WO2008058305A1 - Nucleic acid promoter - Google Patents

Abstract

The present invention relates to a nucleic acid promoter comprising a sequence having at least 70% identity to SEQ ID No. 1 or a functional fragment thereof, or a sequence which hybridizes thereto under stringent conditions.

Description

Nucleic Acid Promoter

The present invention relates to nucleic acid sequences having transcriptional regulatory properties.

Mitochondrial alternative oxidases (AOX or AOD) are key enzymes for a shortcut to the standard respiratory pathway in plants, many fungi and yeasts. These terminal oxidases directly transfer electrons from the mitochondrial ubiquinol pool to oxygen. This allows respiration even in presence of complex III and IV inhibitors like antimycin A or cyanide. The resulting free energy gets released as heat. In contrast to the cytochrome c oxidase, which is the terminal oxidase of the standard respiratory pathway, alternative oxidase does not pump electrons through the mitochondrial membrane. Thus the supply of small metabolic intermediates by the central metabolic pathways gets uncoupled from cellular energy production. Respiratory ATP production then relies on the activity of complex I. Cyanide resistant respiration is common among Crabtree-negative yeasts, which are not capable of aerobic fermentation.

The presumed biological functions of alternative oxidases in different organisms seem to be as diverse as the respective modes of induction. For example, osmotic stress, chilling, wounding, pathogen attack, treatment with H₂O₂ or inhibitors of the main respiratory chain, such as cyanide and antimycin A, induce alternative respiration. There is substantial experimental support describing the present-day role of alternative oxidase as protector of the cell from reactive oxygen species or to provide some metabolic . flexibility. It is generally considered to allow control of ATP synthesis to maintain growth rate homeostasis and an ongoing turnover of the TCA cycle under a high energy charge. The alternative oxidase activity allows for unrepressed glycolysis and TCA cycle turnover, which, e.g., in turn, in the case of Aspergillus niger WU-2223L, contributes to the high productivity of ^' extracellular citric acid.

The structure and function of alternative oxidases from plants and fungi have been studied intensively for a few decades. However, no stable and active form of the enzyme has been purified so far.

In Pichia pastoris, as expected for a crab tree negative yeast cyanide-resistant respiration (CRR) has already been de- tected. However, forced aeration of resting cells was necessary to induce measurable CRR. A gene encoding an alternative oxidase of Pichia pastoris or its expression was not yet described. Quite the contrary, in a recent attempt to characterise the energetic properties of isolated Pichia pastoris mitochondria, no alternative oxidase activity was detected under the applied growth conditions. The closely related yeast Pichia angusta (Hansenula polymorpha) was described to lack cyanide resistant respiration under the studied conditions.

In the Pichia system, most foreign genes are expressed under the transcriptional control of the P. pastoris alcohol oxidase 1 gene promoter (P_AOXI) _r the regulatory characteristics of which are well suited for this purpose. The promoter is tightly repressed during growth of the yeast on most common carbon sources, such as glucose, glycerol or ethanol, but is highly induced during growth on methanol (see e.g. US 4,855,231 and EP 0 483 115 Al) . For production of foreign proteins, P_Aθxi~~con- trolled expression strains are initially grown on a repressing carbon source to generate biomass and then shifted to methanol as the sole carbon and energy source to induce expression of the foreign gene. One advantage of the P_AOXI regulatory system is that P. pastoris strains transformed with foreign genes whose expression products are toxic to the cells can be maintained by growing under repressing conditions.

Although many proteins have been successfully produced using P_AOXI_/ this promoter is not appropriate or convenient in all settings. For example, in shake-flask cultures, methanol rapidly evaporates and it is inconvenient to monitor methanol concentrations and repeatedly add the compound to the medium. Furthermore, the storage of large amounts of methanol required for the growth and induction of P_Aoxi~controlled expression strains in large-volume high-density fermenter cultures is a potential fire hazard. There is a need therefore, for an alternative promoter to P_AOXIf which is both transcriptionally efficient and regulat- able by a less volatile and flammable inducer.

In Ellis et al.^' (MoI Cell Biol (5) (1985): 1111-1121) the isolation of an alcohol oxidase gene from Pichia pastoris is described. Furthermore, the authors of this work identified genomic DNA subfragments containing control regions involved in methanol regulation. It is an object of the present invention to provide nucleic acid sequences with transcriptional regulatory activity and expression systems which overcome the drawbacks of regularly used expression systems requiring the addition of highly inflammable substances like methanol in order to efficiently express a foreign peptide, polypeptide or protein in a host. Furthermore there is a strong need in the art to have regulatory sequences which allow to regulate the expression of peptides and proteins tightly and to turn on and off the expression in a simple, efficient and fast way.

Therefore, the present invention relates to a nucleic acid promoter comprising a sequence having at least 70% identity to SEQ ID No. 1 or a fragment thereof, or a sequence hybridising thereto under stringent conditions.

It surprisingly turned out that the upstream (5¹ site) region of the mitochondrial alternative oxidase (AOD;Genbank Ace. No. DQ465985) consisting of the nucleic acid sequence SEQ ID No. 1 comprises a promoter which can be induced by the addition of glucose or other carbon sources which allow cellular respiration (e.g. glycerol) to the culture medium (cellular growth and induction occur preferably by the addition of 0.05 to 2Og, preferably 1 to 1Og, glucose or 0.05 to 1Og, preferably 0.1 to 5g, glycerol, when e.g. Pichia pastoris is used). Consequently, this promoter can be controlled (induced or repressed) by the addition or removal of glucose or by varying the glucose concentration in the medium. This allows to efficiently produce peptides, polypeptides, proteins or functional nucleic acid molecules op- erably linked to the promoter of the present invention. This is particularly suprising because it is known in the art that yeast cells turn on the expression of alternative oxidases when they are subjected to stress (Gonzalez-Meier, M. A., et al., Plant Physiol 120(3) (1999) : 765-72; Veiga, A. et al . , J. Appl . Micro- > biol 95(2) (2003) :364-71; Simons, B. H., et al., Plant Physiol 120(2) (1999) : 529-38 and Kirimura, K. et al., FEMS Microbiol Lett, 141(2-3) (1996): p. 251-4). Therefore, it could be assumed that a promoter in the upstream region of the mitrochondrial alternative oxidase would also be activated upon stress induction. However, the expression of the mitrochondrial alternative oxidase is induced in the presence of glucose and not induced when no glucose is present in the culture medium. Lack of an abundant supply of a carbon source, i.e. lack of glucose, normally provokes stress reaction in cells and consequently expression of alternative oxidases. In the present case a surprising vice versa effect could be demonstrated.

The promoter of the present invention is the first alternative oxidase promoter found in methylotrophic yeast which is activated in the presence and de-activated in the absence of glucose. Furthermore, other promoters which can be activated by glucose are not entirely and efficiently repressed by the absence or complete consumption in the course of a fermentation process of glucose (e.g. GAP promoter (pGAPZ A, B, and C Manual from Invitrogen; Catalog nos. V200-20 and V205-20; Waterham, H. R., et al., Gene 186 (1997) : 37-44) ).

The present invention also relates to functional fragments of the promoter having the sequence SEQ ID No. 1. These functional fragments can be identified by isolating a region of SEQ ID No. 1, linking said region operably to nucleic acid stretch to be transcribed, introducing the construct obtained into a vector and/or host and inducing the promoter with potential inducers (e.g. glucose) . The amount of transcription and/or translation product indicates the activity of the functional fragments of the promoter.

According to the present invention "identity" means nucleic acid sequence similarity. Sequences with identity share identical nucleotides at defined positions within the nucleic acid molecule. Thus, a nucleic acid sequence sharing at least 70% nucleic acid sequence identity with a reference sequence (i.e., SEQ ID No. 1) requires that, following alignment of a nucleic acid sequence with the reference sequence, at least 70% of the nucleotides in the nucleic acid sequence are identical to the corresponding nucleotides in the reference sequence.

Sequences are aligned for identity calculations using a mathematical algorithm, such as the algorithm of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 87 (1990) -.2264 2268), modified as in Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90 (1993): 5873 5877). Such an algorithm is incorporated into the XBLAST programs of Altschul et al. (J. MoI. Biol. 215 (1990): 403 410) . To obtain gapped alignments, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25 (1997) : 3389 3402) . When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs can be used.

The present invention also relates to variants and derivatives of the promoter of the present invention and outlined in SEQ ID No. 1. In said variants nucleotides of the promoter of the present invention are substituted, deleted or added in any combination. Naturally occurring variants and non-naturally occurring variants are included in the invention and may be produced by mutagenesis techniques or by direct synthesis.

Using known methods in the art, variants may also be generated to improve or alter the characteristics of the nucleic acid promoters of the present invention. Such variants include deletions, insertions, inversions, repeats and substitutions selected according to general rules known in the art.

"Hybridising", as used herein, means that nucleic acid molecules hybridize under conventional (stringent) hybridization conditions (see e.g. Sambrook (Molecular Cloning; A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (1989)). "Stringent conditions" and method steps, in particular as used herein, may for example be: (1) em- ' ploy low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50⁰C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/5OmM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt ' s solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42⁰C, with washes at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55⁰C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C.

According ^'to a preferred embodiment of the present invention the promoter fragment consists of nucleotides 501 to 2000, preferably of nucleotides 1001 to 2000, preferably of nucleotides 1242 to 2000, preferably of nucleotides 1499 to 2000, preferably of nucleotides 1681 to 2000, preferably of nucleotides 1816 to 2000, of SEQ ID No. 1.

These particularly preferred fragments of the nucleotide se- quence SEQ ID No. 1 comprise those elements or stretches which are required for the regulation of the promoter. Of course it is also possible to vary the length or nucleotide sequence of the single fragments provided that they conserve substantially their promoter function. The promoter fragment consisting of nucleotides 1816 to 2000 of SEQ ID No. 1 is especially preferred, because this fragment showed in particular high promoter activity. The fragment according to the present invention may also be SEQ ID No. 47 which lacks the last 37 bp of SEQ ID No. 1. Of course also functional fragments of SEQ ID No. 47 are within the scope of the present invention.

According to a preferred embodiment of the present invention the functional fragment is selected from the group consisting of SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 46 and 47.

All promoters and promoter variants of SEQ ID No. 1 to 15, 46 and 47 whereby the promoter variants having SEQ ID No. 2 to 15, 46 and 47 are all derived from SEQ ID No. 1, showed the same or at least similar transcriptional behaviour in the presence and absence of glucose.

The promoters and variants and fragments thereof may be linked to other nucleic acid fragments or molecules which are preferably derived from other promoters (e.g. promoter elements), such as AOXl, A0X2, ZZAl, CUPl, GAP, FLD, TEFl, TEF2. Furthermore, it is of course also possible to provide nucleic acid molecules comprising more than one promoter fragment derived from SEQ ID No. 1. Such promoter hybrids may show increased (e.g. multiplied) specific promoter activity. If the promoter having SEQ ID No. 1 or fragments thereof is fused to promoter fragments of other promoters the newly obtained promoter may exhibit multiple specificities.

According to a preferred embodiment of the present invention the nucleic acid promoter or functional fragment is operably linked to at least one second nucleic ^'acid promoter or variant or fragment thereof, wherein the at least one second nucleic acid promoter is preferably selected from the group consisting of alcohol oxidase 1 promoter (AOXl promoter), AOX2, ZZAl, CUPl, GAP, FLD, TEFl, FEF2, DASl, DAS2 or variants thereof. The at least one second nucleic acid promoter is preferably an AOXl promoter, wherein the nucleic acid promoter operably linked to said at least one second nucleic acid promoter comprises preferably a nucleotide sequence selected from the group consisting of SEQ ID No. 48, 49 and 50.

Another aspect of the present invention relates to an expression cassette comprising a nucleic acid promoter according to the present invention operably linked to at least one nucleic acid molecule encoding a peptide, polypeptide, protein or functional nucleic acid.

The promoter coded by the nucleotide sequence SEQ ID No. 1 or functional fragments or derivatives thereof can be used to establish an expression cassette which may be introduced into vectors, chromosomal DNA etc.. The expression cassette further comprises at least one nucleic acid molecule which encodes for a peptide, polypeptide, protein or functional nucleic acid. This further nucleic acid molecule is operably linked to the promoter in order to allow the transcription of said nucleic acid molecule under the control of the promoter.

As used herein, the term "cassette" refers to a nucleotide sequence capable of expressing a particular gene if said gene is inserted so as to be operably linked to one or more regulatory sequences present in the nucleotide sequence. Thus, for example, the expression cassette may comprise a heterologous gene which is desired to be expressed through glucose induction. The expression cassettes and expression vectors of the present invention are therefore useful for promoting expression of any number of heterologous genes upon glucose induction. Furthermore, the cassette of the present invention may also contain a DNA stretch which encodes for a signal peptide which allows the secrection of the polypeptide, peptide and/or protein fused thereto. Such a cassette is according to the present invention intended to be a "secretion cassette".

Another aspect of the present invention relates to a vector comprising a nucleic acid promoter or an expression cassette according to the present invention.

The promoter as well as the expression cassette of the present invention may be introduced into a vector by known recombinant techniques.

As used herein, "vector" refers to a carrier DNA molecule into which a nucleic acid sequence can be inserted for introduction into a new host cell where it will be integrated into the genome, replicated and/or expressed. The vector may, for example, be in the form of a plasmid, cosmid, viral particle or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art.

The vector further comprises preferably at least one cloning site, at least one gene or gene fragment encoding a selectable marker, a secretion cassette and/or at least one origin of replication.

Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, a promoter, a transcription termination sequence and a secretion cassette in order to allow the secretion of the translated product encoded by a gene operably linked to the promoter of the vector. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan. If the vector or parts thereof are intended to be integrated into the genome of a host, preferably a yeast host, more preferably a Pi- chia pastoris host, the vector does not necessarily comprise an origin of replications. For chromosomal integration also linear vectors, e.g. assembled by PCR (e.g. overlap extension PCR) or synthetic linear DNA fragments and missing any origin of replication are possible. In the case of yeast plasmids, the vector may comprise at least one autonomous replication sequence (ARS) . Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, zeo- cin, geneticin or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli. A suitable selection gene for use in yeast is the trpl gene. The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan. Further selection markers for the given case would be zeocin (bleomycin) , geneticin (kanMX) or blastizidin. Furthermore, also enzymes may be used as selection markers which are able to provide to the cell nutrients required for the growth of the _ Q — host cells. For instance, invertase (SUC2) may be used as selection marker, which provides a carbon source by clearing saccharose (e.g. Sreekrishna K., et al., Gene 59 (1) (1987): 115-25). However, the secretion cassette of the present invention comprising the promoter of the present invention may also be introduced- in a host without a selection marker. In this case, a selection marker may be introduced in a host by co-transforming a second DNA (e.g. plasmid) comprising a selection marker.

The vector comprises at least one second nucleic acid promoter operably linked to at least one second nucleic acid molecule encoding a peptide, polypeptide, protein or functional nucleic acid.

The provision of at least one further promoter in a vector of the present invention permits the transcription/expression of a second gene operably linked to said further promoter. If the promoter can be induced by other substances or factors than the promoter of the present invention it is possible to obtain a vector capable of expressing different genes under different inducing conditions. For instance, two promoters may be used in a vector of the present invention, wherein the first promoter is a promoter of the present invention and can be induced by the addition and repressed by the removal of glucose. As second promoter the AOXl promoter, for instance, which can be induced by the addition of methanol and repressed by the addition of glucose, may be employed.

According to a preferred embodiment of the present invention said at least one second nucleic acid promoter is selected from the group consisting of alcohol oxidase 1 promoter (AOXl promoter) , A0X2, ZZAl, CUPl, GAP, FLD, TEFl, TEF2 or variants thereof.

The at least one second promoter may be preferably an AOXl promoter. Said promoter can be native or comprising mutations of any kind. Particularly preferred promoters can be found, e.g., in WO2006/089329.

Another aspect of the present invention relates to a host cell comprising a nucleic acid promoter, an expression cassette and/or a vector according to the present invention.

The nucleic acid promoter or expression cassettes or vectors comprising said promoter may be introduced into a host cell by, e.g., transformation. Methods for the transformation of host cells with foreign DNA are well known to the person skilled in the art.

The host cell is preferably a eukaryote, preferably a fungus, more preferably a fungus of the genus Aspergillus, or a yeast, more preferably a yeast of the genus Pichia, in particular Pichia pastoris, Saccharomyces, in particular Saccharomyces cerevisiae, Hansenula, in particular Hansenula polymorpha, or Candida.

The host cell of the present invention comprises the expression cassette preferably integrated into the genomic DNA or ex- trachromosomally in the cytoplasm.

In order to stably introduce the expression cassette of the present invention comprising a promoter and a gene to be transcribed operably linked thereto in the host cell, the nucleic acid molecule comprising said expression cassette is preferably integrated into the chromosome of the host cell.

Yet another aspect of the present invention relates to a method for the recombinant production and the optional isolation of at least one peptide, polypeptide, protein or functional nucleic acid comprising the steps: a) providing a host cell according to the present invention, b) incubating the host cell in a first culture medium, c) optionally incubating the host cell in a second culture medium and d) optionally isolating the peptide, polypeptide, protein or functional nucleic acid from the supernatant or from the host cells, wherein the first and/or second culture medium comprises glucose for the induction of the expression of the at least one peptide, polypeptide, protein or functional nucleic acid.

The promoter of the present invention may be in particular used for the production of recombinant peptides, polypeptides and/or proteins or functional nucleic acid molecules (e.g. ri- bozymes) , as well as for cascade expression, cell differentiation, synthetic regulatory circuits and the production of small molecules and metabolic engineering (ME) . A typical protocol for the production of such molecules may involve the propagation of a suitable clone capable upon induction to express or produce the molecule of interest. Said clone may be cultivated in a first culture medium until reaching a defined cell concentration. Consequently the transcription of the gene operably linked to the promoter of the present invention is induced by the addition of an inducer (e.g. glucose). The induction of the expression is stopped by removing the inducer (e.g. consumption of the glucose by the cells will also lead to a removal of glucose) or by transferring the cells in a second culture medium.

According to a preferred embodiment of the present invention the first and/or second and/or at least one further culture medium comprises at least one further inductor for the at least one second nucleic acid promoter.

Of course it is also possible to produce at least one second molecule under the control of a further or the same promoter.

The at least one further inductor is preferably methanol when the at least one second nucleic acid promoter is an AOXl promoter, DASl, DAS2, FDH or FLD or methylamine or cholin, when the at least one second nucleic acid promoter is a FLD promoter.

Yet another aspect of the present invention relates to a kit for the recombinant production of at least one peptide, polypeptide, protein or functional nucleic acid comprising:

- a vector comprising a nucleic acid promoter according to the present invention, and

- a host cell.

The kit of the present invention may be used in particular for the recombinant production of molecules.

According to a preferred embodiment of the present invention the host cell is a eukaryote, preferably a yeast, more preferably a yeast of the genus Pichia, in particular Pichia pastoris.

The present invention is further illustrated by the following figures and examples, however, without being restricted thereto.

Tig. 1 shows oxygen consumption measurements of exponentially growing Pichia pastoris X-33 cells. A: Control measurement. B: Addition of antimycin A (lOμg ml-1 final concentration) at time-point zero. Respiration of the control strain was impaired by the addition of cyanide, however, a low basal level of cyanide resistant respiration (CRR) was observable. Addition of antimycin A abolished respiration to a large extent and induced the expression of the alternative oxidase. The effect of cyanide on the total respiratory activity decreased over time. 2 hours after induction, full respiratory activity was restored.

Fig. 2 shows the alignment of the conserved C-terminal ^■ part of the alternative oxidases from Candida albicans (AAF21993,

Aoxlb) , Pichia stipitis (AAF97475), Pichia anomala (BAA90763),

Aspergillus niger (074180), Aspergillus nidulans (EAA64931),

Neurospora crassa (AAN39882), Sauromatum guttatum (CAA78823) ,

Arabidopsis thaliana (BAA22624) and Pichia pastoris.

The highly conserved residues among alternative oxidases are boxed.

Fig. 3 shows the time-course of the alternative oxidase expression with different glucose concentrations in the media. A: 1% glucose. B: 5% glucose. The expression of the alternative ox- idase-GFP fusion protein followed the same mode of expression under both glucose concentrations. Relative fluorescence values (mean values from three measurements) were constantly rising and reached the maximum shortly after the time-point of glucose depletion. After this time-point fluorescence values declined due to the degradation of the fusion protein.

Fig. 4 shows fluorescence per optical density. Pichia pastoris was grown in media containing 1% or 5% glucose at the time of inoculation. The obtained fluorescence levels (mean values from three measurements) were normalised to the optical density of the respective strain (mean values from two measurements) at the given time-points, thus reflecting the amount of enzyme per cell. Accumulation and degradation of the protein complex occurred at the same pace under the control of the alternative oxidase promoter, independent of the initial glucose concentration. The fusion-protein kept accumulating when the constitutive GAP promoter was used. The fluorescence peak around the time-point of glucose depletion reflects an expression characteristic of the GAP promoter.

Fig. 5 shows relative oxygen consumption rates (the respiratory activity before addition of any inhibitor was defined as 100%) . The control strain X-33 displayed a low level of CRR, SHAM did not influence the respiratory activity. The strain over-expressing the alternative oxidase (X-33 PpAOD) was not influenced by either cyanide or SHAM. Both respiratory systems were capable of upholding the total respiratory activity. Disruption of the alternative oxidase gene led to impairment of CRR. Measurements of the X-33 and the X-33 PpAOD strain have been performed in triplicates, measurements of the X-33ΔPpAOD strain in duplicates. The reported values represent mean values, error bars represent standard deviations.

Fig. 6 shows the shake flask cultures of X-33, X-33 PpAOD and X-33 ΔPpAOD in media with different glucose concentrations. A: BMD1%. B: BMD5%. Over-expression of the alternative oxidase resulted in lowered final optical density of the recombinant strain. The growth behaviour differed from the other two strains, characterised by a break in the exponential growth phase. This strain entered the stationary growth phase earlier than the control or the X-33 ΔPpAOD strain. Upon reaching the stationary growth phase, the optical density X-33 ΔPpAOD strain decreased compared to the control strain. While over-expression of the alternative oxidase resulted in increased ethanol production, the strain X-33 ΔPpAOD produced the lowest amount of ethanol. The highest measured ethanol concentrations for each strain are also stated in table 1.

Fig. 7 shows the assessment of cell death phenomena associated to the over-expression or disruption of the Pichia pastoris alternative oxidase. A: Percentage of cells showing rhodamine mediated fluorescence. B: Percentage of Tunel positive cells Disruption as well as over-expression of the alternative oxidase led to increased occurrence of apoptotic markers. The stated values are mean values from at least four pictures per time- point from two independent slides, error bars represent standard deviations .

Fig. 8 shows the nucleic acid promoters and fragments and variants thereof as disclosed herein.

Fig. 9 shows specific promoter activity as judged by relative fluorescence intensity (EX395/EM507 ) per optical density (OD595) after 60 of cultivation in BMD1% in deep well plates. Copy numbers of the expression construct as determined by realtime PCR are written above the bars.

CBS7435: negative control, Pichia pastoris CBS7435 without expression cassette

P-AOD_1 (s.c): the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 3

P-AOD_2 (d.c): the double copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 5 P-AOD_4 (s.c): the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID

No. 9

P-AOD__6 (s.c): the single copy strain expressing cycle-3-GFP ^' under the control of the promoter variant according to SEQ ID

No. 13

P-AOD__7 (s.c): the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID

No. 14

P-AOD 2_EcoRI (s.c): the single copy strain expressing cycle-3~

GFP under the control of the promoter variant according to SEQ

ID No. 2

P-AOD 2-AOX (S.C): the single copy strain expressing cycle-3-

GFP under the control of the P-AOD 2-AOX176 fusion.

Fig. 10 shows a comparison of the expression activity of the alternative oxidase promoter variants in BMD1% and BMGO.5% (see Example 20) .

EXAMPLES :

In order to show the ability of the promoter of the present invention to be controlled by varying concentrations of glucose alternative oxidase expression in Pichia pastoris was analysed. The activity of alternative oxidase was measured with a Clark- electrode during the transition phase between exponential and stationary growth without pre-treatment of the cells with an inducing agent. A GFP fusion protein was successfully applied for the characterisation of the time-course of Pichia pastoris alternative oxidase expression. Deregulation of the alternative respiration either by over-expression or disruption of the alternative oxidase gene negatively affected the biomass yield and cell viability, whereas growth rates and glucose uptake rates were slightly increased. Strains and media

Pichia pastoris X-33 (Invitrogen, USA) was used as a platform strain for all engineered Pichia strains. E. coli XL-I blue (Stratagene, USA) was used for all E. coli cloning procedures. All components for E. coli media have been purchased from Carl Roth GmbH (Germany) , all components for Pi^¬ chia pastoris media have been purchased from Becton, Dickinson and Company (USA) . Media and electro-competent Pichia pastoris cells have been prepared according to the "Pichia Expression Kit" manual (Invitrogen) . Zeocin, obtained from InvivoGen (USA) was added to agar plates for selection (lOOμg ml-1 for Pichia pastoris and 25mg ml^"1 for E.coli). Ampicillin (Sigma-Aldrich, Austria) was added to the E. coli media to a final concentration of lOOμg ml^"1.

Example 1: Cloning, Isolation and preparation of DNA

Standard molecular-biology procedures were performed according to Ausubel et al. (2006, Current protocols in Molecular Biology) . Genomic DNA from Pichia pastoris was prepared according to the "Easy-DNA™ Kit" (Invitrogen) . Plasmid DNA and PCR products were prepared and purified using the "Wizard® Plus SV Minipreps" Kit or the "Wizard® SV Gel and PCR Clean-Up System" Kit from Promega GmbH (Germany) , respectively. All restriction enzymes and the T4 DNA Ligase were purchased from MBI Fermentas GmbH (Germany) . PCR reactions were performed with the "Phusion™ High-Fidelity DNA Polymerase" from Finnzymes (Finland) according to the supplied manual in a GeneAmp® PCR System 2700 from Applied Biosystems (OSA) . All overlap extension PCR reactions were performed as follows:

A 50μl PCR reaction mixture without primers was prepared. This solution contained the templates with the overlapping regions at equi-rαolar concentrations. A 35 cycle PCR program was devised according the specifications of the applied polymerase. The annealing time was set to fit the Tm of the overlapping regions as well as the Tm of the primers. The extension time was set for amplification of the full length product. After 10-12 cycles, lOμl of a mixture containing the primers (0,2pmol μl^"1 final concentration), buffer, polymerase and dNTP's were added to the PCR reaction and the final cycles were performed.

Example 2: Amplification and cloning of the Pichia pastoris alternative oxidase gene

The open reading frame of the Pichia pastoris AOD gene was amplified by PCR from genomic DNA of strain X33 employing the primers 5 ^'-cagaattcaaaacaatgttaaaactgtacgcaataagg-3' (EcoRI- PpAOD-f; SEQ ID No. 16) and 5 ' -cagaattcac^'tcgagtttataaaacgagct- catctctttccc-3' (XhoI-PpAOD-r; SEQ ID No. 17) . The stop-codon of the gene was changed from TGA to TAA. The gene was cloned into the pGAPZ-A vector from Invitrogen via the restriction sites EcoRI and Xhol. The resulting plasmid ρGAPZ-A (PpAOD) was transformed into E. coli XL-I blue. Plasmid DNA was isolated from transformants and controlled by restriction analysis and sequen- _,

- 16 - cing. This construct was used for constitutive expression of AOD in Pichia pastoris.

Example 3: Construction of the alternative oxidase disrup- tion cassette

The AOD disruption cassette was constructed by overlap extension PCR. The Zeocin resistance cassette fr-om pGAPZ-A was amplified using the primers 5 '-gttcggattgatgcgtagtctcagggc- ccacacaccatagcttcaaaatg-3 ' (TefZeol-f; SEQ ID No. 18) and 5'- ggtagtgtaagtatacacagcttcctcagtcc tgctcctcggccacg-3 ' (TefZeo2-r; SEQ ID No. 19). A 5' flanking region (the 5' 374bp of the AOD gene) was amplified from genomic DNA with the primers 5 ' -ctcaaagatgttaaaactgtacgcaataaggcc-3 ' (PpAOD-atg-f; SEQ ID No. 20) and 5 ' -cattttgaagctatggtgtgtgggccctgagactacgcatcaatccgaac-3 " (TefZeol-r; SEQ ID No. 21) . A 3" flanking region consisting of the 3' 328bp of the alternative oxidase gene and additional 145bp downstream of the stop-codon, was amplified with the primers 5 ' -cgtggccgaggagcaggactgaggaagctgtgtatacttacactacc-3 ' (TefZeo2-f; SEQ ID No. 22) and 5 '-tagttgacgttcgcggacatag-3 ' (PpAOD-Δ-r; SEQ ID No. 23) . The TefZeo primers had complementary sequences and were used to introduce homologous regions for the following overlap extension PCR with the three PCR products. The two outer primers 5 ' -ctcaaagatgttaaaactgtacgcaataaggcc-3 ' (PpAOD-atg-f (SEQ ID No. 24) and 5 '-tagttgacgttcgcggacatag-3 ' (PpAOD-Δ-r; SEQ ID No. 25) were added after cycle 10 to allow amplification of the full-size product. Gel electrophoresis showed a product of 1701bp. The purified product was cloned into the plasmid pCR®4Blunt-T0P0® according to the "Zero Blunt® TOPO® PCR Cloning Kit for Sequencing" manual (Invitrogen) (Shuman, S., Proc. Natl. Acad. Sci USA 88 (1991) : 10104-10108; Shuman, S. , J. Biol. Chem. 269 (1994) : 32678-32684) and transformed into E.coli. Plasmid DNA was isolated from transformants and controlled restriction analysis and sequencing.

Example 4: Construction of a PpAOD-GFP fusion The alternative oxidase gene was amplified from the plasmid pGAPZ-A (PpAOD) with the primers 5'- cagaattcaaaacaatgttaaaact- gtacgcaataagg-3 ' (EcoRI-PpAOD-f; SEQ ID No. 26) and 5 ' -agcacccaacaactttggatcaacagcagcagctaaaacgagctcatctctttccc-3 ' (Linker-PpAOD-r; SEQ ID No. 27) . The second primer contained additional 33 bases coding for a 11 amino acid linker region and was also used to delete the stop-codon of the alternative oxi- dase gene. The gene coding for GFP was amplified with the primers 5 ' -gctgctgctgttgatccaaagttgttgggtgctatggctagcaaag- gagaagaac-3' (Linker-GFP-f; SEQ ID No 28) and 5'-cactc- gagtttaatccatgccatgtgtaatccc-3' (wtGFP-XhoI-r ; SEQ ID No. 29) . The two PCR products were employed in an overlap extension reaction. Finally the full--length product was purified and cloned into pGAPZ-A via EcoRI and Xhol. The resulting plasmid pGAPZ- A(PpAOD-GFP) for constitutive expression of the AOD-GFP fusion in Pichia pastoris was isolated from E. coli transformants and sequenced. For integration behind the native AOD promoter the PpAOD-GFP integration cassette was amplified from this plasmid using the primers 5 ' -cgttggttacttagaggaggaagctg-3' (PpAOD-infor; SEQ ID No. 30) and 5'-agcttgcaaattaaagccttcgagc-3 ' (CyclTT-r; SEQ ID No. 31) . The primer PpAOD-infor is located within the ORF of the AOD gene. The CyclTT-r primer binds at the end of the CYCl transcription terminator of the vector pGAPZ-A.

Example 5: Analysis of the alternative oxidase gene sequence

The nucleotide sequence of the Pichia pastoris alternative oxidase gene was analysed for mitochondrial targeting sequences according to Claros and Vincens (Eur J Biochem, 241 (1996) : 779-786) , protein parameters were analysed as described by Gasteiger et al. (2005). The deduced amino acid sequence of the ORF was used for a alignment using ClustalW (Thompson, J. D., et al., Nucleic Acids Res, 22(22) (1994): 4673-80) with other known sequences of alternative oxidases from 3 yeasts, 3 fungi and 2 plants .

Exaiπple 6: Transformation of Pichia pastoris

Transformation of Pichia pastoris and E. coli was performed by electroporation according to the ^NΕlectrocomp Kits (Version G) " from Invitrogen with a Gene Pulser and Gene Pulser Cuvettes 0,2cm from Bio-Rad Laboratories (Austria). The plasmids pGAPZ- A(PpAOD) and the pGAPZ-A (PpAOD-GFP) were linearised with Avrll (XmaJI; BInI) before transformation to facilitate integration into the GAP locus. The AOD disruption and PpAOD-GFP integration cassettes were amplified by PCR, purified and directly used for transformation. Integration of pGAPZ-A (PpAOD) and disruption of the AOD gene have been confirmed by colony PCR and oxygen consumption measurements. The resulting strains have been designated X33 PpAOD (the strain over-expressing the alternative oxidase) and X33 ΔPpAOD (the strain with the disrupted alternative oxidase), X33 PpAOD-GFP (P-GAP) (the strain over-expressing the PpAOD-GFP construct under the control of the constitutive GAP promoter) and X33-PpAOD-GFP (P-AOD) (the strain expressing the PpAOD-GFP construct under the control of the native alternative oxidase promoter) , respectively.

Example 7: Shake flask cultures of Pichia pastoris strains 50 ml buffered minimal media containing 1% or 5% glucose (BMD1% or BMD5%) respectively, in 250ml baffled, wide-necked shake flasks were inoculated with over-night cultures to an optical density of OD600~0.1. Optical densities were measured at 600nm against minimal media on a Beckman Coulter Counter DU®800 (Beckman Coulter Inc., USA). The cultures were incubated at 28°C and 80% relative humidity under constant shaking (140rpm) in an Infors Multitron II Shaker (Infors AG; Switzerland) . Pichia pastoris X-33 was used for induction experiments to study the time- course of the alternative oxidase activity after induction with antimycin A (Sigma-Aldrich) . The strain was grown in BMD2% until an optical density between 3 and 4 was reached. Antimycin A was then added to the exponentially growing cultures to a final concentration of lOμg/ml^"1. The strains X-33, X33 ΔPpAOD and X33 PpAOD were grown to study the effects of over-expression and disruption of the alternative oxidase on the growth behaviour and viability of Pichia pastoris. The strains X-33, X33 PpAOD- GFP(P-AOD) and X33 PpAOD-GFP (P-GAP) were grown to study the regulation of the alternative oxidase expression. Expression and degradation of the protein were followed by fluorescence measurements. The background fluorescence values of untransformed Pichia pastoris X-33 were subtracted from those of X33 PpAOD- GFP(P-AOD) and X33 PpAOD-GFP (P-GAP) . Differences in the optical density of the cultures at the given time-points were negligible and therefore not taken into consideration. All shake-flask experiments were performed in duplicates.

Example 8: Sample preparation and measurements ImI samples were taken from shake flask cultures at set time-points. After centrifugation for 1 minute at 13200rpm in an Eppendorf 5415R centrifuge at 4⁰C ethanol and glucose concentrations in the supernatant were determined. Glucose and ethanol concentrations in the media were measured using the "Glucose UV Hexokinase Method" (DIPROmed, Austria) and the "Ethanol UV Meth- od" (Hoffmann-La Roche, Switzerland) , respectively. Both protocols have been downscaled to a total volume of 200μl to enable measurements with a SPECTRAmax Plus384 plate-reader (Molecular Devices, Germany) in UV micro-plates (Greiner Bio-One GmbH, Germany) . Depletion of glucose in the media during the cultivation of cells was defined as the glucose uptake rate (qS) of the cells. The measurement of GFP was performed in black micro-titer plates from Greiner Bio-One containing 200μl cells per well with a SPECTRAmax® Gemini XS Spectrofluorometer from Molecular Devices. The fluorescence was measured at 507nm, the excitation wavelength was 395nm and the cut-off filter was set at 495nm. All measurements and the corresponding calibration curves have been performed at least in duplicates.

Example 9: Oxygen consumption measurements

For oxygen consumption measurements of the samples from the induction experiment with antimycin A cells were grown to an OD600 between 3 and 4 in BMD2%. Then 200μl of the cell solution were used for oxygen consumption measurements in a total volume of ImI. The volume was adjusted with 10OmM potassium phosphate buffer (pH=6) .

Successful over-expression and disruption of the Pichia pas- toris alternative oxidase gene were also functionally verified by oxygen consumption measurements with a Clark electrode Dual Digital Model 20 from Rank Brothers Ltd (Bottisham, UK) . The influence of over-expression or disruption of the alternative oxidase gene on the respiratory activity was measured by adding potassium cyanide (KCN) or salicylhydroxanαic acid (SHAM) to a final concentration of 2mM. KCN was purchased from Sigma-Aid- rich, SHAM from Fluka. Both chemicals were prepared fresh for all measurements. SHAM was dissolved in dimethylsulfoxide (DMSO) (Roth), KCN was dissolved in water with a pH adjusted to 10,5. Measurements of the X-33 and the X-33 PpAOD strain have been performed in triplicates, measurements of the ΔPpAOD strain in duplicates.

Example 10: Tests for apoptot±c markers

The TdT-mediated dUTP nick end labelling (TUNEL) test was applied to determine the effects of over-expression and disruption of the alternative oxidase gene on cell viability of the recombinant strains by assaying apoptotic phenomena with the "In Situ Cell Death Detection Kit, POD" (Roche Diagnostics GmbH) . This method identifies apoptotic cells in situ by using terminal deoxynucleotidyl transferase (TdT) to transfer biotin-dUTP to strand breaks of DNA. The biotin-labeled cleavage sites are then detected by a colour reaction. Dihydrorhodamine 123 (Sigma-Ald- rich) was used to detect free intracellular reactive oxygen species (ROS) . Cells were treated as described previously- . The total number of cells and the number of cells giving a positive signal per picture were counted and used to calculate the percentage of cells showing signs of ROS accumulation. At least four pictures per strain and time-point from two independent slides were used for the calculations.

Example 11: Induction of the Pichia pastoris alternative oxidase frith antimycin A

Addition of antimycin A to an exponentially growing culture of Pichia pastoris X-33 led to growth impairment. The oxygen consumption rates in Fig. 1 illustrate the time-course of alternative oxidase activity during logarithmic cell growth. Cyanide insensitive respiration increased rapidly after addition of antimycin A and growth of the cells was fully restored after 2 hours. Addition of SHAM to the control had virtually no effect on the respiratory activity. A small contribution of the alternative oxidase to the total respiratory activity of the cell was observable upon addition of KCN_f which did not completely inhibit oxygen consumption of the control strain. A basal level of alternative respiration was observed in the untreated control strain as well as in the inhibited culture immediately after the addition of antimycin A, meaning that at least a small amount of active enzyme was. observed during exponential growth of Pichia pastoris on glucose.

Example 12: Cloning and sequence analysis of the Pichia pastoris alternative oxidase gene

The deduced amino acid sequences of the Candida albicans alternative oxidase genes AOXl (AF031229) , AOX2 (AF116872) and the Pichia stipitis SHAM-sensitive terminal oxidase (STOl) gene (AY004212) were sent to Integrated Genomics to search for homo- logs in the preliminary genome sequence of Pichia pastoris IG66. A blast search delivered matches for all three queries in the same contig (contig3604) . We analysed contig3604 for putative open reading frames and found one ORF which showed high sequence similarity to the full coding region of other alternative oxi- dases. The open reading frame was amplified from genomic DNA of Pichia pastoris X33 by PCR as described- in materials and methods . The resulting PCR product was directly sequenced and found to be absolutely identical with the coding sequence in con- tig3604 of the Pichia pastoris genome sequence.

The uninterrupted alternative oxidase ORF (AOD) from Pichia pastoris had a length of 1089 nucleotides. The nucleotide sequence was deposited in the GenBank database under the accession number DQ465985. The translated protein sequence consists of 362 amino acids and contains the, typically highly conserved regions NERMHL, LEEEA and RADEA. H . Multiple protein sequence alignment of the Pichia pastoris alternative oxidase with sequences from other yeasts, fungi and plants showed significant identity in the C-terminal part (Fig. 2), whereas the N-terminal part displayed very low identity, most probably due to the degenerate nature of mitochondrial targeting sequences. The protein has a predicted molecular weight of 41833Da. A predicted cleavable mitochondrial targeting sequence consists of the first 26 N-terminal amino acids. The processed protein therefore has a predicted molecular weight of 38776Da.

Reporter fusion proteins have been applied with great success to study the expression and localisation of proteins. In order to verify the predicted targeting of alternative oxidase into the mitochondria a fusion protein was constructed, linking green fluorescent protein (GFP) C-terminally to the alternative oxidase. This AOD-GFP fusion was expressed employing the strong constitutive GAP promoter. Fluorescence microscopy of the resulting transformants revealed local GFP fluorescence as it is usually observed for a typical mitochondrial localisation in yeasts green fluorescent protein at the mitochondria. Measurements of oxygen consumption rates of the strain X-33 PpAOD- GFP(P-GAP) showed that the alternative oxidase part of the fusion protein was fully functional. Results were similar to those obtained with the X-33 PpAOD strain, which constitutively over- expressed the Pichia pastoris alternative oxidase.

Example 13: Expression analysis of AOD-GFP fusions GFP was also employed as a reporter to follow the time course and level of expression of the Pichia pastoris alternative oxidase under standard laboratory conditions in shake flask cultures. The fusion protein was expressed under the control of the native Pichia pastoris alternative oxidase promoter and also under the control of PGAP. Fluorescence was measured at given time-points and compared to the data obtained from untransformed Pichia pastoris X33. The resulting fluorescence curves followed the growth curves almost in parallel up to the point of complete glucose depletion in the media (Fig. 3) , again indicating a low expression level of the enzyme in the presence of glucose. Even after normalisation of the fluorescence values by the optical density of Picha pastoris X33-PpAOD-GFP (P-AOD) an increasing amount of AOD-GFP enzyme in the cells over time could be observed (Fig. 4); at least as long as glucose was not depleted. Surprisingly the fluorescence decreased very rapidly upon depletion of the carbon source. This led to two possible explanations. The expression of the alternative oxidase was induced by glucose and kept at a steady level. Thus, the enzyme accumulated in the mitochondria until, upon depletion of glucose in the medium, transcription of the alternative oxidase gene came to a halt and the degradation of the enzyme was initiated. Since the computed instability index of the processed protein (41.40) as determined by the algorithm of Gasteiger et al . classifies it as unstable, it is likely that the enzyme is subject to permanent degradation, which only became visible after down-regulation of transcription. This also implicates that the expression level of the enzyme increased constantly during growth on glucose. Otherwise the accumulation of the Aod-GFP fusion protein can only be explained by an increase of mitochondria, providing a higher hosting capacity for the fusion protein. Either of both cases highlighted an exact regulation of expression of the alternative oxidase on a transcriptional level. Addition of methanol (1% final concentration) to the culture with 5% initial glucose concentration 70 hours after inoculation did not induce alternative oxidase expression. The rising optical density of the cultures confirmed the use of methanol as carbon source, but no fluores- ^"cence was measured.

Expression of the fusion protein under control of the GAP promoter was also performed for .5% glucose. This resulted in a constant increase of fluorescence up to 8Oh of culture time. It is therefore assumed that the alternative oxidase must be permanently degraded and expression is controlled at the level of transcription. Interestingly, at the time-point of substrate de- pletion, an increase of fluorescence became apparent during PGAP forced expression. This is a feature of this "constitutive" promoter, which was observed in the lab in several cases before. Upon depletion- of glucose, the expression mediated by this promoter increased, featuring a steeper slope in the respective product curves for a short period, usually two doubling times. This is a feature of the GAP promoter which perfectly matches with strategies of continuous protein production where part of the culture is repeatedly replaced by fresh medium.

Example 14: Constitutive expression and disruption of the AOD gene

■ Employing oxygen consumption measurements constitutive expression of functional alternative oxidase and its disruption, respectively, were demonstrated. The relative respiratory rates (assuming non-inhibited respiration as 100%) of the recombinant strains and the control strain are shown in figure 5. The strong inhibitory effect of KCN on the respiration of ,the control strain Pichia pastoris X-33 indicated a marginal, yet measurable commitment of the alternative oxidase to respiration during growth on glucose. The effect of SHAM on the total respiratory rate was negligible and therefore another evidence of a low alternative oxidase activity making no significant contribution to total respiration during logarithmic cell growth on glucose. The disruption strain X33-ΔAOD was not capable of cyanide-insensitive respiration and consequently the addition of SHAM did not influence the respiratory activity. Since disruption of a single gene abolished cyanide-resistant respiration in Pichia pastoris it was evident that a single gene encoded the alternative oxidase .

The respiratory activity of the over-expressing X-33 PpAOD strain was not susceptible to either of the applied inhibitors. The final concentration of KCN was increased to 6mM without significantly changing the total respiratory activity of the X~33 PpAOD strain. Also, concentrations of 2mM of each of the inhibitors SHAM and KCN were not sufficient to suppress respiration completely. Thus, the constitutively over-expressed alternative respiratory system was capable of maintaining full respiratory activity under conditions where respiration of the non-transformed Pichia pastoris strain was completely inhibited. Due to an over-expression effect also full inhibition by SHAM was hardly possible. The total respiratory activity of the recombinant strains before addition of the inhibitors was not significantly altered compared to the control strain. No morphological changes due to the introduced genetic changes were observed by standard transmitted light microscopy. During growth, the engineered cells equalled the wild-type cells in size and shape.

Example 15: Growth characteristics of Pichia pastoris strains with deregulated AOD expression

Surprisingly the maximal growth rate (μmax) and the substrate uptake rate (qS) of the X33-PpAOD strain were slightly increased (table 1) . Growth of the strain, expressing AOD con- stitutively, decelerated during the log phase and entered the stationary growth phase earlier since also glucose was used up earlier in this culture than by the other two strains (Fig. 6) . The similarity of growth behaviour of the control strain X33 with X-33ΔPpAOD in this stage of growth indicated that this phenomenon was a specific effect caused by AOD over-expression. Biomass yield was lowered as a consequence of constitutive and disrupted alternative oxidase activity under low as well as high glucose concentrations (Fig. 6) . The AOD disruption strain showed only minor deviations from the control strain concerning the final optical density under 1% glucose, whereas the difference under 5% glucose was more pronounced. Since μmax and qS were not significantly altered from the values of the wild-type, the variance in final biomass, indirectly determined by optical density could not be attributed to these physiological parameters. Furthermore, the differences occurred at a later stage of growth than those observed in the X33-PpAOD strain. Due to literature which links alternative oxidase activity to stress response and therefore to cellular viability increased cell death phenomena was considered as possible explanation for this discrepancy.

In addition to the observed alterations in growth behaviour, over-expression of the alternative oxidase also led to increased ethanol production, whereas disruption of the gene led to lower ethanol concentrations . Also these differences were more pronounced in the experiments with the higher glucose concentration. Example 16: Alternative oxidase dependent cell death phenomena

Reactive oxygen species (ROS) are formed in any organism exposed to molecular oxygen and they are initiators of apoptosis. At least in plants over-expression of the alternative oxidase was described to reduce intracellular ROS- concentrations . Reduced expression led to ROS accumulation. ROS accumulation and induction of apoptosis upon disruption of the alternative oxidase gene in Pichia pastoris was therefore also expected. Consequently, over-expression of the alternative oxidase should decrease respiratory ROS production and favour cell viability. To test this hypothesis non-fluorescent dihydrorhodamine 123 (DHR 123) was used, which is oxidized intracellularly by ROS to the fluorescent rhodamine 123 (Rh 123) to study the effect of alternative oxidase activity on ROS production. Furthermore, the fraction of apoptotic cells in liquid cultures was determined by the Tunel test, which traces degradation of genomic DNA, a typical feature of apoptosis. At a glucose concentration of 1% in the culture media neither statistically relevant Rh 123 mediated fluorescence nor apoptotic cells in the Tunel test were found. These results nicely correlated with the earlier findings of Weis et al. (FEMS Yeast Res 5 (2004) : 179-189) , who reported 1% as the optimal glucose concentration to minimise Pichia pastoris cell death phenomena in shake flask and deep well plate cultures.

In media containing of 5% glucose ROS production and the fraction of apoptotic cells were increased for both engineered strains in comparison to the untransformed strain X-33 (Fig. 7). Throughout the time course of the whole experiment AOD disruption led to a larger fraction of apoptotic cells and higher ROS concentration than its over-expression. Nevertheless, in Pichia pastoris both extremes of deregulated AOD expression obviously showed negative effects. In the disrupted strain X-33ΔPpAOD increased ROS production already showed up after 15 hours of growth. In the disrupted strain X-33ΔPpAOD and also in the over- expression strain it increased over time, whereas ROS production in the control was low. For the Tunel test, indicating apoptotic cells first signals were found later than with the ROS test, i.e. after 39 hours of growth. Although showing the same trend as the ROS accumulation the differences between the analysed strains were more pronounced in the results of the more sensitive Tunel test. The extraordinary high ROS concentration from the last measurement point might be an artefact caused by a larger fraction of false positive signals. Both viability tests and their correlation strongly suggest an important role for the alternative oxidase in preventing ROS production and programmed cell death. However, there are negative effects due to alternative oxidase over-expression in its disruption. To do its best for a high cell viability, alternative oxidase from Pichia pas- toris has to be expressed in the right amount and exactly when needed.

Example 17 : Identification of the AOD promoter (pAOD) The deduced amino acid sequences from the Candida albicans alternative oxidase genes aoxl (AF031229) , aox2 (AF116872) and the Pichia stipitis SHAM-sensitive terminal oxidase (stol) gene (AY004212) were compared against the contigs of a genome sequencing project of Integrated Genomics. The sequences were used for protein versus DNA blast searches in the genome sequence from Pichia pastoris IG-66. The blasts delivered the same contig (contig3604) for all three queries. Contig3604 was analysed for putative coding sequences and subjected to a blastx search. One region showed high identity to alternative oxidases from several micro-organisms. Primers were designed according to this sequence. Genomic DNA from Pichia pastoris X-33 was used as template for a PCR. The resulting PCR product was directly sequenced and found to be absolutely identical with the coding sequence in contig3604.

In order to identify the promoter region of the newly identified alternative oxidase the upstream region (starting from the ATG of the alternative oxidase gene) was sequenced (~ 2000nt) .

Example 18: Amplification and cloning of Pichia pastoris alternative oxidase promoter variants

In order to identify functional pAOD fragments the promoter variants having SEQ ID No. 3, 5, 7, 9, 11, 13 and 14 were fused to GFP as described in example 4 using appropriate primers. Expressions studies as performed in example 13 revealed that all pAOD fragments cloned are able to produce GFP under the same conditions as the native AOD promoter. The putative promoter sequence of the alternative oxidase according to SEQ ID No. 14 was amplified by overlap extension PCR from genomic DNA of strain Pichia pastoris CBS7435 in a two-step procedure. The first reaction employed the primers 5'- acaagatctctagttttcaaaacσgaat- ^• cacgataaagg-3' (P-AOD_^f7; SEQ ID No.32) and 5'- cactttcccgtcaaaggccgatttgatatcacggaaggtaagtcttcatg-3 ' ( P- AOD_EcoRI-del_r; SEQ ID No.33). The second reaction employed the primers 5 ' - catgaagacttaccttccgtgatatcaaatcggcctttgacgggaaagtg-3 ' (P-AOD_EcoRI-del_f; SEQ ID No.34) and 5'- agaattcctttgagaatagattagagcaggcc-3' (P-AOD__EcoRI r; SEQ ID No. 35) . The overlap extension PCR was performed as described in example 1. Finally the full- length product was purified and cloned into pGAPZA-GFP by BgIII and EcoRI thereby replacing the GAP promotor. The resulting plasmid pP-AOD 7 (9) was isolated from E.coli transformants and sequenced.

The six remaining alternative oxidase promotor sequences according to SEQ ID No. 3, 5, I₁ 9, 11 and 13 were amplified from the plasmid pP-AOD 7 (9) with the reverse primer 5'- agaattcctttgagaatagattagagcaggcc-3' (P-A0D_EcoRI r; SEQ ID No. 35) and the forward primers 5'- acaagatcttgcaactcctcctaaaacta- catcg-3' (P-AOD_fl; SEQ ID No.36), 5' -acaagatctc-cacact- caaatcccgaacag-3' (P-AOD__f2; SEQ ID No.37), 5'- acaagatctcaagactacagcctcttagagc-3' (P-AOD_f3; SEQ ID No.38), 5'- acaagatctaacccggtcagaaacctaatcac-3 ' (P-AOD_f4; SEQ ID No.39), 5 '- acaagatctatgaaagcgcgaaagagagagatc-3' (P-AOD_f5; SEQ ID No.40) and 5'- acaag-atctaacctctctggaaagaccattcaac-3 ' (P-AOD_f6; SEQ ID No.41), respectively.

The resulting PCR products were purified and cloned into pGAPZA-GFP by BgIII and EcoRI and transformed into E. coli, Plasmid DNA was isolated from transformants and controlled by restriction analysis and sequencing. The resulting plasmids were named pPAOD 1(2), pPAOD 2(1), pPAOD 3(1), pPAOD 4(2), pPAOD 5(2) and pPAOD 6(5) .

To estimate if the EcoRI site mutation influences the expression behaviour of the promoter the EcoRI cutting site was reintroduced into the pPAOD 2(1), pPAOD 3(1) and pPAOD 4(2) plasmids. The site directed mutagenesis were performed as follows :

Two 50μl PCR reaction mixtures one employed with the regarding plasmid and forward primer 5'- catgaagacttaccttccgt- gaattcaaatcggcctttgacgggaaagtg-3' (P-AOD EcoRI f, SEQ ID No.42), the other one with the regarding plasmid and reverse primer 5'- cactttcccgtcaaaggcc-gatttgaattcacggaaggtaagtcttcatg-3 ' (P- AOD_EcoRI__rv, SEQ ID No.43) were prepared. A 22 cycle PCR pro- gramm was devised according the specifications of the applied polymerase. The annealing time was set to fit the Tm of the primers. The extension time was set for amplification of the full length product. After 4 cycles the reaction was stopped and from each solution 25μl were taken and used for a new PCR reaction. With this solution the final cycles were performed. The resulting PCR products were Dpnl digested and transformed into E.coli. Plasmid DNA was isolated from transformants and controlled by restriction analysis and sequencing. The resulting plasmids were named pPAOD 2_EcoRI, pPAOD 3_EcoRI and pPAOD 4_EcoRI .

Additionally to these promoter variants fusions were made between the promoter variants based on SEQ ID No. 5, 7, 9 and the basal AOXl promoter according to SEQ ID No.44. The alternative oxidase promoter part got amplified with the regarding forward primer (P-AOD_f2; SEQ ID No.37, P-AOD_f3; SEQ ID No.38 and P-AOD_f4; SEQ ID No.39) and 5'- aaaacttaagcctatgcagt- cactttcccgtc-3' (AOD-BspTI-rv, SEQ ID No.45). The resulting PCR products were purified and cloned into pAOX176-GFP by BgIII and BspTI. The resulting plasmids pPAOD 2-AOX, pPAOD 3-A0X and pPAOD 4-AOX were transformed into E. coli. Plasmid DNA was isolated from transformants and controlled by restriction analysis and sequencing.

Example 19: Transformation of the alternative oxidase promoter variants in Pichia pastoris and measurement of constitutive cycle-3-GFP expression.

The assembled alternative oxidase promoter constructs, described in example 18, were used for constitutive expression of cycle-3-GFP in Pichia pastoris. Transformation of Pichia pastor- is was performed as described in example 6 by electroporation. All plasmids were linearised with BamHl prior transformation to facilitate integration into the genome. The copy numbers of the promoter variants have been confirmed by real- time PCR. The resulting strains have been designated Pichia pastoris P- AOD_1 (the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 3), Pichia pastoris P-AOD_2 (the double copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 5), Pichia pastoris P-A0D_3 (the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. I)₁ Pichia pastoris P-AOD_4 (the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 9) , Pichia- pastoris P-AOD_5 (the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 11), Pichia pastoris P-AOD_6 (the single copy strain expressing cycle-3-GFP under the cont'rol of the promoter variant according to SEQ ID No. 13), Pichia pastoris P-AOD__7 (the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 14) , Pichia pastoris P-AOD 2__EcoRI (the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 2) , Pichia pastoris P-AOD 3_EcoRl (the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 4), Pichia pastoris P-AOD 4_EcoRI (the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 6), Pichia pastoris P-AOD 2-AOX (the single copy strain expressing cycle-3-GFP under the control of the P-AOD 2-AOX176 fusion), Pichia pastoris P-AOD 3-A0X (the single copy strain expressing cycle-3-GFP under the control of the P-AOD 3-A0X fusion) and Pichia pastoris P-AOD 4-AOX (the single copy strain expressing cycle-3-GFP under the control of the P-AOD 4-A0X fusion.

^'Micro- scale cultures were made in 400μl buffered minimal media containing 1% glucose (BMD1%) . The generated strains were inoculated and grown for 6Oh at 28⁰C and 80% relative humidity under constant shaking (320rpm) . After 24h, 48h and 6Oh samples were taken and analysed. The quantification of GFP and optical density was performed in black micro-titer plates (Greiner Bio- One) containing 50μl cells in a total volume of 200μl per well. The optical density was measured at 595nm with a SPECTRAmax® Plus384 plate reader (Molecular Devices, Germany) and cycle-3- GFP was detected with a SPECTRAmax® Gemini XS plate reader (Molecular Devices, Germany) . The fluorescence was measured at 507nm, the excitation wavelength was 395nm and the cut-off filter was set at 495nm. Single measurements of four independent cultivations have been performed per strain. The second promoter variant, according to SEQ ID No. 5, shows the highest promoter activity (Figure 9) . Assuming the double copy strain of the Pichia pastoris P-AOD_2 produces twice as much of cycle~3- GFP as a putative single copy strain of this promoter variant, no significant difference in expression behaviour between the original promoter sequence with the EcoRI restriction site and the AOD 2~ AOX promoter fusion was found.

Example 20: Expression activity of the alternative oxidase promoter variants on different C-sources

500 μl buffered minimal media containing 0.2% glucose (BMDO.2%) per well in a deep well plate were inoculated with single colonies of the generated strains. The cultures were grown for 48 h at 320 rpm, 28⁰C and 80% humidity in an Infors Multitron II Shaker (Infors AG, Switzerland) . 5 μl of this pre- cultures were used for inoculation of 500 μl buffered minimal media containing 1% glucose or 0.5% glycerol (BMD1% or BMGO.5%) respectively. Four independent cultures were performed per strain. After 24 h, 48 h and 60 h of cultivation samples were taken and optical density and fluorescence was measured as described in example 19. Fig. 10 shows specific promoter activity as judged by relative fluorescence intensity (EX395/EM507) per optical density (OD595) after 48 h of cultivation in BMD1% and BMGO.5% in deep well plates as described in example 20. The background fluorescence values of untransformed Pichia pastoris X-33 were subtracted from those of the recombinant strains. P-AOD_1 (s.c): the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 3

P-AOD_2 (d.c): the double copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 5

P-AOD_4 (s.c): the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 9

P-AOD_6 (s.c): the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 13

P-AOD__7 (s.c): the single copy strain expressing cycle-3-GFP under the control of the promoter variant according to SEQ ID No. 14 P-AOD2_EcoRI (S.C) : the single copy strain expressing cycle-3- GFP under the control of the promoter variant according to SEQ ID No. 2

P-AOD2-AOX (s.c): the single copy strain expressing cycle-3-GFP under the control of the P-AOD2-AOX176 fusion

Claims

Claims :

1. Nucleic acid promoter comprising a sequence having at least 70% identity to SEQ ID No. 1 or a functional fragment thereof, or a sequence which hybridises thereto under stringent conditions .

2. Nucleic acid promoter according to claim 1, characterised in that the functional fragment consists of nucleotides 501 to 2000, preferably of nucleotides 1001 to 2000, preferably of nucleotides 1242 to 2000, preferably of nucleotides 1499 to 2000, preferably of nucleotides 1681 to 2000, preferably of nucleotides 1816 to 2000, of SEQ ID No. 1.

3. Nucleic acid promoter according to claim 1 or 2, characterised in that the nucleic acid promoter or functional fragment is selected from the group consisting of SEQ ID No. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 46 and 47.

4. Nucleic acid promoter according to any one of claims 1 to 3, characterised in that the nucleic acid promoter or functional fragment is operably linked to at least one second nucleic acid promoter or variant or fragment thereof.

5. Nucleic acid promoter according to claim 4, characterised in that the at least one second nucleic acid promoter is selected from the group consisting of alcohol oxidase 1 promoter (AOXl promoter), AOX2, ZZAl, CUPl, GAP, FLD, TEFl, FEF2, DASl, DAS2 or variants thereof. ^■

6. Nucleic acid promoter according to claim 4 or 5, characterised in that the at least one second nucleic acid promoter is an AOXl promoter, wherein the nucleic acid promoter operably linked to said at least one second nucleic acid promoter comprises a nucleotide sequence selected from the group consisting of SEQ ID No. 48, 49 and 50.

7. Expression cassette comprising a nucleic acid promoter according to any one of claims 1 to 6 operably linked to at least one nucleic acid molecule encoding a peptide, polypeptide, pro- tein or functional nucleic acid.

8. Vector comprising a nucleic acid promoter according to any one of claims 1 to 6 or an expression cassette according to claim 4.

9. Vector according to claim 8, characterised in that said vector further comprises at least one cloning site, at least one gene or gene fragment encoding a selection marker, a secretion cassette and/or at least one origin of replication.

10. Vector according to claim 8 or 9, characterised in that the vector comprises at least one second nucleic acid promoter oper- ably linked to at least one second nucleic acid molecule encoding a peptide, polypeptide, protein or functional nucleic acid.

11. Vector according to claim 10, characterised in that said at least one second nucleic acid promoter is selected from the group consisting of alcohol oxidase 1 promoter (AOXl promoter) , AOX2, ZZAl, CUPl, GAP, FLD, TEFl, FEF2, DASl, DAS2 or variants thereof.

12. Host cell comprising a nucleic acid promoter according to any one of claims 1 to 6, an expression cassette according to claim 7 and/or a vector according to any one of claims 8 to 11.

13. Host cell according to claim 12, characterised in that the host is a eukaryote, preferably a fungus, more preferably a fungus of the genus Aspergillus, or a yeast, more preferably a yeast of the genus Pichia, in particular Pichia pastoris, Sac- charomyces, in particular Saccharomyces cerevisiae, Hansenula, in particular Hansenula polymorpha or Candida.

14. Host cell according to claim 12 or 13, characterised in that the expression cassette is integrated into the genomic DNA of the host cell.

15. Method for the recombinant production and the optional isolation of at least one peptide, polypeptide, protein, metabolites or functional nucleic acid comprising the steps: a) providing a host cell according to any one of claims 12 to 14, b) incubating the host cell in a first culture medium, c) optionally incubating the host cell in a second culture medium and d) optionally isolating the peptide, polyp-eptide, protein, metabolites or functional nucleic acid from the supernatant or from the host cells, wherein the first and/or second culture medium comprises a carbon source, preferably glucose or glycerol for the induction of the expression of the at least one peptide, polypeptide, protein or functional nucleic acid.

16. Method according to claim 15, characterised in that the first and/or second and/or at least one further culture medium comprise at least one further inductor for the at least one second nucleic acid promoter.

17. Method according to claim 16, characterised in that the at least one further inductor is methanol when the at least one second nucleic acid promoter is an AOXl promoter, DASl, DAS2, FDH or FLD or methylamine or cholin, when the at least one second nucleic acid promoter is a FLD promoter.

18. Kit for the recombinant production of at least one peptide, polypeptide, protein or functional nucleic acid comprising:

- a vector comprising a nucleic acid promoter according to any one of claims 1 to 6, and

- a host cell.

19. Kit according to claim 18, characterised in that the host cell is a eukaryote, preferably a yeast, more preferably a yeast of the genus Pichia, in particular Pichia pastoris.