WO2008055317A1 - Compositions and methods for the treatment of prostate cancer - Google Patents

Abstract

A pharmaceutical composition for inhibiting the proliferation of prostate cancer cells, said composition comprising a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of: (a) at least one LOX inhibitor (b) at least one cPLA2-α inhibitor.

Description

Compositions and Methods for the Treatment of Prostate Cancer

Cross Reference to Related Application

The application claims the benefit of Australian Provisional Patent Application No. 2006906276 filed on 10 November 2006, which is incorporated herein by reference in its entirety.

Technical Field

The present invention lies in the field of cancer treatment. More specifically, the invention relates to compositions and methods for inhibiting the proliferation of prostate cancer cells, and methods for treating prostate cancer. The compositions comprise combinations of COX inhibitors, LOX inhibitors and cPLA₂-α inhibitors.

Background

Prostate cancer is the second most commonly diagnosed cancer after skin cancer and the second most common cause of cancer-related death after lung cancer. Mortality from prostate cancer is a result of metastasis and progression to androgen refractory disease.

Eicosanoids modulate the interaction of tumor cells with various host components in cancer metastasis. Eicosanoids are bio-active metabolites of arachidonic acid (AA). As shown in Figure 1 , mobilization of AA from membrane phospholipid by phospholipase A2 (PLA₂) represents a key step in cellular responses to various stimuli (growth factors, cytokines, chemokines, and hormones). Another key step is the conversion of the released AA to prostanoids by cyclooxygenases (COX-I and COX-2), to hydroxyeicosatetraenoic acids (HETEs) by lypoxygenase (LOX: mainly 5-LOX, and 12-LOX), and to epoxyeicosatrienoic acids (EETs) by P450-dependent epoxygenase (EOX). In addition to an involvement in wound healing and inflammatory response, eicosanoids contribute to the progression of certain tumour cells. Prostaglandin E2 (PGE₂), the exclusive product of COX-I and COX-2, can promote cancer cell growth and survival via mechanisms involving Akt, p53 and cAMP. PLA₂ can be cytosolic (cPLA₂-α) or secretory (sPLA₂). cPLA₂-α activity is regulated by calcium and phosphorylation (Ser-505). Replacement of Ser-505 with Ala abolishes agonist-stimulated AA release. sPLA₂ can hydrolyse the plasma membrane phospholipids to produce AA after being secreted to the outside of cells, or internalise to activate cPLA₂-α. Both forms of PLA₂ can be inhibited by calcium-dependent phospholipid binding proteins annexin 1 (ANXl) or annexin 2 (ANX2) via a direct interaction or competition for enzyme substrates. COX-I is considered to be constitutively expressed and is likely responsible for the house-keeping function of prostanoids. In contrast, COX-2 is an immediate-early response gene that is undetectable in most mammalian tissues but is rapidly and highly inducible.

Known methods for the treatment of prostate cancer in animals involve the administration of pharmacological agents that block either COX or LOX products. cPLA₂-α plays a central role in the initiation of AA release under physiological and pathological conditions. Recently it has been shown that Annexin I (ANXl) and II

(ANX2), the inhibitors of cPLA₂-α activity, were absent from prostate cancer tissue. It has also been shown that sPLA₂-IIA, the potential activator of cPLA₂-α activity, was induced in human prostate cancer tissues, including those from patients with androgen refractory prostate cancer. Induced sPLA₂-IIA may promote proliferation as the purified SPLA₂-IIA protein stimulates prostate cancer cell growth in culture. As such, inhibitors of cPLA₂-α are also effective in the inhibition of prostate cancer cells by abolishing the growth-promoting action of SPLA₂-IIA, thereby inhibiting the release of AA.

The treatment of prostate cancer using the above methods suffers from two significant disadvantages. First, the use of certain COX inhibitors has been associated with an increased risk of cardiovascular disease resulting from vasoconstriction. Second, treatments which involve inhibition of cPLA₂-α cannot block AA release completely, meaning that certain amounts of phospholipid-bound AA will still be released, or inhibition of cPLA₂-α can lead to an increase in COX/LOX activity by a compensation mechanism. In light of the above disadvantages, there is a need for improved treatments for prostate cancer.

Summary

In a first aspect, the present invention provides a pharmaceutical composition for inhibiting the proliferation of prostate cancer cells, said composition comprising a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor. In a second aspect, the present invention provides a pharmaceutical composition for the treatment and/or prevention of prostate cancer, said composition comprising a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of : (a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor.

In a third aspect, the present invention provides a method for inhibiting the proliferation of prostate cancer cells, said method comprising subjecting the cells to a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor.

In a fourth aspect, the present invention provides a method for the treatment and/or prevention of prostate cancer in a patient in need of said treatment, the method comprising administering to the patient a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor.

The patient may be a mammal. In one embodiment, the mammal is a human. The COX inhibitor may be an NSAID. The COX inhibitor may be a selective inhibitor, capable of inhibiting COX-I or COX-2. Alternatively, the COX inhibitor may be a non-selective inhibitor, capable of inhibiting COX-I and COX-2.

The COX inhibitor may be selected from the group consisting of: ibuprofen and celecoxib. The LOX inhibitor may be an inhibitor that inhibits any one or all of 5 -LOX, 8-

LOX, 11 -LOX, 12-LOX or 15-LOX.

The LOX inhibitor may be a 5 -LOX inhibitor or a 12-LOX inhibitor. Alternatively, the LOX inhibitor may be a 5-LOX inhibitor and a 12-LOX inhibitor.

The LOX inhibitor may be selected from the group consisting of: MK886 and baicalein.

The cPLA₂-α inhibitor may be selected from the group consisting of: pyrrophenone, methylarachidonyl fluorophosphate, methyl trifluoromethyl ketone and 4-(3-{l- Benzyhdryl-5-chloro-2-[2-(3,4-dichloro-phyenylmethane-sulfonylamino)-ethyl]-lH- indol-3-yl}propyl)benzoic acid (also known as Efipladib or Wyeth-1). In one embodiment, the CPLA₂-Oc inhibitor may be selected from the group consisting of pyrrophenone, annexin and Wyeth-1.

In one embodiment, the composition may comprise a COX inhibitor and a LOX inhibitor. Alternatively, the composition may comprise a CPLA₂-CC inhibitor and a COX inhibitor. In another embodiment, the composition may comprise a COX inhibitor, a LOX inhibitor and a cPLA₂-α inhibitor.

In a further embodiment, the composition may be selected from the group consisting of: a combination of a COX-I and COX-2 inhibitor and a 5-LOX inhibitor, and a combination of a COX-2 inhibitor and a cPLA₂-α inhibitor. In these combinations, the COX-I and COX-2 inhibitor may be ibuprofen, the COX-2 inhibitor may be celecoxib, the 5-LOX inhibitor may be MK886 and the cPLA₂-α inhibitor may be pyrrophenone or Wyeth-1.

In the third and fourth aspects of the invention, the at least one COX inhibitor, and either one or both of: (a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor may be administered simultaneously.

In the fourth aspect, the administration may be topical or systemic.

In another aspect, the present invention provides the use of a synergistic combination of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor, for the manufacture of a medicament for treatment or prevention of prostate cancer.

In a further aspect, the present invention provides the use of a synergistic combination of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor, for the treatment or prevention of prostate cancer.

In another aspect, the present invention provides the use of a synergistic combination of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-cc inhibitor, for the manufacture of a medicament for the inhibition of prostate cancer cell proliferation. In a further aspect, the present invention provides the use of a synergistic combination of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor, for the inhibition of prostate cancer cell proliferation.

In an alternative aspect, the present invention provides a pharmaceutical composition for inhibiting the proliferation of prostate cancer cells, said composition comprising a synergistic combination of a therapeutically effective amount of a LOX inhibitor and a cPLA₂-α inhibitor. In another alternative aspect, the present invention provides a pharmaceutical composition for the treatment and/or prevention of prostate cancer, said composition comprising a synergistic combination of a therapeutically effective amount of a LOX inhibitor and a cPLA₂-α inhibitor.

In a further alternative aspect, the present invention provides a method for inhibiting the proliferation of prostate cancer cells, said method comprising subjecting the cells to a synergistic combination of a therapeutically effective amount of a LOX inhibitor and a cPLA₂-α inhibitor.

In another alternative aspect, the present invention provides a method for the treatment and/or prevention of prostate cancer in a patient in need of said treatment and/or prevention, the method comprising administering to the patient a synergistic combination of a therapeutically effective amount of a LOX inhibitor and a cPLA₂-α inhibitor.

With reference to the above aspects of the invention, therapeutic advantages may be realised through combination regimens. In combination therapy, the respective inhibitors may be applied in conjunction with conventional methods of therapy, such as radiotherapy, chemotherapy, surgery, or other forms of medical intervention.

Brief Description of the Drawings

A preferred embodiment of the present invention will now be described, by way of example only, with reference to the accompanying drawings wherein:

Flowchart Diagram 1 illustrates the pathway of eicanosanoid production from membrane phospholipid-bound arachidonic acid.

Figure 1 shows a graph illustrating the effect of pyrrophenone (P2) treatment on three prostate cancer cell lines. Three columns are shown at each concentration of pyrrophenone (column 1: LNCaP cells; Column 2: PC3 cells; Column 3: DU145 cells). *P<0.05 vs no drug treatment.

Figures 2A-2D show an immunohistochemical analysis of cPLA₂-α activity in LNCaP cells. LNCaP cells treated with 0, 7, 14 or 21μM (Figure 2A₅ 2B, 2C, 2D respectively) of Wyeth-1 for 72 hours were stained for phospho-cPL A₂-Oc. Positive cells are stained dark.

Figure 2E shows a graph illustrating the percentage of phospho-cPLA₂-α positive LNCaP cells following Wyeth-1 treatment after 72 hours. Values are derived from mean results of 2 independent experiments + standard deviation. * P = <0.05. Figure 2F shows viable LNCaP cells with MTS analysis using a 0 - 24μM does titration. Values plotted represent the mean results of 3 independent experiments + standard deviation. Absorbance values (490nm) were measured relative to the absorbance of the untreated control (DMSO).

Figures 3A-3D show an immunohistochemical analysis of BrdU positive cells, an indication of the effect of Wyeth-1 treatment on prostate cancer cell proliferation after 72 hours. Proliferating cells are stained dark. Figure 3A (DMSO control), Figure 3B (7μM Wyeth-1), Figure 3C (14μM Wyeth-1), Figure 3D (21 μM Wyeth-1).

Figure 3E shows a graph illustrating the percentage of BrdU positive LNCaP cells following Wyeth-1 treatment after 72 hours. Values are derived from mean results of 2 independent experiments + standard deviation. * P = <0.05.

Figure 4 is a graph showing a tumour growth rate timecourse following cPLA₂-α inhibition with pyrrophenone (P2) in a PC3 cell xenograph model of human prostate cancer. Tumour volume was measured in mm³.

Figures 5 A and 5B are photographs of Western blots used to detect COX-I in pyrrophenone (P2)-treated PC3 cells (Figure 5A) and LNCaP cells (Figure 5B).

Figure 6 is a graph showing prostaglandin E2 (PGE₂) release in LNCaP cells and PC3 cells, following treatment with siRNA to cPLA₂-α in each case. * P = 0.01 by ANOVA vs control.

Figure 7 is a graph illustrating the effect of pyrrophenone (P2) (IC₅o) and ibuprofen (1 mM) on cell viability as measured by an MTS assay. 1 -LNCaP cells; 2-PC3 cells; 3- Fibroblast; 4-embryonic kidney cells; 5-liver cells (H2.35) * P=0.01 vs untreated individual control as 100%. Figure 8A is a photograph of a Western blot showing total and phospho-Akt levels in LNCaP cells treated with 0 (DMSO), IC25 (7μM), IC50 (14μM), and IC75 (21 μM) doses of Wyeth-1 after 72 hours.

Figure 8B is a photograph of a Western blot showing total and phospho-GSK3β levels in LNCaP cells treated with 0 (DMSO), IC25 (7μM), IC50 (14μM), and IC75 (21μM) doses of Wyeth-1 after 72 hours.

Figure 9 A is a photograph of a Western blot showing cyclin Dl expression in LNCaP cells treated with 0 (DMSO, IC25 (7μM), IC50 (14μM), and IC75 (21μM) doses of Wyeth-1 after 72 hours, α-tubulin was used as a loading control. Figure 9B is a graph showing the percentage of cyclin Dl positive LNCaP cells following treatment with Wyeth-1 for 72 hours.

Figure 9c is a graph showing the percentage of p21 (waf/cip) positive LNCaP cells following treatment with Wyeth-1 for 72 hours. Values are derived from mean results of 2 independent experiments + standard deviation. * P = <0.05. Figure 10 shows a graph which compares the effect of a single inhibitor and multiple inhibitors on the relative cell viability of prostate cancer cells.

Definitions

The following are some definitions that may be helpful in understanding the description of the present invention. These are intended as general definitions and should in no way limit the scope of the present invention to those terms alone, but are put forth for a better understanding of the following description.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers, but not the exclusion of any other step or element or integer or group of elements or integers. Thus, in the context of this specification, the term "comprising" means "including principally, but not necessarily solely".

As used herein, the term "synergistic" refers to a greater than additive effect that is produced by a combination of the inhibitors, which exceeds the effect that would otherwise result from use of the inhibitors alone.

A "therapeutically effective amount", as used herein, includes within its meaning a non-toxic but sufficient amount of the particular inhibitor to which it is referring to provide the desired therapeutic effect. The exact amount required will vary from subject to subject depending on factors such as the patient's general health, the patient's age and the stage and severity of the cancer.

As used herein, the term "prevention" includes either preventing the onset of clinically evident cancer altogether, or delaying its onset. As used herein, the term "treatment" includes partial or total inhibition of cancer growth, as well as partial or total destruction of the cancer cells.

As used herein, the term "simultaneously" when referring to simultaneous administration of the relevant inhibitors means at exactly the same time, as would be the case for example in embodiments where the inhibitors are combined in a single preparation. "Simultaneously" may also mean one inhibitor taken a short duration after another, wherein "a short duration" means a duration which allows the inhibitors to have their intended synergistic effect. A short duration for preferred embodiments of the invention would be up to and including 12 hours.

Detailed Description The inventors have identified that compositions comprising at least two or more of a cPLA2 inhibitor, a COX inhibitor and a LOX inhibitor produce a synergistic effect beneficial for inhibiting the proliferation of prostate cancer cells. Accordingly, the invention provides compositions and methods for the inhibition of prostate cancer cell proliferation. The invention also provides compositions and methods for the treatment and/or prevention of prostate cancer.

The combination of a COX inhibitor and either one or both of a LOX inhibitor and a cPLA2 inhibitor has been found to produce a synergistic effect for the purpose of treating prostate cancer. Without wishing to be bound by a particular mechanism, it is believed that a coupling mechanism between cPLA₂-α and COX-I in prostate cancer cells exists whereby reducing or blocking cPLA₂-α increases COX-I levels and PGE₂ production. COX-2 is present but not induced. Thus, while reducing or blocking cPLA₂- α alone may have the effect of suppressing prostate cancer cell growth by restricting the availability of free arachidonic acid and lysophospholipid, the associated induction of COX-I levels and PGE₂ production may promote further mitogenesis, mutagenesis and angiogenesis which in turn may underlie the presence of cancer cells resistant to cPLA₂ inhibition.

A similar induction in COX-I and PGE₂ production is observed with inhibitors to 5- and 12-lypoxygenase (LOX). Hence, while the inhibition of LOX alone may have the effect of decreasing HETE levels, the associated induction of COX-I levels and PGE₂ production may be detrimental. It is believed that COX-I may be inducible in prostate cancer cells. cPLA₂-α inhibition may enhance COX-I expression and PGE₂ production via a decreased LOX production of 5-HETE and 12-HETE, which normally exert a tonic suppressive role on COX-I rather than COX-2 gene transcription. A decrease in HETE levels, as the result of cPLA₂-α inhibition, may remove the suppression of COX-I gene expression causing increased COX-I protein levels and PGE₂ production. Accordingly, combinations of a COX inhibitor and either one or both of a LOX inhibitor and a cPLA₂ may produce a synergistic effect, whereby COX-mediated PGE₂ production induced by cPLA₂-α and/or LOX inhibition and the detrimental effects associated therewith may be alleviated by the inclusion of a COX inhibitor.

COX inhibitors

COX inhibitors useful in the compositions and methods of the invention include both selective (i.e. inhibitors of COX-I or C0X-2) and non-selective COX inhibitors (i.e. inhibitors of COX-I and COX-2).

C0X-2 inhibitors are well known in the art and have been described in the following patents/applications: JP08157361, US5510368, US5681842, US5686460,

US5776967, US5783597, US5824699, US5830911, US5859036, US5869524, W094/13635, W094/20480, W094/26731, W095/00501, W095/21817, W096/03385,

W096/03387, W096/06840, W096/09293, W096/09304, W096/13483, W096/16934,

W096/19462, W096/19463, W096/19469, W096/21667, W096/23786, W096/24584,

W096/24585, W096/25405, W096/26921, W096/31509, W096/36617, W096/36623,

W096/37467, W096/37469, W096/38418, W096/38442, W096/40143, W097/03953, W097/09977, W097/13755, W097/13767, W097/14691, W097/16435, W097/25045 and

W097/25046, the disclosures of which is incorporated herein by reference.

The COX inhibitor may be an NSAID.

The NSAID may be selected from the group consisting of: salicylates, arylalkanoic acids, 2-arylpropionic acids (profens), N-arylanthranilic acids (fenamic acids), pyrazolidine derivatives, oxicams, coxibs and sulfonanilides.

The salicylate may be selected from the group consisting of: aspirin, amoxiprin benorilate, choline magnesium salicylate, diflunisal, faislamine, methyl salicylate, salicyl salicylate (salsalate). The arylalkanoic acid may be selected from the group consisting of: diclofenac, aceclofenac, acemetacin, bromfenac, etodolac, indometacin, ketorolac, nabumetone, sulindac and tolmetin.

The 2-arylpropionic acid may be selected from the group consisting of: ibuprofen, carprofen, fenbufen, fenoprofen, flurbiprofen, ketoprofen loxoprofen, naproxen and tiaprofenic acid.

The N-arylanthranilic acid may be selected from the group consisting of: mefenamic acid, meclofenamic acid and tolfenamic acid.

The pyrazolidine derivative may be selected from the group consisting of: phenylbutazone, azapropazone, metamizole and oxyphenbutazone.

The oxicam may be selected from the group consisting of: piroxicam, lornoxicam, meloxicam and tenoxicam.

The coxib may be selected from the group consisting of: celecoxib, etoricoxib, lumiracoxib and parecoxib. The sulfonanilide may be nimesulide.

The COX inhibitor may be licofelone.

LOX inhibitors

LOX inhibitors are also well known in the art and have been described in the literature. LOX inhibitors useful in the present invention include 5-LOX, 8-LOX, 11-

LOX, 12-LOX and 15-LOX inhibitors, or any combinations thereof.

Examples of suitable LOX inhibitors include, but are not limited to: 3-[l-(4- chlorobenzyl)-3-t-butyl-thio-5-isopropylindol-2-yl]-2,2-dimethylpropanoic acid (MK886) or derivatives thereof, 3-(l-(4-chlorobenzyl)-3-(l-butyl-thio)-5-(quinolin-2-yl-methoxy)- indol-2-y l)-2,2-dimethyl propanoic acid) (MK-591) or derivatives thereof, nordihydroguaiaretic acid (NDGA) or derivatives thereof, 5,6,7-Trihydroxy-2-phenyl-4H- l-benzopyran-4-one (Baicalein) and licofelone.

CPLA₂-CC inhibitors cPLA₂-α inhibitors useful in the compositions and methods of the invention include, but are not limited to those disclosed in WO2004/064822, the disclosure of which is incorporated herein by reference. Specific examples of CPLA₂-O, inhibitors include pyrrophenone, methylarachidonyl fluorophosphate, methyl trifluoromethyl ketone and 4-(3-{ 1 -Benzyhdryl-5-chloro-2-[2-(3,4-dichloro-phyenylmethane-sulfonylamino)- ethyl]-lH-indol-3-yl}propyl)benzoic acid (also known as Efipladib or Wyeth-1).

Antisense inhibitors of cPLA₂-a, COX and LOX gene expression CPLA₂-OC, COX and LOX gene expression may be reduced or inhibited by a homologous antisense nucleic acid. Accordingly, the activity of these enzymes may be reduced thereby providing a means of inhibiting of prostate cancer cell proliferation. The synergistic combinations of the invention may thus administered in combination with antisense inhibitors of cPLA₂-α, COX and LOX gene expression. Therapeutic or prophylactic use of such nucleic acids of at least 5 nucleotides, generally up to about 200 nucleotides, that are antisense to a gene of complementary DNA (cDNA) encoding a cPLA₂-α, COX or LOX protein is also provided herein. Such an antisense nucleic acid may be capable of hybridising to a portion of the RNA precursor (generally mRNA) of a cPLA₂-α, COX or LOX protein, by virtue of some sequence complementarity, and generally under high stringency conditions. The antisense nucleic acid may be complementary to a coding and/or non-coding region of the RNA precursor of the cPLA₂-α, COX or LOX protein. Absolute complementarity to the full RNA precursor of the cPLA₂-α, COX or LOX protein is not required. Antisense nucleic acids in this form have utility as therapeutics that reduce or prostate cancer cell proliferation, and may be used in combination with one or more of a CPLA₂-Oc inhibitor, a COX inhibitor and a LOX inhibitor producing a synergistic effect resulting in the inhibition of prostate cancer cell proliferation. Such combinations can thus be used for the prevention/treatment of prostate cancer. The antisense nucleic acids complementary to the RNA precursor of the CPLA₂-OC, COX or LOX protein may be of at least five nucleotides and are generally oligonucleotides which range in length from 5 to about 200 nucleotides. For example, the anti-sense oligonucleotide is at least 10 nucleotides, at least 15 nucleotides, at least 100 nucleotides, at least 125 nucleotides, at least 150 nucleotides, or at least 175 nucleotides. The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single- stranded or double-stranded. The anti-sense nucleic acid complementary to the RNA precursor of the cPLA₂-α,

COX or LOX protein can be modified at any position on its structure using substituents generally known in the art. The anti-sense nucleic acid may include at least one modified base moiety which is selected from the group including, but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, 2,2- dimethylguanine, 2-methyl- adenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5- s methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5'- methoxycarboxymethyluracil, pseudouracil, 2-thiocytosine, 5- methyl-2-thiouracil, 2- thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5- oxyacetic acid (v), queosine, wybutoxosine, 5-methyl-2-thiouracil, 3- (3-amino-3-N-2- carboxypropyl) uracil, and 2,6-diaminopurine. it) The anti-sense nucleic acid complementary to the RNA precursor of the cPLA₂-α,

COX or LOX protein may include at least one modified sugar moiety, such as arabinose, 2-fluoroarabinose, xylulose, and hexose. The antisense nucleic acid may also include at least one modified phosphate backbone selected from a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a is methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof. The anti-sense nucleic acid can be conjugated to another molecule, such as a peptide, hybridisation triggered cross-linking agent, transport agent or a hybridisation-triggered cleavage agent.

Expression of the sequence encoding anti-sense nucleic acid complementary to the0 RNA precursor of the cPLA₂-α, COX or LOX protein can be by any promoter known in the art to act in mammalian, including human, cells, and may include inducible or constitutive promoters.

RNA interference (RNAi) (see, for example, Chuang et al. (2000) PNAS 97: 4985) can be employed to inhibit the expression of a gene encoding a cPLA₂-α, COX or LOX5 protein. Interfering RNA (RNAi) fragments, particularly double-stranded RNAi, can be used to generate loss of cPLA₂-α, COX or LOX protein. Methods relating to the use of RNAi to silence genes in organisms are known, for instance, Fire et al. (1998) Nature 391 : 806-811 ; Hammond, et al. (2001) Nature Rev, Genet. 2: 110-1119; Hammond et al. (2000) Nature 404: 293-296; Bernstein et al. (2001) Nature 409: 363-366; Elbashir et al0 (2001) Nature 411: 494-498; International PCT application No. WO 01/29058 ; and International PCT application No. WO99/32619), the disclosures of which are incorporated herein by reference.

Double-stranded RNA expressing constructs are introduced into a host using a replicable vector that remains episomal or integrates into the genome. By selecting appropriate sequences, expression of dsRNA can interfere with accumulation of endogenous mRNA encoding an IL-IO homologue.

Other inhibitors of eicosaniod synthesis

5 The synergistic combinations of the invention may be administered in combination with other inhibitors of eicosaniod synthesis, for example, an epoxygenase (EOX) inhibitor, or a phyto-product. A phyto-product is a combination of natural plant derivatives with anti-cPLA2, COX and LOX activities. o Pharmaceutical compositions and routes of administration

The pharmaceutical compositions of the present invention may be administered therapeutically. In a therapeutic application, the compositions may be administered to a patient already suffering from prostate cancer in an amount sufficient to cure, or at least partially arrest the cancer and its complications. Single or multiple administrations of thes pharmaceutical compositions can be carried out with dose levels and pattern being selected by the treating physician.

The therapeutically effective dose level for any particular patient will depend upon a variety of factors including: the severity of the prostate cancer, the composition employed, the age, body weight, general health and diet of the patient, the time of0 administration, the route of administration, the duration of the treatment, drugs used in combination or coincidental with the synergistic composition, together with other related factors well known in medicine.

One skilled in the art would, by routine experimentation, be able to determine an effective, non-toxic amount of this treatment regime which would be required to treatS prostate cancer with the synergistic combination of the present invention.

In the methods of the invention, the amounts of the inhibitors administered may be in the range of about 0.0001 mg to about 1000 mg per kg body weight; for example, about 0.001 mg to about 750 mg per kg body weight; about 0.01 mg to about 500 mg per kg body weight; about 0.1 mg to about 500 mg per kg body weight; about 0.1 mg to about0 250 mg per kg body weight; or about 1.0 mg to about 250 mg per kg body weight. More suitably, an effective dosage per 24 hours may be in the range of about 1.0 mg to about 200 mg per kg body weight; about 1.0 mg to about 100 mg per kg body weight; about 1.0 mg to about 50 mg per kg body weight; about 1.0 mg to about 25 mg per kg body weight; about 5.0 mg to about 50 mg per kg body weight; about 5.0 mg to about 20 mg per kg body weight; or about 5.0 mg to about 15 mg per kg body weight.

Further, it will be apparent to one of ordinary skill in the art that the optimal quantity and spacing of individual dosages of the compositions of the present invention will be determined by the nature and extent of the cancer, the form, route and site of administration, and the nature of the particular patient being treated. Also, such optimum conditions can be determined by conventional techniques.

It will also be apparent to one of ordinary skill in the art that the optimal course of treatment, such as the number of doses of the composition of the present invention given per day for a defined number of days, can be ascertained by those skilled in the art using conventional course of treatment determination tests.

In general, pharmaceutical compositions of the present invention may be prepared according to methods which are known to those of ordinary skill in the art, and accordingly may include a pharmaceutically acceptable carrier, diluent and/or adjuvant. The compositions may be administered by standard routes. In general, the compositions may be administered by the parenteral (e.g., intravenous, intraspinal, subcutaneous or intramuscular), oral or topical route. Administration may be systemic, regional or local. The compositions are preferably administered by the oral route.

The route of administration to be used in any given circumstance will depend on a number of factors, including the severity and extent of the prostate cancer, the required dosage, the compounds being delivered and any potential side effects of the compounds.

The carriers, diluents and adjuvants must be "acceptable" in terms of being compatible with the other components of the composition, and not deleterious to the recipient thereof. Examples of pharmaceutically acceptable carriers or diluents are demineralised or distilled water, saline solution, vegetable based oils such as peanut oil, safflower oil, olive oil, cottonseed oil, maize oil, sesame oils such as peanut oil, safflower oil, olive oil, cottonseed oil, maize oil, sesame oil, arachis oil or coconut oil; silicone oils, including polysiloxanes, such as methyl polysiloxane, phenyl polysiloxane and methylphenyl polysolpoxane; volatile silicones, mineral oils such as liquid paraffin, soft paraffin or squalane; cellulose derivatives such as methyl cellulose, ethyl cellulose, carboxymethylcellulose, sodium carboxymethylcellulose or hydroxypropylmethylcellulose, lower alkanols, for example ethanol or iso-propanol; lower aralkanols, lower polyalkylene glycols or lower alkylene glycols, for example polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1,3- butylene glycol or glycerine, fatty acid esters such as isopropyl palmitate, isopropyl myristate or ethyl oleate, polyvinylpyrridone, agar, carrageenan; gum tragacanth or gum acacia, and petroleum jelly. The carrier or carriers may form from between 10% to 99.9% by weight of the compositions. The pharmaceutical compositions of the invention may be in the form of a composition in a form suitable for administration by oral ingestion (such as capsules, tablets, caplets and elixirs, for example), in the form of an ointment, cream or lotion suitable for topical administration, in a form suitable for delivery as an eye drop, in an aerosol form suitable for administration by inhalation, such as by intranasal inhalation or oral inhalation, in a form suitable for parenteral administration, that is subcutaneous, intramuscular or intravenous injection.

For administration as an injectable solution or suspension, non-toxic parenterally acceptable diluents or carriers can include Ringer's solution, isotonic saline, phosphate buffered saline, ethanol and 1,2-propylene glycol. Some examples of suitable carriers, diluents, excipients and adjuvants for oral use include peanut oil, liquid paraffin, sodium carboxymethylcellulose, methylcellulose, sodium alginate, gum acacia, gum tragacanth, dextrose, sucrose, sorbitol, mannitol, gelatine and lecithin. In addition, these oral formulations may contain suitable flavouring and colourings agents. When used in capsule form the capsules may be coated with compounds such as glyceryl monostearate or glyceryl distearate which delay disintegration.

Adjuvants typically include emollients, emulsifϊers, thickening agents, preservatives, bactericides and buffering agents.

Solid forms for oral administration may contain binders acceptable in human and veterinary pharmaceutical practice, sweeteners, disintegrating agents, diluents, flavourings, coating agents, preservatives, lubricants and/or time delay agents. Suitable binders include gum acacia, gelatine, corn starch, gum tragacanth, sodium alginate, carboxymethylcellulose or polyethylene glycol. Suitable sweeteners include sucrose, lactose, glucose, aspartame or saccharine. Suitable disintegrating agents include corn starch, methylcellulose, polyvinylpyrrolidone, guar gum, xanthan gum, bentonite, alginic acid or agar. Suitable diluents include lactose, sorbitol, mannitol, dextrose, kaolin, cellulose, calcium carbonate, calcium silicate or dicalcium phosphate. Suitable flavouring agents include peppermint oil, oil of wintergreen, cherry, orange or raspberry flavouring. Suitable coating agents include polymers or copolymers of acrylic acid and/or methacrylic acid and/or their esters, waxes, fatty alcohols, zein, shellac or gluten. Suitable preservatives include sodium benzoate, vitamin E, alpha-tocopherol, ascorbic acid, methyl paraben, propyl paraben or sodium bisulphite. Suitable lubricants include magnesium stearate, stearic acid, sodium oleate, sodium chloride or talc. Suitable time delay agents include glyceryl monostearate or glyceryl distearate.

Liquid forms for oral administration may contain, in addition to the above agents, a liquid carrier. Suitable liquid carriers include water, oils such as olive oil, peanut oil, sesame oil, sunflower oil, safflower oil, arachis oil, coconut oil, liquid paraffin, ethylene glycol, propylene glycol, polyethylene glycol, ethanol, propanol, isopropanol, glycerol, fatty alcohols, triglycerides or mixtures thereof.

Suspensions for oral administration may further comprise dispersing agents and/or suspending agents. Suitable suspending agents include sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, poly-vinyl-pyrrolidone, sodium alginate or acetyl alcohol. Suitable dispersing agents include lecithin, polyoxyethylene esters of fatty acids such as stearic acid, polyoxyethylene sorbitol mono- or di-oleate, -stearate or - laurate, polyoxyethylene sorbitan mono- or di-oleate, -stearate or -laurate and the like.

Pharmaceutical compositions of the present invention may be prepared by blending, grinding, homogenising, suspending, dissolving, emulsifying, dispersing and/or mixing the selected inhibitors with the selected excipient(s), carrier(s), adjuvant(s) and/or diluent(s).

One type of pharmaceutical composition of the present invention in the form of a tablet or capsule may be prepared by (a) preparing a first tablet or a capsule comprising a first inhibitor, together with any desired excipient(s), carrier(s), adjuvant(s) and/or diluent(s), and (b) preparing a second tablet or a capsule, wherein the second tablet or the capsule includes a second inhibitor and the first tablet or capsule.

Another type of pharmaceutical composition of the present invention in the form of a capsule may be prepared by (a) preparing a first capsule comprising a first inhibitor together with any desired excipient(s), carrier(s), adjuvant(s) and/or diluent(s), and (b) preparing a second capsule, wherein the second capsule includes a second inhibitor and the first capsule.

A further type of pharmaceutical composition of the present invention in the form of a tablet may be prepared by (a) preparing a capsule comprising an inhibitor together with any desired excipient(s), carrier(s), adjuvant(s) and/or diluent(s), and (b) preparing a tablet, wherein the tablet includes the second inhibitor and the capsule. The emulsions for oral administration may further comprise one or more emulsifying agents. Suitable emulsifying agents include dispersing agents as exemplified above or natural gums such as guar gum, gum acacia or gum tragacanth.

Methods for preparing parenterally administrable compositions are apparent to those skilled in the art, and are described in more detail in, for example, Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pa., hereby incorporated by reference herein.

The topical compositions of the present invention, comprise an inhibitor(s) together with one or more acceptable carriers, and optionally any other therapeutic ingredients. Compositions suitable for topical administration include liquid or semi-liquid preparations suitable for penetration through the skin to the site of where treatment is required, such as liniments, lotions, creams, ointments or pastes, and drops suitable for administration to the eye, ear or nose.

Drops according to the present invention may comprise sterile aqueous or oily solutions or suspensions. These may be prepared by dissolving the inhibitor(s) in an aqueous solution of a bactericidal and/or fungicidal agent and/or any other suitable preservative, and optionally including a surface active agent. The resulting solution may then be clarified by filtration, transferred to a suitable container and sterilised. Sterilisation may be achieved by: autoclaving or maintaining at 90⁰C-IOO⁰C for half an hour, or by filtration, followed by transfer to a container by an aseptic technique. Examples of bactericidal and fungicidal agents suitable for inclusion in the drops are phenylmercuric nitrate or acetate (0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate (0.01%). Suitable solvents for the preparation of an oily solution include glycerol, diluted alcohol and propylene glycol. Lotions according to the present invention include those suitable for application to the skin or eye. An eye lotion may comprise a sterile aqueous solution optionally containing a bactericide and may be prepared by methods similar to those described above in relation to the preparation of drops. Lotions or liniments for application to the skin may also include an agent to hasten drying and to cool the skin, such as an alcohol or acetone, and/or a moisturiser such as glycerol, or oil such as castor oil or arachis oil.

Creams, ointments or pastes according to the present invention are semi-solid formulations of the inhibitor(s) for external application. They may be made by mixing the active ingredient in finely-divided or powdered form, alone or in solution or suspension in an aqueous or non-aqueous fluid, with a greasy or non-greasy basis. The basis may comprise hydrocarbons such as hard, soft or liquid paraffin, glycerol, beeswax, a metallic soap; a mucilage; an oil of natural origin such as almond, corn, arachis, castor or olive oil; wool fat or its derivatives, or a fatty acid such as stearic or oleic acid together with an alcohol such as propylene glycol or macrogols. The compositions may incorporate any suitable surfactant such as an anionic, cationic or non-ionic surfactant such as sorbitan esters or polyoxyethylene derivatives thereof. Suspending agents such as natural gums, cellulose derivatives or inorganic materials such as silicaceous silicas, and other ingredients such as lanolin, may also be included. The compositions may also be administered or delivered to target cells in the form of liposomes. Liposomes are generally derived from phospholipids or other lipid substances, and are formed by mono- or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium. Specific examples of liposomes used in administering or delivering a composition to target cells are synthetic cholesterol (Sigma), the phospholipid l,2-distearoyl-5n-glycero-3-phosphocholine (DSPC; Avanti Polar Lipids), the PEG lipid 3-N-[(-methoxy poly (ethylene glycol)2000)carbamoyl]-l,2-dimyrestyloxy- propylamine (PEG-cDMA), and the cationic lipid l,2-di-ø-octadecenyl-3 -(N₁N- dimethyl)aminopropane (DODMA) or l,2-dilinoleyloxy-3-(N,N-dimethyl)aminopropane (DLinDMA) in the molar ratios 55:20:10:15 or 48:20:2:30, respectively, PEG-cDMA, DODMA and DLinDMA. Any non-toxic, physiologically acceptable and metabolisable lipid capable of forming liposomes can be used. The compositions in liposome form may contain stabilisers, preservatives, excipients and the like. The preferred lipids are the phospholipids and the phosphatidyl cholines (lecithins), both natural and synthetic. Methods to form liposomes are known in the art, and in relation to this specific reference is made to: Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N. Y. (1976), p. 33 et seq., the contents of which is incorporated herein by reference.

The compositions may also be administered in the form of microparticles. Biodegradable microparticles formed from polylactide (PLA), polylactide-co-glycolide (PLGA)₅ and epsilon-caprolactone (έ-caprolactone) have been extensively used as drug carriers to increase plasma half life and thereby prolong efficacy (R. Kumar, M., 2000, J Pharm Pharmaceut Sci. 3(2) 234-258). Microparticles have been formulated for the delivery of a range of drug candidates including vaccines, antibiotics, and DNA. Moreover, these formulations have been developed for various delivery routes including parenteral subcutaneous injection, intravenous injection and inhalation.

The compositions may incorporate a controlled release matrix that is composed of sucrose acetate isobutyrate (SAIB) and organic solvent or organic solvents mixture. Polymer additives may be added to the vehicle as a release modifier to further increase the viscosity and slow down the release rate. SAIB is a well known food additive. It is a very hydrophobic, fully esterified sucrose derivative, at a nominal ratio of six isobutyrate to two acetate groups. As a mixed ester, SAIB does not crystallize but exists as a clear viscous liquid. Mixing SAIB with a pharmaceutically accepted organic solvent such as ethanol or benzyl alcohol decreases the viscosity of the mixture sufficiently to allow for injection. An inhibitor(s) may be added to the SAIB delivery vehicle to form SAIB solution or suspension formulations. When the formulation is injected subcutaneously, the solvent diffuses from the matrix allowing the SAIB-drug or SAIB-drug-polymer mixtures to set up as an in situ forming depot. Those skilled in the art will appreciate that in accordance with the methods of the present invention the synergistic compositions may be administered alone or in conjunction with one or more additional agents as a combination therapy. For example, a synergistic composition of the invention may be administered together with one or more additional chemotherapeutic agents capable of decreasing cell proliferation and invasion and increasing apoptosis in cancer.

For such combination therapies, each component of the combination therapy may be administered at the same time, or sequentially in any order, or at different times, so as to provide the desired effect. Alternatively, the components may be formulated together in a single dosage unit as a combination product. When administered separately, it may be preferred for the components to be administered by the same route of administration, although it is not necessary for this to be so.

Combination regimens

Therapeutic advantages may be realised through combination regimens. In combination therapy the respective inhibitors and any other agents may be administered simultaneously or sequentially in any order. Accordingly, methods of treatment according to the present invention may be applied in conjunction with conventional therapy, such as radiotherapy, chemotherapy, surgery, or other forms of medical intervention. Examples of chemotherapeutic agents include adriamycin, taxol, fluorouricil, melphalan, cisplatin, oxaliplatin, alpha interferon, vincristine, vinblastine, angioinhibins, TNP-470, pentosan polysulfate, platelet factor 4, angiostatin, LM-609, SU- 101, CM-101, Techgalan, thalidomide, SP-PG and the like. Other chemotherapeutic agents include alkylating agents such as nitrogen mustards including mechloethamine, melphan, chlorambucil, cyclophosphamide and ifosfamide, nitrosoureas including carmustine, lomustine, semustine and streptozocin; alkyl sulfonates including busulfan; triazines including dicarbazine; ethyenimines including thiotepa and hexamethylmelamine; folic acid analogues including methotrexate; pyrimidine analogues including 5-fluorouracil, cytosine arabinoside; purine analogues including 6- mercaptopurine and 6-thioguanine; antitumour antibiotics including actinomycin D; the anthracyclines including doxorubicin, bleomycin, mitomycin C and methramycin; hormones and hormone antagonists including tamoxifen and cortiosteroids and miscellaneous agents including cisplatin and brequinar, and regimens such as COMP (cyclophosphamide, vincristine, methotrexate and prednisone), etoposide, mBACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine and dexamethasone), and PROMACE/MOPP (prednisone, methotrexate (w/leucovin rescue), doxorubicin, cyclophosphamide, taxol, etoposide/mechlorethamine, vincristine, prednisone and procarbazine).

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications.

Examples

The invention will now be described in more detail, by way of illustration only, with respect to the following examples. The examples are intended to serve to illustrate this invention and should not be construed as limiting the generality of the disclosure of the description throughout this specification.

MATERIALSAND METHODS Cell Lines All LNCaP, PC3 and DU 145 human prostate cancer cell lines used in the Examples below were purchased from American Type Culture Collection (Rockville, MD, USA). Prostate cancer cells were maintained in RPMI 1640 (Sigma- Aldrich, Sydney, Australia) supplemented with 10% FBS (ICN Biomedical, Sydney, Australia), with all cell cultures at 37⁰C in a humidified environment of 5% CO2. The passage numbers of cells described in the Examples below were between 30 and 45 for LNCaP, 25 and 40 for PC3, and 65 and 80 for DU 145. The cPLA2-α inhibitors pyrrophenone and Wyeth-1 were reconstituted in dimethylsulfoxide (DMSO)

CPLA₂-Cc Inhibitors

The pyrrophenone inhibitor referred to in the examples below is described in Ghomashchi, F., et ah, Biochimica et Biophysica Acta Biomembranes, (2001), 2:160- 166. The Wyeth-1 inhibitor referred to in the examples below is described in U.S. Patent No. 6797708.

Example 1 -Inhibition of cPLA_∑-α with pyrrophenone hinders cancer cell growth

The role of CPLA₂-Oc in cancer cell growth was examined in androgen sensitive LNCaP and insensitive PC3 cells using a cPLA₂-α inhibitor, pyrrophenone (P2) using the colorimetric MTS assay (CellTiter 96 AQueous One Solution Cell Proliferation Assay Promega, Madison, WI, USA). This assay uses a colorimetric method to approximate the number of viable cells in culture by measuring mitochondrial activity. The one solution assay system contains a novel tetrazolium salt (MTS) combined with an electron coupling reagent, phenazine ethosulfate (PES) for enhanced chemical stability. In metabolically active cells, the MTS tetrazolium compound is reduced by mitochondrial dehydrogenase enzymes into a coloured formazan product which is soluble in culture media. The quantity of formazan product or the degree of colour change is proportional to the number of metabolically active cells.

LNCaP, PC3 and DUl 45 cells were plated in triplicate in 96 well plates. Cell densities were 6 x 10⁴/well LNCaP cells and 1 x 10⁴/well for both PC3 and DU 145 cells. After 48 hours, cells adherent on 96 well plates were exposed to various concentrations of pyrrophenone (P2) (Figure 1). Following a 72 hour treatment period, the media from treated wells was aspirated using gentle suction and replaced by a 16.6% MTS solution in fresh media (RPMI, 10% FCS). Cells were incubated at 37⁰C and 5% CO2 for 1 hour or until a visible colour change was observed. The intensity of the colour change was read by spectrophotometer at 490nm. All absorbance values were subtracted with blank well absorbances and analysed.

Inhibitory concentrations IC25, ICso and IC75 were calculated by plotting graphs of viable cell numbers measured by MTS versus concentration of drug required to inhibit cell viability by 25%, 50% and 75% respectively. Values are expressed relative to untreated controls. In both LNCaP and PC3 cells, a dose-dependent decrease in cell growth was observed after 72 h with an IC₅₀ (50% inhibition of cell growth) at 4±1 μM (Figure C). To verify that the observed effects were a result of cPLA₂-α inhibition, cPLA₂-α mRNA expression was knocked down using siRNA. cPLA2-α knockdown was achieved by designing siRNA duplexes to cPLA2-α (NM_024420). Two duplexes were designed and manufactured by Qiagen (Doncaster, Australia), targetting the following cPLA2-α seqeunces: Duplex 1: 5'-TCG CAT TAT GTA TGA ATG TTA (SEQ ID NO: 1); Duplex 2: 5'-TTG AAT TTA GTC CAT ACG AAA (SEQ ID NO: 2). A control duplex was designed against the non-mammalian gene, fluorescein. Sequence: 5'-AAT TCT CCG AAC GTG TCA CGT (SEQ ID NO: 3). We applied siRNA duplexes at a final concentration of 10 nM for PC3 and DU 145 and 5nM for LNCaP. HiPerfect Transfection Reagent (Qiagen, Doncaster, Australia) comprised 1.25 % of total treatment well volume (1.125 μL in 150 μL treatment). Transfection efficiency was measured by transfecting the non-mammalian fluorescein duplex. The cells were washed thoroughly with PBS to remove excess fluorescence and observed under a fluorescent microscope. The number of fluorescent cells/field were counted and expressed as a percentage of total number of cells in that field. CPLA₂-OC mRNA expression was measured by reverse transcription polymerase chain reaction (RT-PCR). Total RNA was isolated using Trizol reagent (Sigma- Aldrich) as per the manufacturer's instructions. The first-strand cDNA was synthesized from 2μg of total RNA using a combination of random hexamers and oligo-dT. End-point primers were designed based on the human cPLA∑-α mRNA (NM_024420). Forward: 5'- ACAGTGGGCTCACATTTAACCT (SEQ ID NO: 4), Reverse: 5'- CTTCCCGATCAAACACATAAGG (SEQ ID NO: 5). GAPDH was used as the housekeeping gene and its primer sequences are: Forward: 5'-TGGACCTGACCTGCCGTCTA (SEQ ID NO: 6), Reverse: 5'-CCTGTTGCTGTAGCCAAATTC (SEQ ID NO: 7). Conditions for PCR were: one cycle of 94⁰C for 2 minutes; 40 cycles of 20 seconds at 94⁰C, 30 seconds at 55⁰C and 30 seconds at 72oC; then one cycle of 5 minutes at 72⁰C. For real time, the cPLA2-α primer sequence: Forward: 5'- ATCCTGATGAATTTGAGCGA (SEQ ID NO: 8), Reverse: 5'- CAAGTAGAAGTTCCTTGAACG (SEQ ID NO: 9). TATA box Binding Protein (TBP) was used as the house-keeping gene: Forward: 5'- GAACCACGGCACTGATTTTC (SEQ ID NO: 10), Reverse: S'-CCCCACCATGTTCTGAATCT (SEQ ID NO: 11). Quantitative PCR measurements were done with SYBR-Green and ROX as a passive reference using the Rotor-Gene 3000. Conditions for PCR were: one cycle of 2 minutes at 50⁰C and 2 minutes at 95⁰C; 50 cycles of 30 seconds at 95⁰C₅ 30 seconds at 65⁰C and 30 seconds at 55⁰C, followed by one cycle for 10 seconds at 25⁰C. Relative changes in cPLA_-α compared to TBP were calculated using the Δ-Δ method (2 delta method) as described in Pfaffl. M. (2001) Nucleic Acids Res;29(9):e45).

When compared to the scramble control, CPLA₂-OC mRNA was reduced by 86% (LNCaP) and 84% (PC3), respectively. There was no evidence for interferon activation in siRNA-treated cells (assessed by qRT-PCR of interferon target genes).

Incorporation of ³H-thymidine was used to measure DNA synthesis in LNCaP and PC3 cells following administration of siRNA as described above. The cell lines were plated in triplicate into two 96 well plates, at previously stated densities. Cells were allowed to seed for 48 hours before treatment. Following a 60 hour incubation period with treatment media, the medium was replaced with fresh medium containing treatment drug and ³H-thymidine (TRK686, Amersham Biosciences, Buckinghamshire, UK) to the equivalence of 1 fCi/ lOOμL. Treated cells were allowed to incubate for a further 12 hours before harvesting, to a total of 72 hours of drug treatment. Five minutes prior to cell harvesting, the medium was aspirated and Trypsin /PBS solution (20% trypsin) was added to the cells to allow for maximal detachment. Cellular DNA was harvested onto filtermats using a cell harvester (PerkinElmer Life And Analytical Sciences, Wellesley, MA, USA) and allowed to dry before being placed into a plastic envelope with scintillation fluid and read in a beta plate counter. Data were normalized to viable cell numbers measured by MTS assay (as described above) on a replicate plate, also treated with drug for 72 hours. Thymidine incorporation displayed a 30% (LNCaP) and a 43% (PC3) reduction in DNA synthesis.

A 26% (LNCaP) and 19% (PC3) increase in caspase 3/7 activity was also noted with siRNA. Apoptosis in LNCaP and PC3 cells following siRNA treatment as described above was measured using an ApoOne caspase 3/7 Homogenous Assay (Promega, Madison, WI, USA). This is a fluorimetric measure of activated Caspase 3 and 7. Prostate cancer cells were plated in triplicate in white 96 well plates (Greiner Bio-One, Frickenhausen, Germany) compatible for both cell culture and fiuorimetry reading. Following a 48 hour seeding period, the cells were treated with vehicle or pyrrophenone (P2) for 72 hours. At the end of this treatment period, 100 μL of the caspase substrate and buffer solution was added (1:100 dilution) to the treatment medium in each well. Plates were allowed to incubate for 18 hours before detection with a Fluroskan Ascent fluorometer (Thermo Labsystems, Beverley, MA, USA) at excitation wavelength 485 nm and emission wavelength 515 nm. Fluorescence Units were normalized for viable cell number using the MTS assay (see Example 1 above).

Together, these results indicate that P2-induced growth arrest in prostate cancer cells is most likely via cPLA₂-α inhibition.

Example 2 -Cancer cell growth response following Inhibition of cPLA₂-α with Wyeth-1 A second inhibitor of cPLA₂-α, Wyeth-1, was used to confirm the effect of cPLA₂- α inhibition on prostate cancer cell viability. To confirm the specificity of Wyeth-1 for cPLA₂-α, immunohistochemical analysis was first carried out to observe inhibitor effect on cPLA₂-α activity. Cells were treated with 0, 7, 14, or 21μM of Wyeth-1 (the concentrations required to negatively impact the viability of LNCaP cells to reach ICO, IC25, IC50, and IC75 respectively) for 72 hours and stained for phosphor-cPLA2-α. At the end of the treatment period, cells were washed in PBS, trypsinised, and collected by centrifugation. The cell pellet was fixed in ImL of 10% formalin for an hour at 4⁰C to stabilise the proteins and nucleic acids thereby preserving the chemical and structural state of the cells. The fixative was removed by centrifugation and the cells were resuspended in PBS, solidified in 2% agarose, and processed for paraffin block. Paraffin embedded tissue was sectioned to 5μm on a microtome and collected onto Superfrost Plus slides (Menxel-Glaser). Slides were dried at 37⁰C prior to immunostaining.

Sections were deparaffinised in xylene for 30 minutes and rehydrated down graded ethanol (absolute, 95%, 75%) through to water. Heat-induced antigen retrieval was performed to recover antigens if heavily modified by fixation and/or 35 paraffin processing. Tissue sections were heated in 1OmM citrate buffer (20OmM) NaCitrate, 20OmM citric acid, pH 6.0) for 20 minutes, prior to immunostaining. Heated slides were cooled in room temperature and rinsed in water. Endogenous peroxidase activity was inhibited to prevent it from interacting with HRP conjugated antibody resulting in high, non-specific background staining. Sections were incubated in 0.3% hydrogen peroxide in methanol for 10 minutes before being rinsed in Tris-buffered saline (20OmM Tris-HCl, 15OmM NaCl, 1OmM Tris-base, 0.5% Tween 20, pH 7.5). False positive staining as a result of antibody attaching to highly charged elements in the tissue section was blocked by incubating slides with 10% horse serum in TBST for 20 minutes. The non-immune block was flicked off prior to incubation with primary rabbit anti- human phospho-cPLA₂ antibody (Cell Signaling) at a dilution of 1 :200. All primary antibody incubation was performed in 10% horse serum in TBST, overnight at 4⁰C. Slides were rinsed with TBST before secondary antibody incubation for 30 minutes at room temperature. Biotin-conjugated secondary anti-rabbit antibody (Vector Laboratories) was diluted to 1 :200 in 1% horse serum in TBST.

Sections were rinsed in TBST before being incubated in Avidin-Biotin Complex (ABC) (Vector Laboratories) for 30 minutes at room temperature. The avidin free sites of this peroxidase-conjugated complex interact with the biotin on the secondary antibody with high affinity. ABC was diluted to 1:200 in 1% horse serum in TBST prior to use. The peroxidase enzyme is visualised with diaminobenzidin (DAB) chromogen (Dako).

Sections were incubated with DAB for 5 minutes or until brown colouration was observed. The reaction was stopped by rinsing the slides with distilled water. Haematoxylin counterstain was performed followed by quick dips in acidic ethanol and blue in Scott's solution. The slides were dehydrated in graded alcohol (75%, 95%, absolute) and mount in DPX. Slides were analyses using Image Pro Plus software. The number of positive and negative/unstained cells was individually tagged under 4Ox magnification. The percentage of positive cells was calculated according to the formulae: Percentage of positive cells = Positive cells x 100/ positive cells + negative cells Ten fields were counted for each section.

Positive cells stained with a dark colour and both cytosolic and nuclear staining was observed (Figures 2A-2D). Figure 2E shows that, LNCaP cells did show a decrease in phosphor-cPLA2 following cPLA2 inhibition with IC25 (7 μM Wyeth-1) being the minimal dose necessary for this reduction. IC25 (7 μM Wyeth-1) and IC50 (14 μM Wyeth-1) resulted in a 36% decrease in cPLA2 activity compared to the control, although no significant difference was observed between the two doses. IC75 (21 μM Wyeth-1) dose of Wyeth-1 treatment lead to a significant 90% decrease in phosphor-cPLA2 levels relative to control. These results indicated that Wyeth-1 is highly effective in reducing cPLA2 activity. A dose titration of Wyeth-1 in LNCaP cells was run and assayed to MTS. The

Wyeth-1, IC25, IC50, and IC75 were determined by dose-titration effect on LNCaP cell viability. A Promega CellTiter 96 Aqueous One Solution Cell Proliferation Assay was used to observe inhibitor effects on prostate cancer cell proliferation. This assay uses a colorimetric method to approximate the number of viable cells in culture by measuring mitochondrial activity. The one solution assay system contains a novel tetrazolium salt (MTS) combined with an electron coupling reagent, phenazine ethosulfate (PES) for enhanced chemical stability. In metabolically active cells, the MTS tetrazolium compound is reduced by mitochondrial dehydrogenase enzymes into a coloured formazan product which is soluble in culture media. The quantity of formazan product or the degree of colour change is proportional to the number of metabolically active cells.

Following a 72 hour treatment period, the media from treated wells was aspirated using gentle suction and replaced by a 16.6% MTS solution in fresh media (RPMI, 10% FCS). Cells were incubated at 37⁰C and 5% CO2 for 1 hour or until a visible colour change was observed. The intensity of the colour change was read by spectrophotometer at 490nm. All absorbance values were subtracted with blank well absorbances and analysed.

Figure 2F illustrates the effect of varying Wyeth-1 concentration on the viability of LNCaP cells. Wyeth-1 concentrations required to negatively impact the viability of LNCaP cells to reach IC25, IC50, and IC75 were 7, 14, and 21μM, respectively (Table 1). All results were measured relative to absorbance values of the untreated, DMSO control. Consistently, LNCaP cell confluence was reduced significantly after highest dose of Wyeth-1 treatment at 72 hour time point compared with control (DMSO). However, inhibitor treatment did not induce a dose-dependent growth retardation as IC25 and IC50 cell confluence did not vary considerably from that of the DMSO control. Wyeth-1 treatment did not alter the morphology of prostate cancer cells; LNCaP cells retained their fibroblast-like, slender appearance for the duration of the study. The number of floating cells did not differ significantly between treated and non-treated flasks.

Table 1: MTS viability results for Wyeth-1 titration in LNCaP cells following cPLA2 inhibition

* Treated with volumes of DMSO equal to inhibitor treatment

Example 3 -Inhibition of cPLA₂-α with Wyeth-1 decreases cancer cell proliferation The relative proportion of proliferating LNCaP cells were analysed by monitoring 5- bromo-2'-deoxyuridine (BrdU) incorporation following Wyeth-1 treatment, BrdU is a thymidine analog and is selectively incorporated into cell DNA at the S phase of cell cycle. Thus, the proportion of BrdU staining is directly proportional to the number of proliferative cells. Following a 60 hour incubation period with treatment media, dissolved BrdU (B9285, Sigma) was added at lOμg/mL concentration. Treated cells were allowed to incubate for a further 12 hours before harvesting, to a total of 72 hours of inhibitor treatment. Harvested cells were fixed, embedded in paraffin and sectioned prior to immunostaining.

Immunostaining was performed according to the methods stated in Example 2 above using monoclonal anti-BrdU antibody (1:1,000) (B2531, Sigma) using 10% horse serum in TBST, with the additional step of covering slides with 2N HCl for 20 minutes at room temperature for DNA denaturing prior to endogenous peroxidase and non-immune blocking.

BrdU was added to cells treated with Wyeth-1 (ICO, IC25, IC50, and IC75 - 0 μM, 7 μM, 14 μM, and 21μM respectively) for 72 hours to identify an inhibitory effect on DNA synthesis. Cells that have incorporated BrdU displayed clear nuclear staining (Figures 3A-3D). IC50 and IC75 dose of Wyeth-1 treatment caused a dose-dependent reduction in the number of cells entering S-phase when compared to DMSO, untreated cells (Figure 3E). The most effective dose range to inhibit DNA synthesis was the IC75 (21μM) concentration (Figure 3E). Compared to the control, LNCaP cells saw a 3 -fold reduction in the number of proliferative cells. IC25 (7μM) treatment had a relatively higher proportion of BrdU positive cells, however, the difference was not statistically significant (Figure 3E). These results indicate that Wyeth-1 treatment does decrease the level of DNA synthesis occurring within prostate cancer cells, and this degree of effect is proportional to inhibitor concentration.

Example 4 - Inhibition of cPLA_∑-α in a PC3 xenograph model of human prostate cancer

PGE2, HETE and EET have growth promoting effects in cancer cells. Lysophospholipid, another product of PLA2 (see Figure 1), is a potent pro-inflammation mediator after being converted to platelet activating factor. Thus, PLA2 inhibition may have additional (potentially beneficial) effects independent from COX, LOX or EOX inhibitor in isolation. Thus, to determine whether CPLA₂-Ct could be a therapeutic target for advanced prostate cancer a pilot study was conducted using a PC3 xenograft model of human prostate cancer. Xenograph techniques were performed according to standard procedures (see Teicher BA.. (2006) Molecular Cancer Therapeutics 5(10):2435-43). Treatment of athyniic nude mice with Wyeth-1 (10 mg/kg, intraperitoneal, daily) began after xenografts reached a >150 mm³ size (Figure 4). Inhibition of cPLA₂-α significantly decreased (-40%) the tumour growth rate at 9 days of treatment (N=7) compared with vehicle control (N=8). No change was identified in body weight, drinking or eating behaviour in treated vs. control mice (Figure 4). Tumour volume was measured based on length x width² x 0.52 and expressed as MEDIAM after subtraction from time zero. P<0.004 for difference between the two slopes. The presence of cancer cells resistant to CPLA₂-CC inhibition indicates that blocking CPLA₂-OC is unlikely to abolish entirely the growth of cancer cells even over a longer treatment period.

Example 5 - Blocking cPLA₂-α increases COX-1 levels and PGE₂ production in prostate cancer cells

Expression of COX-I and COX-2 was examined in unstimulated and P2-stimulated (48 hours) LNCaP and PC3 cells was examined by Western blot (Figures 5A and 5B). The nitrocellulose membrane was incubated in blocking solution (5% v/v skim milk powder in

PBST) for 1 hour at room temperature. Mouse-anti-human COX antibody 1 :300 (Santa

Cruze) was used in PBST with 1% skim milk, overnight at 4⁰C. P2 treatment for 48 hours increased levels of COX-I protein and PGE2 (Figure 6). By contrast, COX-2 levels were unchanged, suggesting that the increased PGE2 levels were produced by COX-I not COX-2.

PGE2 release was also examined in siRNA treated LNCaP and PC3 cells. Cells were transfected with cPLA2 siRNA or control siRNA using transfection reagent (RNAifect) provided in the siRNA Silencing Starter Kit (Qiagen) as described in Example 1. Using the 96 well plate provided, each plate contained two blanks, two non- specific binding wells (NSB), two maximum binding wells (Bo), two total activity wells (TA), an eight point standard curve run in duplicate and 24 samples run in triplicate. Since the samples contained a low level of PGE2, 50μl of culture medium was substituted for EIA buffer in the NSB and Bo wells, and the standards were diluted in culture media. In addition, double the recommended volume of samples added to well, resulting in a final volume of lOOμl/well. As the input of samples per well was doubled, an additional 50μl of culture media was added to wells containing NSB, Bo, and standards.

Next, 50μl of PGE2 AChE tracer was added to each well except the blank and TA wells. This was followed by adding 50 μl of PGE2 monoclonal antibody to all wells except TA, NSB and blank wells. The final reaction plate was then covered with plastic film and incubated for 18 hours at 4⁰C. Wells were then rinsed with washed buffer 5 times and exposed to 200μl of Ellman's reagent per well. Finally, 5μl of tracer was added to the TA well, the assay was allowed to develop (i.e. Bo wells >0.3 A.U) in the dark for 60-90 minutes. The plate was then read at a wavelength of 405-420nm. P2 treatment for 48 hours increased levels of COX-I protein (Figures 5 A and 5B) and PGE₂ (Figure 6). By contrast, COX-2 levels were unchanged, suggesting that the increased PGE₂ levels were produced by COX-I not COX-2. These results demonstrate that COX-I is inducible in responding to CPLA₂-Oi inhibition in prostate cancer cells. The increase in PGE2 is not specific for P2 per se because siRNA to cPLA₂-α increased PGE2 in prostate cells.

The significant increase in PGE2 levels occurred at a time when cancer cell growth is retarded by 25-50%. This raised the issue of whether increased PGE₂ in the remaining cells conferred survival advantage in view of the role for PGE₂ in promoting mitogenesis and mutagenesis. To determine the possible toxicity of the combined treatment, we tested P2 (IC₅₀) and ibuprofen (ImM) in combination on cell viability by MTS assay as described in Example 1 above. While the combination inhibits prostate cancer cell growth, it has no significant toxicity on liver, kidney cells, and fibroblast (Figure 7), demonstrating the difference in AA-PGE2 dependence between cancer and non- tumorigenic cells.

Example 6 -cPLA_∑-α inhibition decreases total and phosphor-AKT levels in LNCaP cells

To determine whether inhibition of cPLA2 affects the central molecule of the PI3K/Akt pathway, western blot analysis of total and phospho-Akt was performed (Figure 8A). Protein extraction was done using RIPA buffer at the 72 hour time point as this was representative of the maximal observed effect. For Western blot experiments, the nitrocellulose membrane was incubated in blocking solution (5% v/v skim milk powder in PBST) for 1 hour at room temperature. Mouse-anti-human Akt antibody 1 :1000 (Cell Signalling) was used in PBST with 1% skim milk, overnight at 4⁰C. The characteristic 62kDa Akt band was readily detectable and of similar intensity in untreated, IC25 and IC50 treated cells. Following IC75 treatment, the level of Akt was diminished significantly. Active, phosphorylated Akt levels experienced a clear dose-dependent decrease in response to increasing inhibitor concentration. GAPDH was used as the loading control. From these results, it is evident that cPLA2 inhibition decreases total and phosphor- Akt levels, the effect of which correlates with inhibitor concentration.

As one of the principal physiological substrates of Akt, GSK3β signaling is required for androgen-stimulated gene expression in human prostate cancer cells. Western blot analysis was carried out to determine the effect of cPLA2 inhibition on total and phospho- GSK3β levels 1:1000 (Cell Signalling) (Figure 8B). Cytosolic PLA2 inhibition decreased GSK3β degradation dose-dependently. This is reflected by subtle reduction in phospho- GSK3β levels following treatment with increasing inhibitor concentrations. Due to decreased rate of degradation, it is expected that the levels of total GSK3β would increase. Indeed, the 46kDa band representative of total GSK3β is slightly increased after Wyeth-1 treatment. These findings indicate that cPLA2 inhibition increases GSK3β activity by reducing its degradation. GAPDH was used as the loading control.

Example 7 -cPLA₂-α inhibition decreases cyclin D1 expression and induces p21 (wak/cip) expression

To determine inhibitor effect on cyclin Dl expression, Western blot and immunohistochemical analysis (see example 2 above) were performed. For Western blot experiments, mouse-anti-human cyclin Dl antibody (1:1600) (Sigma) and biotin- conjugated secondary anti-mouse antibody (1:1200, 1% horse serum in TSBT) (Vector Laboratories) were used during immunohistochemistry. For Western blot experiments, the nitrocellulose membrane was incubated in blocking solution (5% v/v skim milk powder in PBST) for 1 hour at room temperature. Mouse-anti-human cyclin Dl antibody (1 :100) (Sigma) was used in PBST with 1% skim milk, overnight at 4⁰C. Cyclin Dl protein expression was readily detectable in untreated control as a 36kDa band (Figure 9A). Following 72 hours of cPLA2 inhibition, cyclin Dl levels were reduced in a dose- dependent manner. Alpha-tubulin was used as the loading control. Consistent with western blot studies, immunohistochemical analysis showed a step-wise reduction in cyclin Dl levels following treatment. The percentage of cyclin Dl positive cells declined from 20% in control to that of 17, 15 and 10% in IC25, IC50 and IC75 treated groups, respectively (Figure 9B). These results indicate that inhibition of cPLA2 decreases cyclin Dl activity.

Immunohistochemical studies were carried as described in Example 2 above to investigate the effect of cPLA2 inhibition on p21(waf/cip) expression, using mouse-anti- human p21 Wafl/Cipl antibody (1:200) (Cell signalling) and biotin-conjugated secondary anti-mouse antibody (1:1200, 1% horse serum in TSBT) (Vector Laboratories). The results are illustrated in Figure 9C. The basal level of p21 (waf/cip) reached 23% in untreated LNCaP cells. At 72 hour time point, Wyeth-1 treatment is effective in augmenting p21 (waf/cip) expression. Importantly, this induction correlates positively with inhibitor concentration. IC75 concentration was most effective in increasing p21 (waf/cip) levels in that it saw a 40% increase compared to control.

Example 8 - lsobologram analysis

An isobologram analysis was used in order to determine the effect of a combined

10 treatment using ibuprofen and MK886, and pyrrophenone and celecoxib inhibitors at IC₂₅, IC₅O and IC₇₅ doses on cell growth in LNCaP and PC3 cell lines. The synergistic effects between drug combinations were analyzed with the use of an isobologram as described by Deckers et αl. (2000). Briefly, this method is used to detect synergism (supra-additivity), zero interaction (additivity) and antagonism (infra-additivity) by first establishing the zero

I₅ interaction line that has the equation d_a/D_a + d_b/D_b = 1 where d_a + d_b are the dosages of a drug combination and D_a; D_b are the dosages of the drug alone. Interactions of the drugs are defined as follows:

1. Additivity: d_a/D_a + d_b/D_b = 1

2. Antagonism: d_a/D_a + d_b/Db > 1

2Q 3. Synergism: d_a/D_a + d_b/D_b < 1

The Line of Additivity (or Zero Interaction Line) is defined by the equation representing combinations that lie on the Line of additivity are considered as additive. While points Q and P are regarded as synergistic and antagonistic combinations respectively.

The significance of simultaneously blocking cPLA₂-α and COX, CPLA₂-Cc and LOX, and COX and LOX on cell growth was compared with pyrrophenone, COX and LOX inhibitors alone using an MTS assay as described in Example 1 above. The interaction between the two inhibitors in inhibiting cancer cell growth was determined by isobologram analyses of 16 combinations, i.e. 4 doses of pyrrophenone (O, IC25, IC50 and IC75) x 4 doses of COX inhibitor (0, IC25, IC50 and IC75) or LOX inhibitor (0, IC25, IC50 and IC75).

TABLE 2 - Isobologram analysis for synergistic interactions of (A) pyrrophenone and celecoxib, and (B) ibuprofen and MK886 on viability of prostate cancer cells by MTS assay. A number >1 indicates an antagonistic result, a number <1 indicates a synergistic result, and 1 indicates an additive result

A. Pyrrophenone (μM)

These results provide a significant advance in relation to the treatment of prostate cancer for two principal reasons. First, by virtue of the inhibitor combinations being synergistic, the dose of the COX inhibitor can be reduced without compromising treatment efficacy, thereby minimising the risk of undesired cardiovascular events in patients undergoing treatment. Second, a combined treatment comprising mechanistically different inhibitors along the AA pathway can be implemented whereby "upstream" and "downstream" enzyme inhibition is achieved.

Examples 9-16 set out below reflect proposed experiments which would be suitable to support the compositions and uses of the invention.

Example 9: The effect of cPLA₂-α inhibition on COX-1 in human prostate cells in primary culture.

P2 is used to suppress CPLA₂-Oc activity in normal prostate epithelial cells (<10 passages, Clonetics). P2 is assayed over 5 doses up to 10 μM for its ability to suppress arachidonic acid (AA) release. AA release is measured by the following method: LNCaP cells are cultured for 24 h with [³H] -arachidonic acid in serum-free medium containing fatty acid-free BSA, followed by treatment with P2 for various length of time. Beta counts are determined in the conditioned media and cell lysates.

Time-course studies are conducted with the most effective dose. COX-I, COX-2, 5- LOX and 12-LOX expression and activity are examined, with vehicle-treated cells included as the control. Gene expression is determined by qRT-PCR (see Example 1 above) and Western blot (see Example 5 above), and enzyme activities by PGE2 assay (COX) (see Example 5 above), and high-performance liquid chromatography (HPLC) analyses of HETE products (LOX). When an increase in eicosanoid-producing enzymes such as COX-I is observed, siRNA-targeting cPLA₂-α is transfected into cells and the resulting gene expression and enzyme activity compared with those from P2 treatment. The specificity of the induced-eicosanoid enzyme is determined with P2 ± 5 doses of relevant enzyme inhibitor, e.g. COX-I inhibitor SC-560. SC-560 is highly selective and the dose required for inhibiting 50% activity of COX-I is 9 nM whereas the corresponding dose for COX-2 is 6.3 μM (Smith et al., (1998) PNAS 95(22); 13313-8).

Example 10: Effect of cPLA_∑-α inhibition on COX-1 in normal and cancerous rodent prostate

Normal mice are sacrificed at 1, 3, 6, 12 h after being treated with P2 (1, 10, 100mg/kg, intraperitoneal) or vehicle (4 mice per time point). Where necessary the study period is extended to a week with P2 given daily. The ventral and dorsal-lateral lobes of prostate are harvested with a dissecting microscope. Cancerous prostate tissue is obtained from P2 or vehicle treated transgenic mice with prostate cancer (TRAMP, see Example 16 below). COX-I, COX-2, 5-LOX and 12-LOX mRNA and protein levels are determined by qRT-PCR, Western blot and immunohistochemistry (see Examples 1 and 5 above). Tissue PGE₂ production is assayed using an enzyme immunoabsorbent assay kit as described in Devaux et al., (2001), J. Immunol, 167(7): p.3962-17. 5-HETE and 12- HETE is analysed by high-performance liquid chromatography (HPLC). Where HETE levels are too low to detect, radioactive arachidonic acid is given prior to analysis as described in Park et al., (2003), 68(l):35-42. In addition, the specificity of the induced- eicosanoid enzyme is determined with P2 ± a range of 3 doses of relevant inhibitors, as described in Maferrer et al., (1999), Ann. N. Y. Acad. Sci, 889:84-86 and Daikoku et al., (2005), Cancer Res. 65(9) 3755-44.

Example 11: Effect of P2 on the stability of COX-1 mRNA/protein To determine post-transcriptional stabilization of COX-I mRNA in response to P2,

LNCaP is treated for 24 h with P2 or vehicle and subsequently chased for the decay of COX-I mRNA after the addition of actinomycin D (2μg/ml) for 0-8 h. qRT-PCR (see Example 1 above) is used to analyse the decay of COX-I mRNA. The stability of COX-I protein is examined using the same protocol as for mRNA, except that the cells are chased for 0-24 h with 10 μM cycloheximide. The decay of COX-I protein is assessed with Western blot (see Example 5 above). LOX products, 5-HETE, 12-HETE and their inhibitors (MK-886 and Baiclein) are examined for their effects on COX-I mRNA and protein stability as they can also increase COX-I mRNA/proteins.

Example 12: COX-1 /COX-2 promoter activity assay

The COX-1 and COX-2 reporters are constructed by PCR and cloning from human genomic DNA into the Promega pGL4 vector backbone. The COX-1 promoter is from - 2030/-22 promoter region and an intrinsic enhancer sequence Ir-8. The COX-2 promoter is from -327/+59 promoter region. Cells are plated in six-well plates and incubated for 8 hours with complexes of LipofectAMINE, COX-1 or COX-2 and renilla luciferase reporters. Transfected cells are then incubated with complete growth medium for 16 hours prior to experimentation. Promoterless luciferase and transfection reagent is used to determine background luciferase activities and measured with a PolarStar Galaxy luminometer (BMG Labtech, Hoffenberg, Germany) and normalized against the renilla luciferase activity by using the dual-luciferase reporter assay system (Promega).

Example 13: To define the effect ofP2 on transcriptional regulation of COX-1 gene COX-I and COX-2 reporters are constructed by PCR and cloning from human genomic DNA into the Promega pGL4 vector backbone. The COX-I promoter is from - 2030/-22 promoter region and an intrinsic enhancer sequence Ir-8. The COX-2 promoter is from -327/+59 promoter region. Cells are plated in six-well plates and incubated for 8 h with complexes of Lipofect AMINE, COX-I or COX-2 and renilla luciferase reporters. Transfected cells will then be incubated with complete growth medium for 16 h prior to experimentation. Promoterless luciferase and transfection reagent will used to determine background luciferase activities and measured with a PolarStar Galaxy luminometer (BMG Labtech, Hoffenberg, Germany) and normalized against the renilla luciferase activity by using the dual-luciferase reporter assay system (Promega). A plasmid containing firefly luciferase under the control of the human COX-I gene promoter (-2030 to -22 and an intrinsic enhancer sequence) as described in DeLong and Smith, (2005), Biochem and Biophys. Res. Comm. 338(1): 53-61, is transfected into LNCaP cells and used to examine whether induce transcription from the COX-I promoter by P2. Time-course and dose-response studies are conducted in order to understand the duration of action and potency of P2. An increased luciferase reading is consistent with the increased transcription of the COX-I gene by P2. As control, LNCaP cells transfected with COX-2 promoter construct are also treated with P2. The effect of 5 -HETE, 12- HETE and their respective LOX inhibitors on COX-I and COX-2 promoter activity is determined using the similar methodology.

Example 14: Effect of COX-1 induction on cancer cell growth

To determine the minimum dose of SC-560 that abolishes COX-1 and PGE2 induction, the growth inhibitory effect of SC-560 on LNCaP and PC3 cells including the IC25, IC50 and IC75 values is determined. LNCaP and PC3 cells are treated with SC-560 over 4 orders of magnitude < IC25 and P2 fixed at its IC50, as the dose required for blocking COX activity may be ~4 orders of magnitude lower than that for cell growth inhibition. Cells treated with P2 alone serve as a control. The minimum dose of SC-560 required for blocking the CPLA₂-O, inhibition-induced PGE2 is determined based on qRT- PCR (see Example 1 above), Western blots of COX-1 & COX-2 (see Example 5 above) and PGE2 assay (see Example 5 above). The significance of simultaneously blocking cPLA₂-α and COX-I on cell growth is compared with P2 alone using MTS assay (see Example 1 above), thymidine incorporation (see Example 1 above), caspase 3/7 activity (see Example 1 above) and TUNEL as described by Negoescu A, et al, (1998), Biomed 5 Pharmacother. 52(6):252-8. The optimal ratio (i.e., synergy) between the two inhibitors in inhibiting cancer cell growth is determined separately by isobologram analyses (see Example 8 above) of 16 combinations (4 doses of P2 x 4 doses of SC-560).

Example 15: Efficacy of combined cPLA₂-α and COX-1 inhibitors in human cancer

I₀ xenograft

Athymic animals are injected subcutaneously into the flank region with LNCaP cells (1 x 10⁶ cells /mouse) or PC3 cells (1 x 10⁵ cells /mouse). Treatment commences when tumours reach 100mm³ and mice are randomly divided into four groups: (1) vehicle control, (2) P2, (3) SC-560, and (4) P2 + SC-560. Animals are treated with P2 (1, 10, is lOOmg/kg, intraperitoneal, daily, and SC-560 dose is determined from Example 14 above. The optimal ratio between the two inhibitors is determined by isobologram analysis from Example 14 above. Animals are terminated 4 weeks after treatment or tumour size have reached lcm³. 10 experimental mice are included in each study group (calculated using Chi-Square power analysis to have a 99% probability of detecting 40% differences

2Q between groups, α<0.05). As the "tumour take rate" for LNCaP is -75% (with Metrigel), 14 mice per group are prepared to accommodate tumour null mice. For PC3, the tumour take rate is 100%. Besides tumour size, tumours harvested at termination are analysed for COX-I and COX-2 expression by qRT-PCR (Example 1 above) and Western Blot (Example 5 above), PGE2 levels (see Example 5 above), and immunohistochemically 5 (see Example 2 above) for proliferation, apoptosis (TUNEL) (as described by Negoescu A, et al., (1998), Biomed Pharmacother.;52(6):252-8) and microvessel density (CD-31 and Factor VIII).

Example 16: Combined cPLA₂-α and COX-1 therapy in transgenic adenocarcinoma 0 mouse prostate (TRAMP)

The advantages of using LNCaP and PC3 xenografts are the human origin and rich information on their response to various treatments. The disadvantages are that they grow in immunodeficient host at a non-natural site (subcutaneous). Thus, the efficacy study is also conducted in TRAMP. In this model, the tumours appear at 8 weeks and metastasise at 12 weeks. Treatment is introduced over a6-14 week period in the following groups of mice (10 /group): (1) vehicle (2) P2, (3) SC-560, and (4) P2 + SC-560. The dose of P2 and SC-560 are same as 3b. The primary tumour, and the number of lymph node and lung metastases per mouse are examined and compared. COX-I and COX-2 gene expression " and PGE₂ levels are also determined.

Example 17 - Capsule composition

A pharmaceutical composition may be prepared by filling a standard two-piece hard gelatin capsule with a therapeutically effective amount of a first inhibitor and a therapeutically effective amount of a second inhibitor in powdered form, 100 mg of lactose, 35 mg of talc and 10 mg of magnesium stearate.

Example 18 - Injectable Parenteral Composition

A pharmaceutical composition suitable for administration by injection may be prepared by mixing 1-5% by weight of a first inhibitor and 1-5% by weight of a second inhibitor in 10% by volume propylene glycol and water. The solution is sterilised by filtration.

Example 19 - Composition for Parenteral Administration A composition for intramuscular injection could be prepared to contain 1 mL sterile buffered water, and 1 mg each of two or more inhibitors.

Similarly, a composition for intravenous infusion may comprise 250 ml of sterile Ringer's solution, and 5 mg each of two or more inhibitors.

Example 20 - Injectable Parenteral Composition

A composition suitable for administration by injection may be prepared by mixing 1% by weight of two or more inhibitors in 10% by volume propylene glycol and water. The solution is sterilised by filtration.

Example 21 - Composition for Inhalation Administration

For an aerosol container with a capacity of 20-30 ml: a mixture of 10 mg each of two or more inhibitors with 0.5-0.8% by weight of a lubricating agent, such as polysorbate 85 or oleic acid, may be dispersed in a propellant, such as freon, and put into an appropriate aerosol container for either intranasal or oral inhalation administration. Example 22 - Ointment Composition

A typical composition for delivery as an ointment includes 1.Og of two or more inhibitors, together with white soft paraffin to 100.0 g, dispersed to produce a smooth, homogeneous product.

Example 23 - Topical Cream Composition

A typical composition for delivery as a topical cream is outlined below:

Two or more inhibitors 1.0 g each Polawax GP 200 25.0 g

Lanolin Anhydrous 3.0 g

White Beeswax 4.5 g

Methyl hydroxybenzoate 0.1 g

Deionised & sterilised Water to 100.0 g The polawax, beeswax and lanolin are heated together at 60°C, a solution of methyl hydroxybenzoate is added and homogenisation achieved using high speed stirring. The temperature is then allowed to fall to 50°C. The inhibitors are then added and dispersed throughout, and the composition is allowed to cool with slow speed stirring.

Example 24 - Topical Lotion Composition

A typical composition for delivery as a topical lotion is outlined below: Two or more inhibitors 1.2 g each

Sorbitan Monolaurate 0.8 g

Polysorbate 20 0.7 g Cetostearyl Alcohol 1.5 g

Glycerin 7.0 g

Methyl Hydroxybenzoate 0.4 g Sterilised Water about to 100.00 ml

The methyl hydroxybenzoate and glycerin are dissolved in 70 ml of the water at 75⁰C. The sorbitan monolaurate, polysorbate 20 and cetostearyl alcohol are melted together at 75°C and added to the aqueous solution. The resulting emulsion is homogenised, allowed to cool with continuous stirring and the inhibitors are added as a suspension in the remaining water. The whole suspension is stirred until homogenised.

Claims

CLAIMS:

1. A pharmaceutical composition for inhibiting the proliferation of prostate 5 cancer cells, said composition comprising a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor. o

2. A pharmaceutical composition for the treatment and/or prevention of prostate cancer, said composition comprising a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one CPLA₂-Oc inhibitor. s

3. The composition of claim 1 or claim 2, wherein the composition comprises a COX inhibitor and a LOX inhibitor.

4. The composition of claim 3, wherein the COX inhibitor is an NSAID. 0

5. The composition of claim 3 or claim 4, wherein the COX inhibitor is a nonselective COX inhibitor.

6. The composition of claim 5, wherein the non-selective COX inhibitor iss ibuprofen.

7. The composition of any one of claims 3 to 6, wherein the LOX inhibitor is a 5-LOX inhibitor. 0

8. The composition of claim 7, wherein the 5-LOX inhibitor is MK886.

9. The composition of claim 1 or claim 2, wherein the composition comprises a COX inhibitor and a cPLA₂-α inhibitor. s

10. The composition of claim 9, wherein the COX inhibitor is an NSAID.

11. The composition of claim 9 or claim 10, wherein the COX inhibitor is a selective COX-2 inhibitor.

12. The composition of claim 11, wherein the selective COX-2 inhibitor is celecoxib.

13. The composition of any one of claims 9 to 12, wherein the cPLA₂-α inhibitor is pyrrophenone or Wyeth-1.

14. A method for inhibiting the proliferation of prostate cancer cells, said method comprising subjecting the cells to a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of:

(a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor.

15. A method for the treatment and/or prevention of prostate cancer in a patient in need of said treatment and/or prevention, the method comprising administering to the patient a synergistic combination of a therapeutically effective amount of at least one COX inhibitor, and either one or both of: (a) at least one LOX inhibitor

(b) at least one cPLA₂-α inhibitor.

16. The method of claim 14 or claim 15, wherein the composition comprises a COX inhibitor and a LOX inhibitor.

17. The method of claim 16, wherein the COX inhibitor is an NSAID.

18. The method of claim 16 or claim 17, wherein the COX inhibitor is a nonselective COX inhibitor.

19. The method of claim 18, wherein the non-selective COX inhibitor is ibuprofen.

20. The method of any one of claims 16 to 19, wherein the LOX inhibitor is a 5- LOX inhibitor.

21. The method of claim 20, wherein the 5-LOX inhibitor is MK886.

22. The method of claim 14 or claim 15, wherein said composition comprises a COX inhibitor and a CPLA₂-OC inhibitor.

23. The method of claim 22, wherein the COX inhibitor is an NSAID.

24. The method of claim 22 or claim 23, wherein the COX inhibitor is a selective COX-2 inhibitor.

25. The method of claim 24, wherein the selective COX-2 inhibitor is celecoxib.

26. The method of any one of claims 22 to 25, wherein the cPLA₂-α inhibitor is pyrrophenone or Wyeth-1.