons test were used to determine statistical significance.

Animal welfare. All animal experiments were performed in compliance with the Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committee.

A. Expression and Function of TR3 in vitro Upregulation of TRS in HUVEC Serum-starved HUVEC were stimulated with 10 ng/ml VEGF-A¹⁶⁵ for 1 hr and RNA was isolated. Affymetrix DNA microarray chip analysis was then utilized to identify genes which are differentially expressed upon exposure to VEGF-A¹⁶⁵. In agreement with a recent report (17), stimulation with VEGF-A¹⁶⁵ highly upregulated TR3 and we confirmed this finding by quantitative real time RT-PCR and immunoblotting (Fig. IA₅B)- TR3 was also induced, though to a slightly lesser extent, by another VEGF-A isoform, VEGF-A¹²⁰, but not by several other angiogenic growth factors including bFGF, PDGF and placenta growth factor (PlGF), another member of the VPF/VEGF family (Fig. 1C).

Cloning and expression of TR3 sense and antisense cDNAs and mutants

To elucidate TR3/Nur77's role in angiogenesis-related events, we constructed TR3-sense (TR3-S) and TR3-antisense (TR3-AS) DNAs. Also, TR3/Nur77, like other members of the orphan nuclear receptor superfamily, has three functionally distinct domains: transactivation, DNA binding, and ligand binding (11, 18). Therefore, we engineered mutant forms of TR3/Nur77 that lacked each of these domains, as previously described (11) (Fig. 2A). Each of these constructs was fused with the Flag tag and then transduced into HUVEC, using an efficient retroviral system that yielded almost 100% infection (6). HUVEC retrovirally transfected with TR3-S DNA exhibited a 3 -4-fold increase in TR3 protein expression as compared with untransfected cells or HUVEC transduced with LacZ; on the other hand, HUVEC transfected with TR3-AS expressed greatly diminished amounts of TR3 protein (Fig. 2B). All three mutant forms of TR3 were expressed and to similar extents (Fig. 2C). Green fluorescent protein (GFP) fusion proteins were prepared of each mutant and their subcellular distribution followed after introduction into HUVEC. GFP-TR3- ΔDBD protein was localized to the HUVEC cytosol, whereas GFP-TR3-ΔTAD and GFP-TR3-ΔLBD, like GFP-TR3-S, were confined to the nucleus (Fig. 2D). We then tested each of these transfected cells using in vitro angiogenesis assays that measured cell proliferation, survival and tube formation.

Endothelial cell proliferation assay

Serum-starved HUVEC transduced with LacZ (control), TR3-S, or TR3-AS.

DNAs were cultured for 24 h with or without VEGF-A¹⁶⁵ and cell proliferation was assessed by 4 h ³H-thymidine incorporation (6). As shown in Fig. 3 A, HUVEC transduced with TR3-S strongly incorporated ³H-thymidine (lane 3 vs. lane 1, P<

0.001) in the absence of added VEGF-A¹⁶⁵ and in amounts equivalent to those induced by VEGF-A¹⁶⁵ in LacZ transduced cells (lane 3 vs. lane 2, p>0.5).

Incorporation was not enhanced further when VEGF-A¹⁶⁵ was added (lane 4 vs. lane 3, P>0.5). HUVEC transduced with TR3-AS incorporated ³H thymidine at baseline levels (lane 5 vs lane 1) but incorporation was not increased by addition of VEGF-

A¹⁶⁵ (lane 6 vs lane 2, PO.001).

We next investigated ³H thymidine incorporation in HUVEC transduced with mutant TR3s that lacked each of its three domains. As shown in Fig. 3 A, HUVEC transfected with TR3 mutants lacking the transactivation (ΔTAD) or DNA binding (ΔDBD) domains incorporated ³H thymidine at baseline levels which did not increase upon exposure to VEGF-A¹⁶⁵. These data suggest that TR3 transcriptional activity is required for VEGF-A¹⁶⁵-induced HUVEC proliferation. However, HUVEC transfected with the TR3 mutant that lacked the ligand binding domain (ΔLBD) behaved like HUVEC transfected with full-length TR3-S, exhibiting greatly increased ³H thymidine incorporation in the absence of added VEGF-A¹⁶⁵; also, incorporation was not further enhanced by addition of VEGF-A¹⁶⁵. Thus, the ligand binding domain is apparently not required for the enhanced proliferative response observed after TR3 transfection.

Endothelial cell survival assay HUVEC undergo apoptosis when cultured in the absence of serum and VEGF-

A¹⁶⁵ is known to protect endothelial cells from apoptosis (19). After three days of culture in the absence of serum and VEGF-A¹⁶⁵, >70% of LacZ-transfected HUVEC underwent apoptosis lane 1); as expected, addition of VEGF-A¹⁶⁵ protected such HUVEC, reducing apoptosis by approximately one half (lane 2 vs. lane 1, pO.OOl). HUVEC transfected with TR3-S DNA, without added VEGF-A¹⁶⁵, also showed reduced apoptosis, similar to that of LacZ-transfected HUVEC treated with VEGF- A¹⁶⁵ (lane 3 vs. 2, p>0.05); addition of VEGF-A¹⁶⁵ reduced apoptosis slightly further (lane 4). However, in HUVEC transduced with TR3-AS DNA, nearly 80% of cells were apoptotic and addition of VEGF-A¹⁶⁵ did not significantly improve cell survival (lanes 5 and 6, p>0.05). HUVEC transduced with any of the mutant TR3 DNAs underwent nearly 100% apoptosis and could not be rescued by addition of VEGF-A (lanes 7-12, p>0.05). See Figure 3B. Thus, overexpression of full length TR3, but not mutants lacking any of its domains, protects HUVEC from apoptosis in the absence of added VEGF-A¹⁶⁵; further, VEGF-A¹⁶⁵ was not able to protect from apoptosis HUVEC that had been transfected with any of the domain-lacking mutants.

Tube formation assay

As shown in Figure 3 C, HUVEC or HUVEC transfected with LacZ form characteristic tubal networks when cultured on Matrigel in growth medium for 18 h (panel a). TR3-S-transfected HUVEC formed similar networks (panel b). However, HUVEC transfected with TR3-AS or with TR3-ΔTAD formed greatly reduced numbers of tubes (panels c, d). TR3-ΔLBD transfected HUVEC approximated the normal network pattern but formed a somewhat looser meshwork (panel f). Finally, cells transfected with TR3-ΔDBD remained as a confluent monolayer and exhibited no evidence of network formation (panel e). These data indicate that TR3 has an important role in HUVEC tube formation and that the ΔTAD and especially the ΔDBD domain are particularly important in this process. TR3 regulates expression of cell cycle-related genes

VEGF-A ⁵ is known to induce the expression of several cell cycle-related genes in HUVEC (20). Therefore, we investigated whether TR3 had a similar effect. See Figure 4. We found that VEGF-A¹⁶⁵ induced the expression of cyclins A and Dl, PCNA, and E2F in HUVEC transduced with LacZ (Fig. 4, panel 1) and also in untransfected HUVEC (data not shown). In HUVEC transduced with TR3-AS, baseline expression of these genes was reduced or similar to that of LacZ-transduced cells, and expression was either not increased or increased to a lesser extent following addition of VEGF-A^{1 5} (panel 2). In addition, expression of all four of these genes was increased in TR3-S transduced cells in the absence of VEGF-A¹⁶⁵ (panel 3). In TR3-ΔLBD-transfected cells, expression of these genes was roughly similar to that of LacZ-transduced cells and was comparably stimulated upon exposure to VEGF-A ⁶⁵ (panel 4). However, HUVEC transduced with TR3-ΔTAD or TR3-ΔDBD did not express detectable amounts of any of these genes, with or without addition of VEGF- A¹⁶⁵ (panels 5,6). Consistent with these data, HUVEC transfected with TR3-AS, TR3- ΔTAD or TR3-ΔDBD grew much more slowly in culture than control or Lac-Z transfected cells.

B. Expression and Function of Nur77 (the mouse TR3 homologue) in vivo Expression ofNur77 in angiogenesis assays in vivo

Our experiments with cultured endothelium suggested that TR3 could have an important role in regulating angiogenesis. To test this possibility, we investigated whether Nur77, the mouse homologue of TR3, was induced in the course of VEGF- A-mediated angiogenesis in vivo. We first injected an adenoviral vector expressing VEGF-A¹⁶⁴ (the murine equivalent of human VEGF-A¹⁶⁵) into nude mouse ear skin to generate a strong local angiogenic response (7) (Fig. 5A). We found that Nur77 mRNA and protein expression were strongly upregulated in a time-dependent fashion (Fig. 5B, C) that correlated temporally with the early angiogenic response which is characterized by the formation of enlarged, pericyte-poor "mother" vessels (7). Healing skin wounds and TA3/St and MOT ascites tumors induced a similar, VEGF- A-driven angiogenic response (14, 21) and we found that Nur77 expression was upregulated in all three of these examples (Fig. 5D). However, Nur77 was not detected in immunoblots of TA3/St or MOT tumor cell extracts (data not shown). Together, these data demonstrate that Nur77 is strongly upregulated in several different examples of VEGF- A-induced angiogenesis.

Nur77 regulates angiogenesis in Matrigel assays in vivo To elucidate Nur77' s mechanism of action, we made use of a recent modification of the Matrigel assay in order to introduce genes of interest into vascular endothelium in vivo (15). SK-MEL-2 melanoma cells that had been transfected to overexpress VEGF-A¹⁶⁵ (SK-MEL/VEGF cells) (15), and PT67 cells packaging retroviruses that expressed LacZ, Nur77-S, or Nur77-AS, were incorporated into Matrigel plugs that were injected into the subcutaneous space of nude mice. The VEGF-A¹⁶⁵ secreted by SK-MEL/VEGF cells induces nearby vascular endothelial cells to divide and therefore to become susceptible to infection with retroviruses secreted by PT67 packaging cells (15).

Initial experiments confirmed that Nur77 sense and antisense RNAs were expressed by cells in Matrigels (Fig. 6A, panels A-D). We then evaluated the angiogenic response that developed after implantation of Matrigel plugs containing various cell mixtures on dayl (data not shown) and day 3 (Fig. 7A). Angiogenesis was assessed by macroscopy (top panels) and by histology and immunohistochemistry for the endothelial cell marker CD31 (bottom panels). Plugs containing only PT67 cells that packaged LacZ-expressing retroviruses (PT67/LacZ cells) did not induce significant angiogenesis. However, strong angiogenesis was induced in plugs containing SK-MEL/VEGF cells, whether alone or combined with PT67/LacZ cells. The angiogenic response was characterized by the formation of "mother" vessels, enlarged, thin-walled, pericyte-poor vessels typical of early VEGF-A- induced angiogenesis (7). In situ hybridization confirmed that Nur77 was induced in gels containing SK-MEL/VEGF (Fig. 6B). When PT67/Nur77-AS cells were included in the Matrigel, the angiogenic response induced by SKMEL/VEGF cells was strikingly inhibited (Fig. 7A). The effect of Nur77-AS DNA was not attributable to inhibition of VEGF-A ⁵ expression by tumor cells (Fig. 6A, panels E, F). Furthermore, overexpression of TR3/Nur77-AS DNA in either SKMEL/VEGF or PT67 cells did not affect proliferation as measured by ³H-thymidine incorporation (data not shown). To further characterize the role of Nur77 in angiogenesis, we incorporated PT67/Nur77-S packaging cells into the Matrigel plugs, alone or along with SK- MEL/VEGF cells. Strong angiogenesis with mother vessel formation developed when PT67/Nur77-S cells were included along with SK-MEL/VEGF cells (Fig. 7A). Of particular interest, PT67/Nur77-S cells induced significant angiogenesis with the formation of mother vessels even in the absence of SK-MEL/VEGF cells (Fig. 7A), likely because Matrigel implants, as a foreign matrix, induced sufficient endothelial cell proliferation to allow some retroviral uptake. Taken together, these data indicate that Nur77 is able to induce typical angiogenesis in vivo in the absence of exogenous VEGF-A¹⁶⁵.

Quantitation of angiogenesis induced by Nur77

To quantitate the angiogenic response, we measured the intravascular volume of plasma contained within Matrigel plug-associated blood vessels. Evan's blue dye was injected i.v. into mice 1 and 3 days after implantation of Matrigel plugs containing various cell mixtures. This dye binds to plasma proteins and therefore the amount of plasma within the Matrigel-associated vasculature can be calculated from simultaneous measurements of dye concentration in peripheral blood plasma. Matrigel plugs were harvested 5 min after i.v. dye injection, when blood vessels were filled with dye-plasma protein complexes but before there was time for significant extravasation.

Intravascular dye accumulation in Matrigel plugs containing VEGF-A¹⁶⁵- expressing SKMEL/VEGF cells (alone or with PT67/LacZ cells) increased more than 2-fold above baseline levels at 3 days in Matrigels lacking SKMEL/VEGF cells (Fig. 7B, lanes 4 and 6 vs. lane 2, P<0.001); the increase at 1 day was smaller and not statistically significant (lanes 3 and 5 vs. lane 1, P > 0.05). Inclusion of PT67 cells packaging Nur77-AS DNA completely blocked the response of SKMEL/VEGF cells on day 3 (lane 8 vs. lanes 4 and 6, P < 0.001). Dye accumulation in Matrigel plugs increased still further to >3-fold on day 3 when SKMEL/VEGF cells were included along with PT67/Nur77-S cells (lane 10 vs. lanes 4 and 6, P < 0.01). The increment in dye accumulation also achieved statistical significance on 1 day (lane 9 vs. lanes 1, 3 and 5, P <0.001). However, when PT67/Nur77-S cells were incorporated in Matrigel plugs in the absence of SKMEL/VEGF cells, dye accumulation increased significantly by ~ 2 fold on day 1 (lane 11 vs. lanes 1, 3 and 5, P < 0.001). Dye accumulation in these plugs increased further at 3 days, similar to that of 3 day plugs containing SKMEL/VEGF cells, alone or with PT67/LacZ cells (lane 12 vs. lanes 4 and 6, P > 0.05). These data indicate that inclusion of cells packaging Nur77-S not only induces angiogenesis but does so more rapidly than that induced by SKMEL/VEGF cells, consistent with the activity of Nur77 being downstream that of VEGF-A. The quantitative measurements of vascular plasma volumes presented in Fig. 7B therefore confirm the qualitative measures of angiogenesis presented in Fig. 7A.

Inhibition of tumor growth in Nur77-null mice To determine whether TR3/Nur77 is required for tumor-induced angiogenesis, we studied the growth of B16F1 melanoma in Nur77^"A mice. Tumor cells (5 x 10⁵) were injected sc in wild type and Nur77^v" mice and tumor growth was monitored daily. As shown in Fig. 8A and B-a, tumors grew to large size in wild type mice but growth in null mice was greatly inhibited (P<0.001). Inhibition of tumor growth in Nur77^"Λ mice was associated with reduced angiogenesis and particularly with a reduction in the generation of large "mother" vessels (Fig. 8B, b-e). B 16Fl melanoma cells are syngeneic in C57B16 mice and therefore do not generate a cellular immune response. Nonetheless, because TR3/Nur77 has been implicated in apoptosis of T lymphocytes (10), we made a careful search for inflammatory cells. Small numbers of macrophages were found infiltrating tumors in both wild type and Nur77^'A mice but lymphocytes were not found. Therefore, it is unlikely that the inhibition of tumor growth in Nur77^'Λ mice is attributable to a T-lymphocyte defect.

Mechanisms by which Nur77 induces angiogenesis in vivo Nur77 acts independently of VEGFR-2/KDR The data presented above provided evidence that the angiogenic response induced by Nur77 developed earlier than that induced by VEGF-A¹⁶⁵, suggesting that Nur77 functioned downstream of VEGF-A¹⁶⁵. Nonetheless, it was possible that Nur77 acted in part by inducing VEGF-A expression. To test that possibility, we made use of SU1498, a VEGFR-2/KDR kinase inhibitor that is known to inhibit VEGF-A¹⁶⁵- induced angiogenesis (22). In Matrigel assays, SU1498 strongly inhibited the angiogenic response induced by SKMEL/VEGF cells (i.e., by VEGF-A¹⁶⁵) but had no inhibitory effect on the angiogenesis induced by PT67/Nur77 cells (Fig. 9 A₅B). Thus, the angiogenesis induced by Nur77 was not mediated through VEGFR-2/KDR and therefore not through VEGF-A.

Importance ofNur77's transcriptional activity for inducing angiogenesis

TR3/Nur77 is known to be a transcription factor, but at least some of its activities, such as those involving neuronal differentiation and T-cell apoptosis, occur independently of its transcriptional activity (11). To elucidate the mechanisms by which Nur77 mediates angiogenesis, we tested our Nur77 deletion mutants (Fig. 2A) in Matrigel assays in vivo. Angiogenesis did not develop in Matrigels that included only PT67 cells packaging Nur77-ΔTAD or Nur77-ΔDBD (Fig. 10). However, PT67 cells packaging Nur77-ΔLBD induced angiogenesis similar to that induced by

SKMEL/VEGF cells or by full length Nur77. Furthermore, inclusion of PT67 cells packaging Nur77-ΔTAD or Nur77-ΔDBD PT67 markedly inhibited the angiogenic response induced by SKMEL/VEGF cells, whereas Nur77-ΔLBD PT67 packaging cells had no inhibitory effect. These data indicate that both the transactivation and DNA binding domains are required for Nur77 -mediated angiogenesis but that the ligand binding domain is not necessary.

Requirement ofNur77for microvessel permeability

Vascular hyperpermeability to plasma proteins is a signature property of VEGF-A¹⁶⁴-induced angiogenesis. We found that TR3/Nur77 was required for VEGF-A ⁶⁵-induced angiogenesis in an in vivo Matrigel angiogenesis assay (16). We further determined whether Nur77 was required for VEGF-A¹⁶⁵-induced microvessel permeability in the same assay. SKMEL-2 tumor cells transfected to overexpress VEGF-A¹⁶⁵ (SKMELA^EGF)(15) and retrovirus-packaging cells (PT67) were incorporated into Matrigel and injected into the subcutaneous space of nude mice. At 12 hrs, 1 and 3 days after Matrigel injection, Evan's blue dye was injected in to the tail vein. After 30 minutes, dye accumulation in Matrigel represented the volume of plasma that had extravasated, assuming the dye in microvessl was cleaned out. As shown in Figure 1 IA, microvessel permeability was induced by Matrigel containing VEGF-A¹⁶⁵-expressing SKMELA⁷EGF cells, whether alone or combined with PT67/LacZ cells at day 3 (Lanes 2 and 3). However, permeability was greatly enhanced by inclusion of PT67/Nur77-sense cells (Lane 5). Notably, the permeability induced by TR3/Nur77 could be detected at 12 hours after Matrigel injection, a much earlier time point than that observed when using VEGF-A¹⁶⁵ induction. Microvessel permeability was inhibited by inclusion of PT67/Nur77- antisense cells (lane 6). The effect of Nur77 antisense DNA was not attributable to inhibition of VEGF-A¹⁶⁵ expression by SKMEL/VEGF cells (16). Of interest, PT67/Nur77-sense cells exhibited significant permeability even in the absence of SKMEL/VEGF cells, perhaps because Matrigel itself provoked sufficient proliferation of nearby endothelial cells to allow retroviral uptake. Localization of Nur77 to vascular endothelial cells in Matrigel and adjacent skin was confirmed by in situ hybridization (16). Taken together, these data provide strong qualitative evidence that Nur77 is required for VEGF-A^l65-induced microvessel permeability in vivo and can by itself induce microvessel permeability.

We next developed an assay to quantitate the permeability induced by TR3/Nur77 and to evaluate the permeability status of the newly formed vessels. Half hour after Evan's blue dye i.v. injection, dye accumulated in Matrigel was extracted. As shown in Figure 1 IB dye levels in and around gels that included SKMEL/VEGF cells (alone or with PT67/LacZ cells) were slightly and significantly increased above those that contained only PT67/LacZ cells at day 1 (Lanes 3 and 5 vs. lane 1) and day 3 (Lane 4 and lane 6 vs. lane 2, p<0.001), respectively. Dye levels were further augmented (p values 0.05 - 0.001) when PT67/Nur77-sense cells were incorporated with or without SKMEL/VEGF cells (Lanes 7 and 9 vs. Lane 3 and lane 5), and were reduced to background levels by inclusion of PT67/Nur77-antisense cells (Lane 12 vs. lane 2). Consistent with our finding that Nur77 expression lies downstream of VEGF- A¹⁶⁵ signaling, the effects of Nur77 sense or antisense DNA expression were evident as early as 12 h after Matrigel implantation, well before VEGF-A ¹⁶⁴-induced hyperpermeability becomes detectable. These experiments provide a quantitative measure of vascular plasma volume in microvessel permeability and confirm qualitative data concerning the importance of Nur77 expression in VEGF-A ⁶⁵ - induced microvessel permeability. Next, the molecular mechanism underlying TR3/Nur77 -regulated VEGF-

A¹⁶⁵-microvessel permeability was investigated. The data described above indicate that TR3/Nur77-induced microvessel permeability was much earlier than that induced by VEGF-A¹⁶⁵ indicating that TR3/Nur77 functioned downstream of VEGF-A¹⁶⁵. We first confirmed that TR3/Nur77 directly induced microvessel permeability, not by induced VEGF, with KDR kinase inhibitor (SU1498, 1 mg/kg) included in matrigel and i.p. every day after matrigel injection. As shown in Fig. 12A, SU1498 strongly inhibited microvessel permeability induced by VEGF-A¹⁶⁵ (Fig. 12A, lane 1) but had no inhibitory effect on angiΔogenesis induced by PT67/Nur77 cells (Fig. 12 A, lane 2). These data demonstrate that Nur77 functions independent of VEGFR-2/KDR. Figure 12B shows quantitative measurement of the results obtained from the assay in Figure 12 A.

TR3/Nur77 is known to be a transcription factor but some of its activities occur independent of transcription (11). To elucidate the mechanisms by which Nur77 mediated microvessel permeability, we constructed three Nur77 mutants, Nur77- ΔTAD, Nur77-ΔDBD and Nur77-ΔLBD, in which, the transactivation domain (TAD), DNA binding domain (DBD) and ligand binding domain (LBD) were deleted, respectively (16). Matrigel permeability assay showed that, in the absence of SKMEL/VEGF, Nur77-ΔTAD and Nur77-ΔDBD could not induced microvessel permeability (Fig. 13, lanes 3 and 4, top panels). Microvessel permeability induced by Nur77-ΔLBD is similar to that by full length Nur77 (Fig. 13, lane 5 vs. lane 2, top panels). These data indicate that both transactivation domain and DNA binding domain are required for Nur77 mediated microvessel permeability. Furthermore, the VEGF-A ^I65-induced microvessel permeability was completely inhibited by Nur77- ΔTAD and Nur77-ΔDBD, not by Nur77-ΔLBD (Fig. 13, Lanes 3, 4, and 5, bottom panels), suggesting that the transcriptional activity of TR3/Nur77 is critical for its function in angiogenesis.

Next, we assessed whether other vascular permeable factors, such as histamine, platelet activation factor (PAF) and serotonin, could induce TR3 expression in HUVEC. As shown in Figure 14, TR3 mRNA and proteins were highly upregulated by all of these three vascular permeable factors (Fig. 14 A and B).

To further test whether TR3/Nur77 mediated microvessel permeability is modulated via exposure to different permeability factors, we carried out Miles assays in Nur77-/- mice. As shown in Figure 15A, B, C and D, VEGF-A¹⁶⁵, histamine, serotonin and PAF induced skin microvessel permeability in a dose response in wild type C57 mice (Fig. 15 A, B, C and D, top panels). The microvessel permeability induced by VEGF-A^{1 5}, histamine, serotonin and PAF was completely inhibited in Nur77^"A mice (Fig. 15 A, B, C and D, bottom panels). Recently, we reported that B 16 melanoma growth was greatly inhibited in Nur77^"A mice (16). Therefore, we examined whether TR3/Nur77 had any effect on tumor edema. As shown in Fig. 15E, tumor edema induced by Bl 6 melanoma was almost completely inhibited in Nur77^{" "} mice (Fig. 15E). Thus, our data strongly demonstrate that TR3/Nur77 is a key molecular modulator of microvessel permeability.

DISCUSSION

TR3 and its mouse (Nur77) and rat (NGFI-B) homologues play important roles in tumor, lymphocyte and neural growth and survival (10, 23-25). TR3/Nur77/NGFI-B is differentially expressed in brain and in many other tissues during development and is constitutively expressed at low levels in a number of adult tissues (26-30). It is highly induced as an immediate early response gene in the adult nervous system by growth factors, membrane depolarization, seizures, and by a variety of drugs and other stimuli (30-36). TR3 and/or its mouse or rat homologues is also induced in antigen-induced glomerulonephritis, in the regenerating liver, and by diverse stimuli in a variety of cultured cells (37, 38). Recently it has been implicated in the pathogenesis of hepatocellular carcinoma induced by hepatitis B virus X protein (39) and was found to be one of nine genes whose downregulation in solid tumors correlated with reduced metastasis (40). In addition to regulating cell growth and differentiation, TR3/Nur77/NGFI-B has also been implicated in apoptosis in several types of cells including T lymphocytes, the adult retina, vascular smooth muscle cells, and several carcinoma cell lines (10, 23-25). TR3 has also been described as a death receptor in Alzeimer's disease where it is expressed at high levels in neurons undergoing degeneration (41-44). Despite these important functions, Nur77 null mice lack a developmental phenotype, perhaps reflecting compensation by closely related family members such as NORl and NOT (18).

The data presented here extend the role of TR3-Nur77 to a new field, that of VEGF-A-induced pathological angiogenesis. Two isoforms of VEGF-A, but not several other growth factors, induced TR3 expression in cultured vascular endothelial cells (Fig. 1). HUVEC in which TR3 was overexpressed incorporated increased amounts of ³H thymidine, were protected from apoptosis, and induced several cell cycle genes, all responses that are induced by VEGF-A in control HUVEC (Figs. 3, 4). On the other hand, overexpression of antisense TR3 prevented HUVEC from responding to VEGF-A in these same assays and greatly diminished HUVEC tube formation on Matrigel. These in vitro findings were extended in vivo to demonstrate thatNur77 was upregulated in several examples of VEGF- A-mediated angiogenesis, including those induced by Ad-VEGF-A¹⁶⁴, wound healing, and the growth of two VEGF- A-expressing tumors, MOT and TA3/St (Fig. 5). Further, making use of a recently modified Matrigel assay for expressing genes in endothelial cells in vivo, we demonstrated that introduction of Nur77-S DNA induced a typical angiogenic response that was qualitatively and quantitatively equivalent to that induced by VEGF- A-expressing cells (Fig. 7). On the other hand, overexpression of Nur77-AS abrogated the angiogenic response expected from VEGF-A in this assay. The possibility that Nur77 was acting through VEGF-A was excluded by experiments demonstrating that a VEGF-A receptor inhibitor, SU1498, blocked the angiogenic response induced by VEGF-A but not that induced by Nur77 (Fig. 9). These findings, along with the finding that the angiogenic response induced by Nur77 developed earlier than that induced by VEGF-A, indicate that Nur77 acts independently and downstream of VEGF-A. Finally, tumor growth and associated angiogenesis and mother vessel formation were significantly reduced in Nur77 null mice (Fig. 8). Taken together, these data indicate that TR3-Nur77 is necessary and sufficient for VEGF-A-induced angiogenesis, both in vitro and in vivo. TR3/Nur77/NGFI-B is an orphan member of the steroid/thyroid/retinoid superfamily whose members act mainly as transcription factors that induce or repress gene expression (18). However, several groups (11, 45, 46) have recently shown that TR3's ability to induce apoptosis in tumor cells is independent of transcription and occurs when TR3 transmigrates from the nucleus to the cytoplasm. Like other members of its superfamily, TR3/Nur77 has three major domains that regulate different functions (Fig. 2). These include N-terminal transactivation and DNA binding domains that are essential for regulating gene transcription as well as a C- terminal ligand binding domain. Following the lead of Kolluri et al (11), we prepared mutant forms of TR3/Nur77 that deleted each of these domains and transfected each of them into HUVEC. The different mutant forms exerted different effects on

HUVEC in different in vitro assays (Figs. 3, 4). HUVEC transduced to express Nur77 mutants lacking the TAD or DBD domains incorporated ³H thymidine at normal baseline levels but could not be stimulated to increased incorporation by VEGF-A¹⁶⁵. However, TR3-ΔLBD mutants incorporated ³H-thymidine in similar amounts as full length TR3, both without and with added VEGF-A¹⁶⁵.

Overexpression of TR3-S was able to rescue HUVEC from apoptosis as effectively as VEGF-A¹⁶⁵. However, TR3 mutants lacking any of the three domains were not able to do so (Fig. 3B). These data therefore differ from those of Kolluri et al (11) who found that the TAD and DBD domains were not required for inducing apoptosis in tumor cells. TR3-ΔLBD-HUVEC developed fairly good tube formation on Matrigel whereas TR3-ΔTAD-transfected HUVEC showed reduced tube formation and TR3-ΔDBD transfected HUVEC were unable to form tubes, i.e., exhibited a stronger inhibitory response than that of HUVEC transfected with Nur77-AS (Fig. 3C). Finally, mutant HUVEC lacking the TAD or DBD domains expressed undetectable amounts of cell cycle genes under baseline conditions and these genes were only minimally induced by addition of VEGF-A¹⁶⁵ (Fig. 4). However, ΔLBD mutants behaved much as LacZ-transfectants, expressing low levels of cell cycle genes under baseline conditions and greatly increased amounts upon stimulation with VEGF-A¹⁶⁵. These data indicate that the transactivation and DNA binding domains of TR3 are required for TR3-mediated HUVEC proliferation, expression of cell cycle genes, and tube formation, functions that are therefore likely attributable to TR3's transcriptional activity. This finding is not unexpected in the case of the ΔDBD mutant that was localized to HUVEC cytoplasm and therefore not in position to perform transcriptional activity (Fig. 2D). In agreement with these in vitro data, introduction of PT67 cells packaging Nur77 mutants lacking the TAD or DBD domains were unable to induce an angiogenic response in the Matrigel assay, either alone or together with SKMEL/VEGF cells. However, PTK67 cells packaging Nur77-ΔLBD, like those packaging Nur77-S, did induce angiogenesis in this assay, even in the absence of SKMEL/VEGF cells. These data indicate that the transactivation domain and the DNA binding domain, but not the LBD binding domain, are needed for angiogenesis in vivo and are in agreement with a recent report indicating that the DNA binding and transactivation domains of TR3/Nur77 are required for induction of cell proliferation in lung cancer cells (45). EXAMPLE 2 USE OF NUR77 TRANSGENIC MICE

The data described in Example 1 demonstrated that overexpression of TR3/Nur77 was sufficient by itself to induce angiogenesis and also that TR3/Nur77 had an essential role in VEGF- A-induced angiogenesis. In contrast to apoptosis, the DNA binding domain of TR3/Nur77 is required for the induction of cell proliferation in vitro and in the Matrigel angiogenesis assay in vivo. We will test whether any of these functional domains can by itself induce angiogenesis by engineering mutants that contain only one of the three domains (TR3 -TAD, TR3 -DBD, TR3 -LBD or corresponding Nur77 mutants) (Figure 2A). Because TR3-ΔDBD localizes in the cytosol, unlike the full length TR3 which localizes in nuclei, we will also generate a mutant TR3-ΔDBD-NLS that fuses the nuclear localization signal (NLS) with the TR3-ΔBD. Therefore, we can test whether the loss of function of TR3-ΔDBD is due to aberrant cellular localization. Next, we will test whether the transcriptional activity of TR3/Nur77 is required for its function in in vitro and in vivo assays. Currently available information suggests that the transcriptional activity of TR3/Nur77 is mainly dependent on its expression level. However, the transcriptional activity of Nur77 is also controlled in part by phosphorylation (47, 48). Ser-350, which is located within the DNA-binding domain of Nur77, has been shown to be phosphorylated by Akt and both DNA binding and transcriptional activity were greatly inhibited after phosphorylation (47, 48). To test whether phosphorylation of Nur77 S350 inhibits its function in angiogenesis, we will perform two assays: 1) Co-transduce HUVEC withNur77 cDNA and constitutively active Akt. Constitutively active AKT has been obtained from Dr. Alex Toker. Constitutively active AKT will phosphorylate Nur77 and inactivate Nur77 transcription activity; and 2) create the S350D mutant of Nur77. This D350 mutant should mimic the phosphorylation of Ser350 and have no transcription activity. If no angiogenesis is detected, we will assume that the transcriptional activity of Nur77 is required for its role in angiogenesis. To confirm this conclusion, we will generate a dominant negative mutant of Nur77,

Nur77(S350A) as this mutant cannot be phosphorylated by constitutively active Akt. The other important regions are the Ser-105 residue of NGFI-B (142 in TR3 and Nur77) and the threonine 142 residue in NGFI-B (145 in TR3 and Nur77). NGFI-B (SerlO5) regulates NGFI-B 's activity on neuron cell differentiation (49) and Thrl42 of NGFI-B is phosphorylated by growth factor signaling (50). Residues of Nur77 142 and 145 will be mutated to Ala or Asp (GIu for Thr) to create the dominant negative and constitutively active forms.

Mutation Leu487 of Nur77 partially abolished interaction between Nur77 and Bcl2 and inhibited Nur77 mediated apoptosis (11). We will therefore also generate Nur77(L487A) and TR3(L487A) mutants. TR3/Nur77 is constitutively expressed in brain and neuroendocrine tissues

(26-30). It was found to be an inducible immediate early response gene in the nervous system and is also expressed in a variety of other tissues under the control of differentiation and apoptotic factors (51 , 52). As described above, we have found that TR3/Nur77 is also highly upregulated in the vasculature in response to VEGF-A in vitro and in several examples of pathological angiogenesis in vivo (16). Inhibition of TR3/Nur77 expression by its antisense DNA completely inhibited VEGF-induced HUVEC proliferation, cell survival and tube formation in vitro and Matrigel angiogenesis in vivo (16). Therefore, it is now important to use Nur77 knockout mice to investigate the requirement of Nur77 in different examples of pathological angiogenesis, including tumor growth, skin wound healing, and adenovirus VEGF- A164-induced angiogenesis. Angiogenesis induced by bFGF, which does not upregulate Nur77, will serve as a positive control. We will also look at the vessels of Nur77 null mice for ultrastructural abnormalities by EM.

These experiments will determine whether Nur77 is required for tumor growth. Nur77^'A mice were kindly provided by Dr. Jeffrey Milbrandt (Washington University School of Medicine, St. Louis, MO63110). B16F1 murine melanoma cells, murine Lewis Lung carcinoma (LLC) cells, and MMT060562 murine mammary tumor cells (American Type Cell Culture), all of which are syngeneic in C57 mice, are injected (IxIO⁵ cells in 100 ml) into the flank skin of 6- to 8-week-old wild type (C57) and Nur77^"A mice. Tumor size will be measured daily and animals will be sacrificed when tumors have reached a size of- 1500 mm3. If tumors fail to grow to such a size in null mice, they will be arbitrarily sacrificed 2 weeks after the control animals are sacrificed. Tissues will be prepared for immunohistochemical staining with endothelial cell-specific CD31 antibody and for 1 μm Giemsa-stained Epon sections. We will employ light microscopy and morphometries to characterize the intensity of the angiogenic response and the presence of edema and characterize the various types of new blood vessels (e.g., mother vessels, daughter vessels, muscular arteries and veins, glomeruloid bodies).

Skin wound healing in Nur77^"Λ mice will also be assessed. Prior results indicate that VEGF-A was upregulated within 1 day of skin wounding in rats and remained above normal levels for 4-7 days (21). In our recent mouse wound healing studies, Nur77 expression peaked on day 4 after wounding (16). The experiments proposed here will determine whether Nur77 is required for skin wound healing. We will perform punch biopsies on the shaved flanks of wild type C57 and Nur77^"Λmice (16). Mice will be photographed at day 0, 2, 3, 5, 7, 9, 11 and 13 after wound. Photos will be digitally processed and wound areas calculated using the IPlab software. For each sample the rate of the healing process will be measured as a ratio of the area at each time-point divided by the area at time 0 (i.e., immediately after wounding). Tissues will also be collected at suitable intervals for preparation of 1 μm Giemsa- stained Epon sections to evaluate the histology of wound healing and particularly to characterize the types and numbers of new blood vessels that form.

Nur77^"Λ mice will also be generated on a nude background. Adenoviral vectors expressing angiogenic cytokines are a powerful way to study the steps and mechanisms of angiogenesis. However, these vectors provoke a strong immunological response and therefore must be studied in immuno-incompetent nude or SCID mice. For the same reasons, studies of human tumors must also be performed in immuno- incompetent mice. Therefore, for the following experiments, we will breed Nur77^"A onto the athymic (nude) background. Athymic (nude) mice on a C57 background were purchased from Taconic Farms. Nur77^*Λ mice (currently inbred on a C57 background) are crossed with these Nu/Nu mice. We have now obtained the first generation of heterozygous mice (Nur77^+/\ Nu^+Λ). These Fl mice will be crossed with each other to generate the Nur77^"'^' nude mice (one in 16 F2 offspring are expected to have the desired phenotype). The Nur77^"Λ nude mice so generated will also be used for the experiments described below.

As discussed above, human tumor cells will be grown in Nur77^{" "} nude mice. C57 nude mice have been commonly used to study human tumors (53). Initially, we will study human HT1080 fibrosarcoma cells, U87 human glioma cells, Bx-PC-3 human pancreas cancer cell, HCT-116 human colon cancer cells, MD A-MB-231 highly metastatic and MCF7 non-metastatic human breast cancer cells. Tumor cells (1x10⁵ cells in 100 μl) will be injected into the flank skin of 6- to 8-week-old Nur77- /- nude mice and into C57 nude mice as controls. Tumor size will be measured daily and animals will be sacrificed when tumors in control animals reach a size of ~1500mm³. If tumors do reach this size in knockout mice, animals will be sacrificed 2 weeks after the control animals are sacrificed. Tissues will be prepared for immunohistchemical staining with vessel specific CD31 antibody and for 1 μm Giemsa-stained Epon sections to examine the tumor and vascular structures.

Ad-VEGF-A^{1 4}-induced angiogenesis in Nur77^"/" nude mice will also be assessed. The angiogenesis induced by VEGF-A ^I64-expressing adenoviruses in nude mice has been well characterized (7, 54). VEGF-A¹⁶⁴ expression begins within hours of vector injection into tissues. Characteristic mother vessels form initially and these evolve into various types of daughter vessels including glomeruloid bodies, capillaries and vascular malformations. In addition, Ad-VEGF-A¹⁶⁴ induces the expression of enlarged and poorly functional lymphatics (7). To determine the effects of Nur77 on the entire VEGF-A¹⁶⁴ angiogenic response, we will inject Ad-VEGF-A¹⁶⁴ into the ears or peritoneal cavities of Nur77^'A nude mice and control C57 nude mice and evaluate the response at times optimal for the appearance of each of the various types of vessels that are induced by VEGF-A¹⁶⁴ (7, 54). These times are as follows: 3 and 5 days for mother vessels; 7, 10 and 14 days for glomeruloid bodies; 28 and 36 days for both vascular malformations and lymphatics. Angiogenesis will be evaluated as previously described by macroscopy of ears and by tissue harvest for immunohistochemistry and histology in lμm Epon sections. bFGF, PlGF and PDGF are also potent angiogenic factors but none of these were able to induce TR3/Nur77 expression (16). For comparison, therefore, we will also test whether there is any defect in the angiogenic response induced by adenoviruses expressing bFGF, PlGF or PDGF in NurlT^1' nude mice. Angiogenesis will be examined and tissues will be collected for analysis as above.

In all of the in vivo experiments, tissues from 3-5 animals will be collected and studied individually for each set of conditions at each time point. The data in Example 1 strongly implicates TR3/Nur77 in pathological angiogenesis. Inhibition of TR3/Nur77 expression inhibits pathological angiogenesis and we hypothesize that this is the mechanism that accounts for inhibition of tumor growth. However, in some situations, such as wound healing and tissue ischemia (e.g., myocardial infarction), pathological angiogenesis plays a positive role, and failure of angiogenesis impairs healing. Also, overexpression of VEGF by adenoviruses has been reported to accelerate wound closing (55). Our current study demonstrated that overexpression of TR3 cDNA induced HUVEC proliferation and cell survival in the absence of VEGF-A. Overexpression of Nur77 sense DNA also induced angiogenesis in the in vivo Matrigel angiogenesis assay independent of VEGF. Our data suggest that overexpression of TR3/Nur77 in endothelial cells induces angiogenesis, which, in turn, might be expected to accelerate wound healing and relieve ischemia. Therefore, we have created transgenic mice that express Nur77 inducibly and selectively in vascular endothelium. These transgenic mice can also be used to investigate the mechanisms of Nur77 in pathological angiogenesis in vivo and also to refine techniques for enhancing angiogenesis in certain clinical situations.

Transgenic mice that express Nur77 inducibly in an endothelial cell-specific fashion will be studied. The advantage of transgenic mice which inducibly express the transgene is the ability to turn gene expression "on and off by treatment with tetracycline for example (56). As described in Benjamin et al., the VE-Cadherin promoter drives expression of the transgene in the developing vasculature as early as embryonic stage 7.5, and thereafter throughout embryonic development as well as in adults (57). We will use the following procedure: a. TET-Nur77-S mice were created. The copy number of this transgene will be determined by quantitative real-time PCR and Southern blot analysis, which are presently underway. b. Transgenic mice with a tetracycline-regulated transactivator (tTA) expression under the control of an endothelium-specific promoter, VE-Cad, were obtained from Dr. Laura Benjamin (56). c. VE-Cadherin-tTA transgenic mice will be crossed with TET-Nur77-S transgenic male mice. This breeding scheme will provide litters containing both embryos of interest (double transgenics) and controls (single transgenics or wild- type). Animals will be treated with standard amounts (2 mg/ml drinking water, 2 mg/g food) of Doxycycline to inhibit transgene expression. Expression of Nur77 in a tetracycline-inducible manner will be checked by immunohistochemistry using a Nur77 antibody and in situ hybridization. To do this, tetracycline will be withdrawn from the drinking water. It will take two days to clear tetracycline. Tissues will be fixed for tissue processing.

Effects of Nur77 expression on micro vessel development will also be assessed. Although Nur77 is not expressed until embryonic stage 16.5 during normal development (28), ongoing studies indicate that this gene is an important regulator of angiogenesis and microvessel permeability. Thus, we wish to test the effects of ectopic expression of this gene during normal vascular development. To test the effects of ectopic expression of Nur77 during embryonic development, pregnant females will be fed a Doxycycline-free diet to induce expression of the transgene in double transgenic embryos at various stage during development. Mice drinking tetracycline-containing water will be used as a control. Embryos will be dissected at several time points during pregnancy and processed for whole-mount immunohistochemistry using antibodies directed against endothelial markers (CD31 or VEGFR2) in order to detect potential vascular defects. Preferred time-points for initial analysis will be embryonic stages E8.5 and E9.5. At E8.5, only a primitive vascular network has formed in the yolk sac, defects at this stage will determine whether ectopic expression of Nur77 interferes with the establishment of this primitive network, or vasculogenesis (see for review (58)). At E9.5, vasculature in the yolk sac has already gone through extensive remodeling, a process that involves physiological angiogenesis. Defects at this later stage would demonstrate further the involvement of Nur77 in angiogenic processes.

We will also test the effects of Nur77 overexpression in vascular development in newborn mice. Doxycycline will be removed from the diet 3-4 days before parturition to allow complete clearance of the drug at the time of birth (59). Mice drinking tetracycline-containing water will be used as a control. Complete autopsies will be performed and tissues will be prepared for immunohistochemical staining with endothelial cell-specific CD31 antibody and for 1 μm Giemsa-stained Epon sections to examine the vascular structures. Prior results indicate that Nur77 expression peaked on day 4 in healing mouse skin wounds (16). Because Nur77 increased angiogenesis in our Matrigel assay, we will test whether skin wound healing is accelerated in Nur77 transgenic mice. To test this hypothesis, we will perform punch biopsies on the shaved flanks of transgenic mice in the presence or absence of tetracycline in the drinking water (16). Wounds will be monitored and analyzed as described in Experiment 2 of Aim 1. Tissue will be collected at intervals of 1 to 10 days and prepared for 1 μm Giemsa-stained Epon sections to examine the vascular structure.

Tumor growth in Nur77 transgenic mice can also be studied. These experiments will determine whether Nur77 overexpression in vascular endothelium affects tumor growth. B 16Fl murine melanoma cells, murine Lewis Lung carcinoma (LLC) cells and MMT060562 murine mammary tumor cells, all of which are syngeneic in C57 mice (American Type Cell Culture), will be injected (IxIO⁵ cells in 100 μl) into the flank skin of 6- to 8-week-old transgenic mice in the presence or absence of tetracycline. Tumor size will be measured daily and animals will be sacrificed when tumors reach a size of ~ 1500 mm . Tissues will be prepared for immunohistochemical staining with vessel specific CD31 antibody and for 1 μm Giemsa-stained Epon sections to examine the tumor and vascular structure.

In all of the in vivo experiments, tissues from 3-5 animals will be collected and studied individually for each set of conditions at each time point.

Tetracycline will be removed from the drinking water of adult mice two days before experimentation to allow Nur77 expression. Nur77 mice that continue to receive tetracycline in their drinking water will serve as controls (5 mice per group). Hair will be shaved one day before the experiment. Mice will be anesthetized with Avertin (tribromoethanol, 200 mg/kg) and injected i.v. via the tail vein with 0.2 ml of Evan's blue dye (5 mg/ml in saline). 30 min later a complete autopsy will be performed, examining skin, mesenteries and internal organs for increased bluing. Tissues will be dissected and photographed to evaluate the extent of bluing and Evan's blue dye will be extracted with formamide for quantitative measurements of dye extravasation into tissues. We will also determine whether extravasation is further increased by intradermal injections of VEGF-A165, histamine, serotonin, and PAF. EXAMPLE 3

Histamine Induces Angiogenesis through TR3/Nur77

Histamine is one the most important biogenic amines in medicine and biology. It stimulates smooth muscle contraction and increases vascular permeability, both of which are mediated through histamine Hl receptor. It also stimulates gastric acid secretion through H2 receptor. These functions of histamine are targets for treatment of allergic diseases, such as allergic rhinitis, allergic conjunctivitis, urticaria, and bronchial asthma (60, 61).

Most recently, it was found that angiogenesis of the granulation tissue was decreased in histidine decarboxylase (HDC) knockout mice, one of the enzymes involved in histamine synthesis and histamine can rescue angiogenesis in these knockout mice (62). However, in these knockout mice, VEGF expression is also down regulated, thereby confounding interpretation of this data. While histamine rescued VEGF expression in granulation tissue and rescued angiogenesis, it is still not clear whether histamine induced angiogenesis directly. The data presented herein reveal that histamine directly induces mouse skin angiogenesis when it is released slowly and consistently in vivo. Alterations in vascular structure induced by administration to histamine were comparable to those observed in response to treatment with adenovirus expressing vascular growth factor (VEGF). Further studies indicated that histamine induced angiogenesis is mediated by the H2 receptor, rather than via upregulation of VEGF expression. Histamine also regulated HUVEC proliferation through its H2 receptor. Orphan nuclear receptor TR3 (mouse homolog Nur77), which was identified most recently to play critical role in VEGF-induced angiogenesis in our lab, was highly upregulated by histamine in cultured endothelial cells and in histamine-induced angiogenesis in vivo. Histamine-induced TR3 expression was regulated through its receptor 2 (H2). Overexpression of TR3 antisense DNA in endothelial cells completely inhibited histamine-induced EC proliferation and cell cycle genes expression. Furthermore, histamine-induced angiogenesis was completely inhibited in Nur77 knockout mice. These results indicated that histamine is an angiogenic factor which regulates angiogenesis through orphan nuclear receptor TR3/Nur77. Materials and Methods for the practice of Example III

Antibodies against TR3/Nur77 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Pellets that release histamine or control pellets were the product of Innovative Research of America. Histamine and inhibitors for KDR, histamine receptor Hl, H2 and H4 were purchased from Sigma (St. Louis, MO).

Cell culture and assays:

Human umbilical vein endothelial cells (HUVEC, Clonetics, Biowhittaker, Inc. Walkersville, MD) were cultured and transduced with retroviruses carrying various constructs as previously described in Examples I and II. For assay with inhibitors, Mepyramine for Hl (10 μM), Zolantidine (10 μM) for H2 and JNJ777120 (10 μM) for H4 receptors (products of Sigma, St. Louis, MO) will be added to cells 10 min. before 10 μM histamine stimulation.

Histamine induced angiogenesis:

Female, 4-5 week Nu/Nu mice (NIH) were implanted s.c. with pellets that release histamine or control on flank skin. At different time as indicated, tissues were dissected and photographed or were homogenized in T-PER tissue protein extraction reagent (Pierce Biotechnology, Inc. Rockford, IL 61105). Equal amounts of protein were subjected to immunoblot analysis using the TR3/Nur77 antibody. For some experiments with inhibitors, inhibitors (10 mg/kg Mepyramine for Hl, Zolantidine for H2 and JNJ777120 for H4 receptors) were injected in the place where pellets were implanted and injected i.p. daily for 10 days. Nur77^{" "} mice were kindly provided by Dr. Jeffrey Milbrandt (Washington University School of Medicine, St. Louis, MO). Tissues were prepared for 1 μm Giemsa-stained Epon sections as previously described (7). Experiments were carried out in 8 mice per group.

Histamine induces angiogenesis and different kinds of vascular structure In order to study whether histamine can directly induced angiogenesis, we used the unique engineering of the Pellet system development by Innovative Research of America, which effectively and continuously releases histamine in animals. The matrix of the pellet is biodegradable. Pellets with total release of 0.001 mM, 0.01 mM and 0.25mM in 21 days, respectively were planted s.c. on the flank skin of Nu/Nu mice. After 5 days, animals were sacrificed and tissues were photographed. Angiogenesis is induced dose dependently (Data not shown). Therefore, we choose the pellets with total release of 0.01 mM for further experiment. Figure 16 A shows that histamine induced angiogenesis is time dependent.

Application of adenovirus VEGF to skin induced string angiogenesis and several types of vascular structures were found. Therefore, we examined the vascular structure that was induced by histamine. We found that histamine induced comparable structural changes in skin. See Fig. 16B.

Histamine-induced angiogenesis is through the H2 receptor, not through its regulation of VEGF production

In granulation tissue, histamine induction of angiogenesis was demonstrated through upregulation of VEGF expression (62). Therefore, we tested whether VEGF played a role in histamine-induced angiogenesis in skin. We made use of SUl 498, a VEGFR-2/KDR kinase inhibitor that is known to inhibit VEGF-A¹⁶⁵-induced angiogenesis (22) (63). In contrast to its effect on VEGF-induced angiogenesis, SU 1498 had no effect on histamine-induced angiogenesis (Fig. 17A). Furthermore, VEGF protein is not upregulated in histamine stimulated HUVEC, nor in protein extracts from histamine pellet treated tissues (Data not shown).

There are several histamine receptors that play different roles in histamine- induced smooth muscles contraction, increases vascular permeability and gastric acid secretion. Therefore, we wished to identify and characterize the histamine receptor(s) which mediate histamine-induced angiogenesis. As shown in Figure 17B, histamine- induced angiogenesis was inhibited by Zolantidine (an inhibitor of histamine receptor 2, H2), not mepyramine (an inhibitor of histamine receptor 1, Hl), nor JNJ777120 ( an inhibitor of histamine receptor 4, H4) (Fig. 17B). We further confirmed that H2 inhibitor, not Hl inhibitor, nor H4 inhibitor, nor KDR inhibitor, inhibited histamine- induced human umbilical vein endothelial cells (HUVEC) proliferation (Fig. 17C). Histamine did not induce VEGF expression in HUVEC, either (Data not shown).

Requirement of TR3/Nur77 for histamine-induced angiogenesis

As described in the previous examples, 1) orphan nuclear receptor TR3 (mouse homologue Nur77) was required for VEGF-A¹⁶⁵-induced angiogenesis; 2) Nur77 was required for microvessel hyperpermeability induced by both VEGF-A¹⁶⁵ and histamine; and 3) TR3 is upregulated in histamine-stimulated HUVEC. Therefore, we tested whether TR3/Nur77 was involved in histamine-induced angiogenesis. As shown in Fig. 18, Nur77 is also upregulated in mouse tissue treated with histamine pellets (Fig. 18A). Overexpression of TR3 antisense DNA completely inhibited histamine-stimulated HUVEC proliferation (Fig. 18B). Finally, histamine-induced angiogenesis was completely inhibited inNur77-/- mice (Fig.18C).

Conclusion Taken together, we have shown that TR3/Nur77 has an essential downstream role in VEGF-A and histamine signaling in endothelial cells and have begun to dissect the roles of its several domains in regulating different endothelial cell functions. As far as we know, TR3/Nur77 is the first transcription factor found to regulate VEGF- A-mediated angiogenesis and histamine-induced angigoenesis. As such, it could provide a useful target for positive and/or negative regulation of pathological angiogenesis.

REFERENCES FOR EXAMPLES

1. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med l995;l(l):27-31.

2. Risau W. Mechanisms of angiogenesis. Nature 1997;386(6626):671-4.

3. Dvorak HF, Nagy JA, Feng D, Brown LF, Dvorak AM. Vascular permeability factor/vascular endothelial growth factor and the significance of microvascular hyperpermeability in angiogenesis. Curr Top Microbiol Immunol 1999;237:97-132.

4. Ferrara N. Vascular endothelial growth factor: molecular and biological aspects. Curr Top Microbiol Immunol 1999;237:l-30.

5. Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature 2000;407(6801):249-57. 6. Zeng H, Dvorak HF, Mukhopadhyay D. Vascular permeability factor (VPF)/vascular endothelial growth factor (VEGF) peceptor-1 down-modulates VPF/VEGF receptor-2-mediated endothelial cell proliferation, but not migration, through phosphatidylinositol 3-kinase-dependent pathways. J Biol Chem 2001;276(29):26969-79. 7. Pettersson A, Nagy JA, Brown LF, et al. Heterogeneity of the angiogenic response induced in different normal adult tissues by vascular permeability factor/vascular endothelial growth factor. Lab Invest 2000;80(l):99-l 15. 8. Hazel TG, Nathans D, Lau LF. A gene inducible by serum growth factors encodes a member of the steroid and thyroid hormone receptor superfamily. Proc Natl Acad Sci U S A 1988;85(22):8444-8.

9. Li Y, Lin B, Agadir A, et al. Molecular determinants of AHPN (CD437)- induced growth arrest and apoptosis in human lung cancer cell lines. MoI Cell Biol 1998;18(8):4719-31.

10. Liu ZG, Smith SW, McLaughlin KA, Schwartz LM, Osborne BA. Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate- early gene nur77. Nature 1994;367(6460):281-4. 11. Lin B, Kolluri SK, Lin F, et al. Conversion of Bcl-2 from protector to killer by interaction with nuclear orphan receptor Nur77/TR3. Cell 2004;l 16(4):527-40. 12. Nagy JA, Masse EM, Herzberg KT, et al. Pathogenesis of ascites tumor growth: vascular permeability factor, vascular hyperpermeability, and ascites fluid accumulation. Cancer Res 1995;55(2):360-8. 13. Nagy JA, Meyers MS, Masse EM, Herzberg KT, Dvorak HF. Pathogenesis of ascites tumor growth: fibrinogen influx and fibrin accumulation in tissues lining the peritoneal cavity. Cancer Res 1995;55(2):369-75.

14. Nagy JA, Morgan ES, Herzberg KT, Manseau EJ, Dvorak AM, Dvorak HF. Pathogenesis of ascites tumor growth: angiogenesis, vascular remodeling, and stroma formation in the peritoneal lining. Cancer Res 1995;55(2):376-85.

15. Hoang MV, Whelan MC, Senger DR. Rho activity critically and selectively regulates endothelial cell organization during angiogenesis. Proc Natl Acad Sci U S A 2004; 101 (7): 1874-9.

16. Zeng H, Qin L, Zhao D, et al. Orphan Nuclear Receptor TR3/Nur77 regulates VEGF-A-induced angiogenesis through its transcriptional activity. J Exp Med 2006;(in Press).

17. Liu D, Jia H, Holmes DI, Stannard A, Zachary I. Vascular Endothelial Growth Factor-Regulated Gene Expression in Endothelial Cells: KDR-Mediated Induction of Egr3 and the Related Nuclear Receptors Nur77, Nurrl , and Norl . Arterioscler Thromb Vase Biol 2003;23(l l):2002-7.

18. Aranda A, Pascual A. Nuclear hormone receptors and gene expression. Physiol Rev 2001;81(3):1269-304.

19. Benjamin LE, Keshet E. Conditional switching of vascular endothelial growth factor (VEGF) expression in tumors: induction of endothelial cell shedding and regression of hemangioblastoma-like vessels by VEGF withdrawal. Proc Natl Acad Sci U S A 1997;94(16):8761-6.

20. Favot L, Keravis T, Lugnier C. Modulation of VEGF-induced endothelial cell cycle protein expression through cyclic AMP hydrolysis by PDE2 and PDE4. Thromb Haemost 2004;92(3):634-45. 21. Brown LF, Yeo KT, Berse B, et al. Expression of vascular permeability factor (vascular endothelial growth factor) by epidermal keratinocytes during wound healing. J Exp Med 1992;176(5):1375-9.

22. Shen BQ, Lee DY, Zioncheck TF. Vascular endothelial growth factor governs endothelial nitric-oxide synthase expression via a KDR/Flk-1 receptor and a protein kinase C signaling pathway. J Biol Chem 1999;274(46):33057-63.

23. Laabich A, Li G, Cooper NG. Characterization of apoptosis-genes associated with NMDA mediated cell death in the adult rat retina. Brain Res MoI Brain Res 2001;91(l-2):34-42. 24. Watanabe T, Yoshizumi M, Akishita M, et al. Induction of nuclear orphan receptor NGFI-B gene and apoptosis in rat vascular smooth muscle cells treated with pyrrolidinedithiocarbarnate. Arterioscler Thromb Vase Biol 2001;21(l l):1738-44.

25. Woronicz JD, Calnan B, Ngo V, Winoto A. Requirement for the orphan steroid receptor Nur77 in apoptosis of T- cell hybridomas. Nature

1994;367(6460):277-81.

26. Bandoh S, Tsukada T, Maruyama K, Ohkura N, Yamaguchi K. Differential expression of NGFI-B and RNR-I genes in various tissues and developing brain of the rat: comparative study by quantitative reverse transcription-polymerase chain reaction. J Neuroendocrinol 1997;9(l):3-8.

27. Lim RW, Yang WL, Yu H. Signal-transduction-pathway-specific desensitization of expression of orphan nuclear receptor TISl. Biochem J 1995;308(Pt 3):785-9.

28. Milbrandt J. Nerve growth factor induces a gene homologous to the glucocorticoid receptor gene. Neuron 1988; 1(3): 183-8.

29. Nakai A, Kartha S, Sakurai A, Toback FG, DeGroot LJ. A human early response gene homologous to murine nur77 and rat NGFI-B, and related to the nuclear receptor superfamily. MoI Endocrinol 1990;4(10): 1438-43.

30. Ryseck RP, Macdonald-Bravo H, Mattei MG, Ruppert S, Bravo R. Structure, mapping and expression of a growth factor inducible gene encoding a putative nuclear hormonal binding receptor. Embo J 1989;8(11):3327-35.

31. Abe M, Sato Y. cDNA microarray analysis of the gene expression profile of VEGF-activated human umbilical vein endothelial cells. Angiogenesis 2001;4(4):289- 98. 32. Hedvat CV, Irving SG. The isolation and characterization of MINOR, a novel mitogen-inducible nuclear orphan receptor. MoI Endocrinol 1995;9(12):1692-700.

33. Law SW, Conneely OM, DeMayo FJ, O'Malley BW. Identification of a new brain-specific transcription factor, NURRl. MoI Endocrinol 1992;6(12):2129-35.

34. Watson MA, Milbrandt J. Expression of the nerve growth factor-regulated NGFI-A and NGFI-B genes in the developing rat. Development 1990;l 10(l):173-83.

35. Williams GT, Lau LF. Activation of the inducible orphan receptor gene nur77 by serum growth factors: dissociation of immediate-early and delayed-early responses. MoI Cell Biol 1993;13(10):6124-36.

36. Zetterstrom RH, Solomin L, Mitsiadis T, Olson L, Perlmann T. Retinoid X receptor heterodimerization and developmental expression distinguish the orphan nuclear receptors NGFI-B, Nurrl, and Norl. MoI Endocrinol 1996;10(12):1656-66.

37. Hayashi K, Ohkura N, Miki K, Osada S, Tomino Y. Early induction of the NGFI-B/Nur77 family genes in nephritis induced by anti-glomerular basement membrane antibody. MoI Cell Endocrinol 1996;123(2):205-9. 38. Scearce LM, Laz TM, Hazel TG, Lau LF, Taub R. RNR- 1 , a nuclear receptor in the NGFI-B/Nur77 family that is rapidly induced in regenerating liver. J Biol Chem 1993;268(12):8855-61.

39. Lee MO, Kang HJ, Cho H, Shin EC, Park JH, Kim SJ. Hepatitis B virus x protein induced expression of the nur77 gene. Biochem Biophys Res Commun 2001;288(5):l 162-8.

40. Ramaswamy S, Ross KN, Lander ES, Golub TR. A molecular signature of metastasis in primary solid tumors. Nat Genet 2003;33(l):49-54.

41. Honkaniemi J, Zhang JS, Longo FM, Sharp FR. Stress induces zinc finger immediate early genes in the rat adrenal gland. Brain Res 2000;877(2):203-8. 42. Jang TH, Sun SH. Alterations in Ca2+ signaling, and c-fos and nur77 expression are associated with sodium butyrate-induced differentiation of C6 glioma cell. Chin J Physiol 2000;43(4): 149-58.

43. von der Kammer H, Demiralay C, Andresen B, Albrecht C, Mayhaus M, Nitsch RM. Regulation of gene expression by muscarinic acetylcholine receptors.

Biochem Soc Symp 2001;67:131-40.

44. Werme M, Olson L, Brene S. NGFI-B and norl mRNAs are upregulated in brain reward pathways by drugs of abuse: different effects in Fischer and Lewis rats. Brain Res MoI Brain Res 2000;76(l):18-24. 45. Kolluri SK, Bruey-Sedano N, Cao X, et al. Mitogenic effect of orphan receptor TR3 and its regulation by MEKKl in lung cancer cells. MoI Cell Biol 2003;23(23):8651-67.

46. Li H, Kolluri SK, Gu J, et al. Cytochrome c release and apoptosis induced by mitochondrial targeting of nuclear orphan receptor TR3. Science 2000;289(5482): 1159-64.

47. Hirata Y, Kiuchi K, Chen HC, Milbrandt J, Guroff G. The phosphorylation and DNA binding of the DNA-binding domain of the orphan nuclear receptor NGFI- B. J Biol Chem 1993;268(33):24808-12.

48. Katagiri Y, Hirata Y, Milbrandt J, Guroff G. Differential regulation of the transcriptional activity of the orphan nuclear receptor NGFI-B by membrane depolarization and nerve growth factor. J Biol Chem 1997;272(50):31278-84.

49. Katagiri Y, Takeda K, Yu ZX, Ferrans VJ, Ozato K, Guroff G. Modulation of retinoid signalling through NGF-induced nuclear export of NGFI-B. Nat Cell Biol 2000;2(7):435-40. 50. Slagsvold HH, Ostvold AC, Fallgren AB, Paulsen RE. Nuclear receptor and apoptosis initiator NGFI-B is a substrate for kinase ERK2. Biochem Biophys Res

Commun 2002;291(5):l 146-50.

51. Giguere V. Orphan nuclear receptors: from gene to function. Endocr Rev

1999;20(5):689-725. 52. Maruyama K, Tsukada T, Ohkura N, Bandoh S, Hosono T, Yamaguchi K. The

NGFI-B subfamily of the nuclear receptor superfamily (review). Int J Oncol

1998;12(6):1237-43.

53. Amoh Y, Yang M, Li L, et al. Nestin-linked green fluorescent protein transgenic nude mouse for imaging human tumor angiogenesis. Cancer Res 2005;65(12):5352-7.

54. Sundberg C, Nagy JA, Brown LF, et al. Glomeruloid microvascular proliferation follows adenoviral vascular permeability factor/vascular endothelial growth factor-164 gene delivery. Am J Pathol 2001 ;158(3): 1145-60.

55. Romano Di Peppe S, Mangoni A, Zambruno G, et al. Adeno virus-mediated VEGF(165) gene transfer enhances wound healing by promoting angiogenesis in CDl diabetic mice. Gene Ther 2002;9(19): 1271-7.

56. Sun JF, Phung T, Shiojima I, et al. Microvascular patterning is controlled by fine-tuning the Akt signal. Proc Natl Acad Sci U S A 2005; 102(1): 128-33.

57. Gory S, Vernet M, Laurent M, Dejana E, Dalmon J, Huber P. The vascular endothelial-cadherin promoter directs endothelial-specific expression in transgenic mice. Blood 1999;93(1): 184-92.

58. Patan S. Vasculogenesis and angiogenesis as mechanisms of vascular network formation, growth and remodeling. J Neurooncol 2000;50(l-2):l-15. 59. Ludwig A, Schlierf B, Schardt A, Nave KA, Wegner M. Sox 10-rtTA mouse line for tetracycline-inducible expression of transgenes in neural crest cells and oligodendrocytes. Genesis 2004;40(3): 171-5.

60. Beaven M. Histamine Its role in physiological and pathological process; 1978. 61. Brown NJ, Roberts LJ, II. Histamine, bradykinin, and their antagonists:

McGraw Hill, New York; 2001.

62. Ghosh AK, Hirasawa N, Ohtsu H, Watanabe T, Ohuchi K. Defective angiogenesis in the inflammatory granulation tissue in histidine decarboxylase- deficient mice but not in mast cell-deficient mice. J Exp Med 2002;195(8):973-82. 63. Zeng H, Qin L, Zhao D, et al. Orphan nuclear receptor TR3/Nur77 regulates VEGF-A-induced angiogenesis through its transcriptional activity. J Exp Med 2006;203(3):719-29.

While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

Claims

What is claimed is:

1. A method for identifying a test agent which modulates angiogenesis; comprising: a) providing a host cell having altered expression levels of

TR3/Nurr77; b) incubating said cells in the presence and absence of a test agent; and c) determing the effect of said agent on TR3 -mediated angiogenic processes.

2. The method of claim 1, wherein said angiogenic processes are selected from the group consisting of endothelial cell proliferation, endothelial cell survival, formation of mother vessels, induction of cell cycle genes, microvessel permeability, VEGF-A independent angiogenesis and tube formation.

3. The method of claim 1, whereins said TR3/Nur77 level is increased.

4. The method of claim 1, wherein said TR3/Nur77 level is decreased.

5. The method of claim 1, wherein said cells are HUVEC cells.

6. An in vivo model for identifying a test agent which modulates angiogenesis; comprising: a) providing an animal which expresses altered levels of Nur77; b) administering a test agent to said animal; and c) determining the effect of said agent on Nur77-mediated angiogenic processes.

7. The method of claim 6, wherein said Nur77 level is elevated via introduction of a vector encoding Nur77 into the skin of said mouse.

8. The method of claim 7, wherein said vector is selected from the group consisting of an adenoviral vector, an adenoviral-associated vector, a retroviral vector, and a plasmid.

9. The method of claim 6, wherein said animal is a Nur77 knock-out mouse and said Nur77 levels are reduced.

10. The method of claim 8, wherein a tumor explant is introduced into said mouse and said angiogenic process is selected from the group consisting of tumor growth, microvessel permeability, and vessel formation.

11. A method for identifying agents which modulate TR3/Nur77 promoter function, comprising: a) providing host cells comprising a DNA construct having the TR3/Nur77 promoter sequence operably linked to a reporter gene; b) incubating said cells in the presence and absence of said agent; and c) determining whether said agent modulates TR3/Nur77 promoter function as reflected by alterations in reporter gene expression levels.

12. The method of claim 11, wherein said reporter gene is selected from the group consisting of a nucleic acid encoding green fluorescent protein, luciferase, beta- galactosidase, beta-glucuronidase and chloramphenicol acetyltransferase.

13. A method for identifying agents which modulate histamine induced angiogenesis comprising: a) contacting TR3/Nur77 expressing cells or tissues with histamine b) incubating the cells in a) in the presence and absence of a test agent; and c) determining the effect of said agent on histamine induced, TR3- mediated angiogenic processes.

14. The method of claim 13, wherein said angiogenic processes are selected from the group consisting of endothelial cell proliferation, endothelial cell survival, formation of mother vessels, induction of cell cycle genes, micro vessel permeability, VEGF-A independent angiogenesis and tube formation.