WO2008059112A1 - Methods and uses involving genetic abnormalities at chromosome 12 - Google Patents
Methods and uses involving genetic abnormalities at chromosome 12 Download PDFInfo
- Publication number
- WO2008059112A1 WO2008059112A1 PCT/FI2007/050611 FI2007050611W WO2008059112A1 WO 2008059112 A1 WO2008059112 A1 WO 2008059112A1 FI 2007050611 W FI2007050611 W FI 2007050611W WO 2008059112 A1 WO2008059112 A1 WO 2008059112A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nav3
- tumor
- carcinoma
- tumors
- genetic abnormalities
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention relates to the fields of genetics and oncology and provides methods for predicting and identifying tumors of epithelial origin. Specifically, the present invention relates to a novel method of predicting tumor initiation, tumor progression and/or carcinomas, the method comprising detecting genetic abnormality associated with tumors of epithelial origin. The present invention further relates to a novel method of identifying an individual with potential for developing carcinoma, the method comprising detection of genetic abnormalities. The present invention also relates to a method of predicting the progression of carcinomas and the transformation thereof to an aggressive variant, the method comprising detection of genetic abnormalities, which indicate the probability to develop carcinoma.
- the present invention also relates to a use of specific chromosomal region, a gene or a fragment thereof, and/or genetic markers for predicting tumor initiation, tumor progression and/or carcinoma.
- the present invention also relates to a use of specific chromosomal region or a gene or a fragment thereof in therapy, for the development of therapy and for the preparation of a medicament for treating tumors of epithelial origin.
- Cancer is a complex disease in which several genetic and epi- genetic abnormalities have accumulated. A varying number of genetic changes are needed prior to occurrence of a somatically developed tumor. Available data indicate that the development of solid tumors is dependent on combination of deletions and amplifications of multiple chromosome segments (Mertens et al. Cancer Res 57: 2765-2780, 1997; Mitelman et al. Nature Genet, 15: 417-474, 1997). Over 90% of all human neoplasia is derived from epithelia. Thus, epithelial cells play an important role in physiological and path- ophysiological conditions. Carcinomas are malignant tumors derived from epithelial cells. The most common carcinomas include the common forms of breast, prostate, lung and colorectal cancer.
- Colorectal cancer is the third most common cancer worldwide with an estimated one million new cases annually (Parkin et al. CA Cancer J Clin 55: 74-108, 2005). The average lifetime risk in industrialized countries is approximately 5%, and almost half of those affected will die of their disease (Burt, Gastroenterology 1 19: 837-853, 2000). Colorectal cancer develops via a benign precursor lesion, polyp, and is preventable through polypectomy. It is estimated that 30% of the population have colonic polyps, and the incidence of polyps increases with age.
- neoplastic (adenomatous) polyps in 12% of individuals of 40-49 years of age (Imper ⁇ ale TF et al. NEJM 346: 1781-1785, 2002), and in 58% among 50-59 year-old individuals (Mehran A et al. Surg Endosc 17: 1974-1977, 2003).
- Certain inherited disorders which account for some 5-10% of the total colorectal cancer burden, are associated with an increased number of polyps (familial adenomatous polyposis, FAP) or an elevated tendency to malignant progression (hereditary nonpolyposis colorectal cancer, HNPCC) (Lynch and de Ia Chapelle, N Engl J Med 348: 919-932, 2003). Survival is closely related to the stage at diagnosis, even in patients who have already developed malignant disease: over 90% of patients with local cancer are alive after 5 years as opposed to less than 10% of those with metastatic disease (Burt, Gastroenterology 1 19: 837-853, 2000).
- Colorectal carcinomas are notoriously resistant to both chemotherapy and radiotherapy and most patients for whom surgery alone is not curative are doomed to die of their disease (Globcan, International Agency for Research on Cancer. Available at http:/www-dep. iarc.fr/, 2002). It is therefore vital to be able to identify individuals with an increased risk as early as possible to enable efficient cancer prevention or curative treatment.
- Colorectal cancer development via benign precursors along with the accumulation of genetic changes is one of the best-known examples of multi-step carcinogenesis (Chung DC, Gastroenterology 119: 854-865, 2000, and below). This multistep evolutionary nature of colorectal cancer provides excellent opportunities for early cancer detection and prevention.
- Colorectal cancers arise as a result of stepwise accumulation of mutations at the nucleotide level and/or at the gross chromosomal level.
- the overwhelming majority of colorectal cancers display one of the two major genomic instability phenotypes, microsatellite instability (MSI) or chromosomal instability (CIN) (Abdel-Rahman et al. Proc. Natl. Acad. Sci. USA 98: 2538-2543, 2001 ).
- MSI microsatellite instability
- CIN chromosomal instability
- the current literature includes a multitude of biomarkers of potential use in colorectal cancer risk assessment or early detection of this cancer; however, clinical validation is mostly lacking (Umar and Srivastava, Dis Markers 20: 87-96, 2004).
- histology serves as a main predictor, with multiplicity of adenomas, high-grade dysplasia, villous features, and large size (over 1 cm), for increased cancer risk (Winawer et al. Gastroenterology 130: 1872-1885, 2006). Therefore, predictors of advanced pathology would be useful, for both adenomas and cancer, to be able to assign an appropriate risk category for each patient. Biomarkers that could serve as predictors of a tendency to cancer progress would be highly welcome. Lung cancer is a leading cause of cancer-related deaths worldwide, with approximately 1.2 million deaths annually (Ferlay et al.
- SCLC small cell
- NSCLC non-small cell lung cancers
- PSA prostate specific antigen
- markers for epithelial tumors are available but their use is hampered from their nonspecificity: These markers are often elevated also in other conditions than malignancy, such as in inflammatory lesions.
- markers that have been used in the clinics but that do not meet the requirement of spesificity and/or sensitivity are, for instance the following: tumor-derived colon-specific antigen (tCSA), carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), pregnancy-specific beta-glycoprotein 1 (SP1 ), human placental lactogen (HPL), human beta chorionic gonadotrophin (beta-HCG), transferrin (TF) and ferritin (FE).
- tCSA tumor-derived colon-specific antigen
- CEA carcinoembryonic antigen
- AFP alpha-fetoprotein
- SP1 pregnancy-specific beta-glycoprotein 1
- HPL human placental lactogen
- HPL human beta chorionic gonadotrophin
- TF transferrin
- Chromosome 12q21 aberrations have been identified in neuroblastomas and cutan- eous T-cell lymphoma (CTCL).
- CTCL T-cell lymphoma
- a deletion or a translocation of NAV3 gene was associated with a point mutation in the remaining allele only in one of 7 patients studied (Karenko L et al. Cancer Res 65: 8101 -81 10, 2005 and EP1476567 A1 ).
- chromosome 12q21 aberrations were identified by mic- rosatellite analysis. Loss of heterozygosity (LOH) was detected with markers D12S1684 and D12S1708, which border a chromosomal region comprising NAV3 gene (Kimura M et al. Cancer Res 58: 2456-60, 1998). However, the chromosomal region described in the article by Kimura et al. is large and neither the specific region nor the NAV3 gene was observed to be linked to pancreatic carcinoma. On the contrary, this application describes chromosomal abnormalities that are specific for tumors of epithelial origin, in the specific chromosomal region.
- Novel biomarkers for providing more effective and early diagnosis of potentially aggressive tumors as well as identifying tumors susceptible to targeted therapies are warranted.
- the present invention provides one solution for predicting or identifying tumor and carcinoma progression.
- the present invention also discloses a tool for evaluating clinical aggressiveness of epithelial tumors and patient survival.
- the invention provides a new thera-plastic target for carcinoma prevention or therapy.
- the object of the invention is thus to provide novel methods and means for diagnosing, staging and monitoring of patients having cancer, such methods and means allowing an early diagnosis of the disease.
- Another object of the invention is to provide novel methods and means for predicting tumor initiation, tumor progression and/or carcinoma.
- Another object of the invention is to provide novel methods and means for identification of individuals with an increased risk to develop carcinomas, such methods and means being specific and reliable and allowing identification as early as possible.
- Still another object of the invention is to provide novel biomarkers useful in early detection of the cancer as well as cancer risk assessment.
- the present invention relates to a novel method for prediction of tumor initiation, tumor progression and/or carcinomas, characterized by det ⁇ ct- ing the presence or the absence of genetic abnormalities at 12q21.1-q21.31 , specifically 12q21.2, the presence of said genetic abnormalities being associated with tumors of epithelial origin, in a biological sample.
- the genetic abnormalities indicate the presence of epithelial tumors or an initiation or progression of tumors of epithelial origin and/or carcinoma.
- the present invention further relates to a novel method for identifying an individual with potential for developing carcinoma, the method com- prising detection of genetic abnormalities at 12q21 .1-q21 .31 , specifically 12q21.2, said genetic abnormalities being associated with tumors of epithelial origin. That is, the genetic abnormalities indicate tumors of epithelial origin with potential for developing carcinoma.
- the present invention further relates to a novel method of predicting the progression of carcinomas and/or the transformation thereof to an aggressive variant, characterized by detecting genetic abnormalities at 12q21 .1 -q21.31 , specifically 12q21 .2, wherein abnormalities indicate the probability to develop carcinoma.
- the present invention also relates to the use of chromosomal region
- 12q21.1-q21.31 specifically 12q21 .2, and/or NAV3 gene or a fragment thereof for predicting tumor initiation, tumor progression and/or carcinoma, genetic abnormalities at 12q21.2 or NAV3 gene indicating tumors of epithelial origin.
- the present invention also relates to the use of genetic markers at 12q21.1-q21.31 , specifically 12q21 .2, for predicting tumor initiation, tumor progression and/or carcinoma, characterized by detecting the presence or absence of genetic abnormalities, said genetic abnormalities at 12q21.1 - q21 .31 , specifically 12q21.2, in NAV3 gene or in a fragment thereof indicating tumors of epithelial origin. Said genetic abnormalities are associated with tumors of epithelial origin and/or carcinoma.
- the present invention also relates to the use of a specific chromosomal region 12q21.1 -q21.31 , specifically 12q21.2, NAV3 gene, a fragment thereof or a gene product thereof in therapy, for the development of therapy or for the preparation of a medicament for treating tumors of epithelial origin.
- Figure 1 shows a LOH observed at the chromosome 12 microsatel- lite D12S1708 in both adenoma (middle) and carcinoma (bottom) as compared to their matching normal tissue (top).
- Figure 2 shows a MSI observed at the chromosome 12 microsatel- lite D12S1708 in the carcinoma (bottom) compared to its matching normal tissue (top).
- the adenoma (middle) is MSS.
- Figure 3 shows single nucleotide primer extension, (SnuPE) showing LOH in a carcinoma (bottom) as compared to its matching normal (top).
- Figure 4 shows a karyotype of the true malignant Sung carcinoma cells of a patient with CTCL and SCLC.
- Figure 5a shows the result of ⁇ /A ⁇ /3-specif ⁇ c FISH with breast cancer metastases. Black bars indicate the amount of polyploidy in studied cells and grey bars indicate the amount of NAV3 deleted cells. Results are shown as percentage of total cell count.
- Figure 5b shows typical cells of breast cancer metastases with NAV3 deletion. Green signals indicate centromeres and red signals NAV3 copies.
- Chromosome 12q21 .1 -q21 .31 aberrations specifically 12q21 .2 aberrations, more specifically NAV3 gene aberrations, have been found to have role in the development of epithelial originated tumors.
- the present invention is based on a method for detecting genetic abnormalities at 12q21 .1 -q21 .31 , specifically 12q21.2, associated with tumors of epithelial origin, excluding carcinoma of pancreas.
- 12q21 .1-q21.31 affect NAV3 gene or a fragment thereof. Specifically, genetic abnormalities are detected in NAV3 gene or a fragment thereof.
- the tumor of epithelial origin is an adenoma and/or a carcinoma.
- the location of the tumor of epithelial origin is colon, rectum, lung, urinary bladder, breast, squamous or basal cells.
- the epithelial tumor is a colon tumor, rectum tumor, lung tumor, urinary bladder tumor, breast tumor, squamous cell tumor or a basal cell tumor.
- the colorectal tumors can be either adenocarcinomas or premalignant adenomas or polyps
- the tumor in the urinary bladder the tumor can be transitional epithelial polyps with poor differentiation or overt transitional carcinomas
- the breast tumors in the urinary bladder the tumor can be either ductal carcinomas or acinar carcinomas and in the skin, the tumors can be either basaliomas or epidermoid carcinomas (also called squamous cell carcinoma or spinocellular carcinoma).
- the tumor In the iung, the tumor can be either epidermoid carcinoma or adenocarcinomas.
- the genetic abnormalities are determined by the loss of heterozygosity (LOH) of NAV3 gene or a fragment thereof, wherein LOH of NAV3 is indicative of tumor progression.
- LOH heterozygosity
- the genetic abnormalities of NAV3 gene are determined in haploid, diploid and/or polyploid cells.
- the tumor cells are microsatell ⁇ t ⁇ stable (MSS) or m ⁇ crosat ⁇ llite instable (MSI).
- the tumor of epithelial origin is other than carcinoma of pancreas.
- the present invention is also based to the use of chromosomal region 12q21.1-q21.31 , specifically 12q21.2, NAV3 gene or a fragment thereof, and/or markers at 12q21.1-q21.31 , specifically 12q21.2, associated with tumors of epithelial origin.
- the markers at 12q21.1-q21.31 include D12S1684, D12S326, D12S1708 and/or rs1852464.
- the markers at 12q21.2 include D12S326 and/or rs1852464.
- genetic abnormality refers to the presence of a translocation, deletion, amplification, inversion or another defect at 12q21.1-q21.31 , specifically at 12q21.2.
- the expression “deletion” refers to the absence of a nucleotide or nucleotides and/or an exon or exons in the gene sequence which absence adversely affects the function of the gene.
- the expression also refers to the absence of the gene fragment, gene or the chromosomal fragment containing the gene.
- another defect refers to any genetic alteration, such as a substitution, an addition, polymorphism, insertion, inversion etc., which is associated with tumors of epithelial origin.
- loss of heterozygosity refers to the loss of a single parent's contribution to part of the cell's genome. LOH can be considered as an event to unmask a mutant allele of a gene which may play a role in suppressing tumor formation. Thus, LOH is an important marker for tumor initiation or progression.
- BLOH borderline LOH, meaning that one of the alleles in the tumor sample has 25%-39% signal reduction compared to its matching normal.
- translocation refers to transfer of chromosomal regions between non-homologous chromosomes.
- amplification refers to gain of genetic material such as a gene fragment, a gene or the chromosomal fragment containing the gene.
- tumor refers to an abnormal mass of tissue due to abnormal excess of cells divisions or lack of normal cell death.
- Tumors may be benign or malignant, in other words not cancerous or cancerous. Tumors include such as adenomas, carcinomas or polyps.
- adenoma refers to a noncancerous tumor.
- carcinoma refers to a cancer of epithelial origin.
- epithelial refers to the cells that line the internal and external surfaces of the body.
- tumors of epithelial origin refers to tumors, which arise from epithelial cells.
- the tumors of epithelial origin include such as breast, colorectal, lung, urinary bladder, breast, squamous cell, basal cell, prostate, gastric, esophagus and mouth/tongue tumors.
- Epithelial tumors arise from epithelium, the specified set of cells that cover organs and surfaces of the body.
- Epithelium can be simple, such as the one cell layer epithelium covering part of respiratory tract, mammary gland ducts and ductuli or intestine, or can be stratifies, composed of several layers of cells, such as is found in the upper layer of skin or in the urinary bladder.
- the epithelium of the skin is keratinizing, meaning that while the basal cells of the epidermis, covering skin are round and proliferate, the uppermost cells are flattened, non-dividing and their cytoplasm is filled with keratin fibres.
- the urinary epithelium is not keratinizing but even here, the basally located cells are round while the cells located closer to the surface are flattened and thus, this type of epithelium is called transitional.
- the expression "indicating tumors of epithelial origin” refers to that the presence or high probability or possibility of epithelial tumors is shown or described or proved or evidenced.
- the expression "aggressive variant” refers to a can- cer, which grows fast and possibly metastasizes.
- fragment or “functional fragment” refer to a part of NAV3 gene, which is detectable in the methods of the invention such as LOH-analysis or FISH-methods.
- gene product refers to a mRNA, protein or to any product achieved directly or indirectly from the gene.
- Neuron navigator 3 (NAV3 or POMFIL1) gene is a member of a recently identified human gene family, which shows homology to the unc-53, an axonguidance gene from Caenorhabditis elegans (Maes et al. Genomics 80: 21-30, 2002). It also shares homologous sequences with human RAINB1 (retinoic acid inducible in neuroblastoma cells) a mammalian homologue of unc-53 (Merrill et al. PNAS 99: 3422-3427, 2002). By structure prediction NAV3 has calponin-iike domains and SH3 binding sites suggestive of a role in cell signaling (Coy JF et al.
- NAV3 consists of 39 exons and its expression, based on mRNA detection, is largely restricted to the brain tissue (Maes et al. Genomics 80: 21-30, 2002). NAV3 was shown to produce transcripts encoding proteins of different lengths and it may be subject to tissue-specific alternative splicing. NAV3 is structrally a helicase and exonuclease, resembling Werner and Bloom syndrome proteins with the role in maintaining stability of chromosomes (Coy JF et al. Gene 290: 73-94, 2002, Maes et al. Genomics 80: 21-30, 2002).
- NAV3 has been reported to locate in nuclear pre complexes (Coy JF et al. Gene 290: 73-94, 2002) and might have a role in nuclear transport, kinetochore formation and cell cycle control (Fahrenkrog B and Aebi U, Nat Rev MoI Cell Biol 4: 757-66, 2003).
- NAV3 could be a non-classical haploinsufficient tumour suppressor (Sherr CJ, Cell 116: 235-46, 2004).
- FISH Fluorescence in situ hybridization
- BCC basal cell carcinoma
- SCC squamous cell carcinoma
- CGH comparative genomic hybridization
- microsatellite markers D12S1684, D12S326, D12S1708
- SNP marker the intragenic NAV3 rs1852464
- FISH revealed loss of 12q21 in colon tumors and both loss and gain of 12q21 in breast cancers, basal cell carcinoma and squamous cell carcinoma.
- CGH revealed loss of 12q21 in one lung cancer.
- loss or gain of NAV3 appears as a marker of tumors originating from ep ⁇ thelia.
- NAV3 LOH colorectal adenomas and carcinomas arising in the same patient showed NAV3 LOH suggesting that adenoma patients will develop carcinomas through NAV3 LOH. Poor differentiation was observed in an adenoma with NAV3 LOH and the size of NAV3 LOH adenomas tended to be greater than of those without LOH.
- the chromosomal abnormalities found in epithelial tumors, in fact do occur in tumors arising in ail different types of epithelium.
- the basaliomas also called carcinoma basocellulare or basal cell carcinomas
- the squomous cells carcinoma also called carcinoma squamocellulare or spinocellular carcinoma
- this tumor often show keratinisation, a feature characteristic for the keratinizing cells.
- Carcinomas of breast and colorectal carcinomas are examples of malignant tumors arising from simple epithelium, having only one layer of cells normally, but even here, the original benign epithelium contains differentiated cell types, such as exocrine cells of the mammary gland, secreting either milk or mucus, or mucus secreting Goblet cells in the gut epithelium.
- Epithelial tumors can be benign, premalignant or overtly malignant.
- the presence or absence of genetic abnormalities can be detected from a biological sample by any known detection method suitable for detecting translocations, deletions, insertions etc.
- detection methods include fluorescence in situ hybridisations, such as multi-colour fluorescence in situ hybridisations, multi-f ⁇ uor in s/ ⁇ u-hybridisation (MFISH), spectral karyotyping (SKY), Combined binary ratio labelling (COBRA), colour changing karyotyping (CCK).
- fluorescence in situ hybridisations such as multi-colour fluorescence in situ hybridisations, multi-f ⁇ uor in s/ ⁇ u-hybridisation (MFISH), spectral karyotyping (SKY), Combined binary ratio labelling (COBRA), colour changing karyotyping (CCK).
- CGH comparative genomic hybridization
- the genetic changes are classified as DNA gains and losses.
- CGH reveals a characteristic pattern that includes aberrations at chromosomal and subchromosomal levels.
- the presence or absence of the NA V3 gene or an equivalent or a frag- ment thereof can be detected from a biological sample by any known detection method suitable for detecting a gene expression (or copy number), i.e. methods based on detecting the copy number of the gene (or DNA) and/or those based on detecting the gene expression products (mRNA or protein).
- PCR polymerase chain reaction
- RT-PCR in situ hybridisations, such as FISH, mRNA in situ hybridisation, Northern analysis, Southern and Western analyses, immunohistochemistry, and other immunoassays, such as ELISA.
- FISH polymerase chain reaction
- mRNA in situ hybridisation such as FISH
- Northern analysis such as Southern and Western analyses
- immunohistochemistry such as ELISA.
- Preferable methods are those suitable for use in routine clinical laboratories.
- LOH in cancers can be identified by the presence of heterozygosity at a genetic locus in germline DNA and the absence of heterozygosity at the same locus in the tumor cells.
- markers include any biological markers such as microsatellite markers, SNP-markers, any probes, primers or antibodies associated with NAV3 gene.
- Numerous methods are suitable for analysing nucleic acids for the presence of specific sequence variations such as polymorphisms, SNP ' s, inser- tions or deletions. Allelic variants can be discriminated for example by enzymatic methods, electrophoretic methods, and physical methods.
- SSCP single strand conformation polymorphism
- HDPLC denaturing high per- formance liquid chromatography
- the biological sample can be any suitable tissue sample, such as biopsy from the epithelial tissue or lymph node or a metastatic tumor lesion in any body organ or whole blood.
- the biological sample can be, if necessary, pretreated in a suitable manner known to those skilled in the art.
- restoration of the norma! function of the NAV3 gene can be used. This may be reached by enhancing the expression of functionally horno- logous genes, by introducing an intact NAV3 gene or by using an altered form of the NAV3 gene or antisense oligonucleotide against the NAV3 in any technique presently available for gene therapy to prevent the progression of a proliferating disease. In particular, tumor cell growth may be slowed down or even stopped by such therapy.
- Such techniques include the ex vivo and in situ therapy methods, the former comprising transducing or transfecting an intact or altered NAV3 gene (or its functional domains) in a recombinant or peptide form or as antisense oligonucleotides or in a vector to the patient, and the latter comprising inserting the altered gene or oligonucleotide into a carrier, which is then introduced into the patient.
- a transient cure or a permanent cure may be achieved.
- monoclonal or humanized antibodies or peptides binding to the NAV3 protein or to the fusion gene generated as a result of the translocation can be used to suppress the function of the altered NAV3 protein and thus tumor eel! growth may be slowed down or even stopped.
- Antibodies against NAV3 could also be used to carry other agents, such as cytotoxic substances, to the cancer ceils over-expressing the NAV3 gene. Such agents could then be used to kill specifically the cancer cells.
- the present invention discloses for the first time the role of NAV3 LOH in epithelial tumors.
- the present inven- tion also discloses that when NAV3 LOH is observed in colorectal adenomas it is likely that such patient will develop carcinomas through NAV3 LOH as well.
- Detection of deletions or other defects of the NAV3 gene as described in the present invention allows thus earlier identification of patients with an increased risk to develop aggressive cancer and enables efficient can- cer prevention and development of novel diagnostic and follow-up of carcinomas, such as colorectal or lung cancer.
- Discovery of genetic abnormalities of NAV3 in epithelial tumors also opens new possibilities in the advancement of therapies thereof.
- Example 1 NAV3 loss of heterozygosity (LOH) analysis using microsateflite markers
- Three microsatelSite markers spanning the NAV3 gene locus at 12q21.1 -q21 .31 and surrounding the gene from both directions were chosen: pter D12S1684 -(0.8 Mb)- D12S326 -(0.2 Mb)- NAV3 -(3.8 Mb)- D12S1708 qter.
- the DNA samples were amplified by polymerase chain reaction (PCR) using the following primers: D12S1684F 5'cctgcatgcctcagttatga3 ⁇ D12S1684R 5'aacaagccataccagtcagg3 ⁇ D12S326F 5'accaggctccctaaaagtg3', D12S326R 5'agaatgaccagacccacagg3 ⁇ D12S1708F 5 ! gggaacttatgtcaaggctagga3 ⁇ D12S1708R ⁇ 'gatctagtgctcaagaggttttcaaS'.
- PCR polymerase chain reaction
- PCR reactions were performed in 25- ⁇ l reaction volume containing 75-150 ng of template DNA, Gen ⁇ Amp 10x PCR buffer (Applied Biosystems), 0.2 mM of dNTP Mix (GE Healthcare Bio- sciences Ab), 0.8 umol of each primer, and 1 ,5 U of AmpliTaq polymerase (AB).
- Gen ⁇ Amp 10x PCR buffer Applied Biosystems
- 0.2 mM of dNTP Mix GE Healthcare Bio- sciences Ab
- 0.8 umol of each primer and 1 ,5 U of AmpliTaq polymerase (AB).
- the following PCR cycles were used for amplification: 94°C for 3 minutes, 35 cycles of 94°C for 30 seconds denaturation, annealing temperature of 60 0 C for 30 seconds, and 72°C for 45 seconds extension. Final extension was 72°C for 5 minutes.
- the forward primers were fluorescently labeled with FAM and PCR fragments were run on the ABI3730 sequencer/genotyper and results
- a non-radioactive method was used to quantify the relative expression of the two NA V3 alleles in patients heterozygous for the coding A/G polymorphism (rs1852464) within exon 19 of the NAV3 gene.
- the heterozygosity for rs1852464 is up to 0.493 in the Caucasians/Europeans making it a highly useful marker.
- the extension reaction of SNuPE is based on the incorporation of a single ddNTP that is selected to allow differential extension of a labeled primer annealed close to the polymorphic site.
- PCR reactions were performed in 25- ⁇ l reaction volume containing 60-100 ng of template DNA, G ⁇ neAmp 10x PCR buffer (Applied Biosystems), 0.2 mM of dNTP Mix (GE Healthcare Biosciences Ab), 0.4 ⁇ M of each primer, and 1.5 U of AmpliTaq polymerase (AB).
- the following PCR cycles were used for amplification: 94°C for 3 minutes, 35 cycles of 94°C for 30 seconds denaturation, annealing temperature of 56°C for 30 seconds, and 72°C for 45 seconds extension. Final extension was 72°C for 5 minutes.
- the PCR product was subsequently purified by Exonuclease ! (10 U/ ⁇ l) and SAP (Shrimp alka ⁇ ne phosphatase, 2 U/ ⁇ l) (ExoSAP-IT, Amersham Bio- sciences) according to the manufacturer's instructions.
- PCR Extension was performed using a fluorescently labeled extension primer 5' GATGCTGTTTGAGCGCATCATGCTGGGCCC 3' and a nucleotide mix containing the stopping nucleotide ddCTP in place of the normal cyto- sin. PCR Extensions were performed in 20- ⁇ l reaction volume containing 2 ⁇ l of purified PCR product, Thermo Sequenase Reaction Buffer (GE Healthcare Biosciences Ab), 50 ⁇ M of each dATP, dGTP, dTTP, and ddCTP (GE Healthcare Biosciences Ab), 0.2 ⁇ M of SNuPE primer, and 6,4 U of Thermo Sequenase DNA Polymerase (GE Healthcare Biosciences Ab).
- Thermo Sequenase Reaction Buffer GE Healthcare Biosciences Ab
- 50 ⁇ M of each dATP, dGTP, dTTP, and ddCTP GE Healthcare Biosciences Ab
- SNuPE primer 0.2 ⁇ M of
- extension reactions 95°C for 2 minutes, 25 cycles of 95°C for 20 seconds denaturation, annealing temperature of 56°C for 20 seconds, and 7O 0 C for 40 seconds extension. Final extension was 70 0 C for 10 minutes. This yielded extension products of: 43 bp and 49 bp depending on whether G or A is present in the template.
- the products of the primer extension reaction were run on the ABI3730 sequencer/genotyper and results ana- lysed using GeneMapper v3 software (Applied Biosystems).
- Microsatellite instability refers to genome-wide length variation of microsatellites, which are short tandem nucleotide tracts within the DNA, as a result of a failure in DNA mismatch repair
- microsatellite stable refers to constant length of microsatellites, in other words lack of length variation of microsatellites caused by a failure in DNA mismatch repair.
- the LOH analysis was performed as described in Example 1. The results obtained from all series examined are summarized in Table 1. Table 2 gives the results for each marker tested separately.
- Adenomas and carcinomas arising in the same patients were available in 10 out of the 59 cases in series A. The analysis was performed as described in Example 1. In 4 of these 10 patients the adenomas showed LOH or BLOH and in 3 of these 4 cases the matching carcinomas were informative and have mostly similar pattern of LOH/BLOH (Table 3). This suggests that when NAV3 LOH is observed in adenomas it is likely that such patient will develop carcinomas through NAV3 LOH as well.
- Samples for the FISH (fluorescence in-situ hybridization) assay were prepared from 18 randomly selected colorectal carcinoma cases from series A (described in Example 2a) and from seven cases with skin samples obtained from patients suffering from chronic eczema, a non-malignant inflammatory lesion as a negative control. All tissue samples had been processed by routine formalin fixation and embedded in paraffin.
- BAC Three bacterial artificial chromosome (BAC) clones specific to NAV3 DNA (RP1 1 -494K17, RP1 1 -36P3 and RP1 1-136F16; Research Genetics Inc., Huntsville, AL, USA) were labeled with Alexa-594-5-dUTP (Invitrogen) and the chromosome 12 centromere probe (pA12H8) was labeled with Fluorescein-12- dUTP (Roche) using nick translation (Hyytinen E et a/. Cytometry, 16: 93-99, 1994). For each labeling reaction 1 -2 ⁇ g DNA was used in total reaction volume of 50 ⁇ l.
- Table 5 Number of normal cells, polyploidy cells and cells with NAV3 deletion in samples from colorectal carsinoma patients and from inflammatory skin lesions. Fifty celts per case were calculated.
- Sections of 5- ⁇ m were cut from the samples using a microtome and mounted onto a 1 ,35 ⁇ m thin polyethylene membrane (P.A.L.M. Microlaser Technologies, Bernried, Germany) attached to a glass slide. Tissue sections were then deparaffinized and stained with hematoxylin as described before (Stoecklein et al. Am J Pathol 161 : 43-51 , 2002). For morphological control hematoxylin-eosin staining was made according to standard protocol. Areas of malignant cells covering 200000 ⁇ m 2 were laser capture microdissected using the P.A.L.M. Laser-Microbeam system (P.A.L.M. Microlaser Technologies).
- Example 6 The five lung cancer cases were analysed successfully for LOH according to the method described in Example 1a. Of these five lung cancers, one was uninformative for all three markers that were used, but loss of heterozygosity was found in two of the four other cases (Table 6).
- SCLC small cell lung cancer EC - epidermoid carcinoma of the lung
- the amplified DNA was then labeled with digoxigenin-dUTP (Roche) and similarly processed aliquots of reference DNA obtained from peripheral blood mononuclear cells of healthy volunteers with biotin-dUTP (Roche).
- the labeled probes were hybridized on normal male metaphase slides for 2-3 nights.
- metaphases were viewed under a fluorescence microscope and three-color digital images were captured using an epifluorescence microscope (Axioplan imagining 2, Carl Zeiss AG, Oberkochen, Germany) equipped with a CCD camera using statistical limits for green to red ratios to determine DNA copy number gains and losses. Eight to twelve metaphases were included in the analysis for each case.
- As an internal control normal male and female DNA were cohybridized and only differences in sex chromosomes were identified.
- Samples from 16 patients diagnosed to have a transitional epithelial carcinoma of the urinary bladder were selected for the study.
- the samples were routinely fixed in neutral formalin and embedded in paraffin. 1-3 sections of 50 microns thickness were cut and the nuclei were isolated as described in
- BAC Two bacterial artificial chromosome (BAC) clones specific to NAV3 DNA (RP11-36P3 and RP11-136F16; Research Genetics Inc., Huntsville, AL, USA) were labeled with Al ⁇ xa594-5-dUTP (Invitrogen) and the chromosome 12 centromere probe (pA12H8; American Type Cell Culture) was labeled with Alexa488-5-dUTP (Invitrogen) using nick translation (Hyytinen et al. 1994). 50- 75 ng of each labeled BAC and 30 ng of centromere probe were mixed together with 1 ⁇ g of human COT1 DNA (Invitrogen) and precipitated with sodium acetate and ethanol. Precipitated probe mix was diluted into 10 ⁇ l of hybridization buffer (15% w/v dextran sulphate, 70% formamide in 2 x SSC, pH 7.0).
- Nuclei slides were pretreated with 1 M sodium thiocyanate at +80 0 C for 5 minutes and washed with 2 x SSC three times for 5 minutes at room temperature. After washing, slides were treated with 50% glycerol, 0.1 x SSC at +90 0 C for 6 minutes, with 2 x SSC for 3 minutes and with distilled water three times for 2 minutes. Slides were digested enzymatically with proteinase K (Sigma; 8 ⁇ g/ml in 20 mM Tris-HCI, pH 7.5, 2 mM CaCI 2 ) at +37°C for 8 minutes. After dehydration and air drying probe mix was pipetted on slides and slides were denatured for 6 min at +85°C on a hot plate.
- proteinase K Sigma; 8 ⁇ g/ml in 20 mM Tris-HCI, pH 7.5, 2 mM CaCI 2
- Hybridisation was carried out for 48 hr at +37 0 C. Slides were washed three times with 1.5 M Urea, 0.1 x SSC at +47 0 C for 10 minutes, once with 0.1 x SSC for 10 minutes at +47°C, followed by three washes with PBS, 0.1 % NP-40 at room temperature. Finally, slides were rinsed with distilled water, air dried and mounted in Vectashield Mounting Medium with 4 ' ,6-diamino-2 phenylindole dihydrochlor- ide (DAPI; Vector).
- DAPI Vectashield Mounting Medium with 4 ' ,6-diamino-2 phenylindole dihydrochlor- ide
- FISH results were evaluated using Olympus BX51 microscope (Tokyo, Japan) equipped with a 6OX oil immersion objective and a triple bandpass filter for simultaneous detection of Alexa488, Alexa594 and DAPI (Chroma Technology Corp., Brattleboro, VT, USA). 200 nuclei were analysed from each case and the nuclei were grouped as normal if having two labels for chromosome 12 centromere and two for the NAV3. Polyploid nuclei had three or more centromere labels. NAV3 deletion was defined when the number of centromere labels was higher than the number of NAV3 labels and NAV3 amplification was defined when the number of NAV3 labels was higher than centromere labels. The analyses were done blinded to the diagnosis or sample identity by two independent analysers.
- slides were fixed with 4% paraformaldehyde in PBS for 1 minute on ice. After PBS washes, slides were digested enzymatically with proteinase K (Sigma; 0.66 ⁇ g/ml in 20 mM Tris-HCI, pH 7.5, 2 mM CaCI 2 ) at +37 0 C for 6 minutes. After dehydration and air drying probe mix was pipetted on slides and slides were denatured for 5 min at +75°C on a hot plate. Hybridisation was carried out for 24 hr at +37°C.
- proteinase K Sigma; 0.66 ⁇ g/ml in 20 mM Tris-HCI, pH 7.5, 2 mM CaCI 2
- FISH results were evaluated using Olympus BX51 microscope (Tokyo, Japan) equipped with a 6OX oil immersion objective and a triple bandpass filter for simultaneous detection of Alexa488 ! Alexa594 and DAPI (Chroma Technology Corp., Brattleboro, VT, USA). All cancer cells found from the sample were analysed from each case and the cells were grouped as normal if having two labels for chromosome 12 centromere and two for the NAV3, Polyploid cells had three or more centromere labels. NAV3 deletion was defined when the number of centromere labels was higher than the number of NAV3 labels and NAV3 amplification was defined when the number of NA V3 labels was higher than centromere labels. The analyses were done blinded to the diagnosis or sample identity by two independent analyzers.
- Results The results are shown in table 8 and Figures 5a and 5b.
- Four cases were analyzed and all cancer ceils found from the samples were counted from each case.
- Cells were grouped as normal if having two labels for chromosome 12 centromere and two for the NAV3.
- Polyploid cells had three or more centromere labels (>2cen).
- NAV3 deleted cells contained higher number of centromere labels than NAV3 labels (cen>nav) and NAV3 amplified cells had higher number of NAV3 labels than centromere labels (cen ⁇ nav).
- BCC basal cell carcinoma
- SCC squamous cell carcinoma
- Tissue samples Samples from 14 patients diagnosed to have a basal eel! carcinoma and 5 patients with squamous cell carcinoma were selected for the study. The samples were routinely fixed in neutral formalin and embedded in paraffin. 1-3 sections of 50 microns thickness were cut and the nuclei were isolated as described in Example 3, page 18, second paragraph.
- NA V3 FISH analysis results of BCC and SCC samples are shown in Table 9. 3 out of 14 (21 %) of the BCC samples showed NAV3 deletion with deletion range of 6-11 % of the total cell count. In addition, three of the samples (21 %) showed NAV3 gene duplication (amplification range 8-11 %). One out of five (20%) of SCC samples indicated NAV3 deletion (12%).
- Centromere probe e.g. 1-5 ng
- FITC or biotin and one or two BAC-probes were mixed and precipitated by adding 1/10 volume 3M sodium acetate and 2 x volume 100% ethanol, and centrifuged. The supernatant was discarded, the pellet was allowed to dry, after which the DNA was dissolved in a mixture consisting of 50% formamide, and 10% dextran sulphate, 2 x SSC, pH7 and optionally CoM DNA (e.g. 125ng; Gibco BRL, Gaithersburg, MD, USA), called here probe mixture.
- CoM DNA e.g. 125ng
- Target metaphases on slides were denatured in for 2 to 3 minutes in 70% formamide / 2 x SSC solution (pH 7.0) at 70 to 73 0 C, and dehydrated in 70%, 85%, and 100% ethanol, and treated with proteinase K (1 ⁇ g/ml, Sigma Chemical Co, St Louis, MO, USA) in 20 mM Tris/2mM CaCI 2 (pH 7.5) buffer for 7.5 minutes at 37°C, and dehydrated as above.
- the probe mixture was denatured for 5 minutes in 70 0 C, and applied to pretreated slides on a warm plate (37°C), sealed under a coverslip with Rubber Cement (Starkey Chemical Co, LaGrange IL USA) and allowed to hybridize in a humid chamber (37 0 C) for 2 to 3 days.
- the slides were washed 3 times with 50% formamide in 2 x SSC, pH 7, 4 x SSC, and 0.1 x SSC, all at 45°C, and with 4 x SSC, 2 x SSC and PBS at room tempera- ture.
- biotinylated probe was visualised with avidin-FSTC (green, Vector Laboratories, Bur ⁇ ngame, CA, USA) and the digoxigenin labeled probe was visualised with anti-digoxigenin antibody made in sheep conjugated with rhodamine (red, Roche, Mannheim, Germany).
- the slides were counterstained with DAPI and mounted in Vectashield (bothVector Laboratories, Burlingame, CA, USA).
- the air-dried preparations were fixed with 0.1 % paraformaldehyde and dried in ethanol series (70%, 85%, 100%).
- SW 403 and SW480 are shown in table 10. Both cancer cell lines showed dominating 3 centromeres 2 NAV3 -type of deletion in almost all of the cells studied. Normal colon cell lines did not show any NAV3 gene copy number changes.
- NAV3 FISH assay with nuclei extracted from paraffin embedded patient samples indicated NAV3 copy number changes in 31 % of MSS-type colorectal adenocarcinoma samples, 7% of MSI-type of colorectal adenocarcinoma (1 sample out of 14) and in 16% of adenoma tubulare samples. Results are shown in table 12.
- Figure 6 shows comparison of NAV3 FISH results from normal colon samples and MSS-type of colorectal adenocarcinoma. Cancer cells are different from normal colon mucosal cells in terms of polyploidy and NAV3 copy number. Table 12.
- NAV3 FISH analysis results using different colon samples. In each sample, 200 cells were analyzed. NAV3 deleted cells contain higher number of centromere SabeSs than NAV3 labels and NAV3 amplified cells higher number of NAV3 labels than centromere labels.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (12)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12/514,638 US20100143907A1 (en) | 2006-11-13 | 2006-11-13 | Methods and uses involving genetic abnormalities at chromosome 12 |
AT07823247T ATE545714T1 (en) | 2006-11-13 | 2007-11-13 | PROCEDURES AND USES ASSOCIATED WITH GENETIC ANOMALIES ON CHROMOSOME 12 |
BRPI0718610A BRPI0718610A2 (en) | 2006-11-13 | 2007-11-13 | methods and uses involving genetic abnormalities on chromosome 12. |
ES07823247T ES2395117T3 (en) | 2006-11-13 | 2007-11-13 | Methods and uses involving genetic abnormalities on chromosome 12 |
JP2009536756A JP5523103B2 (en) | 2006-11-13 | 2007-11-13 | Methods and uses involving genetic abnormalities in chromosome 12 |
DK07823247.7T DK2092081T5 (en) | 2006-11-13 | 2007-11-13 | Methods and uses for genetic abnormalities of chromosome 12 |
CA002669492A CA2669492A1 (en) | 2006-11-13 | 2007-11-13 | Methods and uses involving genetic abnormalities at chromosome 12 |
PL07823247T PL2092081T3 (en) | 2006-11-13 | 2007-11-13 | Methods and uses involving genetic abnormalities at chromosome 12 |
AU2007321070A AU2007321070B2 (en) | 2006-11-13 | 2007-11-13 | Methods and uses involving genetic abnormalities at chromosome 12 |
EP07823247A EP2092081B9 (en) | 2006-11-13 | 2007-11-13 | Methods and uses involving genetic abnormalities at chromosome 12 |
SI200730916T SI2092081T1 (en) | 2006-11-13 | 2007-11-13 | Methods and uses involving genetic abnormalities at chromosome 12 |
US13/648,575 US20130029337A1 (en) | 2006-11-13 | 2012-10-10 | Methods and uses involving genetic abnormalities at chromosome 12 |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US85851206P | 2006-11-13 | 2006-11-13 | |
FI20065717A FI20065717A0 (en) | 2006-11-13 | 2006-11-13 | Methods and uses related to genetic abnormalities in chromosome 12 |
FI20065717 | 2006-11-13 | ||
US60/858,512 | 2006-11-13 |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/648,575 Continuation US20130029337A1 (en) | 2006-11-13 | 2012-10-10 | Methods and uses involving genetic abnormalities at chromosome 12 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2008059112A1 true WO2008059112A1 (en) | 2008-05-22 |
Family
ID=39401359
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FI2007/050611 WO2008059112A1 (en) | 2006-11-13 | 2007-11-13 | Methods and uses involving genetic abnormalities at chromosome 12 |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP2092081B9 (en) |
JP (1) | JP5523103B2 (en) |
AU (1) | AU2007321070B2 (en) |
CA (1) | CA2669492A1 (en) |
PL (1) | PL2092081T3 (en) |
WO (1) | WO2008059112A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010046530A1 (en) * | 2008-10-20 | 2010-04-29 | Helsingin Yliopiston Rahastot | Methods and uses involving genetic aberrations of nav3 and aberrant expression of multiple genes |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FI113666B (en) * | 2002-01-24 | 2004-05-31 | Tapio Visakorpi | Methods used for refractive sites in chromosome 12 and / or neuron navigator 3 gene in diagnosing the skin's primary T-cell lymphoma and following up or predicting the disease, using these refractive sites and the gene |
WO2005118869A2 (en) | 2004-05-28 | 2005-12-15 | Dana-Farber Cancer Institute, Inc. | Compositions, kits, and methods for identification, assessment, prevention, and therapy of cancer |
US7094534B2 (en) * | 1992-03-04 | 2006-08-22 | The Regents Of The University Of California | Detection of chromosoal abnormalities associated with breast cancer |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
MXPA05014220A (en) * | 2003-07-02 | 2006-03-09 | Novartis Ag | Genes regulated in ovarian cancer as prognostic and therapeutic targets. |
-
2007
- 2007-11-13 PL PL07823247T patent/PL2092081T3/en unknown
- 2007-11-13 WO PCT/FI2007/050611 patent/WO2008059112A1/en active Application Filing
- 2007-11-13 CA CA002669492A patent/CA2669492A1/en not_active Abandoned
- 2007-11-13 AU AU2007321070A patent/AU2007321070B2/en not_active Ceased
- 2007-11-13 EP EP07823247A patent/EP2092081B9/en not_active Not-in-force
- 2007-11-13 JP JP2009536756A patent/JP5523103B2/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7094534B2 (en) * | 1992-03-04 | 2006-08-22 | The Regents Of The University Of California | Detection of chromosoal abnormalities associated with breast cancer |
FI113666B (en) * | 2002-01-24 | 2004-05-31 | Tapio Visakorpi | Methods used for refractive sites in chromosome 12 and / or neuron navigator 3 gene in diagnosing the skin's primary T-cell lymphoma and following up or predicting the disease, using these refractive sites and the gene |
WO2005118869A2 (en) | 2004-05-28 | 2005-12-15 | Dana-Farber Cancer Institute, Inc. | Compositions, kits, and methods for identification, assessment, prevention, and therapy of cancer |
Non-Patent Citations (5)
Title |
---|
SCHMIDT H. ET AL.: "Gains of 12q are the most frequent genomic imbalances in adult fibrosarcoma and are correlated with a poor outcome", GENES CHROMOSOMES CANCER, vol. 34, May 2002 (2002-05-01), pages 69 - 77, XP008109735 * |
SCHNEIDER B.G. ET AL.: "Regions of allelic imbalance in the distal portion of chromosome 12q in gastric cancer", MOL. PATHOL., vol. 56, June 2003 (2003-06-01), pages 141 - 149, XP008109733 * |
SCHNEIDER, B. G. ET AL., J. CLIN PATHOL: MOL PATHOL, vol. 56, 2003, pages 141 - 149 |
See also references of EP2092081A4 * |
STORLAZZI C.T. ET AL.: "Ring chromosome and low-grade gene amplification in an atypical lipomatous tumor with minimal nuclear atypia", INT. J. ONCOL., vol. 23, July 2003 (2003-07-01), pages 67 - 71, XP008110298 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010046530A1 (en) * | 2008-10-20 | 2010-04-29 | Helsingin Yliopiston Rahastot | Methods and uses involving genetic aberrations of nav3 and aberrant expression of multiple genes |
JP2012505666A (en) * | 2008-10-20 | 2012-03-08 | ファーマテスト・サービシーズ・リミテッド | Methods and uses involving NAV3 gene abnormalities and abnormal expression of multiple genes |
Also Published As
Publication number | Publication date |
---|---|
EP2092081A1 (en) | 2009-08-26 |
EP2092081B1 (en) | 2012-02-15 |
AU2007321070A1 (en) | 2008-05-22 |
EP2092081B9 (en) | 2013-01-23 |
JP5523103B2 (en) | 2014-06-18 |
PL2092081T3 (en) | 2013-07-31 |
EP2092081A4 (en) | 2010-06-09 |
JP2010508862A (en) | 2010-03-25 |
AU2007321070B2 (en) | 2013-11-21 |
CA2669492A1 (en) | 2008-05-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2274426B1 (en) | Aberrant mitochondrial dna, associated fusion transcripts and hybridization probes therefor | |
Kresty et al. | Frequent alterations of p16INK4a and p14ARF in oral proliferative verrucous leukoplakia | |
Wada et al. | Does" clonal progression" relate to the development of intraductal papillary mucinous tumors of the pancreas? | |
Baumgart et al. | Genomic instability at both the base pair level and the chromosomal level is detectable in earliest PanIN lesions in tissues of chronic pancreatitis | |
Li et al. | Deletion of the olfactomedin 4 gene is associated with progression of human prostate cancer | |
Muresu et al. | Chromosomal abnormalities and microsatellite instability in sporadic endometrial cancer | |
Jin et al. | Detection of mismatch repair gene germline mutation carrier among Chinese population with colorectal cancer | |
Brueckl et al. | Prognostic significance of microsatellite instability in curatively resected adenocarcinoma of the small intestine | |
US20160083798A1 (en) | Methods and uses involving genetic aberrations of nav3 and aberrant expression of multiple genes | |
Tzao et al. | 5′ CpG island hypermethylation and aberrant transcript splicing both contribute to the inactivation of the FHIT gene in resected non-small cell lung cancer | |
EP2092081B1 (en) | Methods and uses involving genetic abnormalities at chromosome 12 | |
Sugai et al. | Molecular validation of the modified Vienna classification of colorectal tumors | |
Xiao et al. | Chromosomal alteration in Chinese sporadic colorectal carcinomas detected by comparative genomic hybridization | |
EP2411522B1 (en) | Aberrant mitochondrial dna, associated fusion transcripts and translation products and hybridization probes therefor | |
US20130029337A1 (en) | Methods and uses involving genetic abnormalities at chromosome 12 | |
Yadav et al. | Fate of the human Y chromosome linked genes and loci in prostate cancer cell lines DU145 and LNCaP | |
ES2395117T3 (en) | Methods and uses involving genetic abnormalities on chromosome 12 | |
CN114207144A (en) | Compositions and methods for preserving DNA methylation | |
Colombino et al. | Microsatellite instability and mutation analysis among Southern Italian patients with colorectal carcinoma: detection of different alterations accounting for MLH1 and MSH2 inactivation in familial cases | |
Baudi et al. | A novel missense germline mutation in exon 2 of the hMSH2 gene in a HNPCC family from Southern Italy | |
WO2013142982A1 (en) | Colca1 and colca2 and their use for the treatment and risk assessment of colon cancer | |
Birindelli et al. | Genetic markers in sporadic tumors | |
US20160299147A1 (en) | Screening, diagnosis, prognostication and treatment of ovarian cancer | |
Böhm | ATM mutations in familial pancreatic cancer | |
Böhm | ATM Mutations in Familial Pancreatic Cancer: ATM Mutationen Bei Familiärem Pankreaskarzinom |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07823247 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 2009536756 Country of ref document: JP Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2669492 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007321070 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007823247 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2007321070 Country of ref document: AU Date of ref document: 20071113 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12514638 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: PI0718610 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090513 |