ES2395117T3 - Methods and uses involving genetic abnormalities on chromosome 12 - Google Patents

Abstract

An in vitro method of predicting tumor initiation, tumor progression and / or carcinoma, characterized by the detection of the presence or absence of genetic abnormalities in 12q21.2 in a neuron navigator 3 (NAV3) gene or a fragment thereof, indicating the presence of said genetic abnormalities an initiation or progression of detumores of epithelial origin and / or carcinoma in a biological sample.

Description

Methods and uses that involve genetic abnormalities on chromosome 12.

Field of the Invention

[0001] The present invention relates to the fields of genetics and oncology and provides methods for predicting and identifying tumors of epithelial origin. Specifically, the present invention relates to a novel method for predicting tumor initiation, tumor progression and / or carcinomas, the method comprising the detection of genetic abnormalities associated with tumors of epithelial origin. The present invention also relates to a novel method of identifying an individual with the potential to develop carcinoma, the method comprising the detection of genetic abnormalities. The present invention also relates to a method of predicting the progression of carcinomas and transforming them into an aggressive variant, the method comprising the detection of genetic abnormalities, which indicate the probability of developing a carcinoma. The present invention also relates to a use of a specific chromosomal region or a gene or a fragment thereof, and / or genetic markers to predict tumor initiation, tumor progression and / or carcinoma. The present invention also relates to a use of a specific chromosomal region or a gene or a fragment thereof in therapy, for the development of therapy and for the preparation of a medicament for the treatment of tumors of epithelial origin.

Background of the invention

[0002] Cancer is a complex disease in which several genetic and epigenetic alterations have accumulated. A variable number of genetic changes is needed before the onset of a somatically developed tumor. Available data indicate that solid tumor development depends on the combination of deletions and amplifications of multiple chromosome segments (Mertens et al. Cancer Res 57: 2765-2780, 1997; Mitelman et al. Nature Genet, 15: 417-474 , 1997). More than 90% of all human neoplasms derive from the epithelium. Thus, epithelial cells play an important role in physiological and pathophysiological conditions. Carcinomas are malignant tumors derived from epithelial cells. The most common carcinomas include the common forms of breast, prostate, lung and colorectal cancer.

[0003] Colorectal cancer is the third most frequent cancer worldwide with an estimated one million new cases annually (Parkin et al. CA Cancer J Clin 55: 74-108, 2005). The average lifetime risk in industrialized countries is approximately 5%, and almost half of those affected will die of their disease (Burt, Gastroenterology 119: 837-853, 2000). Colorectal cancer develops through a benign precursor lesion, a polyp, and can be avoided by polypectomy. It is estimated that 30% of the population has polyps in the colon, and the incidence of polyps increases with age. Thus, screening colonoscopies in the average of asymptomatic individuals have revealed neoplastic (adenomatous) polyps in 12% of individuals 40-49 years of age (Imperiale TF et al. NEJM 346: 1781-1785, 2002), and in 58% among individuals 50-59 years of age (Mehran A et al. Surg Endosc 17: 1974-1977, 2003). Some inherited disorders, which represent 510% of the total burden of colorectal cancer, are associated with an increase in the number of polyps (familial adenomatous polyposis, FAP) or a high tendency to malignant progression (hereditary colorectal cancer without polyposis, HNPCC) (Lynch and de la Chapelle, N Engl J Med 348: 919-932, 2003).

[0004] Survival is closely related to the stage at the time of diagnosis, even in patients who have already developed the malignant disease: more than 90% of patients with local cancer are alive after 5 years, compared to less than 10% of those with metastatic disease (Burt, Gastroenterology

119: 837-853, 2000). Colorectal carcinomas are notoriously resistant to both chemotherapy and radiotherapy and most patients for whom surgery alone is not curative are doomed to die of their disease (Globcan, International Agency for Research on Cancer. Available at http : /wwwdep.iarc.fr/, 2002). Therefore, it is vital to be able to identify the most at risk individuals as soon as possible for efficient cancer prevention or curative treatment.

[0005] The development of colorectal cancer through benign precursors, together with the accumulation of genetic changes is one of the best known examples of multi-step carcinogenesis (Chung DC, Gastroenterology 119: 854-865, 2000, and below) . This multi-step evolutionary nature of colorectal cancer offers excellent opportunities for early detection and prevention of cancer. Colorectal cancer arises as a result of the gradual accumulation of mutations at the nucleotide level and / or at the gross chromosomal level. The vast majority of colorectal cancers show one of the two main phenotypes of genomic instability, microsatellite instability (MSI) or chromosomal instability (CIN) (Abdel-Rahman et al. Proc. Natl. Acad. Sci. USA 98: 2538-2543, 2001). Current literature includes a multitude of biomarkers of potential use in the evaluation of colorectal cancer risk or early detection of this type of cancer, however, clinical validation is mostly lacking (Umar and Srivastava, Dis Markers 20: 87-96 , 2004).

[0006] At present, histology serves as the main predictor, with multiple adenomas, high grade dysplasia, with large and hairy characteristics (more than 1 cm), of the highest risk of cancer (Winawer et al Gastroenterology 130: 1872-1885, 2006). Therefore, predictors of advanced pathology could be useful, both for adenomas and for cancer, in order to assign an appropriate risk category to each patient. Biomarkers that could serve as predictive factors of a trend towards cancer progress would be very welcome.

[0007] Lung cancer is the leading cause of cancer-related deaths worldwide, with approximately 1.2 million deaths annually (Ferlay et al 2001, GLOBOCAN2000: Cancer Incidence, Mortality and Prevalence Worldwide, Version 1.0 IARC CancerBase No. 5. Lyon, IARCPress). More than 95 percent of lung cancers are related to smoking and, therefore, DNA adducts have a key role in carcinogenesis.

[0008] Patients suffering from lung cancer usually have a poor prognosis, five-year survival rates range from approximately 50% to 10% (Hasleton PS, Respiratory system 1.0 in Cancer Handbook. Http: www.cancerhandbook.net, London: Nature Publishing Group, 2001). However, when lung cancer is detected at an early stage and surgery is possible, five-year survival rates survival rates can reach 85%. Thus, predictive factors for the initiation and / or progression of the tumor would be valuable, in order to allow the prevention or effective therapy of cancer.

[0009] Malignant neoplasms of the lung can be divided according to histological features in small cell lung cancers (SCLC) and non-small cell lung cancers (NSCLC), the latter consisting mainly of squamous cell carcinoma and adenocarcinoma. Recent studies have shown different genetic backgrounds among these types of cancer (Kaminski et al. Chest 125 (5 Suppl): 111 S-5S, 2004, Fong et al. Thorax 58: 892-900, 2003). However, it is assumed that more than 20 genetic or epigenetic abnormalities are necessary before a clinically evident lung cancer. Normally, in lung carcinomas, multiple chromosomal aberrations can be observed that indicate genomic instability. New tumor markers could explain the pathogenesis of cancer and therefore improve the effect of therapies and survival on lung cancer.

[0010] The diagnoses suffer from individual markers or a panel of markers for general cancer detection. For example, the prostate specific antigen (PSA) is secreted by prostate gland cells and elevated levels of PSA are used as a marker of prostate tumors.

[0011] Other markers for epithelial tumors are available, but their use is hampered by their lack of specificity: These markers are usually also elevated in other conditions of malignancy, such as inflammatory lesions. These markers, which have been used clinically, but which do not meet the requirement of specificity and / or sensitivity are, for example, the following: colon-specific tumor derived antigen (STT), carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), pregnancy-specific beta-glycoprotein 1 (SP1), human placental lactogen (HPL), human chorionic beta gonadotropin (Beta-HCG), transferrin (TF) and ferritin (FE).

[0012] It is of utmost importance to develop new methods, which allow early identification of patients with a higher risk to develop aggressive carcinoma to enable effective cancer prevention. A clinically useful method is also necessary that could serve as a predictor of a tendency to carcinoma progress. In addition, additional means for the development of new guidelines for the initiation and monitoring of cancer treatment are very necessary.

[0013] 12q21 chromosomal aberrations, specifically aberrations of the Neuron Navigator 3 (NAV3) gene, have been identified in neuroblastomas and cutaneous T-cell lymphomas (CTCL). Four of the 10 main neuroblastomas studied by Coy et al showed reduced or no expression of NAV3, and three of them had homozygous deletions of both alleles (Coy JF et al. Gene 290: 73-94, 2002). In CTCL, a deletion or translocation of the NAV3 gene was associated with a point mutation in the remaining allele only in one of the 7 patients studied (Karenko L et al. Cancer Res 65: 8101-81 10, 2005 and EP1476567 A1). In pancreatic carcinomas, 12q21 chromosomal aberrations were identified by microsatellite analysis. Loss of heterozygosity (LOH) was detected with markers D12S1684 and D12S1708, which border a chromosomal region comprising the NAV3 gene (Kimura M et al. Cancer Res 58: 2456-60, 1998). However, the chromosomal region described in the article by Kimura et al. It is large and it was not observed that the specific region or the NAV3 gene was linked to pancreatic carcinoma. On the contrary, this application describes chromosomal abnormalities that are specific to tumors of epithelial origin, in the specific chromosomal region.

[0014] New biomarkers are desired to provide a more effective and early diagnosis of potentially aggressive tumors, as well as to identify tumors sensitive to targeted therapies. The present invention provides a solution for predicting or identifying the progression of a tumor and a carcinoma. The present invention also describes a tool for evaluating the clinical aggressiveness of epithelial tumors and the survival of patients. In addition, the invention provides a new therapeutic objective for the prevention or therapy of carcinoma.

Brief Description of the Invention

[0015] The object of the invention is therefore to provide new methods and means for the diagnosis, staging and monitoring of cancer patients, methods and means such as to allow an early diagnosis of the disease.

[0016] Another object of the invention is to provide new methods and means for predicting tumor initiation, tumor progression and / or carcinoma.

[0017] Another object of the invention is to provide new methods and means for the identification of individuals with a higher risk of developing carcinomas, methods and means such that being specific and reliable, allow identification as soon as possible.

[0018] Still another object of the invention is to provide new methods and means for the prediction of the progression of carcinomas and the transformation to an aggressive form, methods and means such that allow a timely therapeutic intervention, which can save life.

[0019] Still another object of the invention is to provide new methods and means for the development of new guidelines for the initiation and monitoring of therapeutic interventions, as well as for the development of new treatment modalities for cancers, methods and such means. that prolong the disease remission phase and introduce new possibilities for the fight against the disease and for the recovery of the patient.

[0020] Still another object of the invention is to provide new biomarkers useful in the early detection of cancer as well as in the evaluation of cancer risk.

[0021] The present invention relates to a novel method for prediction of tumor initiation, tumor progression and / or carcinomas, characterized by the detection of the presence or absence of genetic abnormalities in 12q21.2 in a gene neuron navigator 3 (NAV3) or a fragment thereof, the presence of said genetic abnormalities associated with tumors of epithelial origin, in a biological sample. In other words, genetic abnormalities indicate the presence of epithelial tumors or an initiation or progression of tumors of epithelial origin and / or carcinoma.

[0022] The present invention also relates to a new method for the identification of an individual with the potential to develop a carcinoma of epithelial origin, the method comprising the detection of genetic abnormalities in 12q21.2 in a neuron navigator 3 (NAV3) gene or a fragment thereof, the presence of said genetic anomalies being associated with tumors of epithelial origin. That is, genetic abnormalities indicate tumors of epithelial origin with the potential to develop a carcinoma.

[0023] The present invention also relates to a novel method of predicting the progression of carcinomas of epithelial origin and / or their transformation to an aggressive variant, characterized by the detection of genetic abnormalities in 12q21.2 in a gene neuron navigator 3 (NAV3) or a fragment thereof, where abnormalities indicate the probability of developing a carcinoma.

[0024] The present invention also relates to the use of the NAV3 gene or a fragment thereof to predict tumor initiation, tumor progression and / or carcinoma, genetic abnormalities in the NAV3 gene indicating tumors of epithelial origin.

[0025] The present invention also relates to the use of genetic markers in 12q21.2, to predict tumor initiation, tumor progression and / or carcinoma, characterized by the detection of the presence or absence of genetic abnormalities, said abnormalities. genetic in 12q21.2 in the NAV3 gene or in a fragment thereof indicating tumors of epithelial origin. These genetic abnormalities are associated with tumors of epithelial origin and / or carcinoma.

[0026] The present invention also describes the use of a specific 12q21.2 chromosomal region, specifically the NAV3 gene, a fragment thereof or a genetic product thereof in therapy, for the development of therapy or for the preparation of a medicament. for the treatment of tumors of epithelial origin.

Brief description of the drawings

[0027] In the following, the invention is described in greater detail by means of preferred embodiments with reference to the accompanying drawings, in which:

Figure 1 shows an LOH observed on the D12S1708 microsatellite of chromosome 12 in adenoma (middle) and carcinoma (lower) compared to its corresponding normal tissue (above).

Figure 2 shows an MSI observed on the D12S1708 microsatellite of chromosome 12 in carcinoma (lower) compared to its corresponding normal tissue (above). The adenoma (center) is MSS.

Figure 3 shows the extension of the nucleotide-simple initiator, (SnuPE) showing LOH in a carcinoma (lower) compared to its corresponding normal (above).

Figure 4 shows a karyotype of the true malignant lung carcinoma cells of a patient with LCCT and SCLC.

Figure 5a shows the result of specific FISH NAV3 with metastases in breast cancer. The black bars indicate the amount of polyploidy in the studied cells and the gray bars indicate the amount of cells with suppressed NAV3. The results are shown as a percentage of the total cell count.

Figure 5b shows typical breast cancer metastasis cells with suppressed NAV3. The green signals indicate the centromeres and the red signals NAV3 copies.

Figure 6 shows the comparison of the NAV3FISH results of normal colon samples and colon cancer samples. The NAV3FISH analysis included both normal colon samples and CRC samples from the same patient (n = 36). The average values (%) of normal colon (gray bars) and colon cancer (black bars) are shown.

Detailed description of the invention

[0028] It has been found that abnormalities in 12q21.1-q21.31, specifically 12q21.2, are associated with tumors of epithelial origin.

[0029] Chromosomal aberrations in 12q21.1-q21.31, specifically aberrations in 12q21.2, more specifically aberrations in the NAV3 gene, have been found to have a role in the development of tumors of epithelial origin.

[0030] The present invention is based on a method for the detection of genetic abnormalities in 12q21.1-q21.31, specifically in 12q21.2, associated with tumors of epithelial origin, excluding pancreatic carcinoma.

[0031] Specifically, genetic abnormalities at chromosomal position 12q21.1-q21.31, specifically 12q21.2, affect the NAV3 gene or a fragment thereof.

[0032] Specifically, genetic abnormalities are detected in the NAV3 gene or a fragment thereof.

[0033] In a preferred embodiment of the method of the invention, the tumor of epithelial origin is an adenoma and / or a carcinoma.

[0034] In another preferred embodiment of the method of the invention, the location of the tumor of epithelial origin is the colon, rectum, lung, urinary bladder, breast, squamous or basal cells. In other words, the epithelial tumor is a colon tumor, a rectum tumor, a lung tumor, a bladder tumor, a breast tumor, a squamous cell tumor or a basal cell tumor. In the large intestine, colorectal tumors may be either adenocarcinomas or adenomas or premalignant polyps, in the urinary bladder the tumor may be transitional epithelial polyps with poor differentiation or manifest transition cell carcinomas, breast tumors may be or carcinomas ductal or acinar and skin carcinomas, the tumors can be either basaliomas or squamous cell carcinomas (also called squamous cell carcinoma or squamous cell carcinoma). In the lung, the tumor can be either squamous cell carcinoma or adenocarcinomas.

[0035] In a further preferred embodiment of the method of the invention, genetic abnormalities are determined by the loss of heterozygosity (LOH) of the NAV3 gene or a fragment thereof, where LOH of NAV3 indicates tumor progression.

[0036] In a further preferred embodiment of the method of the invention, genetic abnormalities of the NAV3 gene are determined in haploid, diploid and / or polyploid cells.

[0037] In a further preferred embodiment of the method of the invention, the tumor cells are stable microsatellite (SMS) or unstable microsatellite (MSI).

[0038] In a further preferred embodiment of the method of the invention, the tumor of epithelial origin is distinct from pancreatic carcinoma.

[0039] The present invention is also based on the use of chromosomal region 12q21.1-q21.31, specifically 12q21.2, the NAV3 gene or a fragment thereof, and / or markers in 12q21.1-q21.31 , specifically 12q21.2, associated with tumors of epithelial origin.

[0040] In a preferred embodiment, the markers in 12q21.1-q21.31 include D12S1684, D12S326, D12S1708 and /

or rs1852464.

[0041] In a preferred embodiment, the markers in 12q21.2 include D12S326 and / or rs1852464.

[0042] As used herein, the term "genetic anomaly" refers to the presence of a translocation, deletion, amplification, inversion or other defect in 12q21.1-q21.31, specifically in 12q21.2.

[0043] As used herein, the term "deletion" refers to the absence of a nucleotide or nucleotides and / or an exon or exons in the gene sequence whose absence negatively affects the function of the gene. The term also refers to the absence of the gene fragment, a gene or the chromosomal fragment that contains the gene.

[0044] As used herein, the term "other defect" refers to any genetic alteration, such as a substitution, an addition, polymorphism, insertion, inversion, etc., which is associated with tumors of epithelial origin.

[0045] As used herein, the term "loss of heterozygosity (LOH)" refers to the loss of the contribution of a single parent to a part of the genome of the cell. LOH can be considered as an event to reveal a mutant allele of a gene that can play a role in suppressing tumor formation. Thus, LOH is an important marker for tumor initiation or progression.

[0046] As used herein, the term "BLOH" refers to the LOH limit, which means that one of the alleles of the tumor sample has a signal reduction of 25% -39% compared to its corresponding normal .

[0047] As used herein, the term "translocation" refers to the transfer of chromosomal regions between non-homologous chromosomes.

[0048] As used herein, the term "amplification" refers to the gain of genetic material such as a gene fragment, a gene or the chromosomal fragment that contains the gene.

[0049] As used herein, the term "tumor" refers to an abnormal mass of tissue due to an abnormal excess of cell divisions or the lack of normal cell death. The tumors can be benign or malignant, that is, not cancerous or cancerous. Tumors include adenomas, carcinomas or polyps.

[0050] As used herein, the term "adenoma" refers to a non-cancerous tumor.

[0051] As used herein, the term "carcinoma" refers to a cancer of epithelial origin.

[0052] As used herein, the term "epithelial" refers to the cells that line the internal and external surfaces of the body.

[0053] As used herein, the term "tumors of epithelial origin" refers to tumors that originate from epithelial cells. Tumors of epithelial origin include tumors of the breast, colorectal, lung, urinary bladder, squamous cell, basal, prostate, gastric, esophagus and mouth / tongue.

[0054] Epithelial tumors originate from epithelium, a specific set of cells that cover organs and body surfaces. The epithelium can be simple, such as the epithelium of a layer of cells that covers part of the respiratory tract, ducts and ducts of the mammary glands or intestine, or it can be stratified, composed of several layers of cells, such as the one found in the upper layer of the skin or in the urinary bladder. The epithelium of the skin is keratinizing, which means that while the basal cells of the epidermis, which cover the skin are round and proliferate, the upper cells are flattened, do not divide and their cytoplasm is full of keratin fibers. The urinary epithelium, on the other hand, is not keratinizing but even in this case, the basally located cells are round, while the cells located closer to the surface are flattened and therefore, this type of epithelium is called transition.

[0055] As used herein, the term "indicating tumors of epithelial origin" means that the presence or high probability or possibility of epithelial tumors has been shown or described or tested or evidenced.

[0056] As used herein, the term "aggressive variant" refers to a cancer that grows rapidly and possibly metastasizes.

[0057] As used herein, the terms "fragment" or "functional fragment" refer to a part of the NAV3 gene, which is detectable by the methods of the invention such as LOH analysis or FISH methods.

[0058] As used herein, the term "gene product" refers to an mRNA, protein or any product obtained directly or indirectly from the gene.

[0059] The Neuron navigator 3 gene (NAV3 or POMFIL1) is a member of a newly identified family of human genes, which shows homology with unc-53, an axon guide gene of Caenorhabditis elegans (Maes et al. Genomics 80: 21-30, 2002). It also shares homologous sequences with human RAINB1 (retinoic acid inducible in neuroblastoma cells) a mammalian homologue of unc-53 (Merrill et al. PNAS

99: 3422-3427, 2002). In the prediction of the NAV3 structure it has calponin-like domains and SH3 binding sites suggestive of a function in cell signaling. NAV3 consists of 39 exons and its expression, based on the detection of mRNA, is largely restricted to brain tissue (Maes et al. Genomics 80: 21-30, 2002). It has been shown that NAV3 produces protein transcripts of different lengths and may be subject to tissue specific alternative splicing. Structurally NAV3 is a helicase and exonuclease, reminiscent of Werner and Bloom syndromes proteins with the function of maintaining chromosome stability (Coy JF et al. Gene 290: 73-94, 2002, Maes et al. Genomics 80: 21-30, 2002). Subcellularly, it has been reported that NAV3 is located in pre-nuclear complexes (Coy JF et al. Gene 290: 73-94, 2002) and could play a role in nuclear transport, kinephore formation and cell cycle control (Fahrenkrog B and Aebi U, Nat Rev Mol Cell Biol 4: 757-66, 2003). Therefore, NAV3 could be a non-classical haploinsufficient tumor suppressor (Sherr CJ, Cell 116: 235-46, 2004).

[0060] In the present invention, genetic abnormalities in 12q21.1-q21.31, specifically 12q21.2, were studied by LOH analysis for colorectal adenomas, carcinomas, lung cancers and urinary bladder cancer. Fluorescence in situ hybridization (FISH) was also used for colon tumors, breast cancer, basal cell carcinoma (BCC) and squamous cell carcinoma (SCC), and comparative genomic hybridization (CGH) for lung cancers in order of scrutinizing the chromosomal position 12q21.1-q21.31, specifically 12q21.2.

[0061] All microsatellite markers (D12S1684, D12S326, D12S1708), as well as the SNP marker (the intragenic NAV3 rs 1852464) showed LOH at 12q21.1-q21.31 in adenomas and colorectal carcinomas. In the urinary bladder cancer samples, at least LOH limit was detected with these four markers. The microsatellite markers also showed LOH in lung cancers. In addition, FISH revealed loss of 12q21 in colon tumors and both loss and gain of 12q21 in breast cancers, basal cell carcinoma and squamous cell carcinoma. CGH revealed loss of 12q21 in lung cancer. Thus, the loss or gain of NAV3 appears as a marker of tumors originating in the epithelia.

[0062] In addition, adenomas and colorectal carcinomas originating in the same patient showed NAV3 LOH suggesting that patients with adenoma will develop carcinomas through NAV3 LOH. Poor differentiation was observed in an adenoma with NAV3 LOH and the size of adenomas NAV3LOH tended to be larger than those without those with LOH.

[0063] We have now observed that chromosomal abnormalities, found in epithelial tumors, in fact occur in tumors that originate in all different types of epithelium. Thus, basaliomas (also called basal cell carcinoma or basal cell carcinomas) are made up of cells that are normally located in the most basal part of the epidermis. On the other hand, squamous cell carcinoma (also called squamous cell carcinoma or squamous cell carcinoma), is formed from the most distally located cells and this tumor often shows keratinization, a characteristic feature of keratinized cells. Breast carcinomas and colorectal carcinomas are examples of malignant tumors derived from the simple epithelium, usually having only one layer of cells, but even in this case, the original benign epithelium contains differentiated cell types, such as exocrine cells of the mammary gland , which secrete either milk or mucus, or mucus-secreting calciform cells in the intestinal epithelium.

[0064] Epithelial tumors can be benign, premalignant or manifestly malignant. We observe the chromosomal abnormality described in more detail in this application mainly in malignant tumors, carcinomas, but also in some of the premalignant conditions, such as large adenomas of the colon or rectum.

[0065] Because genetic abnormalities were associated with tumors of epithelial origin, the presence of these abnormalities indicates the initiation, progression and / or presence of tumors of epithelial origin or the development, progression and / or presence of carcinomas. Therefore, it is possible to diagnose or identify patients who have tumors of epithelial origin or carcinoma by detecting the presence of such aberrations in a biological sample. It is also possible to diagnose or identify patients whose tumors are likely to progress or develop or transform into an aggressive variant by detecting the presence of such aberrations. Biological samples from patients or suspect patients can be examined for the presence of such genetic abnormalities.

[0066] According to the method of the present invention, the presence or absence of genetic abnormalities can be detected from a biological sample by any known detection method suitable for the detection of translocations, deletions, insertions, etc. Such methods are readily recognized by those skilled in the art and include in situ fluorescence hybridizations, such as in situ multi-color fluorescence hybridizations, in situ multi-fluorine hybridization (MFISH), spectral karyotype (SKY), combined ratio marking. Binary (COBRA), color change karyotype (CCK). In comparative genomic hybridization (CGH), genetic changes are classified as gains and losses of DNA. CGH reveals a characteristic pattern that includes aberrations at chromosomal and subchromosomal levels. Conventional G-band techniques can also be used in cases where gross detection of gains, losses or translocations is considered sufficient. Preferable methods are those that are suitable for use in clinical laboratories.

[0067] According to a preferred embodiment of the present invention, which exploits the identification of the NAV3 gene in tumors of epithelial origin, the presence or absence of the NAV3 gene or an equivalent or a fragment thereof can be detected from a biological sample. by any known detection method suitable for detecting a gene expression (or copy number), that is, methods based on the detection of the number of copies of the gene (or DNA) and / or those based on the detection of expression products genetics (mRNA or protein). Such methods are readily recognized by those skilled in the art and include conventional methods of polymerase chain reaction (PCR), RT-PCR, in situ hybridizations, such as FISH, mRNA in situ hybridization, Northern analysis, Southern and Western analysis. , immunohistochemistry, and other immunoassays, such as ELISA. Preferable methods are those that are suitable for use in routine clinical laboratories.

[0068] According to another preferred embodiment of the present invention, which takes advantage of LOH analysis for the detection of anomalies of the NAV3 gene, deletion, gene conversion, loss of mitotic and chromosomal recombination can be detected. LOH in cancers can be identified by the presence of heterozygosity in a genetic locus in the germline of DNA and the absence of heterozygosity in the same locus in tumor cells.

[0069] According to another preferred embodiment of the present invention, which takes advantage of suitable markers for the detection of abnormalities of the NAV3 gene, the markers include any biological marker, such as microsatellite markers, SNP markers, any probe, primer or antibody associated with the NAV3 gene. There are numerous suitable methods for nucleic acid analysis to detect the presence of specific sequence variations such as polymorphisms, SNPs, insertions or deletions. Allelic variants can be discriminated for example by enzymatic methods, electrophoretic methods and physical methods. These methods include, for example, single chain conformation polymorphism (SSCP), heteroduplex analysis, fragment analysis, DNA sequencing, mini-sequencing, primer extension methods, microarrays, mass spectrometry and high resolution denaturing liquid chromatography (DHPLC). PCRs are frequently used in the analysis of sequence specific variations or are used in combination with the aforementioned methods.

[0070] In the method of the invention, the biological sample may be any suitable tissue sample, such as a biopsy of the epithelial tissue, a lymph node or a metastatic tumor lesion of any organ of the body or whole blood. The biological sample can be pretreated, if necessary, in an appropriate manner known to those skilled in the art.

[0071] In therapy, restoration of the normal function of the NAV3 gene can be used. This can be achieved by improving the expression of functionally homologous genes, by introducing an intact NAV3 gene or by using a modified form of the NAV3 gene or the antisense oligonucleotide against NAV3 in any technique currently available for gene therapy to prevent the progression of a proliferative disease. . In particular, the growth of tumor cells can be slowed down or even stopped by such therapy. These techniques include ex vivo and in situ therapeutic methods, the former comprising the transduction or transfection of an intact or altered NAV 3 gene (or its functional domains) in a recombinant form or peptide or as antisense oligonucleotides or in a vector for the patient, and the latter comprising inserting the altered gene or oligonucleotide into a carrier, which is then introduced into the patient. Depending on the disease to be treated, a temporary or permanent cure can be achieved. Alternatively, antibodies or monoclonal or humanized peptides binding to the NAV3 protein or to the generated fusion gene can be used as a result of the translocation to suppress the function of the altered NAV3 protein and therefore the growth of tumor cells can be slowed down. or even stopped. Antibodies against NAV3 could also be used to transport other agents, such as cytotoxic substances, to cancer cells that overexpress the NAV3 gene. Such agents could be used to specifically kill cancer cells.

[0072] Understanding genetic aberrations or chromosomal changes, especially those associated with tumor initiation will contribute to the early diagnosis of cancer and the treatment of patients. The present invention describes for the first time the role of LOH of NAV3 in epithelial tumors. The present invention also discloses that when LOH of NAV3 is observed in colorectal adenomas it is likely that said patient will also develop carcinomas through LOH of NAV3.

[0073] The detection of deletions or other defects of the NAV3 gene as described in the present invention, thus allows the earlier identification of patients with a higher risk of developing aggressive cancer and allows the effective prevention of cancer and the development of a new diagnosis and follow-up of carcinomas, such as colorectal or lung cancer. The discovery of genetic abnormalities of NAV3 in epithelial tumors also opens up new possibilities in the advancement of their therapies.

[0074] The following examples are given for further illustration of the invention.

[0075] It will be obvious to one skilled in the art that, as technology advances, the inventive concept can be applied in various ways. The invention and its embodiments are not limited to the examples described below, but may vary within the scope of the claims.

Example 1

a) Analysis of loss of heterozygosity (LOH) in NAV3, using microsatellite markers

[0076] The histology of the formalin-fixed and paraffin embedded tissue samples was verified by a histopathologist. Tumors, adenomas or normal areas were dissected to obtain a tissue ratio of normal pure carcinoma or adenoma or at least 50% proportion for DNA preparation according to a standard protocol. The paraffin sections were cut to a thickness of 10 µm and the DNA was purified following these standard protocols (Isola et al. Am J Pathol 145: 1301-1308, 1994).

[0077] LOH analyzes were performed for the NAV3 gene. Three microsatellite markers were chosen covering the locus of the NAV3 gene in 12q21.1-q21.31 and surrounding the gene in both directions (physical distances between the loci in mega-bases are indicated in brackets according to http: //www.ensembl. org): pter D12S1684- (0.8 Mb) -D12S326

(0.2 Mb) -NAV3- (3.8 Mb) -D12S1708 qter. DNA samples were amplified by polymerase chain reaction (PCR) using the following primers: D12S1684F 5'cctgcatgcctcagttatga3 ', D12S1684R 5'aacaagccataccagtcagg3' D12S326F 5'accaggctcccctaaaagtg3 'D12S326R 5'agaatgaccagacccacagg3', D12S1708F 5'gggaacttatgtcaaggctagga3 ' D12S1708R 5'gatctagtgctcaagaggttttcaa3 '. PCR reactions were performed in a 25 µl reaction volume containing 75-150 ng of template DNA, GeneAmp 10x PCR buffer (Applied Biosystems), 0.2 mM dNTP Mix (GE Healthcare Biosciences Ab), 0.8 umol of each primer, and 1.5 U of AmpliTaq polymerase (AB). The following PCR cycles were used for amplification: 94 ° C for 3 minutes, 35 cycles of denaturation at 94 ° C for 30 seconds, annealed at a temperature of 60 ° C for 30 seconds, and extension at 72 ° C for 45 seconds. The final extension was at 72 ° C for 5 minutes. The forward primers were fluorescently labeled with FAM and the PCR fragments ran on the ABI3730 sequencer / genotyper and the results were analyzed using GeneMapper v3 software (Applied Biosystems).

b) Analysis of loss of heterozygosity (LOH) of NAV3, using the extension of a single nucleotide primer, SnuPE.

[0078] The DNA was prepared as before.

[0079] A non-radioactive method was used to quantify the relative expression of the two NAV3 alleles in heterozygous patients for the A / G coding polymorphism (rs1852464) in exon 19 of the NAV3 gene. The heterozygosity for rs1852464 is up to 0.493 in Caucasian / European so it is a very useful marker. The SNuPE extension reaction is based on the incorporation of a single ddNTP that is selected to allow differential extension of an annealed labeled primer near the polymorphic site.

[0080] The corresponding tumor and normal genomic DNA samples from the same individuals were amplified by PCR using primers rs1852464F 5 'CCTGCTATTTTCATCTTTCAAGC 3' and rs1852464R 5 'GGCTGGGATGCTGTTTGAG 3' to obtain a 130 bp PCR fragment containing A / polymorph

G. The PCR reactions were performed in a 25 µl reaction volume containing 60-100 ng of template DNA, GeneAmp 10x PCR buffer (Applied Biosystems), 0.2 mM dNTP Mix (GE Healthcare Biosciences Ab), 0 , 8 µM of each primer, and 1.5 U of AmpliTaq polymerase (AB). The following PCR cycles were used for amplification: 94 ° C for 3 minutes, 35 cycles of denaturation at 94 ° C for 30 seconds, annealing temperature 56 ° C for 30 seconds, and extension at 72 ° C for 45 seconds. The final extension was at 72 ° C for 5 minutes. The PCR product is subsequently purified by exonuclease I (10 U / µl) and SAP (shrimp alkaline phosphatase, 2 U / µl) (ExoSAP-IT, Amersham Biosciences) according to the manufacturer's instructions.

[0081] PCR extension was performed using a 5''GATGCTGTTTGAGCGCATCATGCTGGGCCC 3 'extension primer and a nucleotide mixture containing the ddCTP termination nucleotide instead of the normal cytosine. PCR extensions were performed in a 20 µl reaction volume containing 2 µl of purified PCR product, Buffer Thermo Sequenase Reaction (GE Healthcare Biosciences Ab), 50 µM of each dATP, dGTP, dTTP, and ddCTP (GE Healthcare Biosciences Ab ), 0.2 µM of SNuPE, and 6.4 U of Thermo Sequenase DNA Polymerase (GE Healthcare Biosciences Ab). The following PCR cycles were used for extension reactions: 95 ° C for 2 minutes, 25 cycles of denaturation at 95 ° C for 20 seconds, annealing temperature of 56 ° C for 20 seconds, and extension at 70 ° C for 40 seconds The final extension was at 70 ° C for 10 minutes. In this way, extension products of: 43 bp and 49 bp were obtained depending on whether G or A are present in the mold. The products of the primer extension reaction were carried out in ABI3730 sequencer / genotyper and the results were analyzed using GeneMapper v3 software (Applied Biosystems).

c) Interpretation of LOH results

[0082] A sample was classified as showing LOH, if one of the alleles in the tumor sample had a 40% or more signal decrease compared to its corresponding normal. There is a great consensus in the literature to use this level of cut, since it is specific and sensitive enough if the tumor percentages are more than 50%, which was effectively the minimum in this study. A signal reduction of up to 23% was observed in normal tissues (eg, Cleton-Jansen et al., Cancer Res 61: 1171, 2001) leaving a gray area between 25% 39% signal reduction. These were considered here as LOH "BLOH" limit according to published literature. (Cleton-Jansen et al, Cancer Res 61: 1171, 2001, Vauhkonen et al. Gastric Cancer 8: 238-244, 2005 and Kim et al. Virchows Arch 443: 491-500, 2003) (Figures 1-3).

Example 2

a) NAV3LOH analysis in series of colorectal tumors

[0083] Three series (designated here A, B and C) were examined:

Series A: Consecutive series of 56 colorectal carcinomas and 21 adenomas (total number = 77) of 59 patients. Adenomas and carcinomas that originate in the same patients were available in 10 of the 59 cases. Judging only by instability in three microsatellite loci examined on chromosome 12, all adenomas were MSS while 14 of the 56 carcinomas showed MSI on one or more marker (s) (25%).

Series B: Well characterized series of familial colorectal tumors that tested negative for a germline mutation in a repair gene. It consisted of 18 MSS carcinomas, 1 MSI carcinoma and 4 MSS adenomas (total number of tumors = 23). This series has been previously characterized by frequent molecular changes in colorectal carcinogenesis.

Series C: Well characterized series of MSI colorectal cancers originating in HNPCC families with the MMR gene tested in germ mutations (total number = 24 tumors).

[0084] The corresponding normal samples were mostly blocks of normal mucosa or, when these were not available, of other normal body tissues available from patients (eg lymph nodes, appendix or blood).

[0085] The instability of microsatellites, MSI, refers to the variation of the length in the entire genome of microsatellites, which are short stretches of tandem nucleotides in DNA, as a result of a failure to repair DNA mismatches , while stable microsatellites, MSS, refer to constant microsatellite length, in other words, lack of microsatellite length variation caused by a failure to repair DNA mismatches.

[0086] LOH analysis was performed as described in Example 1.

[0087] The results obtained in all the series examined are summarized in Table 1. Table 2 shows the results for each marker tested separately. It is of special interest that, using the intragenic SNV NAV3 rs1852464 SNP as a strictly specific marker for LOH in exon 19 of NAV3, the data available so far show a frequency of 7/20 (35%) for the loss of NAV3 on this site in MSS tumors. These 7 tumors include 6 already involved by microsatellite markers, while in only one case BLOH was seen in SNP rs1852464, but not in microsatellite loci of flanking areas. Of the 31 tumors that showed LOH / BLOH by microsatellite markers in series A, 23 were non-informative or are still pending, leaving 8 cases for comparison with SNuPE. Of these 8 cases, 6 showed agreement with the loss of NAV3 in the SNP rs1852464.

2b) LOH analysis of adenomas and colorectal carcinomas originating in the same patient.

[0088] Adenomas and carcinomas originating in the same patients were available in 10 of the 59 cases in the A series. The analysis was performed as described in Example 1.

[0089] In 4 of these 10 patients the adenomas showed LOH or BLOH and in 3 of these 4 cases the coincident carcinomas were informative and mostly have a similar pattern of LOH / BLOH (Table 3). This suggests that when NAV3LOH is observed in adenomas it is likely that said patient will also develop carcinomas through

10 of NAV3 LOH.

2c) Morphological and histological characteristics of colorectal tumors that have NAV3 LOH

[0090] The presence of LOH in adenomas tended to be associated with cases that, by standard criteria, are considered at risk for developing cancer. Of the five adenomas with LOH, the average diameter was more than 9 mm and therefore, close to the critical level of 1 cm, while in the other five cases without LOH, the average diameter was less than 6 mm (Table 4 ). On the other hand, in adenomas with LOH, one in five showed poor differentiation, while the degree of differentiation in negative LOH cases was always high.

Example 3

Deletion of NAV3 detected by FISH in colorectal tumors.

Samples

[0091] Samples for FISH analysis (fluorescent in situ hybridization) were prepared from 18 randomly selected cases of colorectal carcinoma series A (described in Example 2a) and seven cases with skin samples obtained from of patients suffering from chronic eczema, a non-malignant inflammatory lesion as a negative control. All tissue samples were routinely processed by formalin fixation and embedded in paraffin.

Preparation of the nuclei from the tissue embedded in paraffin

[0092] Sections of 50 µm were cut from formalin-fixed tissue and embedded in paraffin. After deparaffinization each section was digested with protease XXIV (Sigma) at 37 ° C for 30 minutes. After enzymatic digestion, the nuclei were sedimented by centrifugation at 2000 g for 10 minutes and diluted in

0.1 M Tris-HCl, 0.07 M NaCl, pH 7.2. The nuclear suspension was pipetted onto a slide and dried overnight at room temperature. The slides were fixed with 0.01% paraformaldehyde for 4 minutes at room temperature, followed by dehydration with classified ethanol (70%, 85%, 100%). The slides were stored at -70 ° C.

Probe marking with Fluorescein-12-dUTP and Alexa-594-5-dUTP

[0093] Three bacterial artificial chromosome (BAC) clones specific for NAV3 DNA (RP11-494K17, RP1136P3 and RP11-136F16; Research Genetics Inc., Huntsville, AL, USA) were labeled with Alexa-594-5-dUTP (Invitrogen) ) and the chromosome 12 centromere probe (pA12H8) was labeled with fluorescein-12-dUTP (Roche) using notch translation ((Hyytinen E et al. Cytometry, 16: 93-99, 1994). For each labeling reaction 1-2 µg of DNA was used in a total reaction volume of 50 µl, 4 µl of each labeled BAC probe and centromere were mixed with human DNA COT1 (Invitrogen) and precipitated with sodium acetate and ethanol. Precipitated probes were diluted in hybridization buffer (15% w / v dextran sulfate, 70% formamide in SSC, pH 7.0) and denatured at 76 ° C for 10 minutes.

FISH with nuclei extracted from paraffin embedded tissue

[0094] The slides were pretreated with 1 M sodium thiocyanate at 80 ° C for 5 minutes and washed three times with 2 x SSC for 5 minutes. After washing the slides they were treated with 50% glycerol, 0.1 x SSC at 90 ° C for 6 minutes, with 2 x SSC for 3 minutes and with distilled water three times, for 2 minutes. The slides were denatured in 70% formamide, 2 x SSC at 87 ° C for 7 minutes. After denaturation the slides were dehydrated with classified ethanol (70%, 85%, 100%) and were enzymatically digested with proteinase K (Sigma; 8 µg / ml in 20 mM Tris-HCl, pH 7.5, 2 mM CaCl2) at +37 ° C for 7 minutes. After digestion the slides were dehydrated and 10 µl was pipetted. of the mixture of denatured probes on the slides. Hybridization was carried out overnight at 37 ° C. The slides were washed three times with 1.5 M urea, 0.1 x SSC at 45 ° C for 10 minutes, once with 0.1 x SSC for 10 minutes and 4 x SSC for 5 minutes, followed by three washes with PN buffer (0.1 M sodium phosphate buffer, pH 8.0, 0.1% NP-40). Finally, the slides were washed with distilled water, air dried and mounted on

5 Vectashield mounting media with DAPI (Vector).

Analysis and results

[0095] The slides were analyzed using Olympus BX 50, Tokyo, Japan, equipped with 8300 series filter and 83103x triple band exciter (Chroma Technology Corp., Brattleboro, Vermont, USA) and a cooled CCD camera (Sensi Cam, PCO, Computer Optics, Kelheim, Germany) next to a computer (Dell GX280, Limerick, 10 Ireland) with Image Pro Plus software (Media Cybernetics, Silver Spring, MD, USA). Fifty cells from each case were analyzed and grouped as normal if they had two centromere markers for chromosome 12 and two for NAV3 cells. Polyploid cells have three or more centromeric markers. The NAV3 deletion was defined when the number of centromere markers was greater than the number of NAV3 markers. A few cells had a centromere marker and a NAV3 marker; this was taken as an artifact

15 technical The results (Table 5) clearly show that colon carcinoma samples have a high frequency of polyploidy and that these cells often show deletion of one or more of the NAV3 alleles.

Example 4

NAV3 LOH analysis of lung tumors

[0096] Archived samples embedded in paraffin from five patients with lung cancer without

5 no evidence of another organ involved or other concomitant cancer. Three of the lung cancer samples were SCLC and two squamous cell carcinomas. Microdissection and PCR amplification of the lung cancer cell samples and their corresponding normal lung tissue samples were performed according to the following protocol.

[0097] 5 µm sections of the samples were cut using a microtome and mounted on a membrane

10 thin 1.35 µm polyethylene (P.A.L.M. Microlaser Technologies, Bemried, Germany), attached to a slide. The tissue sections were then dewaxed and stained with hematoxylin as described above (Stoecklein et al Am J Pathol 161: 43-51, 2002). Hematoxylin-eosin staining for morphological control was done according to the standard protocol. Areas of malignant cells covering 200,000 µm2 were microdissected by laser capture using the P.A.L.M. Laser-Microbeam (P.A.L.M. Microlaser

15 Technologies). Subsequently, a proteinase K digestion was carried out and the DNA was amplified with SCOMP as described above. (Klein et al Proc Natl Acad Sci USA 96: 4494-9, 1999 and Stoecklein et al Am J Pathol 161: 43-51, 2002). The amplification success was assayed by PCR for microsatellite markers D5S500 and D17S1161, as described above (Klein et al Proc Natl Acad Sci USA 96: 4494-9, 1999 and Stoecklein et al Am J Pathol 161: 43-51, 2002).

[0098] The five cases of lung cancer were successfully analyzed for LOH according to the method described in Example 1a. Of these five lung cancers, one was non-informative for the three markers that were used, however the loss of heterozygosity was found in two of the other four cases (Table 6).

Example 5

CGH analysis of lung tumors

[0099] Lung cancer samples from twelve patients were used for CGH. These twelve patients were also diagnosed with CTCL.

[0100] CGH was performed in accordance with the protocol published by Klein et al. 1999 with the modifications described by Stoecklein et al. 2002 (Klein et al Proc Natl Acad Sci USA 96: 4494-9, 1999 and Stoecklein et al Am J Pathol

161: 43-51, 2002). Briefly, microdissected DNA and digested with proteinase K was digested with restriction enzyme Mse I (BioLabs) resulting in DNA fragments with an average length of 256 bp, adapters were ligated to the 5 'protrusions, and DNA fragments were amplified by polymerase chain reaction. The amplified DNA was then labeled with digoxigenin-dUTP (Roche) and similarly aliquots of reference DNA obtained from peripheral blood mononuclear cells of healthy volunteers with biotin-dUTP (Roche) were processed. The labeled probes were hybridized on normal male metaphase slides for 2-3 nights. After post-hybridization washes, the metaphases were examined under a fluorescence microscope and three digital color images were captured using an epifluorescence microscope (Axioplan imagining 2, Carl Zeiss AG, Oberkochen, Germany) equipped with a CCD camera using statistical limits for green to red ratios to determine the gains and losses of the number of copies of DNA. Eight to twelve metaphases were included in the analysis for each case. As an internal control, normal male and female DNA were cohibited and only differences in sex chromosomes were identified.

[0101] In the tumor cells of a lung cancer patient, the loss of 12q21 was demonstrated by CGH (Figure 4). The karyotype of the patient with SCLC and CTCL represents typical changes in SCLC: losses of 3p, 5q, 8p, 10q, and 13q, as well as gains of 5p, and 9q. Some other typical SCLC aberrations (17p loss, and 8q gain) are absent. Characteristic findings of CTCL for example, include losses of 10q / 10, and 13, and gains of 4q, 7, 17q / 17, and 18, which can be demonstrated in this case. Interestingly, the loss of 12q21 was also evident.

Example 6

NAV3 deletions in urinary bladder cancer

Tissue samples

[0102] Samples from 16 patients diagnosed with carcinoma of the transitional epithelium of the urinary bladder were selected for the study. The samples were routinely fixed in neutral formalin and embedded in paraffin. 1-3 sections 50 microns thick were cut and the cores were isolated as described in Example 3, page 18, second paragraph.

Probe marking

[0103] Two clones of bacterial artificial chromosomes (BAC) specific for NAV3 DNA (RP11-36P3 and RP11136F16; Research Genetics Inc., Huntsville, AL, USA) were labeled with Alexa-594-5-dUTP (Invitrogen) and probe of the chromosome 12 centromere (pA12H8; American Type Cell Culture) was labeled with Alexa488-5-dUTP (Invitrogen) using notch translation (Hyytinen et al. 1994). 50-75 ng of each labeled BAC and 30 ng of the centromere probe were mixed with 1 µg of human COT1DNA (Invitrogen) and precipitated with sodium acetate and ethanol. The precipitated probe mixture was diluted in 10 µl of hybridization buffer (15% w / v dextran sulfate, 70% formamide in 2 x SSC, pH 7.0).

Fluorescence in situ hybridization

[0104] Slides with cores were pretreated with 1 M sodium thiocyanate at 80 ° C for 5 minutes and washed three times with 2 x SSC for 5 minutes at room temperature. After washing, the slides were treated with 50% glycerol, 0.1 x SSC at 90 ° C for 6 minutes, with 2 x SSC for 3 minutes and with distilled water three times, for 2 minutes. The slides were enzymatically digested with proteinase K (Sigma; 8 µg / ml in 20 mM Tris-HCl, pH 7.5, 2 mM CaCl2) at + 37 ° C for 8 minutes. After dehydration and air drying, the probe mixture was pipetted onto the slides and the slides were denatured for 6 min at 85 ° C on a hot plate. Hybridization was carried out for 48 hr. at 37 ° C. The slides were washed three times with 1.5 M urea, 0.1 x SSC at 47 ° C for 10 minutes, once with 0.1 x SSC for 10 minutes at 47 ° C, followed by three washes with PBS, 0.1% NP-40 at room temperature. Finally, the slides were washed with distilled water, air dried and mounted on Vectashield mounting medium with 4 ′, 6-diamino-2 phenylindole dihydrochloride (DAPI; Vector).

[0105] The FISH results were evaluated using an Olympus BX51 microscope (Tokyo, Japan) equipped with a 60X oil immersion lens and a triple bandpass filter for simultaneous detection of Alexa488, Alexa594 and DAPI (Chroma Technology Corp. , Brattleboro, VT, USA). 200 nuclei of each case were analyzed and the nuclei were grouped as normal if they had two markers for the chromosome 12 centromere and two for the NAV3. Polyploid nuclei had three centromere markers. The NAV3 deletion was defined when the number of centromere markers was greater than the number of NAV3 markers and NAV3 amplification was defined when the number of NAV3 markers was greater than the centromere markers. The analyzes were made without knowing the diagnosis or the identity of the sample by two independent analyzers.

NAV3LOH analysis using microsatellite markers

[0106] For the LOH (loss of heterozygosity) test, DNA from both normal patient tissue and tumor samples was extracted from sections embedded in 10 µm thick paraffin following standard methods (Isola et al. Am J Pathol 145: 1301-1308, 1994). The analysis was performed as described in Example 1a.

Results

[0107] The results related to LOH (and LOH limit; BLOH), as well as the status of the number of copies of NAV3 in the FISH trial are shown in Table 7. 7 out of 17 samples of urinary bladder cancer (40 %) showed LOH / BLOH with at least one of the markers used in the study. 20 of 64 (30%) alleles were homozygous and could not be analyzed using the LOH method. In the FISH analysis, 3 out of 15 samples (20%) showed deletion of NAV3. Duplication of the NAV3 gene (amplification) was observed with 20% of the samples. One of the samples had both deletion and amplification of NAV3. Two samples were not analyzed for changes in the number of NAV3 copies due to the poor quality of the sample.

Example 7

Deletion of NAV3 in breast cancer

5 tissue samples

[0108] The presence of NAV3 deletions in breast cancer was studied by selecting sentinel lymph nodes from four breast cancer operated patients as study material. Biopsies were obtained from fresh lymph nodes or frozen material and stored at -70 ° C until used for NAV3FISH analysis.

10 Probe marking

[0109] Two clones of bacterial artificial chromosomes (BAC) specific for NAV3 DNA (RP11-36P3 and RP11136F16; Research Genetics Inc., Huntsville, AL, USA) were labeled with Alexa-594-5-dUTP (Invitrogen) and probe of the chromosome 12 centromere (pA12H8; American Type Cell Culture) was labeled with Alexa488-5-dUTP (Invitrogen) using notch translation (Hyytinen et al. 1994). 50-75 ng of each BAC marked and 10 ng of the

The centromere probe was mixed with 1 µg of human COT1DNA (Invitrogen) and precipitated with sodium acetate and ethanol. The precipitated probe mixture was diluted in 10 µl of hybridization buffer (15% w / v dextran sulfate, 70% formamide in 2 x SSC, pH 7.0).

Fluorescence in situ hybridization

[0110] The slides were fixed with 4% paraformaldehyde in PBS for 1 minute on ice. After

20 washings with PBS, the slides were digested enzymatically with proteinase K (Sigma; 0.66 µg / ml in 20 mM Tris-HCl, pH 7.5, 2 mM CaCl2) at + 37 ° C for 6 minutes. After dehydration and air drying the

Probe mixture was pipetted onto the slides and the slides were denatured for 5 min at 75 ° C on a hot plate. Hybridization was carried out for 24 hr at 37 ° C. The slides were washed three times with 1.5 M urea, 0.1 x SSC at 47 ° C for 10 minutes, once with 0.1 x SSC for 10 minutes at 47 ° C, followed by three washes with PBS, 0.1% NP -40 at room temperature. Finally, the slides were washed with distilled water, air dried and mounted on Vectashield mounting medium with 4 ′, 6-diamino-2 phenylindole dihydrochloride (DAPI; Vector).

[0111] FISH results were evaluated using an OlympusBX51 microscope (Tokyo, Japan) equipped with a 60X oil immersion lens and a triple bandpass filter for simultaneous detection of Alexa488, Alexa594 and DAPI (Chroma Technology Corp., Brattleboro, VT, USA). All cancer cells obtained from the sample were analyzed in each case and the cells were grouped as normal if they had two markers for the chromosome 12 centromere and two for NAV3. Polyploid cells had three or more centromere markers. The NAV3 deletion was defined when the number of centromere markers was greater than the number of NAV3 markers and NAV3 amplification was defined when the number of NAV3 markers was greater than the centromere markers. The analyzes were made without knowing the diagnosis or the identity of the sample by two independent analyzers.

Results

[0112] The results are shown in Table 8 and in Figures 5a and 5b. Four cases were analyzed and all cancer cells found from the samples were counted for each case. The cells were grouped as normal if they had two markers for the chromosome 12 centromere and two for the NAV3. Polyploid cells had three or more centromere markers (> 2ce). Cells with suppressed NAV3 contained a greater number of centromere markers than NAV3 markers (cen> nav) and cells with amplified NAV3 had a greater number of NAV3 markers than centromere markers. (cen <nav).

[0113] All four cases showed cells that contained an abnormal number of copies of centromeres and / or NAV3. In addition to the deletion of NAV3 (less than two copies of the NAV3 signal in FISH), the number of cells with polyploidy (more than two copies of the centromere of chromosome 12) and amplification of NAV3 (more than two copies of the signal from NAV3) were analyzed and recorded. In one case (case number 2) polyploidy with less extensive NAV3 deletion was observed, while in the remaining three cases polyploidy was associated with the loss of an NAV3 allele.

[0114] In Figure 5a, the black bars indicate the amount of polyploidy in the cells studied and the gray bars indicate the amount of cells with suppressed NAV3. The results are shown as a percentage of the total cell count. In Figure 5b, typical cancer cells show a deletion of NAV3. The green signals indicate the centromeres and the red signals the copies of NAV3.

[0115] It should be noted that while it was difficult or even impossible to find malignant breast cancer cells in lymph node biopsy using only routine light microscopy, this task became very simple after marking the NAV3 alleles with the probe of specific fluorescence. Even individual cells, in the middle of thousands of normal lymphocytes, could be identified with clear changes in the number of copies and, as a rule, these cells also showed the atypical characteristic nuclei of cancer cells. These abnormal cells have been extremely difficult to identify with light microscopy.

Example 8

Changes in the number of copies of NAV3 in basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) Tissue samples

5 [0116] Samples from 14 patients diagnosed with basal cell carcinoma and 5 patients with squamous cell carcinoma were selected for the study. The samples were routinely fixed in neutral formalin and embedded in paraffin. 1-3 sections 50 microns thick were cut and the cores were isolated as described in Example 3, page 18, second paragraph.

Fluorescence in situ hybridization

[0117] Probe labeling and FISH analysis were carried out as described in example 6.

Results

[0118] The results of NAV3FISH analysis of BCC and SCC samples are shown in Table 9. 3 of 14 (21%) of BCC samples showed deletion of NAV3 with a 6-11% elimination range of total cell count . In addition, three of the samples (21%) showed a doubling in the NAV3 gene (amplification interval 8

15 11%). One in five (20%) SCC samples showed deletion of NAV3 (12%).

Example 9

Changes in the number of copies of NAV3 in colon cancer

NAV3FISH samples and analysis

[0119]

a) Two MSS type colorectal adenocarcinoma cell lines [CCL-230 (SW403) and CCL-228 (SW480)] and two normal colon cell lines [CRL-1539 (CCD-33Co) and CRL-1541 (CCD-112CoN) ] were purchased from the American Type Culture Collection (LGC Promochem AB, Boras, Sweden) and grown at 37 ° C following the manufacturer's instructions. Superfrost Plus 50000-100000 cells were centrifuged on a slide using a cytocentrifuge. The slides were air dried, fixed with acetone and stored at -70 ° C until used for NAV3FISH analysis. Probe labeling and FISH analysis were similar to breast cancer samples in Example 7.

b) For metaphase preparations, the CCL-248, SW403, SW480, RKO, DLD, HCA7, LIM1215 and LoVo (American Type Culture Collection, LGC Promochem AB, Boras, Sweden) cell lines were grown following the ATCC Instructions .

The cells were treated with hypotonic KCl solution, fixed with acetone-methanol (1: 3) and a drop of the cell suspension was placed on a slide to make conventional chromosome preparations.

DNA purified from pA12H8 (centromere 12, ATTC plasmid, purified as above or according to Karenko L et al. J Invest Dermatol 108: 22-29, 1997) and purified DNA from RP11-136F16 and BAC RP11-36P3 (Karenko L et al Cancer Res. 65: 8101-8110, 2005), were marked by translation of notches with FITC-dUTP (NEN Life Science Products, Inc, Boston, MA USA), Alexa-594-dUTP (Molecular Invitrogen Probes, Leiden, Netherlands), biotin-dATP (Gibco BRL, Gaithersburg, MD, USA) or digoxigenin-dUTP (Roche, Mannheim, Germany). The centromere probe (for example, 1-5 ng) labeled with FITC or biotin and one or two BAC probes were mixed and precipitated by adding 1/10 volumes of 3M sodium acetate and 2 x volumes of 100% ethanol , and centrifuged. The supernatant was discarded, the sediment was allowed to dry, after which the DNA was dissolved in a mixture consisting of 50% formamide, and 10% dextran sulfate, 2 x SSC, pH 7 and, optionally, Cot-1 DNA (for example, 125ng, Gibco BRL, Gaithersburg, MD, USA), called here mixing probes. The target metaphases were denatured on a slide for 2 to 3 minutes in 70% formamide / 2 x SSC solution (pH 7.0) at 70-73 ° C, and dehydrated in 70%, 85%, and 100% ethanol, and were treated with proteinase K (1 µg / ml, Sigma Chemical Co., St. Louis, MO, USA) in 20 mM Tris / 2mM CaCl2 buffer (pH 7.5) for 7.5 minutes at 37 ° C, and They became dehydrated as before. The probe mixture was denatured for 5 minutes at 70 ° C, and placed on pre-treated slides on a hot plate (37 ° C), sealed with a rubber Cement coverslip (Starkey Chemical Co, LaGrange IL, USA) and allowed to hybridize in a humid chamber (37 ° C) for 2 to 3 days. The slides were washed 3 times with 50% formamide in 2 x SSC, pH 7, 4 x SSC, and 0.1 x SSC, all at 45 ° C, and with 4 x SSC, 2 x SSC and PBS at room temperature. After post-hybridization washes, the biotinylated probe was visualized with avidin-FITC (green, Vector Laboratories, Burlingame, CA, USA) and the digoxigenin labeled probe was visualized with rhodamine-conjugated sheep anti-digoxigenin antibody ( Red, Roche, Mannheim, Germany). The slides were counterstained with DAPI and mounted in Vectashield (both from Vector Laboratories, Burlingame, CA, USA).

Air-dried preparations were fixed with 0.1% paraformaldehyde and dried in ethanol series (70%, 85%, 100%).

The metaphases were photographed with a UV microscope (Axioplan imagining 2, Zeiss, Germany) and analyzed using the Isis MetaSystems GmbH software with the MFISH module program.

c) Samples of 36 patients diagnosed with MSS type colorectal adenocarcinoma, 14 patients with MSI type colorectal adenoma and 19 patients with tubular adenoma were selected for the study. In addition, 58 normal samples of normal colon mucosa were included in the study as reference material. The samples were routinely fixed in neutral formalin and embedded in paraffin. 1-3 sections 50 microns thick were cut and the nuclei were isolated as described in Example 3. The NAV3 specific FISH test was performed as described in Example 6.

Results

[0120]

a) The analysis of the FISH results of interface cells of colon cancer cell lines (SW 403 and SW480) are shown in Table 10. Both cancer cell lines showed dominant deletion type of 3 centromeres 2 NAV3 in almost all The cells studied. Normal colon cell lines showed no alterations in the copy number of the NAV3 gene.

b) The analysis of the FISH results of metaphase cells of colon cancer cell lines (CCL-248, TS 403, SW480, RKO, DLD, HCA7, LIM1215 and LoVo) are shown in Table 11. The NAV3 deletion It was detected in the vast majority of metaphase cells in two MSS cell lines (CCL-248, SW 403). Also the RKO cell line showed abundant deletions of NAV3. Many of the NAV3 amplifications were detected in the DLD cell line (MSI). Also the SW480 (SMS) line showed more centromere signals than NAV3 signals. Some deletions of NAV3 were detected in the HCA7 cell line.

c) The NAV3FISH trial with nuclei extracted from patient samples embedded in paraffin showed changes in the number of copies of NAV3 in 31% of MMS colorectal adenocarcinoma samples, 7% of MSI-type colorectal adenocarcinoma samples (1 sample of 14) and in 16% of adenoma samples

15 tubular The results are shown in Table 12. Figure 6 shows the comparison of the NAV3 FISH results of samples of normal colon and MSS type colorectal adenocarcinoma. Cancer cells are different from normal colon mucosa cells in terms of polyploidy and copy number of NAV3.

Claims (12)

1.-An in vitro method of predicting tumor initiation, tumor progression and / or carcinoma, characterized by the detection of the presence or absence of genetic abnormalities in 12q21.2 in a neuron navigator 3 gene (NAV3) or a fragment thereof, indicating the presence of said genetic abnormalities an initiation or progression of tumors of epithelial origin and / or carcinoma in a biological sample. 2.-An in vitro method of identifying an individual with the potential to develop carcinoma of epithelial origin, the method comprising the detection of genetic anomalies in 12q21.2 in a neuron navigator 3 (NAV3) gene or a fragment thereof, indicating said genetic anomalies tumors of epithelial origin. 3.-An in vitro method to predict the progression of carcinomas of epithelial origin and / or their transformation to an aggressive variant, characterized by the detection of genetic abnormalities in 12q21.2 in a neuron navigator 3 (NAV3) gene or a fragment thereof, where abnormalities indicate the probability of developing a carcinoma. 4.-A method according to any preceding claim, characterized in that the tumor of epithelial origin is an adenoma and / or a carcinoma. 5.-A method according to any preceding claim, characterized in that the tumor of epithelial origin is in the colon, rectum, lung, urinary bladder, breast, or in squamous or basal cells. 6. A method according to any preceding claim, characterized in that the genetic abnormalities are determined by fluorescence in situ hybridization (FISH). 7. A method according to claims 1-6, characterized by the determination of the loss of heterozygosity (LOH) of the NAV3 gene or a functional fragment thereof, wherein the LOV of NAV3 is indicative of tumor progression. 8. A method according to claims 1-7 characterized in that the genetic abnormalities of the NAV3 gene are determined in haploid, diploid and / or polyploid cells. 9. A method according to any preceding claim, characterized in that the tumor cells are stable microsatellites or unstable microsatellites. 10. An in vitro use of the NAV3 gene or a fragment thereof to predict tumor initiation, tumor progression and / or carcinoma, indicating genetic abnormalities of NAV3 epithelial tumors. 11.-An in vitro use of genetic markers in 12q21.2 for the prediction of tumor initiation, tumor progression and / or carcinoma, characterized by the detection of the presence or absence of NAV3 genetic abnormalities, indicating said tumor genetic abnormalities of epithelial origin. 12. A use according to claim 11, characterized in that the genetic markers are D12S326 and / or rs1852464.