WO2008066854A2 - Procédés et compositions induisant l'apoptose des cellules cancéreuses - Google Patents

Procédés et compositions induisant l'apoptose des cellules cancéreuses Download PDF

Info

Publication number
WO2008066854A2
WO2008066854A2 PCT/US2007/024518 US2007024518W WO2008066854A2 WO 2008066854 A2 WO2008066854 A2 WO 2008066854A2 US 2007024518 W US2007024518 W US 2007024518W WO 2008066854 A2 WO2008066854 A2 WO 2008066854A2
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitor
antibody
compound
cancer
acid
Prior art date
Application number
PCT/US2007/024518
Other languages
English (en)
Other versions
WO2008066854A3 (fr
Inventor
Jing Li
David Raymond Stover
Original Assignee
Novartis Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Ag filed Critical Novartis Ag
Publication of WO2008066854A2 publication Critical patent/WO2008066854A2/fr
Publication of WO2008066854A3 publication Critical patent/WO2008066854A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/75—Agonist effect on antigen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/12—Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function

Definitions

  • Apoptosis is a highly conserved cell suicide program essential for development and tissue homeostasis of all metazoan organisms. Changes to the apoptotic pathway that prevent or delay normal cell turnover can be just as important in the pathogenesis of diseases as are abnormalities in the regulation of the cell cycle. Like cell division, which is controlled through complex interactions between cell cycle regulatory proteins, apoptosis is similarly regulated under normal circumstances by the interaction of gene products that either prevent or induce cell death.
  • TNF-related apoptosis-inducing ligand TRAIL, also referred to as Apo2L
  • Apo2L TNF-related apoptosis-inducing ligand
  • TRAIL Upon binding to DR4 or DR5, two members of the TNF receptor super family, TRAIL induces cell death by apoptosis. See, e.g., Pan et al, Science 277:815-8 (1997); Sheridan, et al, Science 277:818-21 3 (1997); Walczak et al, EMBOJ. 16:5386-97 4 (1997). In vitro, TRAIL has been shown to kill tumor cells, but is relatively non-toxic to normal cells. [003] Additional therapies are needed to treat cancer. The present invention addresses this and other problems.
  • the present invention provides methods of inducing apoptosis in a cancer cell in an individual in need thereof.
  • the method comprises administering to the individual a therapeutically effective amount of (i) an anti-DR4 or anti-DR5 affinity agent agonist; - and (ii) an anti-cancer agent or an anti-proliferative agent.
  • An anti-DR4 or anti-DR5 affinity agent agonist includes an antibody or antigen recognizing portion thereof.
  • a preferred affinity agent is an anti-DR5 antibody agonist, including especially Antibody A provided herein.
  • An anti-cancer agent or anti-proliferative agent includes, but is not limited to a pharmaceutically active agent comprising one or more of: i. an aromatase inhibitor; ii. an antiestrogen, an anti-androgen or a gonadorelin agonist; iii. a topoisomerase I inhibitor or a topoisomerase II inhibitor; iv. a microtubule active agent, an alkylating agent, an anti-neoplastic anti-metabolite or a platin compound; v.
  • a pharmaceutically active agent comprising one or more of: i. an aromatase inhibitor; ii. an antiestrogen, an anti-androgen or a gonadorelin agonist; iii. a topoisomerase I inhibitor or a topoisomerase II inhibitor; iv. a microtubule active agent, an alkylating agent, an anti-neoplastic anti-metabolite or a platin
  • a compound targeting/decreasing a protein or lipid kinase activity or a protein or lipid phosphatase activity, a further anti-angiogenic compound or a compound which induces cell differentiation processes vi. monoclonal antibodies; vii. a cyclooxygenase inhibitor, a bisphosphonate, a heparanase inhibitor, a biological response modifier; viii. an inhibitor of Ras oncogenic isoforms; ix. a telomerase inhibitor; x. a protease inhibitor, a matrix metalloproteinase inhibitor, a methionine aminopeptidase inhibitor, or a proteasome inhibitor; xi.
  • agents used in the treatment of hematologic malignancies or compounds which target, decrease or inhibit theactivity of Flt-3 xii. an HSP90 inhibitor; xiii. antiproliferative antibodies; xiv. a histone deacetylase (HDAC) inhibitor; xv. a compound which targets, decreases or inhibits the activity/function of serine/theronine mTOR kinase; xvi. a somatostatin receptor antagonist; xvii. an anti-leukemic compound; xviii. tumor cell damaging approaches; xix. an EDG binder; xx. a ribonucleotide reductase inhibitor; xxi.
  • HDAC histone deacetylase
  • an S-adenosylmethionine decarboxylase inhibitor xxii. a monoclonal antibody of VEGF or VEGFR; xxiii. photodynamic therapy; xxiv. an angiostatic steroid; xxv. an implant containing corticosteroids; xxvi. an ATI receptor antagonist; and xxvii. an ACE inhibitor and a pharmaceutically acceptable salt or formulation of such a compound.
  • the anti-cancer agent is an apoptosis-inducing agent. In other embodiments, the anti-cancer agent is an anti-proliferative agent.
  • the anti-cancer agent modulates the expression of a gene associated with apoptosis or proliferation.
  • the agent is a proteasome inhibitor.
  • the agent is an siRNA molecule.
  • the method is administering pharmaceutically effective amounts of the combination for the prevention or treatment of proliferative disease.
  • the invention relates to a method of preventing or treating proliferative diseases or diseases that are associated with or triggered by persistent angiogenesis in a mammal, particularly a human, with a combination of pharmaceutical agents of the invention.
  • the proliferative disease or disorder is a cancer.
  • the cancer is a solid tumor.
  • the cancer is a haematologic cancer.
  • the cancer is breast cancer, colon cancer, glioma, haematopoeitic tumor, head and neck cancer and cancer of the esophagus, lung cancer, lymphoma, melanoma, mesothelioma, ovarian cancer, osteosarcoma, pancreatic cancer or cancer of the stomach, bladder, uterus and cervix.
  • the present invention further relates to a commercial package or product comprising (a) a pharmaceutical formulation of a DR4-inhibitor or DR5-inhibitor; and (b) a pharmaceutical formulation of a pharmaceutically active agent for simultaneous, concurrent, separate or sequential use.
  • a commercial package or product comprising (a) a pharmaceutical formulation of a DR4-inhibitor or DR5-inhibitor; and (b) a pharmaceutical formulation of a pharmaceutically active agent for simultaneous, concurrent, separate or sequential use.
  • Each of the combination partners (a) and (b) can be administered together, one after the other or separately in one combined unit dosage form or in two separate unit dosage forms.
  • the unit dosage form may also be a fixed combination.
  • the present invention demonstrates the result that anti-DR4 or anti-DR5 antibody agonists administered with an apoptosis-inducing agent induces apoptosis in cancer cells in a synergistic fashion while having little or no effect on non-diseased cells.
  • cancer cells that are resistant to treatment by one of these components alone will likely be killed when contacted by an anti-DR4 or anti-DR5 agonist antibody and a second apoptosis-inducing agent.
  • contact with anti-DR4 or anti-DR5 agonist antibody and an anti-cancer will lead to a faster induction of apoptosis.
  • the present invention also provides high potency DR5 agonist antibodies and their use to induce apoptosis in cancer cells, and cells associated with proliferative diseases, in combination with a wide variety of anti-cancer agents and apoptosis-inducing agents.
  • the invention relates to a method of preventing or treating proliferative diseases or diseases that are associated with or triggered by persistent angiogenesis in a mammal, particularly a human, with a combination of pharmaceutical agents which comprises:
  • compositions comprising:
  • the present invention further relates to a commercial package or product comprising:
  • each of the combination partners (a) and (b) can be administered together, one after the other or separately in one combined unit dosage form or in two separate unit dosage forms.
  • the unit dosage form may also be a fixed combination.
  • the proliferative disease is cancer.
  • the cancer is a solid tumor.
  • the cancer is a haematologic cancer.
  • the invention provides methods of inducing apoptosis in a cancer cell.
  • the method comprises contacting the cell with (i) an anti-DR4 or anti- DR5 affinity agent agonist; and (ii) an anti-cancer agent.
  • the agonist is an anti-DR-5 antibody.
  • the anti-DR5 antibody has the binding specificity of an antibody comprising a heavy chain variable region comprising the sequence displayed in Tables 1-3 and a light chain variable region as displayed in Tables 1-3. See also US Patent No. 7,229,617 granted 12 June 2007, incorporated herein by reference in its entirety
  • GIy Tyr lie Lys Tyr Asn GIu Lys Phe Lys Asp Arg Ala Thr Leu Thr Ala Asp
  • Table 2A Light Chain Variable Region ( SEQ ID NO : 3 ) GACATTGCGATGACCCAGTCTCACAAGTTCATGTCCACATTAGTGGGAGACAGGGTCAGCATCACCTGCAAGGC CAGTCAGGATGTGAATACTGCTATAGCCTGGTATCAACAAAAACCAGGGCAATCTCCTAAACTACTGATTTACT GGGCATCCACCCGGCACACTGGAGTCCCTGATCGCTTCACAGGCAGTGGATCTGGGACAGATTATACTCTCACC
  • Thr Asp Tyr Thr Leu Thr lie Ser Ser Met GIu Ala GIu Asp Ala Ala Thr
  • Table 3 Anti-DR5 "Antibody A” Sequence Table 3A - Sequence of DR5A heavy chain variable region ( SEQ I D NO : 5 )
  • the anti-DR5 antibody comprises a heavy chain variable region comprising the sequence displayed in Tables 1-3 and a light chain variable region as displayed in
  • the anti-DR5 antibody is Antibody A containing the V H and V L chains provided in Table 3.
  • the agonist is an anti-DR4 antibody.
  • the antibody contains one or more of the the complementarity determining regions
  • the anti-DR5 antibody V H chain contains a CDRl sequence of
  • GYTFTDYTIH (SEQ ID NO:9).
  • the anti-DR5 antibody V H chain contains a CDR2 sequence of
  • the anti-DR5 antibody V H chain contains a CDR3 sequence of
  • HEEGIYFDY (SEQ ID NO: 11).
  • the anti-DR5 antibody V L chain contains a CDRl sequence of
  • the anti-DR5 antibody V L chain contains a CDR2 sequence of
  • the anti-DR5 antibody V L chain contains a CDR3 sequence selected from QQWSSNPLT (SEQ ID NO: 14) and QQHYTTPFT (SEQ ID NO: 15).
  • the cell is contacted with an anti-DR4 antibody agonist and an anti-DR5 antibody agonist.
  • the agonist is a humanized antibody. In some embodiments, the agonist is a single chain antibody.
  • the anti-cancer agent is an apoptosis-inducing agent. In other embodiments, the anti-cancer agent is an anti-proliferative agent.
  • the anti-cancer agent prevents or reduces the expression of
  • the agent prevents activation of NFKB. In some embodiments, the agent prevents degradation of IKB. In some embodiments, the agent is a proteasome inhibitor. In some embodiments, the proteasome inhibitor is selected from the group consisting of PS-341, MG-262 and MG- 132.
  • the agent is an inhibitor of an Inhibitor of Apoptosis (IAP) protein.
  • the inhibitor is SMAC or a SMAC mimetic.
  • the agent is an inhibitor of a polypeptide selected from the group consisting of plexin Bl (PLXNBl), SET domain-containing protein 7 (SET7), mitogen-activated protein kinase kinase kinase 5 (MAP3K5), STE20-like kinase (JIK), MAP kinase-interacting serine/threonine kinase 1 (MKNKl), putative endoplasmic reticulum multispan transmembrane protein (RFTl), 5-kinase, type I, gamma (PIP5K1C), mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), mitogen-activated protein kinase
  • the agent is an activator of a polypeptide selected from the group consisting of signal recognition particle 72kD (SRP72), Caspase-8, Bid, B lymphoid tyrosine kinase (BLK), gene product similar to Pyruvate kinase, M2 isozyme (LOC 148283), glycogen synthase kinase 3 alpha (GSK3A), hypothetical protein FLJ32312 (FLJ32312), mitogen-activated protein kinase 10 (MAPKlO), TCF4: transcription factor 4, v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) (ABL2), v-ros avian UR2 sarcoma virus oncogene homolog 1 (ROSl) and v-myc avian myelocytomatosis viral oncogene homolog.
  • SRP72 signal recognition particle 72kD
  • Caspase-8 Caspas
  • the cancer cell is a colon cancer cell or a pancreatic cancer cell.
  • the agent is an antagonist of PAKl.
  • the agent is an antagonist of a polypeptide selected from the group consisting of UbcHIO, nsurf, stkl2, Askl and JIK.
  • the agent is an siRNA molecule.
  • the present invention also provides methods of inducing apoptosis in a cancer cell in an individual in need thereof.
  • the method comprises administering to the individual a therapeutically effective amount of (i) an anti-DR4 or anti-DR5 affinity agent agonist; and (ii) an anti-cancer agent.
  • the agonist and the agent are administered separately. In some embodiments, the agonist and the agent are administered as a mixture. In some embodiments, the agonist is an anti-DR-5 antibody. In some embodiments, the anti-DR5 antibody has the binding specificity of an antibody comprising a heavy chain variable region comprising the sequence displayed in Tables 1-3 and a light chain variable region as displayed in Tables 1-3. In some embodiments, the anti-DR5 antibody comprises a heavy chain variable region comprising the sequence displayed in Tables 1-3 and a light chain variable region as displayed in Tables 1-3. In some embodiments, the anti-DR5 antibody is Antibody A of Table 3. In some embodiments, the agonist is an anti-DR4 antibody. In some embodiments, the cell is contacted with an anti-DR4 antibody agonist and an anti-DR5 antibody agonist.
  • the agonist is a humanized antibody. In some embodiments, the agonist is a single chain antibody. In some embodiments the agonist is a nanobody.
  • pharmaceutically active agents is a broad one covering many pharmaceutically active agents having different mechanisms of action. Combinations of some of these with an anti-DR5 antibody can result in improvements in cancer therapy. Generally, pharmaceutically active agents are classified according to the mechanism of action. Many of the available agents are anti-metabolites of development pathways of various tumors, or react with the
  • DNA of the tumor cells there are also agents which inhibit enzymes, such as topoisomerase I and topoisomerase II, or which are antimiotic agents.
  • pharmaceutically active agent is meant especially any pharmaceutically active agent other than an anti-DR5 antibody or a derivative thereof. It includes, but is not limited to: i. an aromatase inhibitor; ii. an antiestrogen, an anti-androgen or a gonadorelin agonist; iii. a topoisomerase I inhibitor or a topoisomerase II inhibitor; iv. a microtubule active agent, an alkylating agent, an anti-neoplastic anti-metabolite or a platin compound; v.
  • a compound targeting/decreasing a protein or lipid kinase activity or a protein or lipid phosphatase activity, a further anti-angiogenic compound or a compound which induces cell differentiation processes vi. monoclonal antibodies; vii. a cyclooxygenase inhibitor, a bisphosphonate, a heparanase inhibitor, a biological response modifier; viii. an inhibitor of Ras oncogenic isoforms; ix. a telomerase inhibitor; x. a protease inhibitor, a matrix metalloproteinase inhibitor, a methionine aminopeptidase inhibitor, or a proteasome inhibitor; xi.
  • agents used in the treatment of hematologic malignancies or compounds which target, decrease or inhibit theactivity of Flt-3 xii. an HSP90 inhibitor; xiii. antiproliferative antibodies; xiv. a histone deacetylase (HDAC) inhibitor; xv. a compound which targets, decreases or inhibits the activity/function of serine/theronine mTOR kinase; xvi. a somatostatin receptor antagonist; xvii. an anti-leukemic compound; xviii. tumor cell damaging approaches; xix. an EDG binder; xx. a ribonucleotide reductase inhibitor; xxi.
  • HDAC histone deacetylase
  • an S-adenosylmethionine decarboxylase inhibitor xxii. a monoclonal antibody of VEGF or VEGFR; xxiii. photodynamic therapy; xxiv. an angiostatic steroid; xxv. an implant containing corticosteroids; xxvi. an ATI receptor antagonist; and xxvii. an ACE inhibitor.
  • aromatase inhibitor relates to a compound which inhibits the estrogen production, i.e., the conversion of the substrates androstenedione and testosterone to estrone and estradiol, respectively.
  • the term includes, but is not limited to, steroids, especially atamestane, exemestane and formestane; and, in particular, non-steroids, especially aminoglutethimide, roglethimide, pyridoglutethimide, trilostane, testolactone, ketokonazole, vorozole, fadrozole, anastrozole and letrozole.
  • Exemestane is marketed as AROMASIN; formestane as LENTARON; fadrozole as AFEMA; anastrozole as ARIMIDEX; letrozole as FEMARA or FEMAR; and aminoglutethimide as ORIMETEN.
  • a combination of the invention comprising a pharmaceutically active agent which is an aromatase inhibitor is particularly useful for the treatment of hormone receptor positive tumors, e.g., breast tumors.
  • anti-estrogen relates to a compound which antagonizes the effect of estrogens at the estrogen receptor level.
  • the term includes, but is not limited to, tamoxifen, fulvestrant, raloxifene and raloxifene hydrochloride.
  • Tamoxifen can be administered in the form as it is marketed, e.g., NOLVADEX; and raloxifene hydrochloride is marketed as EVISTA.
  • Fulvestrant can be formulated as disclosed in U.S. Patent No. 4,659,516 and is marketed as FASLODEX.
  • a combination of the invention comprising a pharmaceutically active agent which is an anti-estrogen is particularly useful for the treatment of estrogen receptor positive tumors, e.g., breast tumors.
  • anti-androgen relates to any substance which is capable of inhibiting the biological effects of androgenic hormones and includes, but is not limited to, bicalutamide (CASODEX), which can be formulated, e.g., as disclosed in U.S. Patent No. 4636505.
  • bicalutamide CASODEX
  • gonadorelin agonist includes, but is not limited to, abarelix, goserelin and goserelin acetate. Goserelin is disclosed in U.S. Patent No. 4,100,274 and is marketed as ZOLADEX.
  • Abarelix can be formulated, e.g., as disclosed in U.S. Patent No. 5843901.
  • topoisomerase I inhibitor includes, but is not limited to, topotecan, gimatecan, irinotecan, camptothecian and its analogues, 9-nitrocamptothecin and the macromolecular camptothecin conjugate PNU-166148 (compound Al in WO 99/17804).
  • Irinotecan can be administered, e.g., in the form as it is marketed, e.g., under the trademark CAMPTOSAR.
  • Topotecan can be administered, e.g., in the form as it is marketed, e.g., under the trademark HYCAMTEN.
  • topoisomerase II inhibitor includes, but is not limited to, the anthracyclines, such as doxorubicin, including liposomal formulation, e.g., CAELYX, daunorubicin, including liposomal formulation, e.g., DAUNOSOME, epirubicin, idarubicin and nemorubicin; the anthraquinones mitoxantrone and losoxantrone; and the podophillotoxines etoposide and teniposide.
  • the anthracyclines such as doxorubicin, including liposomal formulation, e.g., CAELYX, daunorubicin, including liposomal formulation, e.g., DAUNOSOME, epirubicin, idarubicin and nemorubicin
  • the anthraquinones mitoxantrone and losoxantrone include the podophillotoxines etoposide and tenipos
  • Etoposide is marketed as ETOPOPHOS; teniposide as VM 26-BRISTOL; doxorubicin as ADRIBLASTIN or ADRIAMYCIN; epirubicin as FARMORUBICIN; idarubicin as ZAVEDOS; and mitoxantrone as NOVANTRON.
  • microtubule active agent as used herein, relates to microtubule stabilizing, microtubule destabilizing agents and microtublin polymerization inhibitors including, but not limited to, taxanes, e.g., paciltaxel and docetaxel; vinca alkaloids, e.g., vinblastine, especially vinblastine sulfate; vincristine, especially vincristine sulfate and vinorelbine; discodermolides; cochicine and epothilonesand derivatives thereof, e.g., epothilone B or a derivative thereof.
  • taxanes e.g., paciltaxel and docetaxel
  • vinca alkaloids e.g., vinblastine, especially vinblastine sulfate
  • vincristine especially vincristine sulfate and vinorelbine
  • discodermolides cochicine and epothilonesand derivatives thereof, e.g.,
  • Paclitaxel is marketed as TAXOL; docetaxel as TAXOTERE; vinblastine sulfate as VINBLASTIN R.P; and vincristine sulfate as FARMISTIN. Also included are the generic forms of paclitaxel as well as various dosage forms of paclitaxel. Generic forms of paclitaxel include, but are not limited to, betaxolol hydrochloride. Various dosage forms of paclitaxel include, but are not limited to albumin nanoparticle paclitaxel marketed as ABRAXANE; ONXOL, CYTOTAX Discodermolide can be obtained, e.g., as disclosed in U.S. Patent No. 5,010,099.
  • Epotholine derivatives which are disclosed in U.S. Patent No. 6,194,181, WO 98/10121, WO 98/25929, WO 98/08849, WO 99/43653, WO 98/22461 and WO 00/31247. Especially preferred are Epotholine A and/or B.
  • alkylating agent includes, but is not limited to, cyclophosphamide, ifosfamide, melphalan or nitrosourea (BCNU or Gliadel), or temozolamide (TEMODAR).
  • Cyclophosphamide can be administered, e.g., in the form as it is marketed, e.g., under the trademark CYCLOSTIN; and ifosfamide as HOLOXAN.
  • anti-neoplastic anti-metabolite includes, but is not limited to,
  • 5-fluorouracil 5-fluorouracil
  • capecitabine gemcitabine
  • DNA de-methylating agents such as 5-azacytidine and decitabine
  • methotrexate edatrexate
  • folic acid antagonists such as, but not limited to, pemetrexed.
  • Capecitabine can be administered, e.g., in the form as it is marketed, e.g., under the trademark XELODA; and gemcitabine as GEMZAR.
  • platinum compound includes, but is not limited to, carboplatin, cis-platin, cisplatinum, oxaliplatin, Satraplatin and platinum agents such as ZD0473.
  • Carboplatin can be administered, e.g., in the form as it is marketed, e.g., CARBOPLAT; and oxaliplatin as ELOXATIN.
  • VEGF vascular endothelial growth factor-receptors
  • AEE788 7H-pyrrolo[2,3- d]pyrimidine derivatives
  • BAY 43-9006 isolcholine compounds disclosed in WO 00/09495 such as (4-tert-butyl-phenyl)-94-pyridin-4-ylmethyl-
  • Compounds include but are not limited to the compounds disclosed in WO 02/092599 and derivatives thereof of 4-amino-5-phenyl-7- cyclobutyl-pyrrolo[2,3-d]pyrimidine derivatives (AEW541); v) compounds targeting, decreasing or inhibiting the activity of the Trk receptor tyrosine kinase family; vi) compounds targeting, decreasing or inhibiting the activity of the AxI receptor tyrosine kinase family; vii) compounds targeting, decreasing or inhibiting the activity of the c-Met receptor; viii) compounds targeting, decreasing or inhibiting the activity of the Ret receptor tyrosine kinase; ix) compounds targeting, decreasing or inhibiting the activity of the Kit/SCFR receptor tyrosine kinase; x) compounds targeting, decreasing or inhibiting the activity of the C-kit receptor tyrosine kinases (part of the PDGFR family), such as compounds which target, decrease or inhibit the activity of the c-Kit
  • Patent No. 5,093,330 e.g., midostaurin
  • examples of further compounds include, e.g., UCN-01 ; safingol; BAY 43-9006; Bryostatin 1 ; Perifosine; Ilmofosine; RO 318220 and RO 320432; GO 6976; Isis 3521; LY333531/LY379196; isochinoline compounds, such as those disclosed in WO 00/09495; FTIs; PDl 84352 or QAN697, a P13K inhibitor; xiii) compounds targeting, decreasing or inhibiting the activity of protein-tyrosine kinase, such as • imatinib mesylate (GLEEVEC); tyrphostin or pyrymidylaminobenzamide and derivatives thereof (AMN 107).
  • GLEEVEC imatinib mesylate
  • a tyrphostin is preferably a low molecular weight (Mr ⁇ 1500) compound, or a pharmaceutically acceptable salt thereof, especially a compound selected from the benzylidene- malonitrile class or the S arylbenzenemalonirile or bisubstrate quinoline class of compounds, more especially any compound selected from the group consisting of Tyrphostin A23/RG-50810, AG 99, Tyrphostin AG 213, Tyrphostin AG 1748, Tyrphostin AG 490, Tyrphostin B44, Tyrphostin B44 (+) enantiomer, Tyrphostin AG 555, AG 494, Tyrphostin AG 556; AG957 and adaphostin (4- ⁇ [(2,5- dihydroxyphenyl) methyl]amino ⁇ -benzoic acid adamantyl ester, NSC 680410, adaphostin); xiv) compounds targeting, decreasing or inhibiting the activity of the epidermal growth factor
  • HERCEPTIN ® trastuzumab
  • cetuximab cetuxim
  • Erlotinib can be administered in the form as it is marketed, e.g. TARCEVA, and gefitinib as IRESSA, human monoclonal antibodies against the epidermal growth factor receptor including ABX-EGFR; and xv) compounds targeting, decreasing or inhibiting the activity/function of serine/theronine mTOR kinase, especially compounds, proteins or antibodies which target/inhibit members of the mTOR kinase family, e.g., RAD, RADOOl, CCI-779, ABT578, SAR543, rapamycin and derivatives / analogs thereof, AP23573 and AP23841 from Ariad, everolimus (CERTICAN) and sirolimus. CERTICAN (everolimus, RAD) an investigational novel proliferation signal inhibitor that prevents proliferation of T-cells and vascular smooth muscle cells.
  • CERTICAN everolimus, RAD
  • CERTICAN an investigational novel proliferation signal inhibitor that prevents proliferation of T-cell
  • antibody When referring to antibody, it is to include intact monoclonal antibodies, nanobodies, polyclonal antibodies, single-chain antibodies, multi-specific antibodies formed from at least 2 intact antibodies, alternative scaffolds containing one or more CDR regions, and antibodies fragments so long as they exhibit the desired biological activity.
  • An antibody includes those that are monomeric, dimereric, trimeric, tetrameric, or otherwise multimeric.
  • the phrase "compound which targets, decreases or inhibits the activity of a protein or lipid phosphatase” as used herein includes but is not limited to inhibitors of phosphatase 1, phosphatase 2A, PTEN or CDC25, e.g., okadaic acid or a derivative thereof.
  • the term "monoclonal antibodies”, as used herein, includes, but is not limited to bevacizumab, cetuximab, trastuzumab, Ibritumomab tiuxetan, and tositumomab and iodine I 131 .
  • Bevacizumab can be administered in the form as it is marketed, e.g.
  • hetero-angiogenic compounds includes but is not limited to compounds having another mechanism for their activity, e.g., unrelated to protein or lipid kinase inhibition, e.g., thalidomide (THALOMID) and TNP-470.
  • TAALOMID thalidomide
  • TNP-470 thalidomide
  • compounds which induce cell differentiation processes include but is not limited to retinoic acid, ⁇ -, ⁇ - or ⁇ -tocopherol or ⁇ -, ⁇ - or ⁇ -tocotrienol.
  • cyclooxygenase inhibitor includes, but is not limited to, e.g., Cox-2 inhibitors, 5-alkyl substituted 2-arylaminophenylacetic acid and derivatives, such as celecoxib (CELEBREX), rofecoxib (VIOXX), etoricoxib, valdecoxib or a 5-alkyl-2-arylamino- phenylacetic acid, e.g., 5-methyl-2-(2'-chloro-6'-fluoroanilino)phenyl acetic acid, lumiracoxib.
  • Cox-2 inhibitors such as celecoxib (CELEBREX), rofecoxib (VIOXX), etoricoxib, valdecoxib or a 5-alkyl-2-arylamino- phenylacetic acid, e.g., 5-methyl-2-(2'-chloro-6'-fluoroanilino)phenyl acetic acid, lumiracoxi
  • bisphosphonates includes, but is not limited to, etridonic, clodronic, tiludronic, pamidronic, alendronic, ibandronic, risedronic and zoledronic acid.
  • Etridonic acid can be administered, e.g., in the form as it is marketed, e.g., DIDRONEL; "clodronic acid” as BONEFOS; “tiludronic acid” as SKELID; “pamidronic acid” as AREDIA; “alendronic acid” as FOSAMAX; “ibandronic acid” as BONDRANAT; “risedronic acid” as ACTONEL; and “zoledronic acid” as ZOMETA.
  • heparanase inhibitor refers to compounds which target, decrease or inhibit heparin sulphate degradation. The term includes, but is not limited to, PI 88.
  • biological response modifier includes, but is not limited to lymphokine or interferons, e.g., interferon ⁇ .
  • inhibitor of Ras oncogenic isoforms includes, but is not limited to H-Ras, K-Ras or N-Ras, as used herein, refers to compounds which target, decrease or inhibit the oncogenic activity of Ras, e.g., a farnesyl transferase inhibitor (FTI), e.g., L-744832,
  • FTI farnesyl transferase inhibitor
  • telomerase inhibitor includes, but is not limited to compounds which target, decrease or inhibit the activity of telomerase.
  • Compounds which target, decrease or inhibit the activity of telomerase are especially compounds which inhibit the telomerase receptor, e.g., telomestatin.
  • matrix metalloproteinase inhibitor includes, but is not limited to, collagen peptidomimetic and non-peptidomimetic inhibitors; tetracycline derivatives, e.g., hydroxamate peptidomimetic inhibitor batimastat; and its orally- bioavailable analogue marimastat (BB-2516), prinomastat (AG3340), metastat (NSC 683551) BMS
  • methionine aminopeptidase inhibitor includes, but is not limited to, compounds which target, decrease or inhibit the activity of methionine aminopeptidase.
  • Compounds which target, decrease or inhibit the activity of methionine aminopeptidase are, e.g., bengamide or a derivative thereof.
  • proteasome inhibitors includes compounds that target, decrease or inhibit the activity of the proteosome. Such compounds include, but are not limited to,
  • PS-341 PS-341 ; MLN 341, bortezomib or Velcade.
  • agent used in the treatment of hematologic malignancies includes, but is not limited to, FMS-like tyrosine kinase inhibitors, e.g., compounds targeting, decreasing or inhibiting the activity of FMS-like tyrosine kinase receptors (Flt-3R); interferon, 1-b-
  • the phrase "compounds which target, decrease or inhibit the activity of Flt-3" as used herein, includes, but is not limited to compounds, proteins or antibodies which inhibit Flt-3, e.g., N- benzoyl-staurosporine, midostaurin, a staurosporine derivative, SUl 1248 and MLN518.
  • HSP90 inhibitors includes, but is not limited to, compounds targeting, decreasing or inhibiting the intrinsic ATPase activity of HSP90; degrading, targeting, decreasing or inhibiting the HSP90 client proteins via the ubiquitin proteosome pathway.
  • Compounds targeting, decreasing or inhibiting the intrinsic ATPase activity of HSP90 are especially compounds, proteins or antibodies which inhibit the ATPase activity of HSP90, e.g., 17- allylamino,17-demethoxygeldanamycin (17AAG), a geldanamycin derivative; other geldanamycin- related compounds; radicicol and HDAC inhibitors.
  • an antiproliferative antibody includes, but is not limited to trastuzumab (HERCEPTIN), trastuzumab-DMl, erlotinib (TARCEVA), bevacizumab (AVASTIN), rituximab (RITUXAN), PRO64553 (anti-CD40) and 2C4 Antibody.
  • antibodies is meant e.g. intact monoclonal antibodies, polyclonal antibodies, multispecif ⁇ c antibodies formed from at least 2 intact antibodies, and antibodies fragments so long as they exhibit the desired biological activity.
  • HDAC inhibitor relates to relates to compounds which inhibit the histone deacetylase and which possess anti-proliferative activity. This includes but is not limited to compounds disclosed in WO 02/22577, especially N-hydroxy-3-[4-[[(2-hydroxyethyl)[2- (lH-indol-3-yl)ethyl]-amino]methyl]phenyl]-2E-2-propenamide, and N-hydroxy-3-[4-[[[2-(2- methyl-lH-indol-3-yl)-ethyl]-amino]methyl]phenyl]-2E-2-propenamide and pharmaceutically acceptable salts thereof (LBH589).
  • SAHA Suberoylanilide hydroxamic acid
  • [4-(2-amino-phenylcarbamoyl)-benzyl]-carbamic acid pyridine-3-ylmethyl ester and ⁇ derivatives thereof butyric acid, pyroxamide, trichostatin A, Oxamflatin,.apicidin, Depsipeptide; depudecin and trapoxin.
  • CERTICAN everolimus, RAD
  • an investigational novel proliferation signal inhibitor that prevents proliferation of T-cells and vascular smooth muscle cells.
  • somatostatin receptor antagonist includes, but is not limited to, agents which target, treat or inhibit the somatostatin receptor, such as octreoride and SOM230.
  • anti-leukemic compound includes but is not limited to Ara- C, a pyrimidine analog, which is the 2'- ⁇ -hydroxy ribose (arabinoside) derivative of deoxycytidine. Also included is the purine analog of hypoxanthine, 6-mercaptopurine (6-MP) and fludarabine phosphate.
  • tumor cell damaging approaches refers to approaches, such as ionizing radiation.
  • ionizing radiation means ionizing radiation that occurs as either electromagnetic rays, such as X-rays and gamma rays; or particles, such as alpha, beta and gamma particles. Ionizing radiation is provided in, but not limited to, radiation therapy and is known in the art. See Hellman, Cancer, 4th Edition, Vol. 1, Devita et al., Eds., pp. 248-275 (1993).
  • EDG binder includes, but is not limited to, a class of immunosuppressants that modulates lymphocyte recirculation, such as FTY720.
  • ribonucleotide reductase inhibitor includes, but is not limited to, pyrimidine or purine nucleoside analogs including, but not limited to, fludarabine and/or ara-C;
  • 6-thioguanine 5-FU
  • cladribine 6-mercaptopurine, especially in combination with ara-C against
  • Ribonucleotide reductase inhibitors are especially hydroxyurea or 2- hydroxy-lH-isoindole-l,3-dione derivatives, such as PL-I, PL-2, PL-3, PL-4, PL-5, PL-6, PL-7 or
  • S-adenosylmethionine decarboxylase inhibitors includes, but is not limited to, the compounds disclosed in U.S. Patent No. 5,461,076.
  • the phrase "monoclonal antibodies of VEGF or VEGFR”, as used herein, includes but is not limited to, compounds disclosed in WO 98/35958, e.g., l-(4-chloroanilino)-4-(4- pyridylmethyl)phthalazine or a pharmaceutically acceptable salt thereof, e.g., the succinate, or in
  • VEGF receptor antibodies e.g., rhuMAb and RHUFab
  • VEGF aptamer e.g., Macugon
  • FLT-4 inhibitors e.g., FLT-3 inhibitors
  • VEGFR-2 IgGl antibody e.g., Angiozyme (RPI 4610)
  • Avastan e.g., Avastan
  • photodynamic therapy refers to therapy which uses certain chemicals known as photosensitizing agents to treat or prevent cancers.
  • photodynamic therapy include, but are not limited to, treatment with agents, such as, e.g., VISUDYNE and porfimer sodium.
  • angiostatic steroid includes, but is not limited to agents which block or inhibit angiogenesis, such as, e.g., anecortave, triamcinolone, hydrocortisone, 11- ⁇ - epihydrocotisol, cortexolone, 17 ⁇ -hydroxyprogesterone, corticosterone, desoxycorticosterone, testosterone, estrone and dexamethasone.
  • agents which block or inhibit angiogenesis such as, e.g., anecortave, triamcinolone, hydrocortisone, 11- ⁇ - epihydrocotisol, cortexolone, 17 ⁇ -hydroxyprogesterone, corticosterone, desoxycorticosterone, testosterone, estrone and dexamethasone.
  • transplant containing corticosteroids includes, but is not limited to agents, such as, e.g., fluocinolone and dexamethasone.
  • ATI receptor antagonist includes, but is not limited to agents, such as DIOVAN.
  • ACE inhibitor includes, but is not limited to CIBACEN, benazepril, enazepril (LOTENSIN), captopril, enalapril, fosinopril, lisinopril, moexipril, quinapril, ramipril, perindopril and trandolapril.
  • Other pharmaceutically active agents include, but are not limited to, plant alkaloids, hormonal agents and antagonists, biological response modifiers, preferably lymphokines or interferons, antisense oligonucleotides or oligonucleotide derivatives; or miscellaneous agents or agents with other or unknown mechanism of action.
  • references to the components (a) and (b) are meant to also include the pharmaceutically acceptable salts of any of the active substances. If active substances comprised by components (a) and/or (b) have, for example, at least one basic center, they can form acid addition salts. Corresponding acid addition salts can also be formed having, if desired, an additionally present basic center.
  • Active substances having an acid group can form salts with bases.
  • the active substances in components (a) and/or (b) or a pharmaceutically acceptable salts thereof may also be used in form of a hydrate or include other solvents used for crystallization.
  • An anti-DR5 antibody is the most preferred combination partner (a).
  • Exemplary pharmaceutically active agents are provided below and in the Examples.
  • Compounds which target, decrease or inhibit the activity of a death receptor are especially compounds, proteins or antibodies that interact with at least one death receptor, that inhibit at least one death receptor or bind to at least one death.
  • the death receptor is selected from DR4 and DR5.
  • the death receptor is DR5.
  • the compound is an Anti-DR5 antibody.
  • the Anti-DR5 antibody has a sequence selected from Tables 1-3,
  • DR5 inhibitors suitable for use in the present invention include the Anti-DR5 antibody that are described in WO 2004/050895 and US Patent No. 7229617 Also included are in particular those compounds, proteins or monoclonal antibodies generically and specifically disclosed in WO2006104672.
  • Antibody refers to a polypeptide comprising a framework region from an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen.
  • the recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes.
  • Light chains are classified as either kappa or lambda.
  • Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
  • Heavy chains may also be based on camelid heavy chains that are the basis of nanobody technology.
  • Naturally occurring immunoglobulins have a common core structure in which two identical light chains (about 24 kD) and two identical heavy chains (about 55 or 70 kD) form a tetramer.
  • the amino-terminal portion of each chain is known as the variable (V) region and can be distinguished from the more conserved constant (C) regions of the remainder of each chain.
  • V variable
  • C conserved constant
  • Within the variable region of the light chain Within the variable region of the light chain is a C-terminal portion known as the J region.
  • Within the variable region of the heavy chain there is a D region in addition to the J region.
  • CDRs complementarity determining regions
  • a traditional immunoglobulin (antibody) structural unit comprises a tetramer.
  • Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light” (about 25 kDa) and one "heavy" chain (about 50-70 kDa).
  • the N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
  • the terms variable light chain (V L ) and variable heavy chain (V H ) refer to these light and heavy chains respectively.
  • Antibodies exist, e.g., as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases.
  • pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)' 2 , a dimer of Fab which itself is a light chain joined to V H -C H i by a disulfide bond.
  • the F(ab)' 2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)' 2 dimer into an Fab' monomer.
  • the Fab' monomer is essentially Fab with part of the hinge region (see FUNDAMENTAL IMMUNOLOGY (Paul ed., 3d ed. 1993). While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies, or those synthesized de novo using recombinant DNA methodologies (e.g., single chain Fv) or those identified using phage display libraries (see, e.g., McCafferty et al, Nature 348:552-554 (1990)).
  • monoclonal or polyclonal antibodies For preparation of monoclonal or polyclonal antibodies, any technique known in the art can be used (see, e.g., Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al, Immunology Today 4:72 (1983); Cole et al, pp. 77-96 in Monoclonal Antibodies and Cancer Therapy (1985)).
  • "Monoclonal" antibodies refer to antibodies derived from a single clone. Techniques for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms such as other mammals, may be used to express humanized antibodies.
  • phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al, Nature 348:552-554 (1990); Marks et al, Biotechnology 10:779-783 (1992)).
  • a "chimeric antibody” is an antibody molecule in which (a) the constant region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class, effector function and/or species, or an entirely different molecule which confers new properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced or exchanged with a variable region having a different or altered antigen specificity.
  • a "humanized” antibody is an antibody that retains the reactivity of a non-human antibody while being less immunogenic in humans.
  • the specified antibodies bind to a particular protein at least two times the background and do not substantially bind in a significant amount to other proteins present in the sample.
  • Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. This selection may be achieved by subtracting out antibodies that cross-react with, e.g., DR5 molecules from other species.
  • immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein.
  • solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).
  • a specific or selective reaction will be at least twice background signal or noise and more typically more than 10 to 100 times background.
  • peptidomimetic and “mimetic” refer to a synthetic chemical compound that has substantially the same structural and functional characteristics of a naturally or non-naturally occurring polypeptide (e.g., SMAC).
  • Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compound are termed “peptide mimetics” or “peptidomimetics” (Fauchere, J. Adv. Drug Res. 15:29 (1986); Veber and Freidinger 77NS p. 392 (1985); and Evans et al. J. Med. Chem. 30: 1229 (1987), which are incorporated herein by reference).
  • Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent or enhanced therapeutic or prophylactic effect.
  • the mimetic can be either entirely composed of synthetic, non-natural analogues of amino acids, or, is a chimeric molecule of partly natural peptide amino acids and partly non-natural analogs of amino acids.
  • the mimetic can also incorporate any amount of natural amino acid conservative substitutions as long as such substitutions also do not substantially alter the mimetic's structure and/or activity.
  • a mimetic composition is within the scope of the invention if it is capable of carrying out at least one of the binding or enzymatic activities of a polypeptide of interest.
  • RNA refers to small interfering RNAs, that are capable of causing interference and can cause post-transcriptional silencing of specific genes in cells, for example, mammalian cells (including human cells) and in the body, for example, mammalian bodies (including humans).
  • the phenomenon of RNA interference is described and discussed in Bass, Nature 411 : 428-29 (2001); Elbahir et al, Nature 411 : 494-98 (2001); and Fire et ah, Nature 391 : 806-11 (1998); and WO 01/75164, where methods of making interfering RNA also are discussed.
  • the siRNAs based upon the sequences and nucleic acids encoding the gene products disclosed herein typically have fewer than 100 base pairs and can be, e.g., about 30 bps or shorter, and can be made by approaches known in the art, including the use of complementary DNA strands or synthetic approaches.
  • the siRNAs are capable of causing interference and can cause post-transcriptional silencing of specific genes in cells, for example, mammalian cells (including human cells) and in the body, for example, mammalian bodies (including humans).
  • Exemplary siRNAs according to the invention could have up to 29 bps, 25 bps, 22 bps, 21 bps, 20 bps, 15 bps, 10 bps, 5 bps or any integer thereabout or therebetween.
  • RNAi technique employs genetic constructs within which sense and anti-sense sequences are placed in regions flanking an intron sequence in proper splicing orientation with donor and acceptor splicing sites. Alternatively, spacer sequences of various lengths may be employed to separate self-complementary regions of sequence in the construct. During processing of the gene construct transcript, intron sequences are spliced-out, allowing sense and anti-sense sequences, as well as splice junction sequences, to bind forming double-stranded RNA.
  • Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
  • the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
  • nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka e/ ⁇ /., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al, MoI. Cell. Probes 8:91-98 (1994)).
  • the term "nucleic acid” encompasses the terms gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
  • polypeptide peptide
  • protein protein
  • amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, .gamma.-carboxyglutamate, and O-phosphoserine.
  • Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an .alpha, carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
  • Constantly modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
  • nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
  • each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
  • TGG which is ordinarily the only codon for tryptophan
  • amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
  • the following eight groups each contain amino acids that are conservative substitutions for one another: (1) Alanine (A), Glycine (G); (2) Aspartic acid (D), Glutamic acid (E); (3) Asparagine (N), Glutamine (Q); (4) Arginine (R), Lysine (K); (5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); (6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); (7) Serine (S), Threonine (T); and (8) Cysteine (C), Methionine (M) ⁇ see, e.g., Creighton, Proteins (1984)).
  • Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (e.g., a polypeptide of the invention), which does not comprise additions or deletions, for optimal alignment of the two sequences.
  • the percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same sequences.
  • Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • the invention provides polypeptides or polynucleotides that are substantially identical to the polypeptides or polynucleotides, respectively, exemplified herein (e.g., the CDRs exemplified in Tables 1-3).
  • the identity exists over a region that is at least about 50 nucleotides in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides in length.
  • sequence comparison algorithm typically one sequence acts as a reference sequence, to which test sequences are compared.
  • sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • the sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequences for comparison are well known in the art.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman ( ⁇ 910) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch (1970) J. MoI. Biol.
  • BLAST and BLAST 2.0 algorithms Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nwc. Acids Res. 25:3389-3402, and Altschul et al. (199O) J. MoI Biol. 215:403-410, respectively.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra).
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. ScL USA 90:5873-5787).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
  • nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid. See below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
  • Another indication that 2 nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
  • Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
  • affinity agent agonist refers to an affinity agent (i.e., a molecule that specifically binds a target molecule) capable of activating a receptor to induce a full or partial receptor-mediated response.
  • an agonist of DR4 or DR5 binds to DR4 or DR5 and induces DR4 or DR5-mediated signaling.
  • a DR4 or DR5 affinity agent agonist can be identified by its ability to bind to DR4 or DR5 and induce apoptosis when contacted to Jurkat cells.
  • An "antibody agonist” refers to the situation where the affinity agent is an antibody.
  • apoptosis-inducing agent refers to a compound that induces or promotes apoptosis in at least one cell type when contacted to the cell type.
  • exemplary apoptosis-inducing agents include, e.g., agonists or mimetics of the following: SMAC, Bax, Bik, Bok, Bim, Bak, Bid, Noxa, Puma, Hrk, or Bad; BH3, p53, TRAIL ligand, Fadd, Myc, and Mekkl, signal recognition particle 72kD (SRP72), Caspase-8, Bid, B lymphoid tyrosine kinase (BLK), gene product similar to Pyruvate kinase, M2 isozyme (LOC 148283), glycogen synthase kinase 3 alpha (GSK.3A), hypothetical protein FLJ32312 (FLJ32312), mitogen-activated protein kinase
  • SMAC
  • NLK e.g., accno. NM_016231
  • GRAF e.g., accno. NM_015071
  • GCK e.g., accno. NMJ
  • ERK5 e.g., accno. NM_002749
  • FGR e.g., accno. NM_005248
  • ACVRLl e.g., accno. NM_000020
  • MEKK5 e.g., accno. NM 002757
  • PIP5K1C e.g., accno. XM 047620
  • MAPKAPK2 e.g., accno.
  • Additional exemplary apoptosis-inducing agents include, e.g., agents that enhance DR5 and DR4 expression and/or stability, agents that enhance caspase activity or stability, and agents that induce or enhance a DNA damage response.
  • Agonist or mimetics in the above list include the gene products themselves, e.g., p53 is a p53 agonist.
  • Antagonists include agents that directly inhibit activity and agents that indirectly inhibit activity through decreasing expression or stability of target molecule mRNA (e.g., siRNAs) or protein.
  • An agent that "prevents or reduces the expression" of a protein refers to compounds that, e.g., bind to, partially or totally block stimulation, decrease, prevent, delay expression. Protein expression can be reduced by at least, e.g., 5%, 10%, 25%, 50%, 75%, 90%, 95% or 100%.
  • Activation of NFKB refers to induction of nuclear localization of NFKB, DNA binding by NFKB or transcription resulting from DNA binding by NFKB.
  • Prevents degradation of IKB refers to degradation of IKB by the proteasome, thereby releasing NFKB to enter the cell nucleus.
  • a “proteasome inhibitor” refers to an agent that inhibits the proteasome-ubiquitin pathway, thereby preventing degradation of IKB and subsequent nuclear localization of IkB's partner, NFKB.
  • the proteasome includes, e.g., the 26S proteasome complex.
  • An “Inhibitor of Apoptosis (LAP) protein” refers to a polypeptide of the protein family that inhibits caspase activity. All but one of the known IAP proteins share a twofold or threefold repeat of a characteristic sequence motif, the Baculovirus Inhibitory Repeat (BIR; -70 residues; survivin is a recently discovered human IAP that contains one BIR region).
  • BIR Baculovirus Inhibitory Repeat
  • IAPs include, e.g., X chromosome linked inhibitor of apoptosis (XIAP; Genbank accession number U32974), the cellular IAP proteins (c-IAP-1 /HIAP- 2/hMIHB and c-IAP-2/HIAP-l/hMIHC; Liston et al, Nature 379:349-353 (1996); Rothe et al, Cell 83:1243-1252 (1995)); the neuronal apoptosis inhibitory protein (NAIP; Roy et al., Cell 80:167-178 (1995)); and survivin (Ambrosini et al., Nature Med.
  • SMAC refers to a mitochondrial polypeptide, which is released together with cytochrome c from the mitochondria in response to apoptotic stimuli. SMAC promotes caspase activation by binding and neutralizing the IAPs. See, e.g., Du et al, Cell 102:33-42 (2000); Verhagen et al., Cell 102:43-53 (2000).
  • Modules are used herein to refer to molecules that inhibit or enhance the activity of expression a gene product.
  • Antagonists or “inhibitors” are compounds that, e.g., inhibit expression of a gene product or bind to, partially or totally block stimulation, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity of the gene product or that bind or down regulate a receptor to which the gene product binds..
  • Antagonists are compounds that, e.g., induce or activate the expression of a gene product or bind to, stimulate, increase, open, activate, facilitate, enhance activation, sensitize or up regulate the activity of the gene product or that bind or up regulate a receptor to which the gene product binds.
  • Agonists or antagonists can include, e.g., antibodies, organic small molecules (e.g., less than 1500 Daltons), genetically modified versions of the gene products themselves, etc.
  • Antagonists include, e.g., siRNA molecules for reducing expression of a transcript encoding a gene product.
  • Any anti-DR4 or anti-DR5 antibody agonist can be used according to the methods of the invention.
  • DR4 also referred to as Death Receptor 4
  • DR5 also referred to as Death Receptor 5
  • Anti-DR5 antibodies have been described previously in, e.g., PCT WO 01/83560 (antibody TRA-8; ATCC PTA-1428) and PCT WO 02/079377.
  • anti-DR5 antibody agonists are described herein.
  • variable regions of the heavy and light chains of an exemplary anti-DR5 antibody agonist are provided in Tables 1-3.
  • the anti-DR5 antibodies compete with the exemplified antibody for binding to DR5.
  • the DR5 antibody agonists have CDRs that are substantially similar to the CDRs exemplified in Tables 1-3.
  • Any type of antibody agonist may be used according to the methods of the invention.
  • the antibodies used are monoclonal antibodies.
  • Monoclonal antibodies can be generated by any method known in the art (e.g., using hybridomas, recombinant expression and/or phage display). However, alternative scaffolds may be used that contain the CDRs of the invention.
  • the antibodies of the invention need not be cross-linked or otherwise treated prior to administration. However, in some embodiments, the antibodies of the invention are cross-linked. Cross-linking (e.g., using hetero- or homo-bifunctional chemical cross-linkers) is well known in the art. Alternatively, stable multivalent Fabs (e.g., trimers or tetramers, etc.) can be administered. See, e.g., PCT WO 99/27964.
  • Exemplary anti-DR5 antibodies include those with the specificity of an antibody comprising the light and heavy chain variable region sequences displayed in Tables 1-3.
  • the antibody is Antibody A, displayed in Table 3.
  • the anti-DR5 antibodies of the invention do not bind to other polypeptides.
  • the ant-DR5 antibodies do not bind any other receptor in the TNF receptor family (e.g., TNFR2, TNFR3, OX40, CD40, FAS, DcR3, CD27, CD30, CD137, DR4, DcRl, DcR2, RANK, OPG, DR3, TR2, NGFR, TNFRl, and TACl).
  • the ant-DR5 antibodies do not bind to DR4, DTRl, DTR2 or OPG.
  • the anti-DR4 or anti-DR5 antibodies of the invention can be extremely potent.
  • the antibodies of the invention in a standard subcutaneous tumor ablation assay, can reduce tumor size by 50% at a concentration of 1 or less mg/kg body weight (and in some embodiments, 0.50 mg/kg, 0.05 mg/kg, or 0.01 mg/kg or less) when administered to an animal 3 times a week for 2 weeks and ablates tumors completely when 10 X that amount is used.
  • the anti-DR4 or anti-DR5 antibodies of the invention are designed to lack or have a reduced antibody-dependent cellular cytotoxicity (ADCC).
  • ADCC antibody-dependent cellular cytotoxicity
  • the antibodies of the invention comprise an IgGi, ⁇ gG 2 , IgG 2A , IgG3 or IgG 4 Fc region.
  • a number of different synthetic molecular scaffolds can be used to display the variable light and heavy chain sequences displayed in Tables 1-3.
  • a publication describing use of the fibronectin type III domain (FN3) as a specific molecular scaffold on which to display peptides including CDRs is Koide, A. et al. J. MoI. Biol 284:1141-1151(1988).
  • Other scaffolding alternatives include, e.g., "minibodies" (Pessi, A.
  • the antibody used according to the present invention is a chimeric (e.g., mouse/human) antibody made up of regions from a non-human anti-DR4 or anti-DR5 antibody agonist together with regions of human antibodies.
  • a chimeric H chain can comprise the antigen binding region of the heavy chain variable region (e.g., sequences in Tables 1- 3) of the non-human antibody linked to at least a portion of a human heavy chain constant region.
  • This humanized or chimeric heavy chain may be combined with a chimeric L chain that comprises the antigen binding region of the light chain variable region (e.g., the sequence displayed in Tables 1-3) of the non-human antibody linked to at least a portion of the human light chain constant region.
  • the light chain is selected from kappa and lambda.
  • the heavy chain constant region can be an IgG, IgM, IgA, IgD or IgE antibody.
  • the chimeric antibodies of the invention may be monovalent, divalent, or polyvalent immunoglobulins.
  • a monovalent chimeric antibody is a dimer (HL) formed by a chimeric H chain associated through disulfide bridges with a chimeric L chain, as noted above.
  • a divalent chimeric antibody is a tetramer (H 2 L 2 ) formed by two HL dimers associated through at least one disulfide bridge.
  • a polyvalent chimeric antibody is based on an aggregation of chains.
  • nucleotide and amino acid sequences of the variable region of an exemplary anti- DR5 antibody agonist are provided in Tables 1-3.
  • the DNA sequences of the antibodies of the invention can be identified, isolated, cloned, and transferred to a prokaryotic or eukaryotic cell for expression by procedures well-known in the art. Such procedures are generally described in Sambrook et al, supra, as well as CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel et al, eds., 1989). Expression vectors and host cells suitable for expression of recombinant antibodies and humanized antibodies in particular, are well known in the art.
  • Host cells capable of expressing functional immunoglobulins include, e.g., mammalian cells such as Chinese Hamster Ovary (CHO) cells; COS cells; myeloma cells, such as NSO and SP2/O cells; bacteria such as Escherichia coli; yeast cells such as Saccharomyces cerevisiae; and other host cells.
  • mammalian cells such as Chinese Hamster Ovary (CHO) cells; COS cells; myeloma cells, such as NSO and SP2/O cells; bacteria such as Escherichia coli; yeast cells such as Saccharomyces cerevisiae; and other host cells.
  • the antibodies of the invention are single chain antibodies.
  • techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al, Methods in Enzymology 203:46- 88 (1991); Shu et al, Proc. Natl. Acad. ScL USA 90:7995-7999 (1993); and Skerra et al, Science 240:1038-1040 (1988).
  • human antibodies are used according to the present invention.
  • Human antibodies can be made by a variety of methods known in the art including by using phage display methods using antibody libraries derived from human immunoglobulin sequences. See, e.g., Lonberg and Huszar, Int. Rev. Immunol 13:65-93 (1995), U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.
  • the antibodies of the present invention are generated using phage display.
  • functional antibody domains are displayed on the surface of phage particles that carry the polynucleotide sequences encoding them.
  • Such phage can be utilized to display antigen-binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine).
  • Phage expressing an antigen binding domain that binds DR4 or DR5 can be selected or identified with DR4 or DR5, e.g., using labeled DR4 or DR5.
  • Phage used in these methods are typically filamentous phage including fd and Ml 3 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein.
  • Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et ah, J. Immunol. Methods 182:41-50 (1995); Ames et ah, J. Immunol. Methods 184:177-186 (1995); Kettleborough et ah, Eur. J. Immunol.
  • Agonist antibodies can be identified by generating anti-DR4 or anti-DR5 Abs and then testing each antibody for the ability trigger DR4 or DR5 mediated events, e.g., inducing apoptosis in a cancer cell.
  • a variety of assays known in the art can be used to detect induction of apoptosis.
  • DOHH-2 or Jurkat cells are contacted with a candidate antibody agonist and then monitored for viability as a function of antibody concentration. Reduced cell viability (e.g., caused by increased apoptosis) with increased antibody concentration indicates that the antibody is an agonist.
  • Cell viability can be assayed by adding Alamar blue, which fluoresces in the presence of living, but not dead, cells.
  • agonist antibodies can be identified by screening hybridomas raised against DR4 or DR5 and then screening the hybridoma supernatant for the ability to induce apoptosis in DOHH-2 or Jurkat cells. Appropriate positive and negative controls can be used to confirm the results. For example, a cell line that does not go through DR4 or DR5-mediated TRAIL induced apoptosis should not go through apoptosis in response to a candidate anti-DR4 or anti-DR5 agonist.
  • the present invention relates to a method for the prevention of treatment of proliferative diseases or diseases that are triggered by persistent angiogenesis in a mammal, preferably a human patient, which comprises treating the patient concurrently or sequentially with pharmaceutically effective amounts of a combination of (a) an Anti-DR5
  • Antibody and (b) an pharmaceutically active agent.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a combination of (a) an Anti-DR5 Antibody; and (b) a pharmaceutically active agent.
  • the present invention provides a pharmaceutical preparation comprising (a) an Anti-DR5 Antibody; and (b) one or more pharmaceutically active agents, together with a pharmaceutically acceptable carrier.
  • the present invention provides a pharmaceutical preparation comprising (a) an Anti-DR5 Antibody; and (b) one or more pharmaceutically active agents selected from the group consisting of an aromatase inhibitor; an antiestrogen; an anti-androgen; a gonadorelin agonist; a topoisomerase I inhibitor; a topoisomerase II inhibitor; a microtubule active agent; an alkylating agent; an anti-neoplastic anti-metabolite; a platin compound; a compound targeting/decreasing a protein or lipid kinase activity or a protein or lipid phosphatase activity, a anti-angiogenic compound; a compound which induces cell differentiation processes; monoclonal antibodies; a cyclooxygenase inhibitor; a bisphosphonate; a heparanase inhibitor; a biological response modifier; an inhibitor of Ras oncogenic isoforms; a telomerase inhibitor; a proteas
  • the pharmaceutically active agent is selected from an FIDAC inhibitor, including e.g., LBH589; protein-tyrosine kinase inhibitors, including, e.g., Gleevec and/or AMNl 07; and/or microtubule stabilizing, microtubule destabilizing agents and microtublin polymerization inhibitors, including, e.g., taxol.
  • an FIDAC inhibitor including e.g., LBH589
  • protein-tyrosine kinase inhibitors including, e.g., Gleevec and/or AMNl 07
  • microtubule stabilizing, microtubule destabilizing agents and microtublin polymerization inhibitors including, e.g., taxol.
  • Preferred diseases include haematological cell related diseases, including CML, and solid cancers.
  • Solid cancer include but are not limited to, e.g., cancers of the breast, colon, prostate.
  • the present invention provides a pharmaceutical preparation comprising (a) an Anti-DR5 Antibody); and (b) one or more pharmaceutically active agents selected from the group consisting of select specific chemical compounds from the list of examples.
  • any of the combination of components (a) and (b), the method of treating a warmblooded animal comprising administering these two components, a pharmaceutical composition comprising these two components for simultaneous, separate or sequential use, the use of the combination for the delay of progression or the treatment of a proliferative disease or for the manufacture of a pharmaceutical preparation for these purposes or a commercial product comprising such a combination of components (a) and (b), all as mentioned or defined above, will be referred to subsequently also as COMBINATION OF THE INVENTION (so that this term refers to each of these embodiments which thus can replace this term where appropriate).
  • Simultaneous administration may, e.g., take place in the form of one fixed combination with two or more active ingredients, or by simultaneously administering two or more active ingredients that are formulated independently.
  • Sequential use (administration) preferably means administration of one (or more) components of a combination at one time point, other components at a different time point, that is, in a chronically staggered manner, preferably such that the combination shows more efficiency than the single compounds administered independently (especially showing synergism).
  • Separate use (administration) preferably means administration of the components of the combination independently of each other at different time points, preferably meaning that the components (a) and (b) are administered such that no overlap of measurable blood levels of both compounds are present in an overlapping manner (at the same time).
  • combinations of two or more of sequential, separate and simultaneous administration are possible, preferably such that the combination component-drugs show a joint therapeutic effect that exceeds the effect found when the combination component-drugs are used independently at time intervals so large that no mutual effect on their therapeutic efficiency can be found, a synergistic effect being especially preferred.
  • delay of progression means administration of the combination to patients being in a pre-stage or in an early phase, of the first manifestation or a relapse of the disease to be treated, in which patients, e.g., a pre-form of the corresponding disease is diagnosed or which patients are in a condition, e.g., during a medical treatment or a condition resulting from an accident, under which it is likely that a corresponding disease will develop.
  • “Jointly therapeutically active” or “joint therapeutic effect” means that the compounds may be given separately (in a chronically staggered manner, especially a sequence-specific manner) in such time intervals that they preferably, in the warm-blooded animal, especially human, to be treated, still show a (preferably synergistic) interaction (joint therapeutic effect). Whether this is the case, can inter alia be determined by following the blood levels, showing that both compounds are present in the blood of the human to be treated at least during certain time intervals.
  • “Pharmaceutically effective” preferably relates to an amount that is therapeutically or in a broader sense also prophylactically effective against the progression of a proliferative disease.
  • a commercial package or "a product”, as used herein defines especially a "kit of parts” in the sense that the components (a) and (b) as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the components (a) and (b), i.e., simultaneously or at different time points. Moreover, these terms comprise a commercial package comprising (especially combining) as active ingredients components (a) and (b), together with instructions for simultaneous, sequential (chronically staggered, in time-specific sequence, preferentially) or (less preferably) separate use thereof in the delay of progression or treatment of a proliferative disease.
  • the parts of the kit of parts can then, e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts.
  • the time intervals are chosen such that the effect on the treated disease in the combined use of the parts is larger than the effect which would be obtained by use of only any one of the combination partners (a) and (b) (as can be determined according to standard methods.
  • the ratio of the total amounts of the combination partner (a) to the combination partner (b) to be administered in the combined preparation can be varied, e.g., in order to cope with the needs of a patient sub-population to be treated or the needs of the single patient which different needs can be due to the particular disease, age, sex, body weight, etc. of the patients.
  • there is at least one beneficial effect e.g., a mutual enhancing of the effect of the combination partners (a) and (b), in particular a more than additive effect, which hence could be achieved with lower doses of each of the combined drugs, respectively, than tolerable in the case of treatment with the individual drugs only without combination, producing additional advantageous effects, e.g., less side effects or a combined therapeutic effect in a non-effective dosage of one or both of the combination partners (components) (a) and (b), and very preferably a strong synergism of the combination partners (a) and (b).
  • a beneficial effect e.g., a mutual enhancing of the effect of the combination partners (a) and (b)
  • a more than additive effect which hence could be achieved with lower doses of each of the combined drugs, respectively, than tolerable in the case of treatment with the individual drugs only without combination
  • additional advantageous effects e.g., less side effects or a combined therapeutic effect in a non-effective dosage of one or both of the combination partners
  • any combination of simultaneous, sequential and separate use is also possible, meaning that the components (a) and (b) may be administered at one time point simultaneously, followed by administration of only one component with lower host toxicity either chronically, e.g., more than 3-4 weeks of daily dosing, at a later time point and subsequently the other component or the combination of both components at a still later time point (in subsequent drug combination treatment courses for an optimal anti-tumor effect) or the like.
  • the COMBINATION OF THE INVENTION can also be applied in combination with other treatments, e.g., surgical intervention, hyperthermia and/or irradiation therapy.
  • the pharmaceutical compositions according to the present invention can be prepared by conventional means and are those suitable for enteral, such as oral or rectal, and parenteral administration to mammals including man, comprising a therapeutically effective amount of a VEGF inhibitor and at least one pharmaceutically active agent alone or in combination with one or more pharmaceutically acceptable carriers, especially those suitable for enteral or parenteral application.
  • the pharmaceutical compositions comprise from about 0.00002 to about 100%, especially, e.g., in the case of infusion dilutions that are ready for use) of 0.0001 to 0.02%, or, e.g., in case of injection or infusion concentrates or especially parenteral formulations, from about 0.1% to about 95%, preferably from about 1 % to about 90%, more preferably from about 20% to about 60% - active ingredient (weight by weight, in each case).
  • Pharmaceutical compositions according to the invention may be, e.g., in unit dose form, such as in the form of ampoules, vials, dragees, tablets, infusion bags or capsules.
  • each of the combination partners employed in a formulation of the present invention may vary depending on the particular compound or pharmaceutical compositions employed, the mode of administration, the condition being treated and the severity of the condition being treated. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the condition.
  • an pharmaceutically active agent is selected from the group consisting of DNA topoisomerase I inhibitors; DNA topoisomerase II inhibitors; microtubule active agents; and anti-metabolites including agents which are inhibitors of thymidine production, inhibitors of vascular endothethial growth factor, DNA demethylating agents or protein-tyrosine kinase inhibitors, such as, e.g., ADRIAMYCIN, discodermolides and epothilones, 5-FU, Camptothecin, Imatinib (GLEEVEC), l-[4-chloroanilino]-4-[pyridylmethyl]-phthalazine succinate PTK787, 5-Aza dC (DECITABINE) and 5 -AZ AC YTIDINE; pharmaceutically acceptable salts or solvates thereof; and pharmaceutically acceptable prodrug esters thereof; and the patient to be treated is a human, an appropriate dose of, e.g.,
  • 5 FU is administered at a appropriate dose in the range from 100-1500 mg daily, e.g., 200 1000 mg/day, such as 200, 400, 500, 600, 800, 900 or 1000 mg/day, administered in one or two doses daily.
  • CAMPTOTHECIN is administered at a appropriate dose in the range from 100-1500 mg daily, e.g., 200-1000 mg/day, such as 200, 400, 500, 600, 800, 900 or 1000 mg/day, administered in one or two doses daily.
  • 5-AZACYTIDINE is administered at a appropriate dose in the range from 100-1500 mg daily, e.g., 200-1000 mg/day, such as 200, 400, 500, 600, 800, 900 or 1000 mg/day, administered in one or two doses daily.
  • DOXORUBICIN may be administered to a human in a dosage range varying from about 10-100 mg/m2/day, e.g., 25 or 75 mg/m2/day, e.g., as single dose;
  • Epirubicin may be administered to a human in a dosage range varying from about 10-200 mg/m2/day;
  • ID ARUBICIN may be administered to a human in a dosage range varying from about 0.5-50 mg/m2/day, e.g., 8 mg/m2/day during three days; and MITOXANTRONE may be administered to a human in a dosage range varying from about 2.5-25 mg/m2/day, e.g., 10-14 mg/m2/day during 5-8 days.
  • FADROZOLE may be administered orally to a human in a dosage range varying from about 0.5 mg/day to about 10 mg/day, preferably from about 1 mg/day to about 2.5 mg/day.
  • EXEMESTANE may be administered orally to a human in a dosage range varying from about 5 mg/day to about 200 mg/day, preferably from about 10 mg/day to about 25 mg/day, or parenterally from about 50-500 mg/day, preferably from about 100 mg/day to about 250 mg/day.
  • FORMESTANE may be administered parenterally to a human in a dosage range varying from about 100-500 mg/day, preferably from about 250 mg/day to about 300 mg/day.
  • ANASTROZOLE may be administered orally to a human in a dosage range varying from about 0.25-20 mg/day, preferably from about 0.5 mg/day to about 2.5 mg/day.
  • TAMOXIFEN citrate may be administered to a human in a dosage range varying from about 10-40 mg/day.
  • VINBLASTINE (not highly recommended as secondary malignancies may occur) may be administered to a human in a dosage range varying from about 1.5 10 mg/m2/day.
  • Vincristine sulfate may be administered parenterally to a human in a dosage range varying from about 0.025-0.05 mg/kg body weight * week.
  • VINORELBINE may be administered to a human in a dosage range varying from about 10-50 mg/m2/day.
  • PACLITAXEL may be administered to a human in a dosage range varying from about 50 300 mg/m2day.
  • DOCETAXEL may be administered to a human in a dosage range varying from about 25-100 mg/m2/day.
  • 5-FU may be administered to a human in a dosage range varying from about 50-1000 mg/m2/day, e.g., 500 mg/m2/day.
  • CAPECITABINE may be administered to a human in a dosage range varying from about 10-1000 mg/m2/day.
  • GEMCITABINE hydrochloride (not highly recommended as secondary malignancies may occur) may be administered to a human in a dosage range varying from about 1000 mg/week.
  • METHOTREXATE may be administered to a human in a dosage range varying from about 5-500 mg/m2/day.
  • IRINOTECAN may be administered to a human in a dosage range varying from about 50-350 mg/m2/day.
  • CARBOPLATIN may be administered to a human in a dosage range varying from about 200-400 mg/m2 about every four weeks.
  • CISPLATIN may be administered to a human in a dosage range varying from about 25 75 mg/m2 about every three weeks.
  • OXALIPLATIN may be administered to a human in a dosage range varying from about 50-85 mg/m2 every two weeks.
  • Alendronic acid may be administered to a human in a dosage range varying from about 5-10 mg/day.
  • Clodronic acid may be administered to a human, e.g., in a dosage range varying from about 750 1500 mg/day.
  • Etridonic acid may be administered to a human in a dosage range varying from about 200-400 mg/day.
  • Ibandronic acid may be administered to a human in a dosage range varying from about 1-4 mg every 3-4 weeks.
  • Risedronic acid may be administered to a human in a dosage range varying from about 20-30 mg/day.
  • Pamidronic acid may be administered to a human in a dosage range varying from about 15- 90 mg every 3-4 weeks.
  • Tiludronic acid may be administered to a human in a dosage range varying from about 200-400 mg/day.
  • Trastuzumab may be administered to a human in a dosage range varying from about 1-4 mg/m2/week.
  • Bicalutamide may be administered to a human in a dosage range varying from about 25-50 mg/m2day.
  • Tyrphostins are preferably administered to a warm-blooded animal, especially a human in a dosage in the range of about 1-6000 mg/day, more preferably 25- 5000 mg/day, most preferably 50-4000 mg/day. Unless stated otherwise herein, the compound is preferably administered from one to 5, especially from 1-4 times per day.
  • Pharmaceutical preparations for the combination therapy for enteral or parenteral administration are, e.g., those in unit dosage forms, such as sugar-coated tablets, capsules or suppositories, and furthermore ampoules.
  • these formulations are prepared by conventional means, e.g., by means of conventional mixing, granulating, sugar-coating, dissolving or lyophilizing processes. It will be appreciated that the unit content of a combination partner contained in an individual dose of each dosage form need not in itself constitute an effective amount since the necessary effective amount can be reached by administration of a plurality of dosage units. One of skill in the art has the ability to determine appropriate pharmaceutically effective amounts of the combination components.
  • the compounds or the pharmaceutically acceptable salts thereof are administered as an oral pharmaceutical formulation in the form of a tablet, capsule or syrup; or as parenteral injections if appropriate.
  • any pharmaceutically acceptable media may be employed such as water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents.
  • Pharmaceutically acceptable carriers include starches, sugars, microcrystalline celluloses, diluents, granulating agents, lubricants, binders, disintegrating agents.
  • Solutions of the active ingredient, and also suspensions, and especially isotonic aqueous solutions or suspensions, are useful for parenteral administration of the active ingredient, it being possible, e.g., in the case of lyophilized compositions that comprise the active ingredient alone or together with a pharmaceutically acceptable carrier, e.g., mannitol, for such solutions or suspensions to be produced prior to use.
  • a pharmaceutically acceptable carrier e.g., mannitol
  • compositions may be sterilized and/or may comprise excipients, e.g., preservatives, stabilizers, wetting and/or emulsifying agents, solubilizers, salts for regulating the osmotic pressure and/or buffers, and are prepared in a manner known per se, e.g., by means of conventional dissolving or lyophilizing processes.
  • the solutions or suspensions may comprise viscosity-increasing substances, such as sodium carboxymethylcellulose, carboxymethylcellulose, dextran, polyvinylpyrrolidone or gelatin.
  • Suspensions in oil comprise as the oil component the vegetable, synthetic or semi-synthetic oils customary for injection purposes.
  • the isotonic agent may be selected from any of those known in the art, e.g. mannitol, dextrose, glucose and sodium chloride.
  • the infusion formulation may be diluted with the aqueous medium.
  • the amount of aqueous medium employed as a diluent is chosen according to the desired concentration of active ingredient in the infusion solution.
  • Infusion solutions may contain other excipients commonly employed in formulations to be administered intravenously such as antioxidants.
  • the present invention further relates to "a combined preparation", which, as used herein, defines especially a "kit of parts” in the sense that the combination partners (a) and (b) as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners (a) and (b), i.e., simultaneously or at different time points:
  • the parts of the kit of parts can then, e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts.
  • the ratio of the total amounts of the combination partner (a) to the combination partner (b) to be administered in the combined preparation can be varied, e.g., in order to cope with the needs of a patient sub-population to be treated or the needs of the single patient based on the severity of any side effects that the patient experiences.
  • the present invention especially relates to a combined preparation which comprises (a) one or more unit dosage forms of an Anti-DR5 Antibody; and (b) one or more unit dosage forms of an pharmaceutically active agent.
  • a proliferative disease is mainly a tumor disease (or cancer) (and/or any metastases), including a tumor which is a breast cancer, genitourinary cancer, lung cancer, gastrointestinal cancer, epidermoid cancer, melanoma, glioma, ovarian cancer, pancreas cancer, neuroblastoma, head and/or neck cancer or bladder cancer, or in a broader sense renal, brain or gastric cancer, in particular, (i) a breast tumor; an epidermoid tumor, such as an epidermoid head and/or neck tumor or a mouth tumor; a lung tumor, e.g., a small cell or non-small cell lung tumor; a gastrointestinal tumor, e.g., a colorectal tumor; or a gen
  • a proliferative disease may furthermore be a hyperproliferative condition, such as leukemias, hyperplasias, fibrosis (especially pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth muscle proliferation in the blood vessels, such as stenosis or restenosis following angioplasty.
  • a hyperproliferative condition such as leukemias, hyperplasias, fibrosis (especially pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth muscle proliferation in the blood vessels, such as stenosis or restenosis following angioplasty.
  • the combination of the present invention can also be used to prevent or treat diseases that are triggered by persistent angiogenesis, such as psoriasis; Kaposi's sarcoma; restenosis, e.g., stent-induced restenosis; endometriosis; Crohn's disease; Hodgkin's disease; leukemia; arthritis, such as rheumatoid arthritis; hemangioma; angiofibroma; eye diseases, such as diabetic retinopathy and neovascular glaucoma; renal diseases, such as glomerulonephritis; diabetic nephropathy; malignant nephrosclerosis; thrombotic microangiopathic syndromes; transplant rejections and glomerulopathy; fibrotic diseases, such as cirrhosis of the liver; mesangial cell-proliferative diseases; arteriosclerosis; injuries of the nerve tissue; and for inhibiting the re-occlusion of vessels after balloon catheter treatment, for use in
  • Combinations of the present invention include use for the treatment, prevention or inhibition of diseases characterized by cell proliferation and infiltration of inflammatory cells such as inflammation, RHA, asthma, chronic bronchitis, artheroschlerosis, and transplant rejection.
  • an Anti-DR5 antibody e.g., breast cancer, lung cancer, ovarian cancer, lymphoma, head and neck cancer and cancer of the colon, esophagus, stomach, bladder, prostrate, uterus and cervix.
  • compositions are selectively toxic or more toxic to rapidly proliferating cells than to normal cells, particularly in human cancer cells, e.g., cancerous tumors, the compound has significant anti-proliferative effects and promotes differentiation, e.g., cell cycle arrest and /or apoptosis.
  • the combinations are also useful for anti- death receptor therapy, such as treating, preventing and inhibiting tumor growth and metastasis, rheumatoid arthritis, ocular neovascularization and psoriasis.
  • the combinations can also be used as death receptor inhibitors in lymphangiogenesis.
  • the combinations can also be used to treat, inhibit or prevent c-kit indications, such as gastrointestinal stromal tumors or GIST, small cell lung cancer, dog mastocytosis and feline sarcoma viruses.
  • c-kit indications such as gastrointestinal stromal tumors or GIST, small cell lung cancer, dog mastocytosis and feline sarcoma viruses.
  • the proteasome inhibitor is a compound of formula I
  • Ri is unsubstituted or substituted aryl; arylalkylcarbonyl, wherein the aryl moiety is unsubstituted or substituted; unsubstituted or substituted heterocyclyl; or heterocyclylalkylcarbonyl, wherein the heterocyclyl moiety is unsubstituted or substituted;
  • R2 is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl;
  • R3 is hydrogen, unsubstituted or substituted aryl or alkyl which is unsubstituted or substituted by unsubstituted or substituted cycloalkyl, unsubstituted or substituted aryl, or unsubstituted or substituted heteroaryl comprising at least one nitrogen atom;
  • R4 is a moiety of the formula IA
  • Ai and A 2 are hydroxy or substituted hydroxy, or together with the binding boron atom and the two binding oxygen atoms form a ring of the formula IA*,
  • W is alkylene, substituted alkylene, unsubstituted or substituted cycloalkylene, unsubstituted or substituted bicycloalkylene or unsubstituted or substituted tricycloalkylene;
  • R5 is unsubstituted or substituted alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocyclyl, or unsubstituted or substituted cycloalkyl; or salts thereof.
  • Aryl preferably has a ring system of not more than 20 carbon atoms, especially not more than 12 carbon atoms, is preferably mono-, bi- or trie-cyclic, and is unsubstituted or substituted, preferably in each case unsubstituted or substituted phenyl or (especially 1- or 2-)naphthyl, one or more substituents preferably being independently selected from the group consisting of an aliphatic radical; free, etherif ⁇ ed or esterified hydroxy; free or esterif ⁇ ed carboxy; formyl; alkanoyl; unsubstituted, mono- or di-substituted amino; mercapto; sulfo; alkyl-thio; carbamoyl; N-alkyl- carbamoyl; NN-di-alkyl-carbamoyl; phenyl; naphthyl; heterocyclyl, especially pyridyl; cyano and
  • methyl, ethyl or propyl alkoxy, e.g. methoxy or ethoxy; di-substituted amino, e.g. dimethylamino; halogen, e.g. chloro or bromo; halogen-alkyl, e.g. trifluoromethyl; and phenyl, (especially 1- or 2-)-naphthyl, and heterocyclyl, especially as defined below, especially pyridyl, e.g. 3-, 4- or especially 2-pyridyl, each of which is unsubstituted or substituted with one or more, especially up to three, substituents, especially independently selected from the other aryl substitutents just mentioned.
  • Aryl R 1 is more preferably biphenylyl, especially 2-, 4- or preferably 3-biphenylyl, pyridylphenyl, especially A-, 3- or most especially 2- pyridyl-(2-, 4- or preferably 3-)phenyl, or lower alkyl-phenyl, especially propyl-phenyl, such as 2-, 4- or especially 3-isopropylphenyl.
  • Arylalkylcarbonyl R 1 (with unsubstituted or preferably substituted aryl) is preferably aryl-lower alkylcarbonyl with aryl as defined above, more preferably phenyl-lower alkyloxy-phenyl-lower alkylcarbonyl, especially 2-, 4- or preferably 3-benzyloxy- phenyl-acetyl or -propionyl, pyridyl-lower alkyloxyphenyl-lower alkylcarbonyl, especially 2-, 4- or preferably 3-(pyridin-2-, -4- or preferably -3-)-acetyl or —propionyl, or phenyl-lower alkylcarbonyl, especially phenyl-2- or preferably 3-phenyl-propionyl or phenylacetyl, wherein phenyl is unsubstituted or substituted by up to three substitutents independently selected from lower alkoxy, especially methoxy, hal
  • Unsubstituted or substituted aryl R 2 or (independently) R 3 is preferably mono-, di- or trisubstituted phenyl, especially substituted by up to four substituents independently selected from the substitutents mentioned for aryl, especially from hydroxy, lower alkoxy (most preferred), preferably methoxy, halogen, preferably fluoro or chloro, and halogen-lower alkyl, preferably trifluoromethyl, especially phenyl substituted by up to three lower alkoxy, preferably methoxy, substituents, or in case Of R 3 unsubstituted phenyl, or further unsubstituted or substituted napthyl, especially 1- or 2-naphthyl that is unsubstituted or substituted by up to four substituents independently selected from the substitutents mentioned for aryl, especially from hydroxy, lower alkoxy (most preferred), preferably methoxy, halogen, preferably fluoro or chloro, and hal
  • Unsubstituted heterocyclyl is preferably a heterocyclic radical that is unsaturated, saturated or partially saturated in the bonding ring and is preferably monocyclic or in a broader sense bicyclic or tricyclic ring; has 3 to 24, more preferably 4 to 16 ring atoms; wherein at least in the ring bonding to the radical of the molecule of formula I one or more, preferably one to four, especially one or two carbon atoms of a corresponding aryl radical are substituted by a heteroatom selected from the group consisting of nitrogen, oxygen and sulfur, the bonding ring preferably having 4 to 12, especially 5 to 7 ring atoms; heteroaryl being unsubstituted or substituted by one or more, especially 1 to 3, substitutents independently selected from the group consisting of the substituents defined above as substituents of substituted aryl; and especially being a heteroaryl radical selected from the group consisting of imidazolyl, thienyl, furyl, tetrahydr
  • Heterocyclyl is unsubstituted or substituted by one or more, preferably up to three, substitutents independently selected from those mentioned above for aryl (where heterocyclyl as substituent of heterocyclyl carries no further heterocyclyl substituent other than pyridyl or indolyl) and from aryl as defined above, especially phenyl, especially those mentioned as being preferred. Unsubstituted heterocyclyl is preferred.
  • heterocyclylalkylcarbonyl Ri the heterocyclyl moiety is preferably substituted or especially unsubstituted heterocyclyl as mentioned above; preferred is substituted or preferably unsubstituted heterocyclyl-lower alkyl, especially with terminal substituted or preferably unsubstituted heterocyclyl, with heterocyclyl as described above; preferred is pyridyl-lower alkylcarbonyl, such as -acetyl or -propionyl.
  • Heteroaryl R 2 is preferably unsubstituted or substituted heteroaryl as mentioned above, especially indolyl that is unsubstituted or substituted by one or more, especially up to three, substitutents independently selected from those mentioned above for substituted aryl, especially from hydroxy, lower alkoxy (most preferred), preferably methoxy, halogen, preferably fluoro or chloro, and halogen-lower alkyl, preferably trifluoromethyl.
  • R 2 is preferably substituted aryl.
  • An aliphatic radical preferably has up to 12 carbon atoms, preferably up to 7 carbon atoms, most preferably up to 4 carbon atoms, and is an aliphatic hydrocarbon radical, such as an unsubstituted or substituted alkynyl, alkenyl or preferably alkyl radical, more preferably lower alkyl, especially methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl or tert-butyl.
  • Alkyl which may be branched or linear, preferably has up to 12 carbon atoms, and is more preferably lower alkyl.
  • Alkyl R 3 is preferably lower alkyl, especially isobutyl.
  • the prefix "lower” denotes a radical having up to and including 7, preferably up to and including 4, carbon atoms.
  • Lower alkyl is, preferably, w-propyl, isopropyl, w-butyl, isobutyl, sec-butyl, /er/-butyl, M-pentyl, isopentyl, neopentyl, n-hexyl or «-heptyl, preferably isobutyl, sec-butyl, /er/-butyl, isopropyl, ethyl or methyl, most preferably isopropyl, ethyl or methyl.
  • Etherified hydroxy is, for example, alkoxy, especially lower alkoxy, such as ethoxy or methoxy, aryloxy, especially phenyloxy, aryl-lower alkoxy, especially phenyl-lower alkoxy, heterocyclyloxy, especially pyridyloxy, or heterocyclyl-lower alkoxy, especially pyridyl-lower alkoxy (aryl and heterocyclyl preferably have the meanings given above).
  • Esterified hydroxy is preferably hydroxy esterified by an organic carboxylic acid, such as an alkanoic acid, for example lower alkanoyloxy.
  • Esterified carboxy is, for example, alkoxycarbonyl, especially lower alkoxycarbonyl, such as e.g. methoxycarbonyl.
  • Mono- or di-substituted amino is, preferably, N-alkylamino or N,N-dialkylamino, especially N-lower alkylamino or lower NN-di-lower alkylamino, such as N-methylamino or N,N- dimethylamino.
  • Halogen is fluorine, chlorine, bromine or iodine, preferably fluorine, chlorine or bromine.
  • Unsubstituted or substituted cycloalkyl preferably has up to 12, more preferably 3 to 8 ring carbonyl atoms and is substituted by one or more, especially up to three, substitutents independently selected from those mentioned for substituted aryl, or preferably unsubstituted.
  • cyclopentyl cyclohexyl or cycloheptyl.
  • alkyl R 3 substituted with unsubstituted or substituted cycloalkyl is preferably as defined above, more preferably lower alkyl, especially isopropyl, and is (preferably terminally) substituted by cycloalkyl as defined above.
  • alkyl R 3 substituted with unsubstituted or substituted aryl alkyl is preferably as defined in the last paragraph, and aryl is defined as above and is substituted by one or more, especially up to three, substitutents independently selected from those mentioned for substituted aryl, or unsubstituted; especially aryl is phenyl substituted by one or more, especially up to three, substitutents independently selected from halogen, especially fluoro, hydroxy or lower alkoxy, especially methoxy, or it is unsubstituted phenyl.
  • alkyl R 3 substituted with unsubstituted or substituted heterocyclyl alkyl is preferably as defined for alkyl R 3 substituted with cycloalkyl, and heterocyclyl is defined as above and is substituted by one or more, especially up to three, substitutents independently selected from those mentioned for substituted heterocyclyl, or unsubstituted.
  • substituted hydroxy is preferably alkyloxy, especially lower alkyloxy, aryloxy, especially with unsubstituted or substituted aryl as defined above, or cycloalkyloxy with unsubstituted or substituted cycloalkyl as defined above.
  • W preferably carries the two oxygen atoms bound to the boron atom on two different carbon atoms that are spatially nearby or neighbouring carbon atoms, especially in vicinal ("1,2-”) or in "1,3 "-position (relatively to each other).
  • Alkylene is preferably an unbranched C 2 -Ci 2 -, preferably C 2 -C 7 alkylene moiety, e.g. ethylene, or propylene, in a broader aspect butylene, pentylene or hexylene, bound via two different carbon atoms as just described, preferably vicinal or in "l ,3"-position.
  • One or more, especially one, of the carbon atoms not bound to the oxygen atoms binding to the boron atom may be replaced by a heteroatom selected from O, S or preferably ⁇ (carrying the required number of H atoms, respectively), for example in l,5-(3-aza-pentylene).
  • Substituted alkylene is preferably an unbranched lower alkylene moiety as defined above which is subsituted or unsubstituted by one or more, especially up to three, substituents preferably independently selected from lower alkyl, such as methyl or ethyl, e.g. in 1- methylethylene, 1,2-dimethylethylene, hydroxy, e.g. in 2-hydroxy-propylene, or hydroxy-lower alkyl, such as hydroxymethyl, e.g. in 1-hydroxymethyl-ethylene.
  • substituents preferably independently selected from lower alkyl, such as methyl or ethyl, e.g. in 1- methylethylene, 1,2-dimethylethylene, hydroxy, e.g. in 2-hydroxy-propylene, or hydroxy-lower alkyl, such as hydroxymethyl, e.g. in 1-hydroxymethyl-ethylene.
  • Unsubstituted or substituted cycloalkylene is preferably C 3 -C 12 -, more preferably C 3 -C 8 - cycloalkylene bound via two different carbon atoms as described for W, preferably vicinal or in "1,3 "-position, such as cyclohexylene or cyclopentylene, in which one or more, especially one, of the carbon atoms not bound to the oxygen atoms binding to the boron atom may be replaced by a heteroatom selected from O, S or N (carrying the required number of H atoms, respectively), for example in tetrahydrofurylene or tetrahydropyranylene, and may be unsubstituted or substituted by one or more, especially up to three substituents independently selected from lower alkyl, such as methyl or ethyl, hydroxy, hydroxy-lower alkyl, such as methoxy, or mono- or oligosaccharidyl bound via an
  • Unsubstituted or substituted Bicycloalkylene is preferably Cs-C ⁇ -bicycloalkylene bound via two different carbon atoms as described for W, preferably vicinal or in "l,3"-position, in which one or more, especially one, of the carbon atoms not bound to the oxygen atoms binding to the boron atom may be replaced by a heteroatom selected from O, S or N (carrying the required number of H atoms, respectively), and may be unsubstituted or substituted by one or more, especially up to three substituents independently selected from lower alkyl, such as methyl or ethyl, hydroxy and hydroxy-lower alkyl, such as methoxy.
  • Preferred is pinanylene (2,3-(2,6,6-trimethyl- bicyclo[3.1.1 ]heptane)).
  • Unsubstituted or substituted tricycloalkylene is preferably C 8 -Ci 2 -tricycloalkylene bound via two different carbon atoms as described for W, preferably vicinal or in "1,3 "-position, in which one or more, especially one, of the carbon atoms not bound to the oxygen atoms binding to the boron atom may be replaced by a heteroatom selected from O, S or N (carrying the required number of H atoms, respectively), and may be unsubstituted or substituted by one or more, especially up to three substituents independently selected from lower alkyl, such as methyl or ethyl, hydroxy and hydroxy-lower alkyl, such as methoxy.
  • lower alkyl such as methyl or ethyl, hydroxy and hydroxy-lower alkyl, such as methoxy.
  • R 4 is -B(OH) 2 or 2,9,9-trimethyl-3,5-dioxa-4-bora- tricyclo[6.1.1.0 2 ' 6 ]dec-4-yl, especially (I S, 2S,6R,8S)-2,9,9-trimethyl-3,5-dioxa-4-bora- tricyclo[6.1.1.0 2 ' 6 ]dec-4-yl.
  • alkyl which may be branched or linear, preferably has up to 12 carbon atoms, and is more preferably lower alkyl.
  • Alkyl R 5 is preferably lower alkyl, especially isopropyl.
  • Substituents are independently selected from unsubstituted or substituted aryl (especially phenyl or hydroxyphenyl), unsubsituted or substituted heterocyclyl (especially imidazolyl or indolyl), unsubstituted or substituted cycloalkyl, each as defined above; hydroxy (preferred), carboxy (preferred), carbamoyl, mercapto, lower alkylthio, e.g. methylthio, phenyl, hydroxyphenyl, indolyl, imidazolyl, amino, tri-lower alkylamino, e.g.
  • R 5 may be methyl, isopropyl, isobutyl, sec- butyl, mercaptomethyl, 2-methylthioethyl, phenylmethyl, hydroxyphenylmethyl, indol-3-ylmethyl, hydroxymethyl, 1 -hydroxyethyl, 2-hydroxyethyl, carbamoylmethyl, 2-carbamoylethyl, 4- aminobutyl, 3-guanidinopropyl, 5-imidazolylmethyl, carboxymethyl or 2-carboxyethyl.
  • Asymmetric carbon atoms of a compound of formula I that are present may exist in the (R), (S) or (R,S) configuration, preferably in the (R) or (S) configuration, most preferably in the configuration indicated in formula I* below.
  • the compounds may thus be present as mixtures of isomers or preferably as pure isomers.
  • Salt-forming groups in a compound of formula I are groups or radicals having basic or acidic properties.
  • Compounds having at least one basic group or at least one basic radical, for example amino, a secondary amino group not forming a peptide bond or a pyridyl radical may form acid addition salts, for example with inorganic acids, such as hydrochloric acid, sulfuric acid or a phosphoric acid, or with suitable organic carboxylic or sulfonic acids, for example aliphatic mono- or di-carboxylic acids, such as trifluoroacetic acid, acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, fumaric acid, hydroxymaleic acid, malic acid, tartaric acid, citric acid or oxalic acid, or amino acids such as arginine or lysine, aromatic carboxylic acids, such as benzoic acid, 2- phenoxy-benzoic acid, 2-acetoxy-benzoic acid, salicylic acid
  • Compounds of formula I having acidic groups may form metal or ammonium salts, such as alkali metal or alkaline earth metal salts, for example sodium, potassium, magnesium or calcium salts, or ammonium salts with ammonia or suitable organic amines, such as tertiary monoamines, for example triethylamine or tri-(2-hydroxyethyl)-amine, or heterocyclic bases, for example N-ethyl-piperidine or NN'-dimethylpiperazine. Mixtures of salts are possible.
  • Compounds of formula I having both acidic and basic groups can form internal salts.
  • Exemplary compounds of formula I include those wherein
  • Ri is either substituted aryl-lower alkylcarbonyl or unsubstituted or substituted aryl
  • R 2 is substituted aryl or unsubstituted or substituted heterocyclyl
  • R 3 is lower alkyl, unsubstituted or substituted aryl or lower alkyl which is substituted by unsubstituted or substituted aryl
  • R 4 is a moiety of the formula IA given above wherein Ai and A 2 are hydroxy, lower alkyloxy, aryloxy with unsubstituted or substituted aryl or cycloalkyloxy with unsubstituted or substituted cycloalkyl, or wherein Ai and A 2 , together with the binding boron atom and the two binding oxygen atoms form a ring of the formula IA* given above wherein W is unsubstituted or substituted lower alkylene bound via two different carbon atoms that are spatially nearby or vicinal, especially in vicinal or, relatively to each other, in "1,3"- position, and
  • R 5 is lower alkyl, or salts thereof.
  • Exemplary compounds of formula I include those wherein
  • R 1 is phenyloxyphenyl-lower alkylcarbonyl; phenyl-lower alkoxyphenyl-lower alkylcarbonyl; pyridyloxyphenyl-lower alkylcarbonyl; phenyl-lower alkylcarbonyl substituted by lower alkoxy, especially methoxy, halogen, especially fluoro or chloro, or halogen-lower alkyl, especially trifluoromethyl; or preferably unsubstituted or substituted phenyl or naphthyl, wherein in both cases the substituents if present are independently one or more, especially one to three, substituents selected from the group consisting of lower alkyl, hydroxy, lower alkoxy, lower alkanoyloxy, carboxy, lower alkoxycarbonyl, formyl, lower alkanoyl, amino, N-lower alkylamino, N,N-di-lower alkylamino, mercapto, sul
  • R2 is phenyl substituted by one or more, especially one to three, moieties independently selected from the group consisting of hydroxy, lower alkoxy, especially methoxy, halogen, especially fluoro or chloro, and halogen-lower alkyl, especially trifluoromethyl;
  • R3 is lower alkyl, especially isobutyl, phenyl or phenyl substituted by one or more, especially up to three substituents independently selected from the group consisting of hydroxy, lower alkoxy, especially methoxy, halogen, especially fluoro or chloro, and halogen-lower alkyl, especially trifluoromethyl;
  • R4 is -B(OH)2 (especially preferred) or 2,9,9-trimethyl-3,5-dioxa-4-bora- tricyclo[6.1.1.02,6]dec-4-yl, especially (IS, 2S,6R,8S)-2,9,9-trimethyl-3,5-dioxa-4-bora- tricyclo[6.1.1.02,6]dec-4-yl; and
  • R5 is lower alkyl, especially isopropyl; or salts thereof.
  • Exemplary compounds of formula I include those wherein
  • R] is phenyloxyphenylacetyl, benzyloxyphenylacetyl, pyridyloxyphenylacetyl, biphenylyl, pyridylphenyl, lower alkylphenyl or substituted phenylpropionyloxy wherein the phenyl substituents are up to three substituents independently selected from the group consisting of methoxy, fluoro, chloro and trifluoromethyl; R2 is phenyl substituted with up to three methoxy substituents, especially 2,3,4- trimethoxyphenyl or 3,4,5-trimethoxyphenyl; R3 is isobutyl or phenyl that is unsubstituted or substituted with up to three moieties independently selected from hydroxy, fluoro and methoxy; R4 is (l S,2S,6R,8S)-2,9,9-trimethyl-3,5-dioxa-4-bora-tricyclo[6.1.1.02,6
  • R5 is isopropyl; or salts thereof.
  • Exemplary compounds of formula I include those wherein
  • Ri is biphenylyl, lower alkyl-phenyl, phenyl-lower alkyl-carbonyl, phenoxy-phenyl-lower alkyl- carbonyl, phenyl-lower alkoxy-phenyl-lower alkyl-carbonyl or pyridyl-phenyl;
  • R2 is either phenyl substituted by 1 to 3 lower alkoxy radicals or phenyl-lower alkoxy-phenyl;
  • R3 is lower alkyl or phenyl-lower alkyl;
  • R4 is 4,4,5,5-tetramethyl-[l,3,2]dioxaborolan-2-yl, (l S,2S,6R,8S)-2,9,9-trimethyl-3,5-dioxa-4- bora-tricyclo[6.1.1.02,6]dec-4-yl or -B(OH)2; and
  • R5 is lower alkyl; or salts thereof
  • the compounds of formula I or salts thereof are prepared in accordance with processes known.
  • the processes preferably comprise a) reacting a dipeptide analogue of the formula II,
  • R3, R4 and R5 have the meanings given under formula I, with an amino acid of the formula III,
  • Rl and R2 have the meanings given under formula I, functional groups present in a compound of formula II and/or III, with the exception of the groups participating in the reaction, being protected if necessary by readily removable protecting groups, and any protecting groups present are removed, or b) for the production of a compound of the formula I wherein Ri is arylalkylcarbonyl or heterocyclylalkylcarbonyl and the other moieties R 2 to R 5 have the meanings given under formula I, reacting an amino compound of the formula IV,
  • R2, R3, R4 and R5 have the meanings given under formula I, with a carbonic acid of the formula V,
  • OH K OH K ; or a reactive derivative thereof, wherein Rl is arylalkylcarbonyl or heterocyclylalkylcarbonyl, functional groups present in a compound of formula IV and/or V, with the exception of the groups participating in the reaction, being protected if necessary by readily removable protecting groups, and any protecting groups present are removed, and, if desired, converting a compound of formula I obtained by process a) or b) into another compound of formula I, converting an obtained free compound of formula I into a salt, converting an obtained salt of a compound of formula I into a different salt or into its free form, and/or separating a mixture of isomeric compounds of formula I into the individual isomers.
  • compounds of formula I can be prepared by using educts with the appropriate configuration.
  • compounds of formula I* or salts thereof can be prepared by a) reacting a dipeptide analogue of the formula II*,
  • R3, R4 and R5 have the meanings given under formula I, with an amino acid of the formula III*,
  • Rl and R2 have the meanings given under formula I, functional groups present in a compound of formula II* and/or III*, with the exception of the groups participating in the reaction, being protected if necessary by readily removable protecting groups, and any protecting groups present are removed, or b) for the production of a compound of the formula I* wherein Ri is arylalkylcarbonyl or heterocyclylalkylcarbonyl and the other moieties R 2 to R 5 have the meanings given under formula I, reacting an amino compound of the formula IV*, wherein R2, R3, R4 and R5 have the meanings given under formula I, with a carbonic acid of the formula V,
  • Rl is arylalkylcarbonyl or heterocyclylalkylcarbonyl, functional groups present in a compound of formula IV* and/or V, with the exception of the groups participating in the reaction, being protected if necessary by readily removable protecting groups, and any protecting groups present are removed, and, if desired, converting a compound of formula I* obtained by process a) or b) into another compound of formula I*, converting an obtained free compound of formula I* into a salt, or converting an obtained salt of a compound of formula I* into a different salt or into its free form.
  • the end products of formula I may contain substituents that can also be used as protecting groups in starting materials for the preparation of other end products of formula I, e.g. in the case of R 4 other than -B(OH) 2 .
  • R 4 other than -B(OH) 2 .
  • a readily removable group that is not a constituent of the particular desired end product of formula I is designated a "protecting group", unless the context indicates otherwise.
  • a characteristic of protecting groups is that they can be removed readily (i.e. without the occurrence of undesired secondary reactions) for example by solvolysis, reduction, photolysis or alternatively under physiological conditions (e.g. by enzymatic cleavage).
  • Removal of a protecting group for the -B(OH) 2 -group preferably takes place with an acid, e.g. hydrogen chloride, in an appropriate solvent, e.g. a lower alkanol, such as methanol, or a lower alkane, such as hexane, or a mixture thereof, at temperatures of 0 to 50 0 C, e.g. at room temperature.
  • an acid e.g. hydrogen chloride
  • the reaction mixture is preferably stirred at a temperature of between approximately -20 0 C and 50 0 C, especially between 0 0 C and room temperature, to yield a compound of formula I.
  • the reaction is preferably carried out under an inert gas, e.g. nitrogen or argon.
  • reaction is preferably carried out under conditions analogous to those described for process a).
  • Salts of a compound of formula I with a salt- forming group may be prepared in a manner known per se. Acid addition salts of compounds of formula I may thus be obtained by treatment with an acid or with a suitable anion exchange reagent.
  • Salts can usually be converted to free compounds, e.g. by treating with suitable basic agents, for example with alkali metal carbonates, hydrogencarbonates, or hydroxides, typically potassium carbonate or sodium hydroxide.
  • suitable basic agents for example with alkali metal carbonates, hydrogencarbonates, or hydroxides, typically potassium carbonate or sodium hydroxide.
  • Stereoisomeric mixtures e.g. mixtures of diastereomers
  • Diastereomeric mixtures for example may be separated into their individual diastereomers by means of fractionated crystallization, chromatography, solvent distribution, and similar procedures. This separation may take place either at the level of one of the starting compounds or in a compound of formula I itself.
  • Enantiomers may be separated through the formation of diastereomeric salts, for example by salt formation with an enantiomer-pure chiral acid, or by means of chromatography, for example by HPLC, using chromatographic substrates with chiral ligands.
  • the solvents from which those can be selected which are suitable for the reaction in question include for example water, esters, typically lower alkyl-lower alkanoate, e.g., diethyl acetate, ethers, typically aliphatic ethers, e.g. diethylether, or cyclic ethers, e.g.
  • tetrahydrofuran liquid aromatic hydrocarbons, typically benzene or toluene, alcohols, typically methanol, ethanol or 1- or 2-propanol, nitriles, typically acetonitrile, halogenated hydrocarbons, typically dichloromethane, acid amides, typically dimethylformamide, bases, typically heterocyclic nitrogen bases, e.g. pyridine, carboxylic acids, typically lower alkanecarboxylic acids, e.g. acetic acid, carboxylic acid anhydrides, typically lower alkane acid anhydrides, e.g.
  • acetic anhydride cyclic, linear, or branched hydrocarbons, typically cyclohexane, hexane, or isopentane, or mixtures of these solvents, e.g. aqueous solutions, unless otherwise stated in the description of the process.
  • solvent mixtures may also be used in processing, for example through chromatography or distribution.
  • New starting materials and/or intermediates, as well as processes for the preparation thereof, are likewise the subject of this invention.
  • such starting materials are used and reaction conditions selected such as to allow the manufacture of the preferred compounds.
  • the starting materials of formulae II - V or their precursors are known, can be prepared according to known processes, or are commercially obtainable; in particular, they can be prepared using processes identical or in analogy to those described in the Examples.
  • a compound of formula II, wherein the substituents are as defined above under formula I, is obtainable for example by the following reactions: [00248] First, a boronic acid analogue of an amino acid of the formula VI comprising for example the configuration as indicated in formula VI*
  • R3 has the meanings given above for compounds of formula I and R4 has the meanings other than -B(OH)2 mentioned above for compounds of formula I, especially is (1 S,2S,6R,8S)- i j P j P-trimethyl-S ⁇ -dioxa ⁇ -bora-tricyclot ⁇ .l .l .O ⁇ dec ⁇ -yl, or an acid addition salt thereof, especially the salt thereof with trifluoroacetic acid, is condensed with an amino acid of the formula VII comprising for example the configuration as indicated in formula VII*
  • R 5 has the meanings given above for compounds of the formula I and P ⁇ is a protected amino group, preferably tert-butoxycarbonylamino, under reaction conditions analogous to those described for reaction a) above (also a condensation reaction, also preferably with in situ formation of active carbonic acid derivatives), thus yielding a compound of formula II in N-protected form which is then N-deprotected, e.g. using conditions described in the standard textbooks mentioned above, in the case of tert-butoxycarbonylamino e.g. with hydrochloric acid in an appropriate solvent, e.g. dioxane and/or methylene chloride giving a compound of the formula II that can be used directly in process a).
  • R 5 has the meanings given above for compounds of the formula I and P ⁇ is a protected amino group, preferably tert-butoxycarbonylamino, under reaction conditions analogous to those described for reaction a) above (also a condensation reaction, also preferably with in situ formation of active carbon
  • boronic acids of the formula VI are known, commercially available and/or can be synthesized according to known procedures.
  • compounds of the formula VI wherein R 3 is lower alkyl, especially isobutyl and R 4 is as described for compounds of the formula VI, preferably (lS,2S,6R,8S)-2,9,9-trimethyl-3,5-dioxa-4-bora-tricyclo[6.1.1.0 2>6 ]dec-4-yl can be prepared by reacting a compound of the formula VIII,
  • R 4 has the meanings just described, in an appropriate solvent, e.g. methylene chloride, with n-lower alkyl lithium, especially n-butyllithium, and subsequently with zinc chloride, yielding a compound of the formula IX,
  • R4 has the meanings given above under formula VI.
  • This compound is then reacted with LiN(SiCH 3 ) 2 , and the resulting compound of the formula is then reacted in the presence of trifluoro acetic acid to yield the salt of the formula X, wherein R 4 has the meanings given under formula VI, which is a compound of the formula VI and can then be used directly for reaction with the compound of formula VII as shown above.
  • R 4 has the meanings given under formula VI, which is a compound of the formula VI and can then be used directly for reaction with the compound of formula VII as shown above.
  • a compound of the formula III is known, commercially available and/or can be obtained according to standard procedures.
  • a compound of the formula III wherein R 1 is aryl, especially biphenylyl may be prepared by reacting a compound of the formula XI,
  • R2 has the meanings given for a compound of the formula I, which is known, commercially available or obtainable according to standard procedures, with a compound of the formula XII,
  • Rl-X (XII) wherein Rl is aryl and X is halogen, especially bromo, in an appropriate solvent, e.g. in dimethylformamide, in the presence of a base, especially an alkali metal carbonate, e.g. potassium carbonate, at temperatures between 50 and 100 0 C, e.g. at 90 0 C, preferably under inert gas, e.g. nitrogen or argon.
  • a base especially an alkali metal carbonate, e.g. potassium carbonate
  • inert gas e.g. nitrogen or argon.
  • Amino acid derivatives of the formula VII are known, commercially available or obtainable according to standard procedures. They are preferably used in the amino protected form, e.g. with tert-butoxycarbonylamino instead of the free amino group.
  • the apoptosis-inducing agent is a proteasome inhibitor from the 2,4-diamino-3-hyroxycarboxylic acid family of compounds. See, PCT WO 00/64863.
  • the proteasome inhibitor is a 2,4-diamino-3-hydroxycarboxylic acids of formula XIV,
  • a and B independently represent a bond or an unsubstituted or substituted aminoacyl moiety
  • Ri represents hydrogen; an amino protecting group; or a group of formula R 5 Y-wherein
  • R 5 represents hydrogen or an unsubstituted or substituted alkyl, alkenyl, alkinyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, heterocyclyl or heterocyclylalkyl group; and Y represents -CO-; -NH-CO-; -NH-CS-; -SO2-; -O-CO-; or -O-CS-; R 2 represents the side chain of a natural amino acid; an alkyl, arylalkyl, heteroarylalkyl or cycloalkylalkyl group; or trimethylsilylmethyl, 2-thienyimethyl or styrylmethyl; R 3 represents halogen, alkyl, alkoxy or hydroxyalkoxy; and
  • R4 represents 2(R)-hydroxyindan-l(S)-yl; (S)-2-hydroxy-l -phenylethyl; or 2-hydroxy-benzyl unsubstituted or substituted in 4 position by methoxy; wherein the 2,4-diamino-3- hydroxycarboxylic acid is in free form, is a pharmaceutically acceptable salt thereof or in a pharmaceutical composition.
  • Unsubstituted or substituted alkyl preferably is alkyl of 1 to 5 carbon atoms, preferably of 1 to 4 carbon atoms; e.g. methyl, ethyl, isopropyl or tert-butyl; it is especially of 1 or 4 carbon atoms.
  • the substituent is e.g. phenoxy, hydroxy or unprotected or protected amino.
  • Unsubstituted or substituted arylalkyl is e.g. phenylalkyl of altogether 7 to 10 carbon atoms, such as benzyl or 2-phenylethyl. It is unsubstituted or substituted in the aryl or alkyl moiety by e.g.
  • hydroxy such as in benzyl-CH(OH)- or phenyl -CH(CH 2 OH)-, by alkyl, amino or alkylamino; or is e.g. naphthylalkyl of 1 to 4 carbon atoms in the alkylene part, especially naphthylmethyl.
  • An amino protecting group preferably is benzyloxycarbonyl, cycloalkyialkoxycarbonyl, especially cyclohexylmethoxycarbonyl, or tert-butoxycarbonyl.
  • Unsubstituted or substituted heteroarylalkyl preferably is pyrldylalkyl, especially 2-pyridylmethyl and 4-pyddylmethyl.
  • Aryl, heteroaryl and the aryl parts of arylalkyl and heteroarylalkyl may be mono- or polycyclic, such as e.g. pyridyl, naphthyl, 9-fluorenylmethoxycarbonyl (FMOC) or benz-imidazolyl.
  • alkylene part of arylalkyl or heteroarylalkyl may be substituted by e.g. hydroxy.
  • a heterocyclyl group, and the heterocyclyl part of a heterocyclylalkyl group is a saturated heterocyclic group having one or more heteroatoms selected from nitrogen, oxygen and sulfur. It preferably has 5 or 6 ring constitutent atoms, and preferably up to 3 heteroatoms.
  • Cycloalkylalkyl preferably is cyclohexylalkyl; it preferably is of 1 to 4 carbon atoms in the alkylene part.
  • Halogen is fluorine, chlorine, bromine or iodine, preferably chlorine or bromine.
  • Alkyl and alkoxy preferably are of 1 to 4 carbon atoms, especially of 1 or 2 carbon atoms, more especially methyl or methoxy.
  • Hydroxyalkoxy preferably is ⁇ -hydroxyalkoxy of 2 to 4 carbon atoms, especially 2- hydroxyethoxy.
  • a salt is e.g. an acid addition salt such as a hydrochloride.
  • the compounds of formula I have several chiral centers and can therefore exist in a variety of stereoisomers.
  • the invention provides all stereoisomers as well as racemic mixtures unless specified otherwise.
  • the isomers may be resolved or separated by conventional techniques, e.g. chromatographically. As appears from formula I the configuration at the carbon atom in the 2 position is R, in the 3 and 4 positions it is S.
  • R 1 preferably is hydrogen, pyridylalkoxycarbonyl, naphthylalkoxycarbonyl, naphthylalkylcarbonyl, benzyl-CH(OH)-carbonyl, phenoxymethylcarbonyl, phenylalkylcarbonyl or an amino protecting group such as tert.-butoxycarbonyl, cycloalkyialkoxycarbonyl, especially cyclohexylmethoxycarbonyl, or benzyloxycarbonyl which is unsubstituted or substituted by alkyl or amino; it especially is naphthylmethoxycarbonyl, naphthylmethylcarbonyl, pyridylmethoxycarbonyl, phenylpropionyl, aminophenylpropionyl, tert.-butoxycarbonyl, aminobenzyfoxycarbonyl, alkylbenzyloxycarbonyl, dialkylbenzyloxycarbonyl or benzy
  • A is an unsubstituted or substituted aminoacyl moiety
  • it preferably is an unsubstituted or substituted ⁇ -aminoacyl moiety such as alanine, leucine, isoleucine, asparagine, valine, tert-butylglycine, tert-leucine or histidine.
  • It preferably is the protected or unprotected moiety of a natural ⁇ -amino acid, preferably of an amino acid which is a normal constitutive part of proteins, or tent leucine. It preferably has the L configuration.
  • A is especially glycine, L-valine, L- tert-leucine or a bond, even more preferably L-tert-leucine.
  • R 2 preferably is the side chain of a natural amino acid, preferably of an ⁇ -amino acid, preferably of an amino acid which is a normal constitutive part of proteins. It is e.g. isopropyl, aminocarbonylmethyl, methyl, 1-methylpropyl, benzyl, 4-hydroxybenzyl or isobutyl, preferably benzyl.
  • B is an unsubstituted or substituted aminoacyl moiety
  • it preferably is an unsubstituted or substituted ⁇ -aminoacyl moiety, such as phenylalanine, valine, leucine, isoleucine, alanine or asparagine.
  • It preferably is the unsubstituted or substituted moiety of a natural ⁇ -amino acid, preferably of an amino acid which is a normal constitutive part of proteins.
  • ⁇ -Amino acids with a second carboxyl group e.g. glutaminic acid
  • Q-C 3 alcohol especially methanol. It preferably has the L-configuration.
  • B especially is L-valine, L-glutaminic acid methyl ester or a bond, even more preferably L-valine.
  • R 3 preferably is halogen, methyl or methoxy, especially methoxy.
  • R 4 preferably is 2(R)-hydroxyindan-l(S)-yl or 2-hydroxybenzyl unsubstituted or substituted as defined above, especially 2-hydroxy-4-methoxy-benzyl.
  • Y preferably is -CO- or -O-CO-, especially -O-CO-.
  • R 5 preferably is an unsubstituted or substituted alkyl, arylalkyl or heteroarylalkyl group, especially alkyl; when it is unsubstituted or substituted heteroarylalkyl it preferably is pyridylalkyl, especially 2-pyddylmethyl; when it is unsubstituted or substituted arylalkyl it preferably is benzyl-
  • the proteasome inhibitor is a 2-amino-3-hydroxy-4-tert-leucyl- amino-5-phenyl-pentanoic acid amide derivative. See, e.g., PCT 01/89282.
  • the proteasome inhibitors of the invention relate to compounds of formula XV
  • Rl and R2 are independently of the other an aliphatic radical, or an aromatic, aromatic- aliphatic, cycloaliphatic, cycloaliphatic-aliphatic, heterocyclic or heterocyclic-aliphatic radical, each radical having not more than 20 carbon atoms;
  • R3 is hydrogen, oxa-alkyl, an aliphatic radical or a radical with up to 20 carbon atoms of the formula -(Y)m-R6, wherein Y is alkyl, m is 0 or 1 and R6 is an unsubstituted or substituted monocyclic radical with 5 or 6 ring members containing up to 3 hetero atoms selected from the group consisting of nitrogen, oxygen and sulfur, wherein said monocyclic radical can also be fused to a benzo ring;
  • R4 and R5 are independently selected from the group consisting of hydrogen; an aliphatic radical ; free, etherified or esterified hydroxy; free or esterified carboxy; formyl; alkanol; unsubstituted, mono-or di-substituted amino; mercapto; sulfo; alkyl-thio; carbamoyl; N- alkyl-carbamoyl; N,N-di-alkyl-carbamoyl; cyano and nitro; wherein carbon containing radicals R4 and R5 have up to 12 carbon atoms, with the proviso that R4 and R5 are not both hydrogen if n is 1, Rl is benzyl or tert-butyl, R2 is benzyl or 4-methoxy-benzyl, R3 is isopropyl and X is oxygen and that R4 is not methoxy if n is 0 or 1, R2 is 4-methoxy- benzyl, R
  • n is 0 or 1, preferably 0.
  • An aliphatic radical has up to 12 carbon atoms, preferably up to 7 carbon atoms, most preferably up to 4 carbon atoms, and is such an unsubstituted or substituted aliphatic hydrocarbon radical, that is to say such an unsubstituted or substituted alkynyl, alkenyl or preferably alkyl radical, one or more substituents preferably being independently selected from the group consisting of free, etherified or esterified hydroxy; free or esterified carboxy; formyl; alkanol; unsubstituted, mono-or di-substituted amino; guanidino; mercapto; sulfo; alkyl-thio; carbamoyl; N-alkyl-carbamoyl; N, N- di-alkyl-carbamoyl; cyano and nitro.
  • An aliphatic radical Ri is preferably lower alkyl, such as especially tert-butyl.
  • An aliphatic radical R 3 is preferably unsubstituted lower alkyl or lower alkyl substituted by hydroxy, carboxy, amino, carbamoyl, guanidino, mercapto or alkyl-thio, most preferably a side chain of the amino acids alanine, leucine, isoleucine, serine, threonine, cysteine, methionine, asparagine, glutamin, aspartate, glutamate, lysine or arginine, especially valine.
  • An aliphatic radical R 4 is preferably methoxy.
  • An aromatic radical Ri or R 2 has not more than 20 carbon atoms, especially not more than 12 carbon atoms, and is unsubstituted or substituted, preferably in each case unsubstituted or substituted phenyl or naphthyl, especially 1 -naphthyl, one or more substituents preferably being independently selected from the group consisting of an aliphatic radical; free, etherified or esterified hydroxy; free or esterified carboxy; formyl; alkanol; unsubstituted, mono-or di-substituted amino; mercapto; sulfo; alkyl-thio; carbamoyl; N-alkyl-carbamoyl; N, N-di-alkyl-carbamoyl; cyano and nitro, more preferably being selected from alkyl, e.
  • methyl, ethyl or propyl alkoxy, e. g. methoxy or ethoxy; di-substituted amino, e. g. dimethylamino; halogen, e. g. chloro or bromo; and halogen- alkyl, e. g. trifluoromethyl.
  • an aromatic-aliphatic radical Ri or R 2 having not more than 20 carbon atoms the aromatic moiety is as defined above and the aliphatic moiety is preferably lower alkyl, such as especially CpC 2 alkyl, which is substituted preferably as defined for the aromatic radical or preferably unsubstituted.
  • An aromatic-aliphatic radical Ri is preferably benzyl or naphthalen-1- ylmethyl.
  • An aromatic-aliphatic radical R 2 is preferably benzyl substituted in the benzene moiety by 1-5, preferably by 1-3 methoxy groups; benzyl substituted in the benzene moiety, preferably in position 4, by a dimethyl-amino group; or naphthalen-1-ylmethyl. Most preferably an aromatic- aliphatic radical R2 is 2,3,4- or 3,4,5-trimethoxy-benzyl.
  • a cycloaliphatic radical R] or R 2 has up to 20, especially up to 10 carbon atoms, is mono-or poly-cyclic and is substituted preferably as defined for the aromatic radical or preferably unsubstituted, for example such a cycloalkyl radical, especially such a 5-or 6-membered cycloalkyl radical, such as preferably cyclohexyl.
  • a cycloaliphatic-aliphatic radical Ri or R 2 having not more than 20 carbon atoms the cycloaliphatic moiety is as defined above and the aliphatic moiety is preferably lower alkyl, such as especially C r C 2 alkyl, which is substituted preferably as defined for the aromatic radical or preferably unsubstituted, for example cyclohexyl-methyl.
  • a heterocyclic radical R 1 or R 2 contains up to 20 carbon atoms, generally up to 12 carbon atoms, and is substituted preferably as defined for the aromatic radical or unsubstituted and is preferably a saturated or unsaturated monocyclic radical having 5 or 6 ring members and 1 to 3 hetero atoms which are preferably selected from the group consisting of nitrogen, oxygen and sulfur, for example, thienyl or pyridyl, or a bi-or tri-cyclic radical wherein, for example, a benzene radical is fused to the mentioned monocyclic radical, especially, for example, indolyl, such as 5-indolyl, or chinolyl, such as 8-chinolyl.
  • heterocyclic-aliphatic radical R] or R 2 having not more than 20 carbon atoms the heterocyclic moiety is as defined above and the aliphatic moiety is preferably lower alkyl, such as especially C r C 2 alkyl, which is substituted preferably as defined for the aromatic radical or preferably unsubstituted.
  • a heterocyclic-aliphatic radical Ri or R 2 is for example indolyl-methyl, especially 5-indolyl-methyl, or chinolyl-methyl, especially 8-chinolyl-methyl.
  • Oxa-alkyl R 3 is a radical of the formula -G(O-CH 2 -CH 2 ),-R 7 , in which G and R 7 are alkyl, e.g., lower alkyl, and t is 1 to 3, preferably 2, and is especially 2-(l,4-dioxa-hexyl)-ethyl.
  • Y is alkyl, preferably lower alkyl
  • m is 0 or 1
  • the radical Re is a saturated or unsaturated monocyclic radical having 5 or 6 ring members and up to 3 hetero atoms selected from the group consisting of nitrogen, oxygen and sulfur and alternatively containing a fused benzo ring, such a radical being substituted preferably as defined for the aromatic radical or preferably unsubstituted.
  • a radical R 6 is preferably bound to Y via a ring carbon atom and is for example an unsubstituted or substituted member selected from the group consisting of cyclopentyl, cyclohexyl, cyclopentadienyl, phenyl, pyrrolidyl, pyrazolidyl, imidazolidyl, tetrahydrofuryl, piperidyl, piperazinyl, morpholinyl, pyrrolyl, pyrazolyl, imidazolyl, furyl, thienyl, pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl, indenyl, naphthyl, indolyl and chinolyl.
  • a radical of the formula -(Y) 01 -R 6 is piperidyl, especially 4-piperidyl, piperazin-ethyl, especially piperazin-1-ylethyl, morpholinyl-ethyl, especially morpholin-4-ylethyl, pyridyl-methyl, such as 2-, 3-or 4-pyridyl-methyl, or a side chain of the amino acids phenylalanine, tyrosine, tryptophane or histidine.
  • X is preferably oxygen (-O-).
  • Alkyl is preferably lower alkyl.
  • Lower alkyl is, for example, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n- pentyl, isopentyl, neopentyl, n-hexyl or n-heptyl, preferably isobutyl, sec-butyl, tert-butyl, isopropyl, ethyl or methyl, most preferably isobutyl, ethyl or methyl.
  • Etherif ⁇ ed hydroxy is, for example, alkoxy, especially lower alkoxy, such as ethoxy or methoxy.
  • Esterified hydroxy is preferably hydroxy esterified by an organic carboxylic acid, such as alkanoic acid, or a mineral acid, such as a hydrohalic adic, for example lower alkanoyloxy or especially halogen, such as iodine or especially fluorine, chlorine or bromine.
  • Esterified carboxy is, for example, alkoxycarbonyl, especially lower alkoxycarbonyl, such as e. g. methoxycarbonyl.
  • Alkanol is, i.e., alkylcarbonyl, especially lower alkylcarbonyl, such as e.g. acetyl.
  • Mono-or di-substituted amino is, for example, N-alkylamino or N, N-dialkylamino, especially N-lower alkylamino or lower N,N-di-lower alkylamino, such as e. g. N-methylamino or
  • Halogen is fluorine, chlorine, bromine or iodine, preferably fluorine, chlorine or bromine.
  • Salt-forming groups in a compound of Formula XV are groups or radicals having basic or acidic properties.
  • Compounds having at least one basic group or at least one basic radical may form acid addition salts, for example with inorganic acids, such as hydrochloric acid, sulfuric acid or a phosphoric acid, or with suitable organic carboxylic or sulfonic acids, for example aliphatic mono-or di-carboxylic acids, such as trifluoroacetic acid, acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, fumaric acid, hydroxymaleic acid, malic acid, tartaric acid, citric acid or oxalic acid, or amino acids such as arginine or lysine, aromatic carboxylic acids, such as benzoic acid, 2-phenoxy-benzoic acid, 2-acetoxy-benzoic acid, salicylic acid,
  • Compounds of Formula XV having acidic groups may form metal or ammonium salts, such as alkali metal or alkaline earth metal salts, for example sodium, potassium, magnesium or calcium salts, or ammonium salts with ammonia or suitable organic amines, such as tertiary monoamines, for example triethyl- amine or tri-(2-hydroxyethyl)-amine, or heterocyclic bases, for example N-ethyl-piperidine or N,N'-dimethyl- piperazine.
  • metal or ammonium salts such as alkali metal or alkaline earth metal salts, for example sodium, potassium, magnesium or calcium salts
  • ammonium salts with ammonia or suitable organic amines such as tertiary monoamines, for example triethyl- amine or tri-(2-hydroxyethyl)-amine, or heterocyclic bases, for example N-ethyl-piperidine or N,N'-dimethyl- piperazine.
  • the antibodies and agents of the invention can be administered directly to the mammalian subject for treatment, e.g., of hyperproliferative disorders including cancer such as, but not limited to: carcinomas, gliomas, mesotheliomas, melanomas, lymphomas, leukemias, adenocarcinomas, breast cancer, ovarian cancer, cervical cancer, glioblastoma, leukemia, lymphoma, prostate cancer, and Burkitt's lymphoma, head and neck cancer, colon cancer, colorectal cancer, non-small cell lung cancer, small cell lung cancer, cancer of the esophagus, stomach cancer, pancreatic cancer, hepatobiliary cancer, cancer of the gallbladder, cancer of the small intestine, rectal cancer, kidney cancer, bladder cancer, prostate cancer, penile cancer, urethral cancer, testicular cancer, cervical cancer, vaginal cancer, uterine cancer, ovarian cancer, thyroid cancer, parathyroid cancer, adrenal cancer,
  • cancer such
  • compositions of the present invention are by any of the routes normally used for introducing a chemotherapeutic compound into ultimate contact with the tissue to be treated.
  • the antibodies and agents are administered in any suitable manner, optionally with pharmaceutically acceptable carriers. Suitable methods of administering such antibodies and agents are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
  • compositions of the present invention are determined in part by the composition being administered, as well as by the method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present invention (see, e.g., Remington's Pharmaceutical Sciences, 17th ed. 1985)).
  • the antibodies and agents can be made into aerosol formulations (i.e., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
  • Formulations suitable for administration include aqueous and non-aqueous solutions, isotonic sterile solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • compositions can be administered, for example, by orally, topically, intravenously, intraperitoneally, intravesical Iy or intrathecally.
  • the compositions are administered nasally.
  • the formulations of compounds can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.
  • Solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • the modulators can also be administered as part a of prepared food or drug.
  • the compounds of the present invention can also be used effectively in combination with one or more additional active agents (e.g., chemotherapeutics) depending on the desired therapy or effect.
  • the dose administered to a patient should be sufficient to effect a beneficial response in the subject over time.
  • the dose will be determined by the efficacy of the particular modulators employed and the condition of the subject, as well as the body weight or surface area of the area to be treated.
  • the size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular compound or vector in a particular subject. Administration can be accomplished via single or divided doses.
  • the antibody agonist and the apoptosis-inducing agent can be administered together in a mixture or each can be administered separately.
  • the antibody agent and the apoptosis inducing agent can, but need not, be administered concurrently.
  • TRAIL-induced (and anti-DR4 or anti-DR5 -induced) apoptosis See Table 5 and Examples. Those gene products that inhibit TRAIL-induced apoptosis can be targeted with inhibitors to synergistically increase apoptosis induced by TRAIL, anti-DR4 or anti-DR5 antibodies. Similarly, those gene products that promote TRAIL-induced apoptosis can be targeted with activators to synergistically increase apoptosis induced by TRAIL, anti-DR4 or anti-DR5 antibodies.
  • activators of gene products that inhibit TRAIL-induced apoptosis can be used to reduce apoptosis where and when it is detrimental.
  • inhibitors of those gene products that promote TRAIL-induced apoptosis can also be used to reduce apoptosis where and when it is detrimental.
  • TTP thrombotic thrombocytopenic purpura
  • Plasma from patients afflicted with TTP induces apoptosis of human endothelial cells of dermal microvascular origin, but not large vessel origin
  • Plasma of TTP patients thus is thought to contain one or more factors that directly or indirectly induce apoptosis.
  • TRAIL is present in the serum of TTP patients, and may play a role in inducing apoptosis of microvascular endothelial cells.
  • HUS hemolytic-uremic syndrome
  • One embodiment of the invention is directed to treat the condition that is often referred to as "adult HUS" (even though it can strike children as well).
  • a disorder known as childhood/diarrhea-associated HUS differs in etiology from adult HUS.
  • AIDS patients are believed to involve clotting of small blood vessels. Breakdown of the microvasculature in the heart has been reported in multiple sclerosis patients. As a further example, treatment of systemic lupus erythematosus (SLE) is contemplated.
  • SLE systemic lupus erythematosus
  • the inventors have discovered that expression of the gene product Myc is necessary but not sufficient for efficacy of anti-DR5 antibodies to induce apoptosis in tumor cells. Accordingly, expression of Myc in tumor cells (e.g., from a biopsy) provides a marker for identifying cells (and therefore subjects) that are unlikely to respond to DR5-targeted therapies. Specifically, if tumor cells express less Myc than wildtype cells, it is less likely that DR5-targeted therapy will be effective than if Myc is expressed at or above wildtype expression levels.
  • the present invention provides methods of determining the efficacy of anti-DR5 agonist antibody-based therapies by obtaining a sample of tumor cells from a subject and detecting expression levels of Myc in the cells, wherein a lower than wild type expression level of Myc indicates that the therapies will have reduced or no efficacy in killing tumor cells.
  • Ratios of eluents and other solvent mixtures are given in volume by volume (v/v), if no mentioned otherwise.
  • Examples 1-52 are as provided in PCT publication WO 2004/050895, incorporated by referenced herein in its entirety.
  • Example 53 Inhibition of the chymotrypsin-like activity of the 2OS proteasome [00347] Exemplary IC 50 values determined according to the test described above for compounds of formula I are given below (Table 4).
  • the assay development for the anti-DR5 screen includes cloning, expressing and purifying Trail ligand and testing it on Jurkat cells to determine if cells would be killed with the ligand.
  • the assay comprised Alamar Blue, a redox dye that fluoresces when living cells reduce the dye. When cells are killed by apoptosis, the resulting environment is oxidizing and the dye is not reduced and no fluorescence can be detected. TRAIL induced apoptosis in Jurkat cells.
  • a screen for antibody agonists is performed. Mice are immunized with the DR5 receptor and B cells are fused to myelomas.
  • the resulting hybridomas are arrayed into 384 well plates and following several days of growth, 20 ⁇ l of supernatant and cross-linking antibody is added to wells containing Jurkat cells. Twenty-four hours later alamar blue dye is added and 24 hours later the plate is read using an Acquest. Positive wells containing positively reacting antibodies are identified.
  • the three antibody agonists show different dose responses relative to Jurkat cell killing.
  • Antibody A has the best potency and thus is chosen for further studies.
  • Imgenex-257 is a DR5 specific antibody that has no functional activity.
  • Caspase 3 activation is determined. To determine if the antibody is killing the cells by apoptosis and not by some indirect or non-specific mechanism, Caspase-3 activity assays are run.
  • Antibody or ligand is mixed with cells at various concentrations and cell extracts are generated from the treated cells.
  • a fluorescent substrate is added to the lysate, which could be used to test for active caspase 3, an indicator of apoptosis.
  • the Ab stimulates apoptosis in a similar fashion to the ligand.
  • T47D and ZR-75-1 are both resistant to the tumoricidal activity of DR5, whereas MCF-7 and MDA-MB-231 are sensitive.
  • Tumor cells are sensitive to the action of the antibody but normal cells, human lung fibroblasts (HLF) and human umbilical vein epithelial cells (HUVEC) are resistant as indicated by their lack of a dose response.
  • HVF human lung fibroblasts
  • HUVEC human umbilical vein epithelial cells
  • mice show no disease.
  • the experiment is terminated at day 50. All of the untreated are dead. None of the treated show any relapse at day 50.
  • the above experiment represents a single dose study.
  • the group size is expanded to 8 mice per group and 50, 200, and 400 ⁇ g doses are given as described in the previous single dose study. The results indicate that the antibody is effective at low (e.g., 50 ⁇ g) doses.
  • the group size is 2 mice.
  • mice 400 ⁇ g shows in vivo tumoricidal activity, whereas the mice treated with 20 ⁇ g or
  • Tumor cells over-express inhibitors of apoptosis (IAPs) and Bcl2 that blocks the release of key pro-apoptotic proteins (cyto C and SMAC) from the mitochondria.
  • IAPs inhibitors of apoptosis
  • Bcl2 that blocks the release of key pro-apoptotic proteins (cyto C and SMAC) from the mitochondria.
  • SMAC inhibits the IAPs.
  • a SMAC mimetic called LB 672 is tested for its possible synergstic effect to sensitize tumor cells to the action of the DR5 agonist.
  • a second synergist strategy is employed to test the use of proteasome inhibitors as
  • DR4/DR5 synergists prevent the proteasome from degrading IKB. This in turn prevents the release of NFKB. NFKB is known to translocate to the nucleus and initiate transcription of BCL2, IAPS, and other anti-apoptotic factors.
  • Tests are done to determine whether proteasome inhibitors would sensitize tumor cells to DR5 by the addition of MG 132, a commercially available weak proteasome inhibitor. MG 132 sensitizes resistant SW 480 colon cells to the action of the Ab at reasonably high concentrations.
  • proteasome inhibitors sensitize A2058-LUC to the DR5 antibodies.
  • the proteasome inhibitors sensitize the resistant hepatoma cell line HUH-7 to the antibodies as well.
  • the nucleic acid sequences of the heavy and light chain variable regions are displayed in Tables 1-3.
  • the amino acid sequence of the heavy chain variable region is displayed in Tables 1-3 and the amino acid sequence of the light chain variable region is displayed in Tables 1-3.
  • the chimera is expressed in SP2/0 cells at 20 pg/cell/day.
  • the resulting human chimeric antibody is cross-linked with a goat anti-human Fc and tested for functional activity.
  • the chimeric has functional tumoricidal activity equivalent to the mouse antibody.
  • a library of siRNA molecules is transfected into cells, the cells are contacted with
  • TRAIL and the cells are screened for altered viability compared to the absence of TRAIL. Cells with altered viability are then used to identify the particular siRNA transfected into the cell, thereby determining the gene inhibited by the siRNA.
  • Gene products corresponding to siRNAs are selected based on the screen. Gene products whose inhibition with siRNAs leads to a low TRAIL (+/-) ratio are inhibitors of TRAIL- induced apoptosis.
  • Tables 5A and 5B provide additional information, including Genbank accession numbers, for the gene products identified.
  • Table 5 A lists activators of TRAIL-induced apoptosis while Table 5B lists inhibitors of the same.
  • H.s plexin Bl (PLXNBl), mRNA" 3 PLXNBl 73.85 5.96 0.081 6.27E-05 H.s. SET domain-containing protein 7 NM 03064 (SET7), mRNA 8 SET7 79.06 7.30 0.092 0.000266
  • JIK H.s. STE20-like kinase
  • mRNA 1 JIK 86.41 8.67 0.102 0.000727
  • PIP5K1C 0 PIP5K1C 83.06 8.88 0.107 0.001498
  • CDK6 mRNA 9 CDK6 84.10 10.52 0.125 0.006206
  • MAPK7 MAPK7
  • B lymphoid tyrosine kinase (BLK), mRNA NM_001715 BLK 98.04 77.87 0.801 0.004003 similar to Pyruvate kinase,
  • M2 isozyme (LOC148283), XM_086132 PKM21ike 83.15 60.32 0.778 0.006752
  • FLJ32312 FLJ32312
  • NM_144709 FLJ32312 88.32 65.01 0.751 0.010144
  • TCF4 transcription factor 4
  • H.s v-abl Abelson murine leukemia viral oncogene homolog 2 arg, Abelson- related gene (ABL2), transcript NM 005158 ABL2
  • siRNAs are identified that specifically inhibit expression of Gsk3 ⁇ or GSK3 ⁇ , thereby allowing determination of the effect of either gene product on TRAIL-induced apoptosis. Inhibition of Gsk3 ⁇ , but not Gsk3 ⁇ , reduces Caspase activity in cells compared to controls. Thus, Gsk3 ⁇ is an activator of TRAIL-induced apoptosis. Similarly, two other gene products SRP72 and FLJ32312, are activators of apoptosis. [00376] Example 57
  • UbcH 10 ubiquitin conjugase UbcH 10 (UBE2C) antagonist and anti-DR5 antibody
  • UbcH 10 plays an essential role in cell cycle regulation.
  • the present inventors found that UbcH 10 is significantly over-expressed in carcinomas of multiple anatomic sites, notably breast, stomach/esophagus, colorectum, lung and ovary.
  • the data indicate that UbcHlO plays an important role in tumor development. Therapeutic potential of inhibiting UbcH 10 in the treatment of cancers is then examined.
  • RNAi-mediated silencing ofUbcHlO expression The consequences are analyzed of gene silencing in tumor cells with high UbcH 10 levels. Sequences are designed for three different and non-overlapping small interfering RNAs (siRNA) (UbcH 10-495, UbcHlO-378, UbcHlO-412). Each siRNAs is initially tested in 2 cell lines, T3M4 (derived from a pancreatic carcinoma) and DLD-I (derived from colorectal carcinoma). All three of the siRNAs targeted to UbcH 10, but not control siRNA, result in efficient diminution of the UbcH 10 protein, which correlated with their ability to suppress cell growth.
  • siRNA small interfering RNAs
  • UbcH 10 does not induce any changes in cell morphology indicative of apoptosis, such as cell rounding, detachment, nuclear condensation or production of apoptotic bodies.
  • siUbcHlO treatment does not result in proteolytic processing of the two executioner caspases, caspase-3 and caspase-7 (14), as measured by Western blot analysis and fluorescent caspase activity assays.
  • UbcH 10 Down-regulating UbcH 10 is additive to effects of standard chemotherapeutic drugs: UbcH 10 is highly over-expressed in human cancers compared to most normal tissues. To determine therapeutic potential of targeting UbcH 10, several known chemotherapeutic and a molecularly targeted agent are surveyed for potential tumor-specific effects subsequent to UbcH 10 silencing. For these studies, the microtubule-stabilizing agent paclitaxel, the spindle inhibitor, vinblastine, the DNA alkylation agent, mitomycin c, and a functionally agonistic antibody capable of triggering DR5/TRAIL-mediated apoptosis are employed, to cover a spectrum of agents with different mechanisms of action.
  • the microtubule-stabilizing agent paclitaxel, the spindle inhibitor, vinblastine, the DNA alkylation agent, mitomycin c, and a functionally agonistic antibody capable of triggering DR5/TRAIL-mediated apoptosis are employed, to cover a
  • pancreatic cancer cell lines T3M4 and Panc-1, and an androgen- independent prostate carcinoma cell line, CWR-RVl, are treated with siUbcHlO for 48 hours followed by incubation with vinblastine, paclitaxel, mitomycin c, and anti-DR5 for an additional 24 hours.
  • the results indicate that co-treatment with mitotic poisons and DNA-damaging drugs following UbcHlO silencing produced an additive reduction in cell viability in a number of tumor cell lines that are tested.
  • Initial treatment of cancer cells for 48 hours with siUbcHlO reduce the amount of viable cells by >50%, which are further decreased by the addition of cytotoxic agents for an additional 24 hours.
  • UbcHlO Down-regulating UbcHlO sensitizes cells to TRAIL/DR5-mediated cell killing: Primary human fibroblasts (BJ), human mammary epithelial cells (HMEC), and T3M4 cells are sequentially treated with siUbcHlO (siUbcH 10-495) for 48 hours followed by agonistic anti-DR5 antibodies (500 ng/ml) for an additional 6 hours. Fluorescent (FITC)-labeled contro.1 siRNAs are used to ensure equal transfection efficacy of all cell lines including BJ and HMEC cells. Cells are analyzed by microscopy.
  • FITC Fluorescent
  • Proteasome inhibitors circumvent defects in the mitochondrial apoptosis pathway.
  • active caspase-8 can lead directly to the activation of downstream effector caspases like caspase-3 (so called type-I-cells).
  • type-II-cells most cells including HCTl 16
  • the two prototypical pathways, extrinsic (death-receptor) and intrinsic (mitochondrial) are interconnected by caspase-8-mediated cleavage of the pro-apoptotic bcl-2 family member Bid, which promotes the mitochondrial release of cytochrome c and SMAC.
  • cytochrome c associates with Apaf-1 and pro-caspase-9 forming the "apoptosome", which leads to the activation of pro-caspase-9 and subsequent activation of effector caspases such as caspase-3.
  • Cytosolic SMAC binds to members of the IAP (inhibitor of apoptosis) protein family and thereby prevents IAP inhibition of caspase-3 and —9.
  • Tumor-cell specific cytotoxic activity of an anti-DR5 agonistic antibody [00390] Tumor-cell specific cytotoxic activity of an anti-DR5 agonistic antibody [00390] TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) induces apoptosis upon binding to its functional receptors DR4 and DR5 on the surface of tumor cells.
  • An anti-DR5 agonistic antibody is generated by hybridoma technology and functional cell based screening. The anti-DR5 agonistic antibody specifically binds to DR5, mimics TRAIL to induce cell death in tumor cells, and has little effect on most normal cells in vitro.
  • the anti-DR5 agonistic antibody appears to mediate cell death mainly through apoptosis, as demonstrated by the activation of caspase 3, with moderate ADCC and no CDC activity in in vitro assays. This is further supported by the relative vivo efficacy of various chimeric forms of the antibody using murine IgGl and human IgGl and IgG4 Fc domains and by the robust activation of Caspases in vivo.
  • the anti-DR5 agonistic antibody provides a means to interrogate the mechanisms of TRAIL induced tumor specific cell death. It also demonstrates promise as a novel therapeutic for cancer treatment. [00391]
  • TRAIL and its functional receptors DR4 and DR5 are of particular interest in the development of cancer therapeutics, as they preferentially mediate tumor cell apoptosis.
  • a chimeric monoclonal antibody (mAb) is developed that specifically binds to DR5 and mimics TRAIL to induce cell death in tumor cells.
  • the mAb kills 50% of a panel of 40 human colon cancer cell lines with an IC50 of 10 nM or less.
  • the tumor cell cytotoxicity is further enhanced by addition of 5- Flurouracil (5-FU), while 5-FU toxicity against normal cells is not increased by the mAb.
  • the antitumor efficacy in vivo is evaluated in human colorectal tumor xenograft models in mice, as a single agent and in combination with 5-Fu.
  • the mAb is able to induce >70% regression of established Colo205 tumor xenografts.
  • Neither the mAb or 5-FU at its maximally tolerated dose induce regression of HCTl 16 xenografts; however, combinations of the mAb and 5- FU induce regressions in this model as well.
  • the data support the use of the mAb in clinical trials of human colon cancer as either single agent or in combination with the 5-FU pro-drug, capecitabine.
  • Tumor efficacy in vivo is evaluated in haematological cell lines with the Anti-DR5 antibody alone or in combination with an HDAC inhibitor. Additional cell lines that are examined include CML, K562, Molt 4, and HuT78 cell lines.
  • Tumor efficacy in vivo is evaluated in cell lines with the Anti-DR5 antibody alone or in combination with a protein-tyrosine kinase inhibitors (Gleevec and/or AMN 107).
  • Cell lines that are examined include CML cell lines.
  • Tumor efficacy in vivo is evaluated in cell lines with the Anti-DR5 Antibody alone or in combination with a microtubule stabilizing, microtubule destabilizing agents and microtublin polymerization inhibitors, including, e.g., taxol.
  • Examined cell lines include PC3M cell lines.
  • crosslinked Antibody A mimics the action of TRAIL by stimulating apoptosis downstream of DR5.
  • this antibody Upon binding to DR5, this antibody induces intracellular signaling through a Caspase 8 dependent pathway resulting in the activation of effector caspases and apoptosis.
  • the tumor cell killing activity of the antibody is tested against a number of tumor cell lines.
  • Antibody A has significant cell killing observed in most cell lines tested. Correlation of cell killing with strong Caspase 3 activation confirms that the cell killing is due to apoptosis.
  • Crosslinked antibodies are typically pre-formed by incubating Antibody A with goat anti-human Fc (Jackson ImmunoResearch Laboratories, Inc.
  • IC50s of the cell lines are calculated using X-fit program in EXCEL (Microsoft,
  • Labeling for flow cytometry is done by the following procedure: cells are incubated with Antibody A or a control human IgGl antibody against chicken lysozyme (5OnM or as otherwise) for 1 hour at 4°C, after washing 3 times in ice-cold PBS with 1% FBS, the cells are further incubated with a 1 :200 dilution of a phycoerythrin-conjugated goat anti-human IgG (Jackson
  • ANALYSIS Antibody A sensitivity in a panel of breast cancer cell lines is screened.
  • Antibody A is added.
  • the reagents are added simultaneously. 72 hours after addition of crosslinked Antibody A, the cell survival is checked by
  • Antibody A and chemotherapeutics like LBH589, Taxol, Glivec and AMN107 are also evaluated in the same cell survival assays. Synergistic effect is observed in Antibody A sensitive cell lines when
  • Antibody A is combined with LBH589 or Taxol, but no super additive effect is found when
  • Antibody A is combined with Glivec or AMN 107.
  • the sensitivity of glioma cell lines to Antibody A suggested glioma be the potential clinical indication for Antibody A as single agent or in combination.
  • Antibody A's potency of inducing cell death is systematically evaluated in cell survival assays in vitro with a panel of mesothelioma cell lines. 5 out of 8 (63%) mesothelioma cell lines are very sensitive to crosslinked Antibody A with nanomolar or even picomolar IC50s.
  • MTX and Carboplatin are evaluated in the same cell survival assays.
  • the profound synergistic or super additive effects are observed in mesothelioma cell lines that are sensitive to crosslinked Antibody A.
  • the strong sensitivity of mesothelioma cell lines to Antibody A suggests mesothelioma is a potential clinical indication for Antibody A either as single agent or in combination with chemotherapeutics.
  • Antibody A's potency of inducing cell death is evaluated in cell survival assays in vitro with five osteosarcoma cell lines: MG-63, MNNG/HOS, SK-ES-I, U-2OS and Saos-2. Only MG-63 cell is sensitive to crosslinked Antibody A with sub-nanomolar IC50. The rest four cell lines had
  • Taxol synergistic effect is observed in three of the five cell lines: MG-63, U-2OS and Saos-2.
  • Antibody A combination therapy is provided.
  • Antibody A's potency of inducing cell death is systematically evaluated in cell survival assays in vitro with a panel of pancreatic cancer cell lines. Overall, 8 out of 12 (67%) pancreatic cancer cell lines had ⁇ 50% survival at 2OnM crosslinked Antibody A.
  • Example 70 [00433] Experimental methods for prostate cancer are as described in Example 62.
  • Antibody A's potency of inducing cell death is evaluated in cell survival assays in vitro with four prostate cancer cell lines: 22RvL, DU- 145, LNCaP and PC3M. Only PC3M cell is sensitive to crosslinked Antibody A with sub-nanomolar IC50. The remaining three cell lines have

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Cette invention concerne des agonistes des anticorps anti-DR4 ou anti-DR5, associés avec des agents inducteurs d'apoptose, induisant en synergie l'apoptose des cellules cancéreuses. L'invention concerne également un traitement combiné permettant de traiter les patients souffrant de maladies prolifératives ou de maladies associées avec une angiogenèse persistante. Le patient reçoit le traitement suivant : un agoniste de l'anticorps anti-DR5, et un ou plusieurs agents pharmaceutiquement actifs.
PCT/US2007/024518 2006-11-28 2007-11-28 Procédés et compositions induisant l'apoptose des cellules cancéreuses WO2008066854A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US86753106P 2006-11-28 2006-11-28
US60/867,531 2006-11-28

Publications (2)

Publication Number Publication Date
WO2008066854A2 true WO2008066854A2 (fr) 2008-06-05
WO2008066854A3 WO2008066854A3 (fr) 2009-08-13

Family

ID=39323023

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/024518 WO2008066854A2 (fr) 2006-11-28 2007-11-28 Procédés et compositions induisant l'apoptose des cellules cancéreuses

Country Status (1)

Country Link
WO (1) WO2008066854A2 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011098520A1 (fr) * 2010-02-10 2011-08-18 Novartis Ag Polypeptides agonistes de liaison à dr5
WO2011104266A1 (fr) 2010-02-25 2011-09-01 Novartis Ag Inhibiteurs dimères d'iap
WO2012080260A1 (fr) 2010-12-13 2012-06-21 Novartis Ag Inhibiteurs iap dimériques
WO2012080271A1 (fr) 2010-12-13 2012-06-21 Novartis Ag Inhibiteurs iap dimériques
EP3048116A1 (fr) 2015-01-23 2016-07-27 International-Drug-Development-Biotech Anticorps anti-dr5 avec activité d'apoptose accrue
WO2019126725A1 (fr) * 2017-12-22 2019-06-27 The Board Of Trustees Of The Leland Stanford Junior University Compositions et méthodes pour traiter les maladies liées à l'âge
WO2019165340A1 (fr) * 2018-02-26 2019-08-29 Igm Biosciences, Inc. Utilisation d'une molécule de liaison anti-dr5 multimère en association avec un agent chimiothérapeutique pour le traitement du cancer

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999037684A1 (fr) * 1998-01-26 1999-07-29 Genentech, Inc. Anticorps du recepteur 4 de la mort cellulaire (dr4) et leurs utilisations
WO2000073349A1 (fr) * 1999-05-28 2000-12-07 Genentech, Inc. Anticorps dr4 et utilisation de ces derniers
WO2004050895A2 (fr) * 2002-11-27 2004-06-17 Irm Llc Procedes et compositions induisant l'apoptose de cellules cancereuses
WO2006029275A2 (fr) * 2004-09-08 2006-03-16 Genentech, Inc. Methodes d'utilisation de ligands de recepteurs de mort, ainsi que d'anticorps cd20
WO2006075012A2 (fr) * 2005-01-12 2006-07-20 Nycomed Gmbh Nouvelles pyrrolodihydroisoquinolines
WO2006084869A1 (fr) * 2005-02-09 2006-08-17 Nycomed Gmbh Tetrahydropyridothiophenes permettant de traiter des maladies proliferatives telles que le cancer
WO2006104672A1 (fr) * 2005-03-24 2006-10-05 Irm Llc Amplification de la sensibilité dépendante de myc d'un cancer à des agonistes de dr5

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999037684A1 (fr) * 1998-01-26 1999-07-29 Genentech, Inc. Anticorps du recepteur 4 de la mort cellulaire (dr4) et leurs utilisations
WO2000073349A1 (fr) * 1999-05-28 2000-12-07 Genentech, Inc. Anticorps dr4 et utilisation de ces derniers
WO2004050895A2 (fr) * 2002-11-27 2004-06-17 Irm Llc Procedes et compositions induisant l'apoptose de cellules cancereuses
WO2006029275A2 (fr) * 2004-09-08 2006-03-16 Genentech, Inc. Methodes d'utilisation de ligands de recepteurs de mort, ainsi que d'anticorps cd20
WO2006075012A2 (fr) * 2005-01-12 2006-07-20 Nycomed Gmbh Nouvelles pyrrolodihydroisoquinolines
WO2006084869A1 (fr) * 2005-02-09 2006-08-17 Nycomed Gmbh Tetrahydropyridothiophenes permettant de traiter des maladies proliferatives telles que le cancer
WO2006104672A1 (fr) * 2005-03-24 2006-10-05 Irm Llc Amplification de la sensibilité dépendante de myc d'un cancer à des agonistes de dr5

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BUCHSBAUM D J ET AL: "Antitumor efficacy of TRA-8 anti-DR5 monoclonal antibody alone or in combination with chemotherapy and/or radiation therapy in a human breast cancer model" CLINICAL CANCER RESEARCH, THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 9, no. 10 Pt 1, 1 September 2003 (2003-09-01), pages 3731-3741, XP002399316 ISSN: 1078-0432 *
BUCHSBAUM DONALD J ET AL: "TREATMENT OF HUMAN BREAST CANCER XENOGRAFTS WITH MONOCLONAL ANTIBODY AGAINST DR5 WITH OR WITHOUT CHEMOTHERAPY INHIBITS TUMOR GROWTH IN NUDE MICE" PROCEEDINGS OF THE ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, NEW YORK, NY, vol. 43, 1 March 2002 (2002-03-01), pages 1005-1006, XP001536554 ISSN: 0197-016X *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TWI480051B (zh) * 2010-02-10 2015-04-11 Novartis Ag 生物化合物
US9120855B2 (en) 2010-02-10 2015-09-01 Novartis Ag Biologic compounds directed against death receptor 5
WO2011098520A1 (fr) * 2010-02-10 2011-08-18 Novartis Ag Polypeptides agonistes de liaison à dr5
JP2013519364A (ja) * 2010-02-10 2013-05-30 ノバルティス アーゲー アゴニストｄｒ５結合ポリペプチド
AU2011214355B2 (en) * 2010-02-10 2014-05-22 Ablynx Nv Agonist DR5 binding polypeptides
WO2011104266A1 (fr) 2010-02-25 2011-09-01 Novartis Ag Inhibiteurs dimères d'iap
WO2012080271A1 (fr) 2010-12-13 2012-06-21 Novartis Ag Inhibiteurs iap dimériques
WO2012080260A1 (fr) 2010-12-13 2012-06-21 Novartis Ag Inhibiteurs iap dimériques
EP3048116A1 (fr) 2015-01-23 2016-07-27 International-Drug-Development-Biotech Anticorps anti-dr5 avec activité d'apoptose accrue
WO2019126725A1 (fr) * 2017-12-22 2019-06-27 The Board Of Trustees Of The Leland Stanford Junior University Compositions et méthodes pour traiter les maladies liées à l'âge
US11891442B2 (en) 2017-12-22 2024-02-06 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for treating age-related diseases
WO2019165340A1 (fr) * 2018-02-26 2019-08-29 Igm Biosciences, Inc. Utilisation d'une molécule de liaison anti-dr5 multimère en association avec un agent chimiothérapeutique pour le traitement du cancer
CN111757941A (zh) * 2018-02-26 2020-10-09 Igm生物科学股份有限公司 多聚体抗dr5结合分子与化学治疗剂联合用于治疗癌症的用途
JP2021514945A (ja) * 2018-02-26 2021-06-17 アイジーエム バイオサイエンシズ インコーポレイテッド がんを治療するための、化学療法剤と併用した多量体抗ｄｒ５結合分子の使用
JP7358365B2 (ja) 2018-02-26 2023-10-10 アイジーエム バイオサイエンシズ インコーポレイテッド がんを治療するための、化学療法剤と併用した多量体抗ｄｒ５結合分子の使用

Also Published As

Publication number Publication date
WO2008066854A3 (fr) 2009-08-13

Similar Documents

Publication Publication Date Title
US11760728B2 (en) Tead inhibitors and uses thereof
US20200277378A1 (en) Combination therapies
KR20220034739A (ko) Tead 억제제 및 이의 용도
US8173128B2 (en) Methods and compositions for inducing apoptosis in cancer cells with an anti-DR5 antibody
KR20210029783A (ko) 넥틴-4에 대해 특이적인 비사이클릭 펩타이드 리간드
JP2019521641A (ja) がんを監視及び治療するための方法
KR20190072528A (ko) 암에 대한 치료 및 진단 방법
AU2016350701A1 (en) CD80 extracellular domain polypeptides and their use in cancer treatment
KR20170074962A (ko) 암에 대한 조합 요법
WO2008066854A2 (fr) Procédés et compositions induisant l'apoptose des cellules cancéreuses
KR20070120146A (ko) 면역요법에서 ｃｄ25 항체의 용도
CN112566661B (zh) 喹啉衍生物与抗体的药物组合
KR20210006405A (ko) 암의 치료를 위한 PD-1/PD-L1, TGFβ 및 DNA-PK의 조합 억제
KR20230131189A (ko) Tead 억제제 및 이의 용도
KR20190003957A (ko) 암 모니터링 및 치료 방법
JP2017534574A (ja) チロシンキナーゼ阻害薬（ｔｋｉ）に耐性のがんを処置するための組成物および方法
JP2021511372A (ja) Ｔｉｍ３に対する抗体で癌を処置する方法
CA3155219A1 (fr) Inhibition combinee de pd-1, tgfb et tigit pour le traitement du cancer
TW201642897A (zh) Ｈｅｒ２結合劑治療
WO2021139682A1 (fr) Anticorps anti-galectine-9 et ses utilisations
CN112915202A (zh) 喹啉衍生物与pd-1单抗的药物组合
AU2020260381A1 (en) Pharmaceutical compositions and use thereof for relieving anticancer drug resistance and enhancing sensitivity of anticancer drug
KR20210066837A (ko) 암 치료를 위한 pd-1 안타고니스트, atr 억제제 및 백금화제의 조합
US11878958B2 (en) MEK inhibitors and uses thereof
EP3440111B1 (fr) Anticorps anti-vegfr-1 et leurs utilisations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07867578

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07867578

Country of ref document: EP

Kind code of ref document: A2