WO2008064907A1 - Polypeptides having modulatory effects on cells - Google Patents

Abstract

The present invention relates to peptides and polypeptides having the sequence SAVTFAVCAL or variants thereof, capable of binding to Calcineurin and/or to NS5A-TP2 and to their use in therapy, as well as to nucleic acid sequences and vectors encoding these peptides and polypeptides, and to cells comprising said polypeptides, nucleic acid sequences or vectors. The invention further relates to the use of the peptides, polypeptides or their derivatives to bring about phenotypic changes in mammalian cells, particularly to up-regulate calcineurin activity. The invention finally relates to a method for intracellular identification of substances which bind to calcineurin and which modulate the physiological effects of calcineurin.

Description

Polypeptides having modulatory effects on cells

The present invention relates to peptides and polypeptides having modulatory effects on cell functions and being capable of binding to Calcineurin and/or to NS5A-TP2. The invention also relates to nucleic acid sequences and vectors encoding these peptides and polypeptides, and to cells comprising said polypeptides, nucleic acid sequences or vectors of the invention, as well as to the use of these peptides, polypeptides, nucleic acid sequences, vectors and cells in therapy. The present invention also relates to a method for modulating calcineurin activity, and to a method for intracellular identification of substances which bind to calcineurin and which modulate the physiological effects of calcineurin, that is which modulate calcineurin dependent cellular pathways. The invention further relates to a method for modulating NS5A-TP2 activity, and to a method for intracellular identification of substances which bind to NS5A-TP2 and which modulate the physiological effects of NS5A-TP2, that is which modulate NS5A-TP2 dependent cellular pathways.

In absence of classical genetics, the deciphering of mammalian regulatory networks rests mostly on the reverse genetics methodology, and particularly on the use of transdominant negative agents such as dominant negative alleles (1), antibodies (2), nucleic acid aptamers (3), peptide aptamers (4), antisense or small interfering RNA (5), and small molecule inhibitors when available (6). In most applications, these agents are designed or selected to specifically target a protein and they are then introduced into cellular or animal models to assess the phenotypic consequences of the targeted perturbation they exert. Another approach consists of constructing large libraries of transdominant agents in retroviral vectors and performing genetic selections or screening to isolate library members that confer given phenotypes. Libraries of antisense cDNAs (7), random fragments of cDNAs (8), ribozymes (9), combinatorial peptides (10), shRNAs (11) have been used successfully to interrogate proteomes and identify new members of mammalian regulatory pathways.

Elaborate experimental schemes have thus been developed and used successfully to identify cytostatic random cDNA fragments (12) and random linear peptides terminally fused to GFP (13). In both cases, a counterselection against dividing cells has been - -

devised and, in the latter case, coupled to a positive screening for cells that do not divide and thus maintain a fluorescent vital dye. Whereas different antiproliferative linear peptides have been isolated, their mechanism of action has not been elucidated so far (13).

Peptide aptamers are man-made combinatorial protein reagents that bind target proteins and can interfere with their function in living cells and organisms (14) (4). They consist of conformationally-constrained random sequence peptide loops (called 'variable regions') displayed by a scaffold protein. They bind their cognate targets with a strong affinity and, usually, a high specificity, which allows them to discriminate between closely related members within a protein family (14), or even between different allelic variants of a given protein (15). So far, peptide aptamers have been mostly selected through yeast two-hybrid screening experiments, for their ability to bind a given target protein. In fewer instances, peptide aptamers have been selected for their ability to confer selectable phenotypes to yeast (16,17) and bacteria (18). Peptide aptamers selected in yeast have been used successfully to identify their cognate target proteins by two-hybrid screening.

A number of arguments strongly support the choice of peptide aptamers to perform various phenotypic screening or selections, with the goal of interrogating proteomes to identify target proteins involved in the underlying regulatory networks. First, proof of concept has been obtained in yeast where peptide aptamers were selected for their ability to overcome the cell cycle arrest induced by a mating pheromone, and where target proteins were identified by yeast two-hybrid screening (16,17). Second, peptide aptamers can target many different kinds of intracellular proteins such as kinases, phosphatases, receptors, adaptor proteins, transcription factors, chaperones, etc., involved in many regulatory pathways (reviewed in (4) ). Third, peptide aptamers have been shown to decorate their target proteins by binding to many different surfaces, involved in different functions (27). For this reason, peptide aptamers can induce a wider range of perturbations on protein function than other reverse genetics methods, such as gene knockout or the use of transdominant negative alleles. Last, the double constraint imposed on the variable regions reduces the conformational freedom and yields typically high binding affinities for the target proteins, thereby facilitating their identification by different methods.

The work of the inventors illustrates the particularities of using combinatorial protein molecules for phenotypic screening of transdominant reagents, as opposed to using nucleic acid molecules. For example, when using nucleic acid molecules (cDNA fragments, antisense, shRNAs), the identity of the target proteins is immediately unveiled by sequencing the isolated library members. In contrast, selected combinatorial protein molecules must be used as probes to determine the identity of their targets, by performing yeast two-hybrid cDNA screening (10,16,17) or affinity capture experiments followed by mass spectrometry (28).

However, combinatorial protein molecules, and particularly peptide aptamers, present a considerable advantage over nucleic acid molecules. Whereas the latter can only inhibit the function of their target proteins (by a dominant negative effect or by reducing expression levels), the former can cause more diverse perturbations on the function of their targets, including an activation as observed in the present invention. Therefore, the use of combinatorial protein molecules for phenotypic screening or selections allows a more extensive probing of proteomes, thus enhancing the chances to identify different target proteins whose perturbations cause a given phenotype. Another significant advantage of using peptide aptamers lies in their application for drug discovery. Once their target proteins are identified, peptide aptamers can guide the identification of small molecule mimicks that bind the same molecular surfaces on the targets and induce the same biological effects (27). The use of retroviral libraries of peptide aptamers for phenotypic screening or selections thus aids the unraveling of molecular regulatory networks that control major biological processes and impacts positively on therapeutic research by facilitating the discovery of new targets and small molecule drugs.

In the context of the present invention, the inventors have built and used a lentiviral peptide aptamer library to isolate aptamers that inhibit cell proliferation in vitro. They have determined the identity of the target proteins of one of the isolated peptide aptamers (referred to as R5G42 (SEQ ID 22)) by performing yeast two-hybrid screening experiments (see table 2), and have retained NS5A-TP2 (which contains a conserved HD domain, found in many phosphatases) and CNA (the catalytic subunit of calcineurin), as two strong target candidates. With respect to the first of these targets, no biological information is currently available for NS5A-TP2 (SEQ ID 15), except that its coding gene is transactivated by the non-structural NS5A protein from hepatitis C virus (22). The use of the R5G42 peptide aptamer could help elucidate the function of this protein, which could play a role in the control of cell proliferation. - -

With respect to the second target, calcineurin (also referred to as protein phosphatase 3 (PPP3) or protein phosphatase 2B (PP2B)) is a well-studied protein phosphatase that plays a key role in coupling Ca²⁺ signaling to cellular responses (reviewed in (23)). Calcineurin is a serine/threonine protein phosphatase constituted of a catalytic subunit, Calcineurin A (CNA) and a Ca²⁺ regulatory unit, Calcineurin B (CNB).

CNA comprises a catalytic domain at its N terminal and a regulatory domain at its C terminal which contains the CNB binding domain, a Calmodulin (CaM) binding domain and an Auto-Inhibitory domain (Al) which masks the active site of CNA (see figure 3b). Binding of Ca²⁺ activated calmodulin to CNA displaces the auto-inhibitory domain and activates calcineurin phosphatase activity through the relief of auto-inhibition. Three isoforms of human CNA, referred to as CNA alpha (SEQ ID 16), CNA beta (SEQ ID 17) and CNA gamma (SEQ ID 18), have been identified (see figure 5). These three isoforms show from 83 to 89 % identity over 90% of their sequence not including the N- and C-terminal tails. Calcineurin is believed to be involved in many physiological pathways such as T-cell activation, cell apoptosis, skeletal myocyte differentiation, osteoclast differentiation and cardiac hypertrophy. In T-cells, it has been shown that activated CNA dephosphorylates the NFAT (nuclear factor of activated T cell) transcription factor, allowing it to enter the nucleus and activate the transcription of interleukin 2 (IL-2). NFAT is a general name applied to a family of transcription factors which consists of five members, four of which (NFATd -NFATc4) have been shown to be regulated by Ca²⁺ and Calcineurin. Upon stimulation, NFAT proteins are dephosphorylated by calcineurin, which allows them to translocate to the nucleus and become transcriptionally active (reviewed in (29). NFAT members are involved in the activation or repression of many genes involved in diverse physiological pathways such as T cell activation, the development of cardiac muscle, skeletal muscle cells differentiation, skeletal muscle hypertrophy and the development of nervous systems.

The demonstration that calcineurin was the target of the immunosuppressants cyclosporin A and FK506 has sparked a considerable interest in this protein and has greatly facilitated the elucidation of its function, especially in T cell activation. However, the structural mechanisms of the activation and the inhibition of calcineurin by, respectively, calmodulin and immunophilin-immunosuppressant complexes remain poorly understood (26). Despite numerous studies, the role of calcineurin in cell proliferation remains less clear. Cyclosporin A has been shown to inhibit the proliferation of various cells, but at - -

concentrations exceeding that required to observe an inhibition of T cell activation. FK506, although a more potent immunosuppressant than cyclosporin A, shows a weaker antiproliferative activity (reviewed in (24)). These observations suggest that the antiproliferative activity of these immunophilins may be caused by the modulation of other target protein(s). Moreover, contrary to the hypothesis that calcineurin positively regulates cell proliferation, calcineurin has been shown to induce apoptosis through different mechanisms including the dephosphorylation of Bad, a pro-apoptotic Bcl-2 family member (25).

In the context of the present invention, the inventors have identified a new CNA ligand that activates CNA phosphatase activity through a potentially original mechanism, since its binding site is located between the CaM-binding domain and the auto-inhibitory domain, but does not appear to be circumscribed to the CaM-binding domain. In accordance with the invention, the new ligand comprises a peptide having the sequence SAVTFAVCAL (SEQ ID 20), or derivatives thereof. The invention thus relates to this peptide, and to larger peptides or polypeptides containing the SAVTFAVCAL sequence, especially to peptide aptamers which contain the SAVTFAVCAL sequence as a conformationally-constrained loop in a protein platform. The invention further relates to the use of the peptide or its derivatives to bring about phenotypic change in eukaryotic cells, in particular in mammalian cells, particularly to up-regulate calcineurin activity.

This application describes the first phenotypic selection of peptide aptamers in mammalian cells. It also describes the first identification of a functional perturbation of a protein targeted by combinatorial protein molecules isolated from an antiproliferative screening.

More specifically, the invention relates to a polypeptide comprising or consisting of (i) the amino acid sequence SAVTFAVCAL (SEQ ID 20), or (ii) the amino acid sequence GPSAVTFAVCALGP (SEQ ID 21), or (iii) a variant of the amino acid sequence (i) or (ii) having one amino acid change.

According to the invention the term polypeptide signifies an amino acid sequence of 9 or more amino acids. Polypeptides consisting exclusively of amino acid sequences (i), (ii) or (iii) as defined above are also referred to herein as peptides of the invention. The polypeptides of the invention are capable of binding to intracellular molecular targets in eukaryotic cells, in particular in mammalian cells. The binding of the polypeptides of the invention to their intracellular target has a modulatory effect on the cell. Such targets include Calcineurin and/or NS5A-TP2. The interaction of the polypeptide with its target gives rise to a phenotypic change in the cell for example an antiproliferative activity, an apoptic effect or a differentiating effect on mammalian cells.

In a preferred embodiment, the polypeptides of the invention bind to proteins which comprise at least the sequence extending from amino acid 378 to 500 of the beta isoform of CNA, or analogous positions in the alpha and gamma isoforms. In another preferred embodiment, the polypeptides of the invention bind to native CNA, i.e. as occurring in mammalian cells or human cells, more particularly, free of two-hybrid reporter components.

The princeps peptide of the invention is the decapeptide (i) :

SAVTFAVCAL (SEQ ID 20)

According to the invention, this decapeptide may be extended at the amino and / or carboxy termini by the addition of further amino acids, for example from one to 300 amino acids, preferably one to 80 amino acids, at either or both sides. The peptide (ii), having 14 amino acids and having the sequence :

GPSAVTFAVCALGP (SEQ ID 21) is a particularly preferred embodiment of the invention in this regard.

The invention also encompasses variants of the peptides (i) and (ii) having one amino acid difference with respect to the peptide (i) or (ii), wherein 'difference' (or 'change') signifies the substitution, deletion or insertion of one amino acid in the parental sequence (i) or (ii). Said variants are referred to herein as sequence (iii).

Particularly preferred peptide variants (iii) of the invention are those in which one amino acid in the parental sequence (i) or (ii) is substituted by a different amino acid, for example by an amino acid sharing a same property such as polarity, acidity, basicity or hydrophobicity. In one embodiment, one amino acid in the in the C-terminal portion of the (i) or (ii) sequence is substituted by another amino acid. In a preferred embodiment, the substituted amino acid is neither the serine nor one of the two valine amino acids of the (i) or (ii) parental sequence. In a most preferred embodiment, the phenylalanine amino acid is substituted by an isoleucine amino acid.

According to the invention, the amino acid sequence (i), (ii) or (iii) may be part of a larger polypeptide i.e. covalently joined at its amino and / or carboxy termini to other amino acid residues or sequences thereof. For example, the amino acid sequence (i), (ii) or (iii) may be embedded within a larger polypeptide, or may be fused at one or both extremities to a heterologous polypeptide, giving rise to a fusion protein. The total length of such a chimeric polypeptide, including the amino acid sequence (i), (ii) or (iii), is normally from 14 to 600 amino acids, for example 14 to 150 amino acids.

According to a preferred embodiment, the amino acid sequence (i), (ii) or (iii) is conformational^ constrained by covalent binding to a scaffold molecule, preferably at both C and N termini, i.e. the sequence (i), (ii) or (iii) is doubly constrained. The scaffold (also called 'platform') can be any molecule which is capable of reducing, through covalent bonding, the number of conformations which the sequence (i), (ii) or (iii) can assume. Examples of conformation-constraining scaffolds include proteins and peptides, for example thioredoxin and thioredoxin-like proteins, nucleases (e.g. RNaseA), proteases (e.g. trypsin), protease inhibitors (e.g. eglin C), antibodies or structurally-rigid fragments thereof, fluorescent proteins such as GFP or YFP, and conotoxins. A conformation- constraining protein or peptide can be of any appropriate length, for example from 5 to 150 amino acids, preferably 5 to 40 or 5 to 60 or 80-120 amino acids. Other suitable platform molecules include carbohydrates such as sepharose. The platform may be a linear or circular molecule, for example, closed to form a loop. The combinatorial constraint may also be bought about by covalent bonding of the N- and C- terminal amino acids of the peptide to each other. The amino acid sequence (i), (ii) or (iii) may e part of a peptide aptamer.

The platform is generally heterologous with respect to the amino acid sequence (i), (ii) or (iii), i.e. the platform is not of the same origin as the amino acid sequence (i), (ii) or (iii). - -

The association of the platform and amino acid sequence (i), (ii) or (iii) generally does not exist in nature. In particular, the association of the platform and amino acid sequence (i), (ii) or (iii) is preferably not an aquaporin 7 molecule.

According to a preferred embodiment, the scaffold is a protein and the amino acid sequence (i), (ii) or (iii) is located between two cysteines in the scaffold protein. In this manner, the amino acid sequence (i), (ii) or (iii) and any flanking amino acids form a conformational^ constrained loop structure which has proven to be particularly suitable as an intracellular recognition molecule.

Human thioredoxin (hTRX) (SEQ ID 19) or E. coli thioredoxin A (TRX-A)₁ or a thioredoxin- like molecule (TRX-like), are particularly preferred as scaffolds. In this case, the amino acid sequence (i), (ii) or (iii) is located in the active-site loop, between the two cysteines at positions 32 and 35 (see amino acid sequence of human thioredoxin illustrated in Figure 7), or analogous positions in thioredoxin-like (TRX-like) molecules. Thioredoxin-like proteins are defined herein as proteins having at least 50%, preferably at least 80% and most preferably at least 90% identity, for example 95% identity, with the amino acid sequence of human thioredoxin (SEQ ID 19) over an amino acid sequence length of 80 amino acids (see figure 7). Thioredoxin-like molecules also include peptides which have a three-dimensional structure substantially similar to that of human or E.coli thioredoxin, for example glutaredoxin. A particularly preferred thioredoxin platform is native human thioredoxin (SEQ ID 19), or alternatively, human thioredoxin having one or more point mutations in the amino acid sequence flanking the active site. In particular, thioredoxin molecules in which one, two or three amino acids of the native human sequence are substituted by different amino acids, are especially suitable as scaffolds of the invention. Indeed, the inventors have demonstrated that the binding affinity of the polypeptide to its intracellular target can be modulated by variation of the amino acid sequence of the human TRX (SEQ ID 19). In a preferred embodiment, thioredoxin molecules in which one amino acid of the native hTRX sequence is substituted by a different amino acid, are used as scaffolds for the polypeptides of the invention. Particularly preferred variants of human thioredoxin are those in which one amino acid is substituted by a different amino acid, for example by an amino acid sharing a same property such as polarity, acidity, basicity or hydrophobicity. - -

Alternatively, one amino acid is substituted by a different amino acid having a different polarity, acidity, basicity or hydrophobicity. In a preferred embodiment, the substituted amino acid is neither one of the five amino acids on the amino-side of the cysteine at position 32, nor one of the five amino acids on the carboxy-side of the cysteine at position 35 of hTRX. In yet another preferred embodiment, the substituted amino acid is one of the five amino acids on the amino-side of the cysteine at position 32, or one of the five amino acids on the carboxy-side of the cysteine at position 35 of hTRX.

In a most preferred embodiment, the polypeptide of the invention has one of the sequences listed in figure 8 (SEQ ID N⁰ 22-29, 33 or 34).

The amino acid sequences (i), (ii) or (iii), when conformational^ constrained within a platform such as h-TRX or TRX-like proteins will be referred to herein as peptide aptamers.

According to a preferred embodiment of the invention, the polypeptide is capable of binding to Calcineurin and/or to NS5A-TP2. In one embodiment the polypetides of the invention are capable of binding to CNA and NS5A-TP2. In another embodiment, they are capable of binding to CNA but not to NS5A-TP2. In yet a further embodiment, they are capable of binding to NS5A-TP2 but not to CNA. In this context, unless otherwise specified, "calcineurin" or "CNA" signifies full length Calcineurin A (human) or a polypeptide comprising at least amino acids 378 to 500 of the beta isoform of human CNA.

"Binding" signifies non-covalent interaction between the polypeptide and Calcineurin and/or NS5A-TP2, sufficient to give rise to a detectable transcriptional signal in a two- hybrid assay. Affinity of binding is generally between 10^"6M and 10^"9M.

Intracellular binding between the polypeptide of the invention and calcineurin and/or NS5A-TP2 can be determined for example by perfoming a two-hybrid (2H) assay, as described in WO 96/02561 , in which the polypeptide is the bait protein and calcineurin or NS5A-TP2 is the prey protein. Alternatively calcineurin or NS5A-TP2 can be the bait and the polypeptide can be the prey.

The two-hybrid assay uses the activation of a reporter gene by the binding of a reconstituted transcription factor onto its operator sequences, and the fact that in most - -

eukaryotic transcription factors, the activating and binding domains are modular and can function in close proximity to each other without direct binding. This means that even when the transcription factor is split into two fragments, it can still activate transcription when the two fragments are indirectly connected. In yeast two-hybrid screening, separate bait and prey plasmids are simultaneously introduced into the mutant yeast strain. Bait plasmids are engineered to produce a protein product in which the binding domain (BD) fragment is fused onto the bait protein. Prey plasmids are engineered to produce a protein product in which the activating domain (AD) fragment is fused onto the prey protein. After transfection of the yeast with both plasmids, interaction between the bait and the prey protein activates the transcription of the reporter gene, and thereby allows the interaction to be detected.

Common transcription factors used for yeast two-hybrid screening include GAL4 and the DNA-binding domain of the E. coli protein LexA. In one embodiment, reporter genes can encode for enzymes that allow synthesis of specific amino acids that the mutant yeast strain is otherwise unable to produce, such as for example leucine and adenine. Thus, yeast containing a bait protein and a prey protein which interact, will grow on media lacking those amino acids.

Another commonly used reporter gene is lacZ which when activated results in yeast colonies that generate a blue colour under certain conditions.

Extracellular or in vitro binding between the polypeptide of the invention and calcineurin and/or NS5A-TP2 can be determined by classical methods analogous to those used for immunodetection, for example, by immobilising the polypeptide on a support and contacting with labelled calcineurin or NS5A-TP2. Alternatively calcineurin or NS5A-TP2 can be immobilised on a support and contacted with the polypeptides of the invention carrying a detectable label.

The polypeptides of the invention generally bind to calcineurin through said amino acid sequence (i), (ii) or (iii), and preferably bind to the calcineurin subunit A. They generally bind to at least one, and preferably all of the alpha (SEQ ID 16), beta (SEQ ID 17) or gamma (SEQ ID 18) isoforms of human calcineurin A (CNA) (see figure 5). - -

The polypeptides of the invention preferably bind to CNA at a site, or at a plurality of sites, located within the sequence extending from the amino terminal of the calmodulin binding domain to the carboxy terminal of the auto-inhibitory domain of CNA (see figure 3b). The site is however not limited to the calmodulin binding domain, as this domain is not in itself sufficient for binding.

The polypeptides generally binds to the human CNA beta isoform at its C-terminal through a site, or at a plurality of sites, located within the sequence extending from amino acid 378 to 500, or analogous positions in the alpha and gamma isoforms.

The polypeptide of the invention also generally binds to NS5A-TP2 (SEQ ID 15) (see figure 6). The precise binding site of the polypeptide to NS5A-TP2 has not been determined by the inventors.

The polypeptide of the invention are capable of exerting a modulatory effect on a cell, for example at least one cellular function is upregulated, downregulated, activated or eliminated, for example calcineurin-dependent pathways or NS5A-TP2 dependent pathways. Most preferably, the peptides and peptide aptamers of the invention give rise to a specific detectable phenotype or change in phenotype on binding to the target within a cell. For example, the specific detectable phenotype consists in the expression of a reporter gene, a modification of the proliferative rate of the cells, cell apoptosis, a modification of cell differentiation or resistance to cell death. In a preferred embodiment, the polypeptides of the invention have a differentiating effect on osteoclasts in the absence of RANKL, i.e. the polypeptides of the invention enhance the formation of osteoclasts in the absence of RANKL. In another preferred embodiment, the polypeptides of the invention reduce muscular atrophy, indicating enhancement of muscle differentiation.

Most preferably, the specific detectable phenotype brought about by the binding of the polypeptide of the invention to its target, is an antiproliferative activity in mammalian cells, particularly in human cells. The antiproliferative activity can for example be detected by infecting the cells labelled with the fluorescent vital dye CMTMR which cells incorporate and dilute as they proceed through division cycles, with a lentiviral vector encoding the polypeptide of the invention in conditions in which the polypeptide is expressed in the cells. The cells which do not divide - -

or divide at a slower rate maintain a higher fluorescence level which can be detected, for example by flow cytometry (see figure 2A).

Alternatively, antiproliferative activity can be detected by transfecting the cells with a plasmid encoding the polypeptide of the invention in conditions in which the polypeptide is expressed in the cells, cultivating the cells for a period during which they would normally form detectable colonies, for example one to three weeks, detecting the colonies for example by staining of the cells that grow with crystal violet and counting the colonies (see figure 2B).

The invention also relates to a nucleic acid sequence comprising or consisting of a sequence encoding the polypeptide of the invention as defined above, and to a vector containing this nucleic acid sequence. Preferably, the vector is suitable for introduction and expression of the nucleic acid in mammalian cells, in mammalian tissue, such as muscle tissue, or in a mammalian organ, for example a retroviral vector, a lentiviral vector or a plasmid.

The invention also encompasses a eukaryotic cell comprising the polypeptide of the invention as defined above, particularly a mammalian cell, or mammalian cell line, for example a murine or human cell or cell line. Particularly preferred cell types are cells of the immune system, skeletal muscle cells, bone cells or cardiac muscle cells, for example T cells, myocytes, satellite cells, muscle fibers, osteoclasts, or osteoblasts.

The polypeptide of the invention may be introduced into the cell in a number of different ways. For example, it can be introduced into the cell by expression of a DNA sequence encoding the polypeptide. This method is generally applied when genetic manipulation of the cell or the organism is possible. In such cases a nucleic acid molecule encoding the polypeptide is introduced into the cell in a suitable vector, comprising all the necessary control sequences for expression.

Alternatively, the polypeptide is introduced into the cell in purified form using a cell permeable agent, such as protein transduction domains (PTDs), for example penetratin. - -

This method is particularly advantageous for therapy when genetic modification of the individual is undesirable. A further alternative is to microinject the polypeptide into the cell.

The invention also relates to methods for identifying substances which modulate the interaction between calcineurin (CNA) and a polypeptide of the invention. These methods allow the identification of molecules which can up- or down-regulate the physiological effects of calcineurin, and which consequently have therapeutic potential, for example the molecules may up-regulate the phosphatase activity of calcineurin. In particular, these methods allow the identification of molecules which can modulate NFAT-dependent activation or repression of gene transcription.

More particularly, the invention relates to a method for the identification of substances which modulate the interaction between CNA and a polypeptide of the invention, said method comprising the steps of (i) contacting a candidate modulatory substance with CNA and the polypeptide of the invention in conditions in which CNA and said polypeptide can bind, and in which said binding can be detected by a specific signal ; (ii) detecting a change in the intensity of said signal ; and (iii) optionally recovering the candidate substance.

More specifically, this aspect of the invention includes a method for the identification of substances which modulate the interaction between CNA and a polypeptide of the invention, said method comprising the steps of

(i) introducing a candidate modulatory substance, CNA and the polypeptide of the invention into a eukaryotic cell, in conditions in which a specific detectable phenotype associated to the binding of CNA with the polypeptide of the invention can be detected ;

(ii) detecting a change of the said specific detectable phenotype ; and (iii) optionally recovering the candidate substance.

Modulatory substances or ligands identified by this method may be proteins, peptides, small organic molecules, nucleic acids, including DNA or RNA. Small organic molecule - -

can be defined as non polymeric organic molecules which have a molecular weight of less than 3000 Da, preferably less than 2500, 2000, 1500, 1000, 750 or 500 Da.

The interaction which is modulated by the candidate substance is generally the binding of the polypeptide of the invention to CNA at a site or a plurality of sites located within the sequence extending from the amino terminal of the calmodulin binding domain up to and including the carboxy terminal of the auto-inhibitory domain of CNA, particularly, the sequence extending from amino acid 378 to 500 of the beta isoform of CNA, or equivalent positions in the alpha or gamma isoforms. The method of the invention therefore allows identification of molecules which compete with the polypeptide of the invention for this binding site. Such molecules may agonise or antagonise the effect of the polypeptide of the invention, for example they may stimulate or prevent the polypeptide of the invention from stimulating the phosphatase activity of calcineurin, and may stimulate or inhibit the anti-proliferative effect of calcineurin.

The method relies on the detection of a change in the phenotypic status of the cells in the presence of the three components of the system (i.e. the candidate compound, CNA and the polypeptide of the invention), compared to the phenotypic status of the same cells when only CNA and the polypeptide of the invention are introduced into the cells.

The specific detectable phenotype may consist of the expression of a heterologous or endogenous reporter gene, a modification of the proliferative rate of the cells, cell apoptosis, a modification of cell differentiation or resistance to cell death.

The two hybrid assay as described in EP1582590 may be used to identify candidate modulatory substances. In this context, the bait is usually Calcineurin, bound to a DNA- binding moiety, and the prey is usually the polypeptide of the invention, bound to a gene activating moiety. This type of assay allows the identification of substances which modulate binding of the polypeptide of the invention to CNA₁ as seen by enhancement or inhibition of reporter gene expression. The reporter gene in this context is usually a heterologous reporter gene introduced into the cells for the purpose of the assay. - -

If it is desired to identify substances which have the capacity to modulate, not only the binding of the polypeptide of the invention to CNA, but also the physiological effect on the cells of this binding, then a phenotypic screen using endogenous cellular phenotypes should be used. For this type of assay, phenotypic characteristics such as expression of an endogenous reporter gene, modification of the proliferative rate of the cells, cell apoptosis, a modification of cell differentiation or resistance to cell death may be used as the read-out for modulatory activity.

The invention also relates to methods for identifying substances which modulate the interaction between NS5A-TP2 and a polypeptides according of the invention.

In particular, the invention relates to a method for the identification of substances which modulate the interaction between NS5A-TP2 and a polypeptide of the invention, said method comprising the steps of (i) contacting a candidate modulatory substance with NS5A-TP2 and the polypeptide of the invention in conditions in which NS5A-TP2 and said polypeptide can bind, and in which said binding can be detected by a specific signal ;

(ii) detecting a change in the intensity of said signal ; and (iii) optionally recovering the candidate substance.

More specifically, this aspect of the invention includes a method for the identification of substances which modulate the interaction between NS5A-TP2 and a polypeptide of the invention, said method comprising the steps of (i) introducing a candidate modulatory substance, NS5A-TP2 and the polypeptide of the invention into a eukaryotic cell, in conditions in which a specific detectable phenotype associated to the binding of NS5A-TP2 with the polypeptide of the invention can be detected ; (ii) detecting a change of the said specific detectable phenotype ; and (iii) optionally recovering the candidate substance.

Molecules which bind to calcineurin at the same site as that bound by the polypeptides of the invention (within the sequence extending from amino acid 378 to 500 of the beta - -

isoform of CNA, or equivalent positions in the alpha or gamma isoforms), may be used to modulate calcineurin activity in vivo or in vitro. Such a method comprises contacting calcineurin with a ligand capable of binding to calcineurin at a site located within the sequence extending from the amino terminal of the calmodulin binding domain to the carboxy terminal of the auto-inhibitory domain of CNA, in conditions suitable to allow effective binding between the ligand and calcineurin thereby modulating at least one activity of calcineurin, for example phosphatase activity, and the consequent antiproliferative activity. According to this aspect of the invention the ligand may be a polypeptide according to the invention, comprising or consisting of the amino acid sequences (i) (ii) or (iii), or may be a small molecule, nucleic acid or protein which binds to calcineurin at the same site as the polypeptide of the invention.

The polypeptides of the invention can be used as therapeutic agents for use in humans or animals, more particularly as the active ingredient in pharmaceutical compositions, optionally associated with a pharmaceutically acceptable carrier. The nucleic acids encoding the polypeptides of the invention may also be used as therapeutic agents. A particularly preferred embodiment is the use of a peptide (i), (ii) or (iii) of the invention in a TRX or TRX-like scaffold, particularly a human TRX scaffold, as a therapeutic agent. In particular, the invention relates to methods for treating or preventing conditions in which the up-regulation of calcineurin phosphatase activity or the activation of NS5A-TP2 is required, by administering to an individual in need of such treatment, effective amounts of the polypeptide or nucleic acid of the invention. Preferably, the administration is performed at the body site or organ concerned by the pathology, for example muscle, bone, brain, heart, etc.

One aspect of the invention therefore relates to the use of the polypeptide, the nucleic acid, the vector or the cell of the invention for the preparation of a medicament for treating or preventing a disorder which can be treated or prevented by upregulating the phosphatase activity of calcineurin or by activating NFAT in eukaryotic cells. A further aspect of the invention relates to the use of the polypeptide, the nucleic acid, the vector or the cell of the invention for the preparation of a medicament for treating or preventing a disorder which can be treated or prevented by limiting the proliferation of eukaryotic cells. Typically, the eukaryotic cells are mammalian cells, preferably human cells, and are chosen from cancer cells, cardiomyocytes, neurones, fibroblasts, skeletal muscle cells, osteoclasts, osteoblasts or T-cells. The condition may be a pathology associated with NFAT phosphorylation state, T-cell activation state, skeletal myocyte differentiation stage, skeletal muscle dystrophy or atrophy, neurone development or bone formation. As examples of conditions in which administration of the polypeptide of the invention may be advantagous, reference may be made to Osteopetrosis (or marble bone disease), Duchenne muscular dystrophy, cancer or repair of a farcted area in the heart.

In onother embodiment, the invention relates to a method for enhancing transcription of a gene in a cell, which gene is under the transcriptional control of a regulatory element, particularly a promoter, containing at least one NFAT- response element, by introducing a polypeptide according to the invention in the cell.

A further aspect of the invention therefore to the use of the polypeptide, the nucleic acid, the vector or the cell of the invention for the preparation of a medicament for treating or preventing a disorder which can be treated or prevented by the binding of the polypeptide of the invention to NS5A-TP2 in eukaryotic cells, for example for treating hepatitis C or a HCV induced liver tumors.

Brief description of the figures

Figure 1. Design of the peptide aptamer library and of the antiproliferative screening (A) Schematic representation of the pBK1 peptide aptamer library. This SIV-derived expression system directs the expression of two cistrons coding for a EGFPf transduction marker and HA-tagged peptide aptamers consisting of a 10 aminoacid variable region inserted within the active site of human thioredoxin.

(B) Workflow of the screening for antiproliferative peptide aptamers. Rat XC cells are transduced with pBK1 and labelled with CMTMR. The highest percentile of fluorescent cells is then isolated by flow cytometry, and the peptide aptamer coding sequences are amplified by PCR from genomic DNA to construct sub-libraries. The sub-libraries are used in successive iterations of this process. Figure 2. Antiproliferative effect of peptide aptamers

(A) Progressive enrichment of peptide aptamer sublibraries in antiproliferative peptide aptamers through screening iterations. XC or HeIa cells were transduced with pBK1 or different R"n" sub-libraries obtained after n screening iterations, and were labelled with CMTMR. The mean fluorescent intensity increases with the number of screening iterations, indicating a progressive enrichment in peptide aptamers exerting an antiproliferative effect.

(B) Colony formation assays. HeIa or MCF-7 cells were transfected with plasmids directing the stable expression of the Cdk inhibitor p21, a library of peptide aptamers from pBK1 (AptaLib), Human thioredoxin (HTRX), and peptide aptamers R7G44, R5G42, R5G52. The cells were cultured for two weeks and the colonies were stained with crystal violet.

Figure 3. Interaction between peptide aptamer R5G42 and calcineurin A

(A) Yeast two-hybrid mating assay. TB50α yeast were co-transformed with pSH18-34T (bearing a lacZ reporter gene) and plasmids directing the expression of LexA alone or in fusion with peptide aptamers R5G42, R7G44 or R5G52. MB210a yeast were transformed with the selected cDNA library plasmids directing the expression of CNAβ, CNAy, and NS5ATP2 truncated proteins. To obtain negative controls, MB210a yeast were also transformed with the empty prey plasmid (pJG4-5) and with pJG4-5 directing the expression of Ras and FKBP12 prey proteins. To obtain a positive control, MB210a yeast were transformed with pJG4-5 directing the expression of RG22 peptide aptamer prey fusion protein that interacts with LexA in the context of most LexA fusion proteins. (B) Schematic representation of the CNA clones selected through the yeast two-hybrid screening and of the truncations performed on CNAβ.

- CNA beta C ter -delta 1 : amino acids 378 to 500

- CNA beta C ter -delta 2 : amino acids 378 to 456

- CNA beta C ter -CaM : amino acids 378 to 423 (C) Affinity capture assay. Comparable amounts of GST-R7G44 or GST-R5G42 recombinant fusion proteins were coupled to glutathione-sepharose beads. Purified calcineurin was added onto the beads and the captured molecules were revealed by a western blot experiment using an anti-calcineurin antibody.

Figure 4. Stimulation of calcineurin activity by peptide aptamer R5G42 (A) In vitro calcineurin phosphatase assay. Dephosphorylation of the model substrate pNPP by purified calcineurin was measured in presence of various amounts of purified calmodulin (CaM), GST-R5G42 or GST-R7G44 fusion proteins.

(B) Monitoring of BAD phosphorylation in cultured cells. Hela-Tet cells were transfected with plasmids directing the transient expression of BAD, CNAβ, CNB and peptide aptamers R5G42, R5G52 or R7G44. Transfected cells were treated or not with 500 nM FK506. The expression level of BAD and the phosphorylation of serine 112 and 136 residues were monitored by western blot experiments using specific antibodies.

Figure 5. Human calcineurin A isoforms (A) amino acid sequence of calcineurin A alpha isoform (SEQ ID 16)

(B) amino acid sequence of caicineurin A beta isoform (SEQ ID 17)

(C) amino acid sequence of calcineurin A gamma isoform (SEQ ID 18)

Figure 6. NS5A-TP2 Amino acid sequence of NS5A-TP2 (SEQ ID 15)

Figure 7. Human Thioredoxin

Amino acid sequence of human thioredoxin (SEQ ID 19)

Figure 8. R5G42 and R5G42 mutants

Amino acid sequences of R5G42 (SEQ ID 22) and of the R5G42 C2, C3, C4, C5, C7, C8, C12, N9 and N12 mutants (SEQ ID 23-29 and 33-34).

Figure 9. Interaction matrix between R5G42 mutants and CNA beta, CNA gamma and NS5A-TP2

The capacity of R5G42 mutants having a one amino acid change as compared to R5G42 to bind CNA beta and gamma C-Terminal fragments (fig. 3b) and NS5A-TP2 was tested in yeast two-hybrid assays. CNA beta and gamma C-Terminal fragments and NS5A-TP2 - -

were cloned in three different vectors (pSH18-34, pJK103 and pRB18-40). These three plasmids differ from each other in the level of sensitivity of their promoter, pSH18-34 having the highest sensitivity and pRB18-40 having the lowest.

R5G42 mutants C2, C7 and C8 were shown to interact with the CNA beta and gamma C- terminal fragments but not with NS5A-TP2, and R5G42 mutant N9 (SEQ ID 33) was shown to interact with NS5A-TP2 but not with the CNA beta and gamma C-terminal fragments.

Figure 10. Expression of human TRX in HeLa cells transfected with pCI-HA or pBof plasmids

From equivalent total protein amounts (revealed by the intensity of the anti-Actin labelling), HA labelled Trx is only detected with plasmids pCI-HA/Trx and pBof/Trx. However, in the context of pBof, the expression lever is lower.

Figure 11. Expression of aptamers according to the invention in HeLa cells.

HeLa cells were transfected with pCI-HA plasmids containing either an empty vector, Trx, R5G42, C2, C7, C8, N9 and R5G52. Expression in the cells of Trx, R5G42, C2, C7, C8 and N9 was confirmed by a Western Blot.

Figure 12. Effect of peptide aptamers according to the invention on Osteoclast differentiation

Trx, CNA^* and Peptide aptamers R5G42, C2, C7, C8 and N9 were transfected into RAW1 cells and left for four days in absence of the normal differentiation factor RANKL. CNA* is activated calcineurin A which elicits a robust differentiation response. The results show that differentiation is induced by the aptamers R5G42 and C7.

A. Transfection of RAW1 cells with an empty vector and addition of RANKL two days after transfection (positive control), and transfection with a vector containing TRX (negative control). B. Transfection OF RAW1 cells with vectors containing CNA* (positive control for differentiation activation) and the peptide aptamers R5G42, C2, C7, C8 and N9

Figure 13. Expression of proteins in Mice muscles after electroporation and denervation Mice hind legs received an injection followed by electroporation of plasmids containing Thioredoxin (TRX) or a control aptamer (34). Their left hind legs were then denerved. - -

Control mice (CT) received only an NaCI injection. Total proteins were extracted for an analysis of the expression of certain key proteins among which TRX, the aptamer 34 and its target (C34), Calcineurine A (CNA), beta-Tubuline (B-Tub), Bcl2 and Bax. It is to be noted that the fibers having incorporated the vectors (pCI-HA-TRX, pCI-HA-34) only represent a fraction of the muscle analysed.

Figure 14. Specificity of aptamers according to the invention for CNA and NS5A-TP2 Interaction matrix between peptide aptamers R5G42, C2, C7, C8, N9, R5G44 and R5G52 with CNA constructs CNA1-CNA8 (A) CNA9-1 1 (B) and NS5A-TP2 (C). An interaction phenotype between CNA3 / CNA 11 , which both contain the Calmodulin binding domain (CaM) and the auto-inhibitory domain (Al) but not the CNB binding domain (CNB) and the aptamers R5G42, C2, C7, C8 and N9 is observed in a two-hybrid assay. R5G44 and R5G52 aptamers recognize neither the CNA fragments, nor NS5A-TP2. Only aptamers R5G42 and N9 recognize NS5A-TP2. CNB : CNB binding domain; CaM : Calmodulin binding domain; Al : auto-inhibitory domain

Figure 15. Detection of the expression of CNA constructs in yeast In order to check the expression of the CNA constructs CNA1 to CNA7 in the two-hybrid assay, a cellular lysate was performed followed by Western Blot detection. The molecular weights of the different constructs are represented in the squares. For CNA5 and CNA6, no bands are detected which is probably due to their small size (about 19 kDa)

Figure 16. Detection of the expression of aptamers according to the invention in yeast The lysis of the yeasts was performed on colonies obtained after the mating of mat a and mat alpha strains and the determining of the two-hybrid phenotype. Aptamers R5G42, C2, C7, C8, N9 and R5G52 are in the LexA-pGILDA vector. Their expression was detected unsing an antibody which recognize LexA.

Figure 17. Amino acid seguences of CNA1-CNA11 (SEQ ID 35-45)

Figure 18. Measure of the tibialis anterior area14 days post-denervation

Vectors containing TRX, the R5G42, C7 or N9 aptamers or NaCI (control) were electroporated in mice hind legs (day 1) and an unilateral abolition of the motor - -

innervation of the tibia muscles of the left hind leg was performed (day 3). After euthanasia of the mice (day 17) the tibialis anterior area was measured. Without denervation, the muscle area is relatively stable from one experiment to another (6.532.412 +/-351.070, or 5,3% of variation). With denervation a reduced atrophy effect of about 27% and 48 % is observed with aptamers R5G42 and N9 as compared to the atrophy effect obtained using the NaCI control (See figures 19-20). The 100% of atrophy effect was evaluated using the data obtained with the NaCI control. A-B. Measure of the the tibialis anterior area with (left hind leg) or without (rigth hind leg) denervation - C. Section of the tibialis anterior area14 days post-denervation

Examples The inventors set out to identify and isolate combinatorial protein reagents capable of inhibiting tumor cell proliferation.

A peptide aptamer library was built in a lentiviral expression system to isolate aptamers that inhibit cell proliferation in vitro. Using one of the isolated aptamers (R5G42) as a bait protein, a yeast two-hybrid screening of cDNA libraries was performed and calcineurin A (CNA) was identified as a target protein candidate. R5G42 binds CNA in vitro and stimulates its phosphatase activity. When expressed transiently in human cells, R5G42 induces the dephosphorylation of Bad. The use of this ligand is therefore likely to help elucidate the still elusive structural mechanisms of activation and inhibition of calcineurin.

In the experiments reported in the following examples, the inventors have constructed a peptide aptamer library in a simian immunodeficiency virus (SΙV)-derived gene expression system. They have performed an iterative genetic screening to isolate peptide aptamers that inhibit tumor cell proliferation. They have identified the catalytic subunit of the calcium-activated protein phosphatase calcineurin as a target of one of the isolated aptamers. They have shown that this aptamer upregulates the phosphatase activity of calcineurin in vitro and in cultured cells. Their work has identified an antiproliferative molecule that binds and stimulates calcineurin through a seemingly original mechanism. - -

The inventors have shown that an antiproliferative peptide aptamer (R5G42) binds CNA and activates its phosphatase activity in vitro. Consistent with the in vitro results, the transient expression of R5G42 in human cells induces the dephosphorylation of Bad on Serine 136, which is totally reversed by FK506. The expression of R5G52, another antiproliferative peptide aptamer, does not affect Bad phosphorylation levels. Altogether, these results indicate that Bad dephosphorylation is specifically caused by the activation of CNA by R5G42, as opposed to being an indirect consequence of an antiproliferative activity. The antiproliferative effect of R5G42 could stem from a calcineurin-mediated induction of apoptosis, which would only occur upon prolonged expression of the peptide aptamer. .

Details of the Materials and Methods employed in the following Examples 1 to 7 are provided in Example 7

Example 1 : Peptide aptamer libraries and screening strategy

To construct their peptide aptamer libraries, the inventors used a SIV-derived lentiviral expression vector directing the constitutive expression of bicistrons (transgenes and a

GFP marker) under the control of an EF1α promoter (see Example 6 for experimental procedures). They first built 12 low-complexity peptide aptamer libraries, combining two scaffolds (human thioredoxin or a E.coli thioredoxin, whose coding sequence harbors codons optimized for expression in mammalian cells), two epitope tags (HA or 6His) and three variable region lengths (16, 10 or 7 amino acids). They performed pilot experiments to determine which library yielded the highest expression level of peptide aptamers upon transduction of XC cells with viral particles. They observed that the best combination was the HA-tagged, human thioredoxin displaying a random peptide loop of 10 amino acids and they constructed accordingly pBK1 , a high-complexity peptide aptamer library (see figure 1A).

To isolate library members that inhibit tumor cell proliferation, the inventors made use of the fluorescent vital dye CMTMR (5-(and-6)-(((4-chloromethyl)benzoyl) arnino)tetramethylrhodamine), which cells incorporate and dilute, as they proceed through - -

division cycles. Those cells that do not divide maintain a high fluorescence level and can thus be sorted by flow cytometry. Because of a significant background of cells that do not grow or proliferate more slowly independent of the expression of peptide aptamers, multiple screening rounds were necessary to isolate peptide aptamers that exert an antiproliferative effect. The inventors thus constructed a peptide aptamer sub-library from the highest percentile of CMTMR-positive cells obtained after each screening iteration and they submitted each sub-library to a subsequent screening round (see figure 1 B).

Example 2 : Isolation of antiproliferative peptide aptamers

The inventors used rat XC cells, derived from a RSV-induced sarcoma, which enabled them to use viral particles harboring a murine ecotropic envelope. They performed 7 screening iterations before isolating and characterizing individual peptide aptamers. They determined the antiproliferative activity of the sub-libraries both in XC cells and in human HeLa cells. As shown in Figure 2A, the mean fluorescence intensity of both cell lines increases gradually with the number of screening iterations, thereby indicating a progressive enrichment of antiproliferative peptide aptamers within the sub-libraries. The inventors picked and sequenced 100 clones from the R5 and R7 sub-libraries, obtained from the fifth and seventh screening iteration, respectively. More than 40% of the peptide aptamers isolated after the seventh screening iteration corresponded to a single library member, named R5G42. The occurrence of this aptamer was already significant after the fifth iteration but was not detectable after the fourth iteration. Three other peptide aptamers that showed a lower occurrence were also isolated (R7G11 (SEQ ID 30), R7G44 (SEQ ID 31) and R5G52 (SEQ ID 32)) (see Table 1).

The inventors wished to establish the antiproliferative activity of these peptide aptamers using alternative cellular models and a non-retroviral vector to express individually each aptamer. They cloned the aptamer coding genes into a vector bearing a hygromycin selection marker. They also subcloned the pBK1 library into this vector, to create "AptaLib". They continuously expressed the aptamers, the empty thioredoxin scaffold or AptaLib in HeIa and MCF-7 cells for 2 weeks and they stained the cells that grew. Aptamers R5G42 and R5G52 significantly inhibited the proliferation of both cell lines, as compared to AptaLib and human thioredoxin. Aptamer R7G44, similarly to other aptamers - -

(not shown), did not exert any antiproliferative effect (see figure 2B). These aptamers may originate from the remaining background of slowly proliferating cells during the seventh screening iteration, independently of the expressed aptamers. Surprisingly, aptamer R7G11 did not inhibit cell proliferation in this assay (not shown), despite showing a high occurrence in the seventh sub-library (Table 1). This could be due to the fact that the CMTMR assay is more sensitive in detecting modest antiproliferative effects than the colony formation assay or that some peptide aptamers somehow enhance the CMTMR labeling of their host cells. From all these results, it was decided to focus on peptide aptamer R5G42 and to identify its target protein.

Example 3 : Identification of calcineurin A and NS5A-TP2 as target proteins

The inventors performed two yeast two-hybrid screening experiments against a LexA- R5G42 bait protein, using a human testis and a human foetal brain cDNA library. They obtained 29 and 42 reconfirmed clones, respectively. They disregarded those clones that either showed a barely detectable two-hybrid interaction phenotype, or that cross- interacted with control aptamers, or that corresponded to hypothetical proteins (Table 2). The inventors thus retained two candidates. The highest occurring clone, from both libraries, corresponded to the NS5A-TP2 protein, recently discovered through a systematic search for genes that are transactivated by the non-structural NS5A protein from hepatitis C virus (22). No biological knowledge is currently available for this protein. The other remaining target candidate was calcineurin A (CNA), for which two different isoforms (beta and gamma) were selected from the testes library (see figure 3A). To confirm the interaction between R5G42 and CNA, the inventors performed an in vitro binding assay between recombinant purified GST-aptamer fusion proteins, coupled to a glutathione-sepharose matrix, and purified CNA. The GST-R5G42 solid phase readily captured CNA, as opposed to a GST-R7G44 control (see figure 3C).

Example 4 : Mapping of the R5G42 binding site on CNA and Mutations of R5G42

Mapping of the R5G42 binding site on CNA

The inventors set out to map the R5G42 binding site on CNA. The CNA interacting clones selected in the yeast two-hybrid experiments corresponded to the carboxy-terminal - -

regions of the beta and gamma isoforms, encompassing the calmodulin-binding domain and the auto-inhibitory domain (see figure 3B). Among the 3 truncations constructed from the CNAβ selected clone (see figure 3B), only CNAβΔI retained its yeast two-hybrid interaction phenotype with R5G42 (see figure 3A and data not shown). These results indicate that the R5G42 binding site on CNA lies between the amino-terminus of the calmodulin-binding domain and the carboxy-terminus of the auto-inhibitory domain, and is not circumscribed to the CaM binding domain. This yeast two-hybrid mating assay also supports the specificity of interaction between R5G42 and CNA, as R5G42 did not show an interaction phenotype with two unrelated bait proteins (RAS, FKBP12) and as R7G44 and R5G52 did not show an interaction phenotype with CNA. R5G52, however, did not show an interaction phenotype with peptide aptamer RG22, which interacts with LexA in the context of most (but not all) LexA fusion proteins. The LexA-R5G52 bait protein may thus not be properly expressed and/or folded in this yeast two-hybrid setting.

Mutations of the R5G42 amino sequence

The inventors explored the ability of R5G42 mutants having a one amino acid change as compared to R5G42, to bind to CNA beta and gamma C-Terminal fragments (fig. 3b) and to NS5A-TP2. To this end, they proceeded to yeast-two hybrid assays as in example 3. CNA beta and gamma C-Terminal fragments (fig. 3b) and NS5A-TP2 were cloned in three different plasmids (pSH 18-34, pJK103 and pRB18-40), which differed from each other in the level of sensitivity of their promoter to the bait/prey complex formation, pSH18-34 having the highest sensitivity and pRB18-40 having the lowest.

R5G42 mutants C2 (SEQ ID 23), C7 (SEQ ID 27) and C8 (SEQ ID 28) were shown to interact with the CNA beta and gamma C-terminal fragments but not with NS5A-TP2, and R5G42 mutant N9 (SEQ ID 33) (see figure 8) was shown to interact with NS5A-TP2 but not with the CNA beta and gamma C-terminal fragments (figure 9). The inventors thereby showed that point mutation in the R5G42 amino acid sequence allowed to identify mutants sequence with an increased selectivity for each of the targets identified for R5G42.

Binding of R5G42 and R5G42 mutants to subsequences of CNA and to NS5A-TP2

The inventors proceeded to further yeast two-hybrid binding assays between peptide aptamers R5G42 (SEQ ID 22), C2 (SEQ ID 23), C7 (SEQ ID 27), C8 (SEQ ID 28), N9 (SEQ ID 33), R5G44 and R5G52 with CNA constructs CNA1-CNA8 (figure 14A), CNA9- - -

CNA11 (figure 14B) and NS5A-TP2 (SEQ ID 15) (figure 14C). The sequences of CNA1- CNA11 (SEQ ID 35-45) are shown in figure 17. The sensitivity of this yeast two-hybrid assay was higher than in the experiment reported above.

An interaction phenotype between each of CNA3 and CNA 11 , which both contain the Calmodulin binding domain (CaM) and the auto-inhibitory domain (Al) but not the CNB binding domain (CNB) and the aptamers R5G42, C2, C7, C8 and N9 was observed. R5G44 and R5G52 aptamers (negative controls) recognized neither the CNA fragments, nor NS5A-TP2. The only aptamers which recognized NS5A-TP2 were R5G42 and N9 (figure 14). The fact that CNA1 and CNA2 which both contain the Calmodulin binding domain (CaM) and the auto-inhibitory domain (Al) as well as the CNB domain did not interact with the aptamers of the invention appears to be due to an artefact of the yeast two hybrid protocol. Indeed, the inventors clearly showed in the Bad dephosphorylation assay in mammalian cells commented in example 5, that endogenous CNA was activated on transfecting R5G42 into the cells.

Example 5 : Modulation of calcineurin activity in vitro and in mammalian cells

Activation of CNA phosphatase activity in vitro The inventors next explored the ability of R5G42 to modulate the enzymatic activity of its target protein. To this end, they first performed an in vitro phosphatase assay using purified CNA and para-nitrophenylphosphate (pNPP) as a substrate. As shown in Figure 4A, the addition of purified calmodulin (CaM) is required to activate CNA. The addition of recombinant purified GST-R5G42 did not result in an inhibition or an exacerbation of CaM-activated CNA phosphatase activity (not shown). However, the addition of high concentrations of GST-R5G42 activated CNA phosphatase activity in absence of CaM, to a level comparable to that observed using CaM. The addition of equal amounts of the control aptamer R7G44 did not produce a significant effect. This experiment indicates that R5G42, like CaM, binds and activates CNA phosphatase activity in vitro.

Dephosphorylation of Bad in HeLa cells

The inventors set out to confirm this finding in human cells. Bad is a key pro-apoptotic protein whose activity is tightly regulated by its phosphorylation status, itself controlled by - -

the balanced activity of several protein kinases and calcineurin. Therefore, the phosphatase activity of calcineurin in cells can be monitored by examining Bad phosphorylation. HeLa cells were transfected with plasmids directing the expression of Bad, CNAβ, CNB and either R5G42, R5G52 or R7G44. The inventors observed that expression of R5G42 decreased the phosphorylation of Bad on serine 136, without affecting the phosphorylation on serine 112 (see figure 4B). To demonstrate that this effect was caused by an upregulation of calcineurin activity, they performed the same experiments in presence of FK506, a well-known inhibitor of calcineurin. The R5G42- induced dephosphorylation of Bad on serine 136 was no longer observed in presence of FK506 (see figure 4B).

Effect of aptamers according to the invention on osteoclast differentiation

Osteoclasts are bone-resorbing, multinucleated cells that differentiate from monocyte precursors. The differentiation of osteoclasts is dependant on a tumor necrosis factor (TNF) family cytokine, receptor activator of nuclear factor (NF)-κB ligand (RANKL), as well as macrophage colony-stimulating factor (M-CSF) (30).

Recent studies have suggested that the nuclear factor of activated T-cells (NFATd ) is a master switch for osteoclastogenesis in reponse to RANK receptor activation (31).

The necessary and sufficient role of NFATd in osteoclastogenesis was suggested by the in vitro observation that NFATd^^' embryonic stem cells do not differentiate into osteoclasts (32).

The activation of NFAT d as well as of NFAT c2/c3/c4 is mediated by the calcium/calmodulin dependant phosphatase, calcineurin A (CNA).

The inventors assessed the ability of some CNA-specific peptide aptamers to promote osteoclast differentiation via the activation of CNA. Raw1 cells (osteoclasts precursors) were transfected with the following plasmids: pCI-HA-Trx (negative control), pCI-HA CNA^* (positive control for differentiation activation), pCI-HA R5G42, pCI-HA R5G42-C2, pCI-HA R5G42-C7, pCI-HA R5G42-C8 and pCI-HA R5G42-N9 (this last point mutant shows a dramatic reduction of the two hybrid interaction phenotype against CNA compared to R5G42). The differentiation state was then observed 4 days post-transfection. As expected, cells in control conditions (with RANKL) were differentiated into osteoclasts. - -

Some cells with the osteoclast phenotype can be observed with CNA*, R5G42, and R5G42-C7 (see figure 12), indicating that these proteins are able to initiate and fullfill the differentiation process. Nevertheless with the negative control R5G42-N9 and the C2 and C8 mutants, some cells with several nuclei can be observed but no osteoclasts fully differentiated were detectable in this experimental period.

Thus, the aptamers R5G42 and R5G42-C7 exert an effect on CNA sufficient to permit the differentiation of monocyte-derived cells into osteoclasts in the absence of RANKL.

Example 6 : In vivo denervation assay in mice tibia muscles

Mice hind legs first received an injection of plasmids containing Thioredoxin (TRX), a control aptamer (34) or only NaCI, followed by electroporation. Their left hind legs were then denerved. After euthanasia, total proteins were extracted, and the expression of certain key proteins among which TRX, the aptamer 34 and its target (C34), Calcineurin A (CNA), beta-Tubuline (B-Tub), Bcl2 and Bax was checked. The level of CNA expression in muscle was high and TRX and the control aptamer 34 cloned in the pCI-HA vector were detected (see figure 13).

Another group of mice hind legs were electroporated after the injection of vectors containing TRX₁ the R5G42, C7 or N9 aptamers or with NaCI (control) at day 1. A unilateral abolition of the motor innervation of the tibia muscles of the left hind leg was performed at day 3 in order to induce a muscular atrophy. The mice were then euthanised at day 17, i.e. 14 days after sciatic denervation of the left hind leg. The measure of the tibialis anterior area 14 days post-denervation showed that without denervation (right hind leg), the muscle area is relatively stable from a one experiment to another (6.532.412 +/- 351.070, or 5,3% of variation). With denervation a reduced atrophy effect of about 27% and 48 % is observed with aptamers R5G42 and N9 as compared to the atrophy effect obtained using the NaCI control (figure 18).

Example 7 : Materials and methods

The following section describes the materials and methods used in the above-described examples. - OU ~

Cell culture

All mammalian cells were maintained in a 5% CO₂ atmosphere at 37°C in Dulbecco's

Modified Eagle's Medium (Invitrogen-Gibco) supplemented with 10% v/v fetal calf serum and 100 microg/ml penicillin-streptomycin.

Construction of lentiviral vectors

All the lentivectors were derived from pR4SA-EFS-GFP-W (19). This vector first was digested with Hind III, thus eliminating EGFP, WPRE and EcoRI sites, to create pVRVl

The remaining EcoRI site upstream of the CMV promoter was blunted and the vector was religated to create pVRV2. pVRV2 was digested with BamHI and Hindlll and the following hybridized oligodeoxynucleotides :

5'-GATCGCTAAGCGAATTCCTCGAGGCGCGCGTCGACCAGGATCC-S' (SEQ ID 1) and

5'- AGCπGGATCCTGGTCGACGCGCGCCTCGAGGAATTCGCTTAGC-3' (SEQ ID 2) were ligated to create pVRV3, that bears a multiple cloning sequence. pVRV4 was constructed by inserting an IRES-EGFPf (farnesylated enhanced GFP) coding sequence in pVRV3. This was done by a multiplex ligation between Sall/BamHI-cut pVRV3, a

Sall/Ncol-cut EMCV IRES cassette (from plRES2-EGFP, Clontech) and a Ncol/BamHI-cut

EGFP-f coding sequence (from pEGFP-F, Takara Bio). A HA-tagged HTRX fragment from pJMX-HTRX (Abed et al, in preparation) was then PCR amplified using the oligonucleotides δ'-GCGGCTAAGCCATGTACCCTTATGATGTGCCAG-S' (SEQ ID 3) and δ'-GGAGACTTGACCAAACCTCTG-S' (SEQ ID 4) and this fragment was ligated into Blpl/Xhol-cut pVRV4. The resulting plasmid, pVRV6, directs the bicistronic expression of a HA-tagged human TRX (with a modified active site) and of EGFP carrying a farnesylation sequence so as to anchor the marker protein to plasma membranes.

Construction of the peptide aptamer expression library pBK1 , a library of peptide aptamers bearing 10 amino acids within the active site of HA- tagged human TRX was constructed. The oligonucleotides - -

5'-TGGGCCGAGTGGAGCGGTCCG(NNS)₉NNCGGACCGAGCAAGATGATCGCCCC -3' (SEQ ID 5) where N is A, C, G or T and S is C or G, and 5¹-GGGGCGATCATCTTGCTCGGTCCG-3¹ (SEQ ID 6) were annealed and duplexes were produced using the Klenow DNA polymerase. The Avail-cut duplexes were ligated into Cpol-cut pVRV6. The ligation product was transformed into ElectroTen Blue competent bacteria (Stratagene) and 8.5x10⁹ transformants were obtained.

Viral vector production

Lentiviral particles were produced by transfecting into 293T cells the following plasmids: i) pVRV6, pVRV12 (pVRV6 directing the expression of p21^Cιp1), pBK1 or any aptamer sub- library; ii) helper pSIV15, directing the expression of gag and pol (20); iii) FbmoSalf, directing the expression of a murine ecotropic envelope (19); iv) pRev (20). In some experiments, plasmids iii and iv were replaced by the G-rev plasmid (20), directing the expression of Rev and the VSV-G pantropic envelope. Lentivirus-containing supernatants were collected and filtered 48h post-transfection through a 0.45 micron filter. Viral titers were determined by infecting XC or HeIa cells and counting GFP-positive cells with a cytometer (FACScan, Becton-Dickinson). From 40% to 100% cells were routinely infected.

Screening of antiproliferative peptide aptamers

XC cells were plated 24h before infection (2 x 10⁵ cells/well, 6-well plates, 6 plates). To infect the cells, a medium containing a viral supernatant and 6 microg/ml polybrene was added. Three days later, the cells were collected, washed with PBS, stained 5 x 10⁵ cells/ml with 10 microM CellTracker™ Orange CMTMR (Invitrogen) in PBS at 37°C for 30 min and incubated in culture medium for another 30 min at 37°C. The cells were then plated onto 10 cm dishes (10⁶ cells/dish). After 72h, the cells were collected and the highest percentile of CMTMR fluorescent cells was sorted using a FACS Vantage flow cytometer (Becton-Dickinson). The sorted cells were pooled and their genomic DNA was extracted using a Wizard Genomic DNA purification kit (Promega). Aptamer coding genes were PCR amplified using the oligonucleotides 5'-AACCGGTGCCTAGAGAAGGT-3¹ (SEQ ID 7) and 5¹-AGACCCCTAGGAATGCTCGT-3¹. (SEQ ID 8)

The EcoRI/Xhol-digested products were cloned into EcoRI/Xhol-cut pVRV6, to create successive sub-libraries of peptide aptamers, named pCMTMR 1 to 7.

Two-hybrid screening of R5G42-interacting proteins pVRV6-R5G42 was digested with EcoRI and Xhol and ligated the fragment into EcoRI/Xhol-cut pGILDA (Clontech) to create pGILDA-R5G42, a plasmid directing the galactose-inducible expression of a LexA-R5G42 fusion protein. MB226α pSH 18-34 yeast (21) was transformed with pGILDA-R5G42 and MB210a yeast (21) with human foetal brain and human testes cDNA libraries, constructed in pJG4-5. The yeast-two hybrid screening of both libraries was performed essentially as described (21), using 4x10⁸ cfu and 2.4x10⁸ cfu from the brain and testes libraries, respectively. The mating efficiency was estimated at 50% and 58% and the number of diploid exconjugants at 0.2 x 10⁸ and 1x10⁸ for the brain and testis cDNA library transformed yeast, respectively. The expression of the bait and the libraries were induced at 30⁰C for 5h, from 10% of the diploids. The yeast were collected and plated onto 10 UraHisTrp Leu^' galactose/raffinose plates for 5 days, then replica plated onto 10 UraHisTrp^'Ade^" X-gal galactose/raffinose plates. 60 clones wer picked from the brain and 48 clones from the testes library that grew in absence of leucine and adenine, and that displayed a β-galactosidase activity. Library plasmids were recovered and re-transformed into EGY48α. The interaction phenotypes were confirmed by a mating assay with EGY42a transformed with pGILDA-R5G42. The library cDNAs were then sequenced from most reconfirmed clones.

Yeast two-hybrid mating assays To build the different truncations of the CNAβ Cter interacting clone, oligonucleotides that enabled cloning the PCR products into pJG4-5 by homologous recombination were designed.

RH6: 5'-πATGATGTGCCAGAπATGCCTCTCCCGAAπCagtatttgctctgatgatg-3' (SEQ

ID 9) RH4: 5'-AMCCTCTGGCGAAGAAGTCCAMGCπCTCGAGCTActgtacagcatctttccg-3'

(SEQ ID 10)

RH3: 5'- AAACCTCTGGCGAAGAAGTCCAAAGCπCTCGAGCTAggcactttgcagggtctgc-3'

(SEQ ID 11) - -

RH7: 5'- ACCTCTGGCGAAGAAGTCCAAAGCTTCTCGAGTCAcctgagaacagagaagact-S" (SEQ ID 12)

The 5' end of RH6 (upper case) matches part of the HA epitope tag and the 5' ends of RH4, RH3 and RH7 (upper case) match the 5' extremity of the ADH terminator. The PCR reactions was performed using pCMV-SPORT6-CnAβ as a template. CnAβCter Δ1, Δ2, CaM were constructed by combining oligonucleotides RH6/RH4, RH6/RH3, RH6/RH7, respectively. MB210a was co-transformed with the PCR products and EcoRI/Xhol-cut pJG4-5. The prey plasmids were retrieved from the transformants (21) and the homologous recombination products were checked by sequencing. MB210a was also transformed with positive and negative controls of interaction. TB50α was co-transformed with pSH18-34T (a plasmid bearing a high-sensitivity lacZ reporter gene) and pGILDA directing the expression of LexA, LexA-R5G42, LexA-R7G44 and LexA-R5G52. The yeast two-hybrid mating assays were performed as described (21).

In vitro binding assay pVRV6-aptamer plasmids were first digested with EcoRI and Xhol and the fragments were ligated into EcoRI/Xhol-cut pGEX4T1. GST-aptamer fusions were expressed in a BL- 21(DE3) E.coli strain. Overnight cultures were diluted 1/100 and let to grow at 37°C to reach an OD₆oo of 0.6 to 0.8. The expression of fusion proteins was induced by adding 1mM IPTG and incubating overnight at 20⁰C with vigorous shaking. The bacteria were collected and resuspended into a lysis buffer (5OmM Tris pH8, 10OmM NaCI, 1mM DTT) containing 1mg/ml lysozyme. They were frozen and thawed three times and sonicated on ice. The lysates were centrifuged at 1300Og for 30 min and the soluble fractions were collected. Equal amounts of GST-aptamers were immobilized on 100μl glutathion sepharose 4B beads (Amersham) at room temperature for 20 min. The beads were washed three times with lysis buffer. The beads were incubated with 1 or 3 μg of bovine brain purified calcineurin (Upstate) for 1h at 4°C. The beads were then washed five times with lysis buffer and the bound protein was eluted by boiling samples 10 min in presence of electrophoresis loading buffer. The samples were loaded onto a SDS-PAGE, transferred to nitrocellulose membrane, and calcineurin was detected by western-blotting using an anti-calcineurin pan A antibody (1/1000, Chemicon International). The blot was revealed using a HRP-linked rabbit antiserum and an ECL kit (Perkin Elmer). - 4 -

CeII proliferation assay

To stably express peptide aptamers in mammalian cells, the episomal eukaryotic expression vector pCEP4 that bears a CMV promoter and a hygromycin selection marker (InVitrogen) was used. Aptamer coding sequences were PCR amplified using the oligonucleotides

5'-GCAAGCTAGCATGTACCCTTATGATGTGCCA-S' (SEQ ID 13) that hybridized to the HA coding sequence and

5'-CGTTGCGGCCGCTTAGACTAATTCATTAATGGT-S' (SEQ ID 14) that contained a stop codon. The PCR products were digested with Nhel and Notl and ligated into Nhel/Notl- cut pCEP4 to create pEA-aptamer plasmids. 3 x 10⁵ cells/well were plated in 6-well plates and transfected 24h after using Jet PEI (Qbiogen), 3,7μg pEA- aptamer plasmids and 0.3μg pEGFP-C1 (Clontech) to monitor transfection. Hygromycin (InVitrogen) was added at 200μg/ml two days later and the cells were cultured for 2 weeks, renewing the medium twice a week. The cells were then rinsed in PBS and were fixed and stained by incubating 30 min in crystal violet (0.05% crystal violet, 20% ethanol, 0.37% formaldehyde). Excess crystal violet was removed by washing with water.

In vitro phosphatase assay

GST-aptamer fusion proteins were first produced as described above. For this experiment, GST-aptamer fusion proteins were eluted from glutathion sepharose beads using 2OmM reduced L-glutathione (Sigma), and the eluates were dialyzed overnight against a phosphatase buffer (5OmM Tris-HCI pH7.4, 0.1 mM CaCI₂). The phosphatase activity of calcineurin was measured using pNPP (Sigma) as substrate, in a final volume of 100μl. The sample solution contained 5OmM Tris-HCI (pH7.4), 0.1mM CaCI₂, 1mM NiSO₄, 0.15mg/ml BSA (Sigma), 0.1 μM calcineurin (Upstate). Purified calmodulin (Upstate) and GST-aptamer fusion proteins were added at different concentrations (see figure legend). After a 15 min pre-incubation at 37°C, the reactions were started by adding 4.1mM pNPP and the mixtures were incubated at 37°C for 20 min. The nitrophenylate product was measured at 405nm using an Envision plate reader (Perkin Elmer). The background level that was determined was substracted using a mixture lacking calcineurin.

Monitoring of Bad phosphorylation The peptide aptamer coding genes were cloned into pPEAt (a pCEP4-based vector that bears a tetracyclin-inducible promoter and a hygromycin resistance gene), as described above ("cell proliferation assay").

4 x 105 Hela-tet cells/well were seeded in a 6-well plate 24h before transfection. 1 μg of pEBG-mBad (a plasmid directing the expression of the murine Bad protein; Cell Signaling Technology), 0.5 μg of pCMV-SPORT6-CnAβ and pCMV-SPORT6-CnB (plasmids directing the expression of human calcineurin Aβ and B; RZPD), and 1 μg of pPEAt- R5G42, -R5G52 or -R7G44 were transfected with Jet PEI (Qbiogen). After an overnight incubation of the transfection mix, the cells were washed once with culture medium and fresh medium was added, with or without 0.5μM FK506 (Calbiochem). The cells were collected 24h later, washed twice in PBS, and lysed 20min in ice-cold lysis buffer (2OmM Tris, pH 7.4, 15OmM NaCI, 2mM EDTA, 1% NP40, protease inhibitor cocktail complete EDTA free-Roche). The lysates were centrifuged to remove cellular debris and the protein content was quantified using the microBCA protein assay kit (Pierce). 50μg of the lysates were loaded on a 4-12% SDS-PAGE, transferred to nitrocellulose membranes, and blotted with anti-phospho-Bad (Ser112), anti-phospho-Bad (Ser136), and anti-Bad antibodies (Cell Signaling Technology). The blots were revealed using the enhanced chemiluminescence (ECL) system (Perkin Elmer).

Raw Cell Differentiation assay.

Raw1 cells were transfected with the following plasmids: pCI-HA-Trx (negative control), pCI-HA CNA* (positive control for differentiation activation), pCI-HA R5G42, pCI-HA

R5G42-C2, pCI-HA R5G42-C7, pCI-HA R5G42-C8 and pCI-HA R5G42-N9. The sequence of CNA* is the same as that of CNA8 (see figure17, SEQ ID 42). The sequences of the R5G42 (SEQ ID 22), C2 (SEQ ID 23), C7 (SEQ ID 27), C8 (SEQ ID 28) and N9 (SEQ ID 33) aptamers is shown on figure 8.

One day before the transfection, Raw I cells were plated in 6-well dishes at 50 cell/mm².

Transfection was performed with FuGene 6 Reagent (Roche) using 2μg of each plasmid and following supplier recommandations.

8h after transfection D-MEM was changed with α- MEM. In the control dishes α-MEM +

50ng/ml RANKL was added. After 2 days, medium was changed with a fresh medium.

The differentiation state was then observed 4 days post-transfection. - -

Vectors for yeast two-hybrid, mammalian cells and in vivo assays The vectors used in the series of experiments are listed in table 3. The amplification is performed first starting from several isolated bacteria colonies, in 5ml culture media which allows to obtain a small amount of DNA (Miniprep), sufficient to determine if the cloning was efficient. The genes are then sequenced in order to eliminate errors which could have occurred during the PCR process. If the plasmids are to be used to transfect human or animal cells, a larger quantity is then produced from 300 ml of culture (Maxiprep) CNA fragments were cloned in HA-pJG4-5 vectors for the yeast two-hybrid analysis preys. The aptamers and mutants af R5G42 were cloned in pCI-HA vectors for the expression in mammalian cells and in pBof (cGFP; double promoter) for expression in animals. pGEX vectors were also prepared for expression of the aptamers in bacteria. The sequences of all vectors were checked.

In vivo tibia muscles denervation assay in mice (length : 17 days)

Dav 1

General anaesthesia of the mice

Four weeks old animals were anaesthetised with a mix of ketamine 50 (PANPHARMA, Ref : PF250211) and Xylazine hydrochloride (Sigma Ref X1251) (2/3 , 1/3). Intraperitoneal injections were performed (120μl for a 25g mouse, adjusted in function of the weight).

Injection of the plasmids in the Ie tibialis Mice hind legs were shaved. Both hind legs received an intra-muscular injection with vectors containing TRX, the R5G42, C7 or N9 aptamers, a control aptamer (34) or NaCI (control) in order to obtain an over-expression of a gene in the muscle. The plasmid DNA (purified by cesium chloride) was diluted in NaCI 4,5%o filtered 0,22μm. After disinfection with ethanol 70% of the anterior surface of the tibia, 30μl containing 5μg of plasmid DNA containing the aptamer and 2μg of plasmid DNA containing a nuclear GFP were injected trans-cutaneously. Electroporation

An electric field was applied to the muscle to allow the entry of the plasmid DNA into the muscular fibres. A thin layer of echography gel was applied on both sides of the tibia. The electric field applied corresponded to eight 20 milliseconds impulses spaced by 500 milliseconds, at 200 Volts/cm.

Day 3

Sciatic denervation

The mouse was positioned on its right flank. The left hind leg and the flank were disinfected. A cutaneous incision was performed in the superior third of the thigh. The conjunctive sheath was cut without harming the two muscular masses beneath. The sciatic nerve can be found between the two masses on passing a forceps in the middle. It was sectioned at two spots at 5mm from each other, starting from the afferent side. The skin was then sutured.

Day 17 Euthanasia of the animals

The mice were euthanised by cervical dislocation after general anaesthesia.

The anterior tibialis were removed and fixed on a cork lid with a gum and rapid freezing was performed by diving the whole in liquid nitrogen chilled methycyclohexane. The muscles were thus conserved at -80⁰C.

Treatment of the samples

Crvosections

10μm sections were prepared with a cryostat and placed on slides. The slides were conserved at -80⁰C. lmmunostaining

The selected slides were treated with the MOM Kit (Vector laboratories, PK-2200).

The sections allow to highlight the slow fibres (MyHC slow antibodies, Sigma, M8421) and the rapid fibres (MyHC Fast, Sigma, M4276).

The developments were performed with DAB (SK-4100) and VIP kits from Vector Laboratories.

The baths were photographed with a binocular magnifier (Binoluminar), at 0.8x optic, and

2Ox digital enlarging. - -

The analysis of the surfaces of the muscles was performed with the Metamorph software (version 6).

Tables

Table 1 : Occurrence of antiproliferative peptide aptamers after the last screening iteration and variable region sequences.

Amino acids in lower case correspond to the HTRX flanking residues.

- -

Table 2: Results of the yeast two-hybrid screening against R5G42. The table lists the different clones selected from the brain and testes libraries and sequenced. Bold numbers correspond to strong, specific two-hybrid interaction phenotypes. Plain numbers correspond to weak, specific interaction phenotypes. Numbers in italics correspond to non-specific clones, which show two-hybrid interaction phenotypes with other peptide aptamers.

- -

Table 3 : Plasmids

+ : Construction performed in laboratoire nn : not necessary mini : Miniprep maxi : Maxiprep Seq : Sequencing

- -

References

I . Herskowitz, I. (1987) Functional inactivation of genes by dominant negative mutations. Nature 329, 219-222 2. Richardson, J. H. and Marasco, W.A. (1995) Intracellular antibodies: development and therapeutic potential. Trends Biotechnol. 13, 306-310

3. Rimmele, M. (2003) Nucleic acid aptamers as tools and drugs: recent developments. Chembiochem. 4, 963-971

4. Hoppe-Seyler, F., Cmkovic-Mertens, I., Tomai, E. and Butz, K. (2004) Peptide aptamers: specific inhibitors of protein function. Curr. MoI. Med. 4, 529-538

5. Silva, J., Chang, K., Hannon, G.J. and Rivas, F.V. (2004) RNA-interference-based functional genomics in mammalian cells: reverse genetics coming of age. Oncogene 23, 8401-8409

6. Strausberg, R.L. and Schreiber, S.L. (2003) From knowing to controlling: a path from genomics to drugs using small molecule probes. Science 300, 294-295

7. Deiss, LP. and Kimchi, A. (1991) A genetic tool used to identify thioredoxin as a mediator of a growth inhibitory signal. Science 252, 117-220

8. Gudkov, A.V., Kazarov, A.R., Thimmapaya, R., Axenovich, S.A., Mazo, I.A. and Roninson, I. B. (1994) Cloning mammalian genes by expression selection of genetic suppressor elements: association of kinesin with drug resistance and cell immortalization. Proc. Natl. Acad. Sci. U.S.A. 91, 3744-3748

9. Li, Q.X., Robbins, J.M., Welch, P.J., Wong-Staal, F. and Barber, J. R. (2000) A novel functional genomics approach identifies mTERT as a suppressor of fibroblast transformation. Nucleic Acids Res. 28, 2605-2612 10. Xu, X., Leo, C, Jang, Y., Chan, E., Padilla, D., Huang, B.C., Lin, T., Gururaja, T., Hitoshi, Y., Lorens, J. B. et al. (2001) Dominant effector genetics in mammalian cells. Nat. Genet. 27, 23-29

I I . Paddison, P.J., Silva, J. M., Conklin, D.S., Schlabach, M., Li, M., Aruleba, S., Balija, V., O'Shaughnessy, A., Gnoj, L., Scobie, K. et al. (2004) A resource for large-scale RNA- interference-based screens in mammals. Nature 428, 427-431

12. Pestov, D. G. and Lau, L.F. (1994) Genetic selection of growth-inhibitory sequences in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 91, 12549-12553 13. Hitoshi, Y., Gururaja, T., Pearsall, D.M., Lang, W., Sharma, P., Huang, B., Catalano, S.M., McLaughlin, J., Pali, E., Peelle, B. et al. (2003) Cellular localization and antiproliferative effect of peptides discovered from a functional screen of a retrovirally delivered random peptide library. Chem. Biol. 10, 975-987 14. Colas, P., Cohen, B., Jessen, T., Grishina, I., McCoy, J. and Brent, R. (1996) Genetic selection of peptide aptamers that recognize and inhibit cyclin- dependent kinase 2. Nature 380, 548-550

15. Xu, C.W., Mendelsohn, A.R. and Brent, R. (1997) Cells that register logical relationships among proteins. Proc. Natl. Acad. Sci. U.S.A. 94, 12473-12478 16. Geyer, C. R., Colman-Lerner, A. and Brent, R. (1999) "Mutagenesis" by peptide aptamers identifies genetic network members and pathway connections. Proc. Natl. Acad. Sci. U.S.A. 96, 8567-8572

17. Norman, T.C., Smith, D.L., Sorger, P.K., Drees, B.L., O'Rourke, S.M., Hughes, T.R., Roberts, CJ. , Friend, S. H., Fields, S. and Murray, A.W. (1999) Genetic selection of peptide inhibitors of biological pathways. Science 285, 591-595

18. Blum, J. H., Dove, S.L, Hochschild, A. and Mekalanos, J.J. (2000) Isolation of peptide aptamers that inhibit intracellular processes. Proc. Natl. Acad. Sci. U.S.A. 97, 2241-2246

19. Mangeot, P.E., Duperrier, K., Negre, D., Boson, B., Rigal, D., Cosset, F. L. and Darlix, J. L. (2002) High levels of transduction of human dendritic cells with optimized SIV vectors. MoI. Ther. 5, 283-290

20. Negre, D., Mangeot, P.E., Duisit, G., Blanchard, S., Vidalain, P.O., Leissner, P., Winter, A.J., Rabourdin-Combe, C₁ Mehtali, M., Moullier, P. et al. (2000) Characterization of novel safe lentiviral vectors derived from simian immunodeficiency virus (SIVmac251) that efficiently transduce mature human dendritic cells. Gene Ther. 7, 1613-1623

21. Bickle, M., Dusserre, E., Moncorge, O., Bottin, H. and Colas, P. (2006) Selection and characterization of large collections of peptide aptamers through optimized yeast two- hybrid procedures. Nat. Protoc. in press

22. Yang, Q., Cheng, J., Liu, Y., Hong, Y., Wang, J.J. and Zhang, S.L. (2004) Cloning and identification of NS5ATP2 gene and its spliced variant transactivated by hepatitis C virus non-structural protein 5A. World J. Gastroenterol. 10, 1735-1739

23. Aramburu, J., Heitman, J. and Crabtree, G.R. (2004) Calcineurin: a central controller of signalling in eukaryotes. EMBO Rep. 5, 343-348 - -

24. Kahl, CR. and Means, A.R. (2003) Regulation of cell cycle progression by calcium/calmodulin-dependent pathways. Endocr. Rev. 24, 719-736

25. Wang, H. G., Pathan, N., Ethell, I. M., Krajewski, S., Yamaguchi, Y., Shibasaki, F., McKeon, F., Bobo, T., Franke, T.F. and Reed, J. C. (1999) Ca2+-induced apoptosis through calcineurin dephosphorylation of BAD. Science 284, 339-343

26. Ke, H. and Huai, Q. (2003) Structures of calcineurin and its complexes with immunophilins-immunosuppressants. Biochem. Biophys. Res. Commun. 311, 1095-1102

27. Baines, I. C. and Colas, P. (2006) Peptide aptamers as guides for small molecule drug discovery. Drug Disc. Today, 11, 334-341 28. Gururaja, T., Li, W., Catalano, S., Bogenberger, J., Zheng, J., Keller, B., Vialard, J., Janicot, M., Li, L., Hitoshi, Y. et al. (2003) Cellular interacting proteins of functional screen- derived antiproliferative and cytotoxic peptides discovered using shotgun peptide sequencing. Chem. Biol. 10, 927-937

29. Hogan P. G., Chen L., Nardone J. and Rao A. (2003) Transcriptional regulation by calcium, calcineurin, and NFAT. Genes and Dev. 17, 2205-2232

30. Asagiri M, Takayanagi H. The molecular understanding of osteoclast differentiation. Bone 40 (2006) 251-264

31. Zhu LL, et al . RANK-L induced the expression of NFATd , but not of NFkB subunits durino osteoclast formation. Biochemical and Biophysical Research Communications 326(2005) 131-135

32. Takayanagi H et al,. Induction and activation of the transcription factor NFATd integrate RANKL signaling for terminal differentiation of osteoclasts. Dev Cell 3 (2002) 889-901

Claims

- -Claims

1. A polypeptide comprising or consisting of

(i) the amino acid sequence SAVTFAVCAL (SEQ ID 20), or

(ii) the amino acid sequence GPSAVTFAVCALGP (SEQ ID 21), or

(iii) a variant of the amino acid sequence (i) or (ii) having one amino acid change, said polypeptide being capable of binding to a protein which comprises at least the sequence extending from amino acid 378 to 500 of the beta isoform of calcineurin A, to Calcineurin A and/or to NS5A-TP2.

2. A polypeptide according to claim 1 , wherein said amino acid sequence (i), (ii) or (iii) is part of a larger polypeptide.

3. A polypeptide according to claim 1 or 2, having a modulatory effect on a cell and wherein said cell is a eukaryotic cell, a mammalian cell, an animal cell, a murine cell or a human cell.

4. A polypeptide according to claim 3, wherein said cell is a muscle, bone, neuronal or cardiac cell.

5. A polypeptide according to any one of claims 1 to 4, wherein said polypeptide has an antiproliferative or differentiating effect on said cell.

6. A polypeptide according to any one of claims 1 to 5, wherein said polypeptide activates NFAT.

7. A polypeptide according to any one of claims 1 to 6, wherein said amino acid sequence (i), (ii) or (iii) is conformational^ constrained by covalently binding to a scaffold molecule. - -

8. A polypeptide according to claim 7, wherein said amino acid sequence (i), (ii) or (iii) is bound to the scaffold at both C and N termini.

9. A polypeptide according to claim 8, wherein said amino acid sequence (i), (ii) or (iii) is located between two cysteines.

10. A polypeptide according to claim 7, 8 or 9, wherein the scaffold molecule is a thioredoxin, a thioredoxin-like protein, a nuclease, for example RNaseA, a protease, for example trypsin, a protease inhibitor, for example eglin C, an antibody or a structurally- rigid fragment of an antibody, a fluorescent protein, for example GFP or YFP, a conotoxin, preferably human thioredoxin or E. coli thioredoxin A.

11. A polypeptide according to claim 10, wherein the scaffold molecule is human thioredoxin and said amino acid sequence (i), (ii) or (iii) is located between the two cysteines located at positions 32 and 35.

12. A polypeptide according to any one of claims 1 to 11 , which binds to calcineurin through said amino acid sequence (i), (ii) or (iii).

13. A polypeptide according to any one of claims 1 to 12, which binds to the calcineurin A subunit.

14. A polypeptide according to claim 13 which binds to at least one of the alpha, beta or gamma isoforms of human calcineurin A (CNA).

15. A polypeptide according to claim 13 or 14 which binds to CNA at a site located within the sequence extending from the amino terminal of the calmodulin binding domain to the carboxy terminal of the auto-inhibitory domain of CNA, wherein said site is not limited to the calmodulin binding domain.

16. A polypeptide according to claim 13, 14 or 15 which binds to the human CNA beta isoform at a site located within the sequence extending from amino acid 378 to 500. - -

17. A fusion protein comprising the polypeptide of claim 1 covalently bound at its amino or carboxy terminus to another protein.

18. A nucleic acid sequence comprising or consisting of a sequence encoding the polypeptide of claim 1.

19. A vector comprising the nucleic acid sequence of claim 18.

20. A eukaryotic cell comprising the polypeptide of claim 1 , the nucleic acid sequence of claim 18 or the vector of claim 19.

21. A eukaryotic cell according to claim 20, wherein said eukaryotic cell is a mammalian cell.

22. The polypeptide of claim 1 for use in therapy.

23. Use of the polypeptide of claim 1 , the nucleic acid of claim 18 or the vector of claim 19 for the preparation of a medicament for treating or preventing a condition which can be treated or prevented by upregulating the intracellular phosphatase activity of calcineurin in eukaryotic cells or by activating NFAT.

24. Use of the polypeptide of claim 1 , the nucleic acid of claim 18 or the vector of claim 19 for the preparation of a medicament for treating or preventing a condition which can be treated or prevented by limiting the proliferation or inducing the differentiation of eukaryotic cells.

25. Use according to claim 23 or 24, wherein said eukaryotic cells are cancer cells, cardiomyocytes, neurones, fibroblasts, myocytes, satellite cells, skeletal muscle cells, osteoblasts, osteoclasts, or T-cells.

26. Use according to claim 23 or 24, wherein said eukaryotic cells are mammalian cells, preferably human cells. - -

27. Use according to claim 23 or 24, wherein said condition is associated with NFAT phosphorylation state, T-cell activation state, skeletal myocyte differentiation stage, skeletal muscle dystrophy or atrophy, neurone development, bone formation or osteoclast differentiation.

28. Use according to claim 23 or 24,wherein said condition is Duchenne muscular dystrophy, osteopetrosis, cancer or a farcted area in the heart.

29. Method for the identification of substances which modulate the interaction between CNA and the polypeptide of claim 1 comprising the steps of

(i) contacting a candidate modulatory substance with CNA and the polypeptide of claim 1 conditions in which CNA and said polypeptide can bind, and in which said binding can be detected by a specific signal ;

(ii) detecting a change in the intensity of said signal ; and

(iii) optionally recovering the candidate substance.

30. Method for intracellular identification of substances which modulate the interaction between CNA and the polypeptide of claim 1 comprising the steps of

(i) introducing a candidate substance, CNA and the polypeptide of claim 1 into a eukaryotic cell, in conditions in which a specific detectable phenotype associated to the binding of CNA with the polypeptide of claim 1 can be detected ;

(ii) detecting a change of the said specific detectable phenotype ; and

(iii) optionally recovering the candidate substance.

31. Method according to claim 29 or 30, where the interaction which is modulated by the candidate substance is the binding of the polypeptide of claim 1 to CNA at a site located within the sequence extending from the amino terminal of the calmodulin binding domain to the carboxy terminal of the auto-inhibitory domain of CNA.

32. Method according claim 29 or 30, where the interaction which is modulated by the candidate substance is the binding of the polypeptide of claim 1 to the human CNA beta isoform at site located within the sequence extending from amino acid 378 to 500. - -

33. Method according to any one of claims 30 to 32, where said specific detectable phenotype consists in the expression of a reporter gene, a modification of the proliferative rate of the cells, cell apoptosis, a modification of cell differentiation or resistance to cell death.

34. Method according to any one of claims 30 to 32, where said conditions comprise the use of a two-hybrid assay.

35. Method for modulating calcineurin activity in vivo or in vitro comprising contacting calcineurin with a ligand capable of binding to calcineurin at a site located within the sequence extending from the amino terminal of the calmodulin binding domain to the carboxy terminal of the auto-inhibitory domain of CNA, said site not being limited to the calmodulin binding domain in conditions suitable to allow effective binding between the ligand and calcineurin thereby modulating at least one activity of calcineurin.

36. Method according to claim 35, where the ligand is capable of binding to the human CNA beta isoform at a site located within the sequence extending from amino acid 378 to 500.

37. Method according to to claim 35 or 36, where the ligand is a peptide according to claim 1.

38. Method according any one of claims 35 to 37, where said activity is a phosphatase activity.

39. A polypeptide according to any one of claims 1 to 16, wherein said polypeptide has an differentiating effect on osteoclasts in the absence of RANKL.

40. Method for enhancing transcription of a gene in a cell, said gene being under the transcriptional control of a regulatory element, particularly a promoter, containing at least one NFAT- response element, by introducing a polypeptide according to claim 1 in said cell.