WO2008048570A2 - Piwil2-related biomarkers and cell lines useful therewith - Google Patents

Abstract

Methods useful to regulate piwi-related expression, biomarkers for precancerous stem cells and biomarkers for oncogenes (oncogene itself can be a biomarker for cancer, and pCSC cell lines and CSC cell lines are provided herein.

Description

TITLE

PIWIL2-RELATED BIOMARKERS AND CELL LINES USEFUL THEREWITH

INVENTORS: Jian-Xin Gao, Rulong Shen, Li Chen, Sanford H. Barsky, Yin Ye

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of United States Provisional

Application No. 60/851,979 filed October 16, 2006, the disclosure of which is incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0002] Clinically, most cancers undergo reversible premalignant stages of hyperplasia and dysplasia, which might progress to malignant primary and invasive tumors. Recent evidence indicates that the process is initiated by the "so-called" cancer stem cells (CSCs). While CSCs have been identified in the hematopoietic and solid cancers, the mechanisms underlying CSC derivation are largely unknown. It has been proposed that CSCs may originate from a stem or progenitor cell through a precancerous stage, during which the stem cells are hierarchically disturbed in their genetic program of self-renewal by environmental insults; whereas the progenitor cells may acquire the properties of stem cells. Thus, whether pCSCs exist or not and how they develop into cancer cells are important issues for cancer stem cell biology.

[0003] Although current diagnostic criteria and molecular markers provide some guidance in predicting patient outcome and selecting appropriate course of treatment, a significant need exists for a specific and sensitive method for detection, prevention and treatment of cancer, particularly in early-stage.

[0004] Such a method should specifically distinguish patients with precancer that is likely to regress from those patients with precancer that progress to malignant tumors.

[0005] There is now provided herein a further advance that is useful to regulate piwi-related expression in an effective manner.

[0006] There is also provided herein advances that are useful as biomarkers for stem cells and as biomarkers for oncogenes.

[0007] In addition, there is also provided herein pCSC cell lines and CSC cell lines.

SUMMARY OF THE INVENTION

[0008] In a broad aspect, there is provided herein precancerous stem cells (pCSCs) that are useful in determining both benign and malignant differentiation

[0009] In another aspect, there is provided herein precancerous stem cells (pCSC) useful as a target for anti-cancer drug development, cancer detection, cancer prevention, and cancer therapy.

[0010] In certain embodiments, the pCSC is useful as a diagnostic tool for evaluating one or more of the developmental stages of initiation (hyperplasia and metaplasia), premalignancy (dysplasia), and malignancy (carcinoma in situ, invasion, and metastasis).

[0011] In certain embodiments, the pCSCs can be detected in peripheral blood, secreting fluids and other non-invasive specimens from the patients having high-risk for cancer

[0012] In another broad aspect, there provided herein methods which use the germline stem cell protein, piwil2, as a signatory molecule during cancer development, and is persistently expressed on the precancerous and some cancerous cells from initiating to metastatic stages as well as from a variety of cancers.

[0013] In another broad aspect, there is provided herein a method for detecting pCSCs expressed in various types of cancers examined, such as cervix, breast, and thyroid, comprising detecting a piwil2 protein. In certain embodiments, piwil2 is detected in premalignant lesions as well as in histologically "normal" areas surrounding premalignant or malignant lesions.

[0014] In another broad aspect, there is provided herein a biomarker for cancer initiation comprising piwil2. The biomarker is useful for early diagnosis, prevention, prognosis, and therapy of cancer. The biomarker is expressed in the cells of hyperplasia, metaplasia, dysplasia, and various stages of cancer as well as the cells in normal tissues adjacent to cancer. The biomarker is useful for early diagnosis of cancer. The biomarker is also useful for cancer prognosis. The biomarker is also useful for distinguishing, based on the level of piwil2, precancer (dysplasia) from cancer (carcinoma). The biomarker is also useful for detecting metastatic cancer. The biomarker is also useful as a target for anti-cancer drugs. The biomarker is also useful for prevention and therapy of cancers by using one or more immunological approaches. The biomarkers can also be useful as tumor vaccines.

[0015] In a particular aspect, there is provided herein a biomarker for detecting precancerous stem cells (pCSCs) in a sample wherein the biomarker comprises piwil2.

[0016] In another particular aspect, there is provided herein a method for detecting precancerous stem cells (pCSCs) in a sample, the method comprising detecting a piwil2 in the sample. In a particular embodiment, the method can include detecting the expression of piwil2 in cells of hyperplasia, metaplasia, dysplasia, and various stages of cancer as well as the cells in normal tissues adjacent to cancer. The progression of these lesions can be determined based on the levels and isoforms of piwil2.

[0017] The measurement of the piwil2 gene activation can occur before the formation of morphologically identifiable precancerous lesion, whereby pipwl2 is useful as a biomarker of tumor initiation.

[0018] In certain embodiments, piwil2 is identified by its specific, rather than ubiquitous, expression in the normal tissue adjacent to cancers. Also, the piwil2 is thus useful to screen cancer-risk population earlier than at a precancerous stage.

[0019] In another particular aspect, there is provided herein a method of detecting precancerous stem cells (pCSC), the method comprising: a) providing a tissue sample from a subject, and b) detecting at least one biomarker comprising piwil2 in the tissue sample under conditions such that the presence or absence of precancerous cells in the tissue sample is determined. In certain embodiments, the subject comprises a human subject. Also, the tissue sample can comprise tumor tissue or adjacent surrounding normal tissue. In certain embodiments, the method can further comprise the step of c) providing a prognosis to the subject.

[0020] In another particular aspect, there is provided herein a method for killing or inhibiting the proliferation of precancerous stem cells (pCSC) comprising contacting the pCSC with a biologically effective amount of a composition comprising at least one agent targeted to at least one cancer marker comprising piwil2.

[0021] In certain embodiments, the method further comprises identifying the death of or the prevention of the growth of the precancerous cells following the contacting. The method can be used for distinguishing tumorigenic from non-tumorigenic cancer cells, comprising detecting the presence of piwil2 in a precancerous cell. Also, the method can further comprise where piwil2 is detected in premalignant lesions as well as in histologically "normal" areas surrounding premalignant or malignant lesions.

[0022] In another particular aspect, there is provided herein a composition comprising the biomarkers as set forth herein.

[0023] In another particular aspect, there is provided herein a screening test for a pre-cancerous condition comprising contacting one or more of the biomarkers an in any of the preceding claims with a test agent, and determining whether the test agent modulates the activity of the biomarker.

[0024] In another particular aspect, there is provided herein a method of identifying a potential for the initiation or development of at least one cancer-related disease in a subject, the method providing measuring one or more of the biomarkers as set forth herein.

[0025] In another particular aspect, there is provided herein a cell line selected from the group consisting of 2C4, 2C4G2, 3B5C and 3B6C which are deposited as Budapest Treaty patent deposit at ATCC on DATE##,200x, under Accession Numbers xxxxx, xxxxx, xxxxx, and xxxxx, respectively.

[0026] The pCSC cell lines are characterized as expressing neither hematopoietic and lineage (Lin) markers nor hematopoietic stem cell (HSC) markers (CD45^"c-kit^"Sca- l^"Lin^"), and having the potential for both benign and malignant differentiation. Also, in certain embodiments, the pCSC cells have the properties of both normal stem cells and CSCs.

[0027] In another particular aspect, there is provided herein a use of any one of the cell lines in the formulation of a treatment of a precancerous condition.

[0028] In another particular aspect, an expression library can be derived from at least one cell line which can be used in screening experiments to discover cancer- associated or specific antigens for use as immunotherapeutics and diagnostics.

[0029] In another particular aspect, there is provided herein a precancerous stem cell (pCSC) useful as a target for anti-cancer drug development, cancer prevention, and cancer therapy. [0030] In another particular aspect, there is provided herein a clone of the pCSCs which are useful determining both benign and malignant differentiation of cells.

[0031] In another particular aspect, there is provided herein a diagnostic tool for evaluating one or more of the developmental stages of initiation, premalignancy (hyperplasia, metaplasia, and dysplasia), carcinoma in situ, invasion, and metastasis comprising a pCSC. The pCSCs of 2C4, 3B5C and 3B6C:have one or more of the following characteristics: do not express hematopoietic pan-marker CD45 and lineage markers CD3ε, CD4, CD8, B220, Ter-119, CD l Ib and Gr-I; have the phenotype: CD34\ CD38^low, c-Kif, Sca-1^", CD90^', Ly6C^" and CD44^hlgh; and, are distinct from normal hematopoietic stem/progenitor cells. Also, in certain embodiments, The pCSCs of any of the preceding claims wherein the pCSCs exhibit a stem-like cell phenotype: CD45-c-kifSca-rLm CD44^hlgh (CD45KSLCD44^hlgh).

[0032] In certain embodiments, the cytological analysis demonstrates that all the pCSCs exhibit stem-like cell morphology with large numbers of cytoplasmic vacuoles or granules, somewhat distinct from normal BM-derived CD34⁺Lin^" and CD34^"Lin^" blast cells.

[0033] In certain embodiments, the pCSCs retain incomplete multipotency of differentiation toward various hematopoietic lineages. Also, in certain embodiments, the pCSCs have one or more properties expected of a stem cell, including one or more of self-renewal and multipotency. Still further, in certain embodiments, the pCSCs have the property of benign differentiation which distinguishes the pCSCs from malignant stem cells (CSCs); and further have the property of malignant differentiation which distinguishes them from normal stem cells. In certain embodiments, at least one of the pCSCs has the potential for both benign and malignant differentiation, depending on environmental cues.

[0034] In another particular aspect, there is provided herein a therapeutic approach to the cure of various types of cancers achievable through rational targeting of pCSCs.

[0035] In another particular aspect, there is provided herein a clone of a precancerous stem cell (pCSC) from a spleen of a mouse with dendritic-cell like lymphoma, the clone having manifestly different phenotypical and tumorigenic properties from both normal stem cells (NSCs) and cancer stem cells (CSCs).

[0036] In another particular aspect, there is provided herein a clone having a phenotype demonstrated as CD45-c-kit(K)-Sca-l(S)Lin(L)-CD44^hlgh (CD45KSL- CD44^hlgh).

[0037] In another broad aspect, there is provided herein the use of Piwil2 to regulate expression of stem cell gene.

[0038] In another broad aspect, there is provided herein the use of piwil2 to regulate expression of oncogenes.

[0039] In another broad aspect, there is provided herein the use of a piwil2 siRNA to alter expression of piwil2 mRNAs, including full length piwil2 and isoform piwil2.

[0040] In another broad aspect, there is provided herein a method for reducing expression of one or more embryonic stem cell-related genes in a cell comprising transfecting the cell with a piwil2 siRNA. hi certain embodiments, the embryonic stem cell-related genes include one or more of: REX-I, TEGF-I, SOX2 and Oct-4.

[0041] In another broad aspect, there is provided herein a method for reducing expression of one or more adult stem cell-related genes in a cell comprising transfecting the cell with a piwil2 siRNA. In certain embodiments, the adult stem cell- related genes include one or more of: Bmi-1, Smo, Stat3 and ABCG2.

[0042] In another broad aspect, there is provided herein a method for increasing expression of one or more of one or more adult stem cell-related genes in a cell comprising transfecting the cell with a piwil2 siRNA. In certain embodiments, the adult stem cell-related genes include one or more of: c-Myc, Notch- 1, and endolin.

[0043] In another broad aspect, there is provided herein a method for altering expression of one or more adult stem cell-related genes in a cell (including Bcl2, Fzd5, Fzd2 and β-catenin), comprising transfecting the cell with piwil2 siRNA.

[0044] In another broad aspect, there is provided herein a cancer stem cell (CSC) line (326T), derived from a murine thymoma, and exhibiting the phenotype of CD45+c-kit-Sca-l-Lin- (CD45+KSL-), which is deposited as Budapest Treaty patent deposit at ATCC on DATE##,200x, under Accession Number xxxxx.

[0045] In another broad aspect, there is provided herein a CSC cell line having the capacity of tumorigenesis in both SCID and IC mice.

[0046] In another broad aspect, there is provided herein a CSC cell line wherein the CSC cell line expresses little of the germline stem cell gene piwil2 and piwil2-regulated embryonic stem cell genes Oct-4, TDGF-I and Rex-1. [0047] In another broad aspect, there is provided herein a CSC 326T cell line capable of developing into acute leukemia in SCID mice and developing into chronic myelogenous leukemia in IC mice.

[0048] In another broad aspect, there is provided herein a 326T cell line exhibiting karyotype of t(2;8)(Fl;El), a single chromosome translocation.

[0049] In another broad aspect, there is provided herein a method for determining a magnitude of malignancy of genetic altered stem or progenitor cells, comprising determining a level of piwil2 and piwil2-regulated embryonic stem cell genes in a cell.

[0050] In another broad aspect, there is provided herein a CSC cell line having a phenotype as follows: CD45⁺c-Kif^/lowSca-r^/lowLin ^/lowCD44⁺CD24⁺ (CS45⁺KLS-^/low CD44CD24⁺).

[0051] In another broad aspect, there is provided herein a pCSC cell line having a phenotype as follows: CD45^"c-Kit^"Sca-l^"Lin^*/lowCD44^hi8hCD24^'(CS45^"KLS^' CD44^highCD24^").

[0052] In another broad aspect, there is provided herein a method for establishing cancer stem cell lines, comprising: using XLCM™ to selectively support cancer stem cell growth from bulk cell cultures ;injecting lethally irradiated CD45.1 congenic B6 mice precancerous stem cells (pCSCs) 2C4 or 2C4G2 together with recipient-type bone marrow (BM) cells until one or more tumors are developed; seeding single cells from the BM of all the mice and from any tumor and mouse in 2ml RlOF (RPMI plus 10% FCS) or H5X (serum-free HBCM™ plus 5% XLCM™) and culturing to develop one or more clones that show blast morphology with differentiated granuocytes; and, culturing the clone in H5X media such that the clone could be passaged. In certain embodiments, the method is useful to establish human CSC lines.

[0053] In another broad aspect, there is provided herein an isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a Piwil2-80, comprising a protein sequence substantially as shown in Fig. 29.

[0054] In another broad aspect, there is provided herein an isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a Piwil2-80, comprising a DNA sequence substantially as shown in Fig. 30.

[0055] In another broad aspect, there is provided herein a biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the piwil 12-80 protein sequence of Fig. 29.

[0056] In another broad aspect, there is provided herein a biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the piwil 12-80 DNA sequence of Fig. 30.

[0057] In another broad aspect, there is provided herein an isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a piwil2-60, comprising a protein sequence substantially as shown in Fig. 31.

[0058] In another broad aspect, there is provided herein an isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a Piwil2-60, comprising a DNA sequence substantially as shown in Fig. 32.

[0059] In another broad aspect, there is provided herein a biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the piwil 12-60 protein sequence of Fig. 31.

[0060] In another broad aspect, there is provided herein a biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the DNA piwill2-60 sequence of Fig. 32.

[0061] In another broad aspect, there is provided herein a biomarker for determining the survival com pCSCs, comprising monitoring the ectopic expression of piwil2-60.

[0062] In another broad aspect, there is provided herein a biomarker for detection of one or more long-term cultured primary cell lines, including, but not limited to human dermal fibroblasts (HDF), human lung fibroblasts (HLF), and breast epithelial cells (HT125), comprising monitoring expression of piwil2-l 10.

[0063] In another broad aspect, there is provided herein a biomarker for detecting one or more cancer cell lines, including but not limited to as cervical cancer cells (HeLa), and breast cancer cells (468, 231 and HT126), comprising monitoring expression of one or more or piwil2-80 and piwil2-60.

[0064] In another broad aspect, there is provided herein a biomarker for detecting tumorigenic capacity of a cancer cell line in SCID mice, comprising monitoring expression of one or more of: piwil2-80 and piwil2-60.

[0065] Various objects and advantages of these embodiments will become apparent to those skilled in the art from the following detailed description of the preferred embodiment, when read in light of the accompanying drawings.

DESCRIPTION OF THE DRAWINGS

[0066] Figures Ia-Ig show the characterization of pCSCs -

[0067] Fig. IA - The phenotype of pCSC clones: the data shown are from clone

2C4, clone 3B5C and clone 3B6C are similar (not shown).

[0068] Fig. IB - The morphology of the pCSCs: a representative (2C4) of 3 clones (Wright-Giemsa staining; original magnification x200).

[0069] Fig. 1C - Comparison of morphology between the pCSCs and HSCs:

HSC-enriched CD34^'Lin^" and CD34⁺Lin^' cells were sorted by FACSorter from the BM of B6 mice (xlOOO). DC-like cell line 3 B 1 1 was derived from the same mouse of the pCSCs.

[0070] Fig. ID - The karyotype of pCSCs: a representative of 2C4 clone, exhibiting pseudodiploid karyotype with multiple chromosomal translocations identical to the 3B5C and 3B6C clones (not shown).

[0071] Figs. IE, IF and IG - Long-term repopulating assay: Congenic

CD45.1 B6 mice were lethally irradiated and injected i.v. with 0.5 ~ 1 x 10⁶ 2C4, 3B5C or 3B6C cells along with 2 ~ 5 x 10⁵ recipient-type BM cells. Donor-specific CD45.2⁺ lymphoid (CD3a⁺) and myeloid (CDl Ib⁺ or Gr-I⁺) cells were monitored by flow cytometric analysis of blood cells starting from 4 wks post transfer, once every two wks, until 18 wks (Fig. IE). The mice were sacrificed 10 months post transfer, and the blood and BM cells were collected for HANDS-Nested DNA PCR to identify donor-derived cells (Fig. IF). To verify the self-renewal capability of the long-term repopulated donor cells, 1 xlO⁶ BM cells from the primary recipients were injected i.v. into the secondary recipients, which were sacrificed 10 wks post transfer. The pCSC- derived neo^r gene in the BM, liver and spleen was determined by HANDS-Nested DNA PCR (Fig. IG). The data shown in B are from a recipient with transient expansion of pCSC-derived hematopoietic cells at 8 and 13 wks post transfer, and the data shown in C & D are from one of 3 experiments (5~ 10 mice/group/expt).

[0072] Figures 2A -2E. - pCSCs can differentiate into various type of tissue cells

[0073] Fig. 2 A - Differentiation of pCSCs into hematopoietic and non- hematopoietic cells: The lethally irradiated CD45.1 congenic B6 mice were injected i.v. with 1 x 10⁶ 2C4 (n = 5) or eGFP⁺ 2C4G2 cells (n = 10) along with 5 x 10⁵ recipient-type BM cells as described above. The mice were sacrificed 5 months post transfer. Various organs including liver, kidney, spleen and adipose tissues were harvested, fixed in 10% formaldehyde of PBS, prepared for H & E. staining, and examined under fluorescent microscope. At least three discontinuous sections (100 im/step) were examined for each organ to ensure that eGFP⁺ cells were identified under the fluorescent microscope. The morphology of eGFP⁺ cells was determined under the bright field of the fluorescent microscope (original magnification xlOOO).

[0074] Figs. 2B-2E - Development of pCSCs in blastocyst chimeric mice. E3.5 dpc of FVB mice were injected with 2C4G2 (8 ~ 10 cells per blastocyst), and transferred to pseudopregnant surrogate mothers. The progenies were delivered and grew to adult without any complication. The data shown are from one of two experiments, in which 8 progenies (male: n=6; female: n=2) were obtained. One male mouse died of fighting at 3 months of age.

[0075] Fig. 2B - eGFP⁺ RBCs in 7/8 of the chimeric mice: The data shown are representative of air-dried blood smear from two mice at age of 2 months examined under bright and fluorescent field, respectively, of a fluorescent microscope (Nike, E400, Japan).

[0076] Fig. 2C - pCSC-derived eGFP⁺CD45⁺ cells: peripheral blood were harvested from the chimeric mice at age 2 months (n=6; other two pregnant mice were not examined) or control FVB mice (n=10), stained with PE-conjugated mAb to CD45, and analyzed by flow cytometry.

[0077] Figs. 2D and 2E - Living image of the chimeric mice: A representative living image of the chimeric mice at 4 months of age is shown in Fig. 2D, demonstrated by rVIS imaging systems incorporated with Living Imaging® software (Xenogen Inc.); and the eGFP derived photon counts in the region of interest (ROI) of 7 mice are shown in Fig. 2E. Normal FVB mice were used as control for living imaging.

[0078] Figures 3a-3E - pCSCs developed into various types of tumors in immunodeficient mice.

[0079] Fig. 3 A - Tumor incidence from 3 experiments. Equal numbers of sex matched SCID mice were inoculated s.c. or i.p. with 5 x 10⁶ PCSCs. No significant difference in incidence was observed between s.c. and i.p. inoculated mice. As a control, C57BL/6 mice inoculated s.c. (n=2) or i.p. (n=2) with 2C4 cells did not develop tumor within 5 months of observation (data not shown) "*" indicates that a mouse developed ascites, "**" indicates that the 3B6C cells infiltrated in the liver and spleen (see E).

[0080] Fig. 3B - Kinetics of tumor growth: the data shown are from experiments 1 & 2 in A. Each color in B represents each indicated cell line.

[0081] Fig. 2C - A representative of gross tumors from a mouse inoculated i.p. with 3B5C clone.

[0082] Fig. 3D - A histological representative of pCSC-derived tumors from the mice inoculated i.p. with 2C4 or 3B5C clones.

[0083] Fig. 3E - A histological representative from the spleen of mice inoculated i.p. or s.c. with 3B6C clone. Note that megakaryocytes in the spleen of normal SCID mice were replaced by atypical neutrophils or esionophils.

[0084] Figures 4A and 4B - phenotype of pCSC-derived tumor cells.

[0085] Fig. 4A - Single tumor cells were prepared and freshly stained with mAb to CD45 and a mixture of lineage-specific mAbs to CD3, CDl Ib, Ter-119, Gr-I and B220; or

[0086] Fig. 4B - cultured for 2 d and stained with mAb to CD45 in combination with mAbs to lineage markers or to c-kit and Sca-1 as indicated. The green and red dot plots or histograms represent the tumor cells derived from 2C4G2 (green) and 2C4 (red), respectively (Fig. 4A). Five populations of tumor cells are identified based on the level of CD45 and eGFP expression (Fig. 4B).

[0087] Figures 5A-5C - regulating pCSC expansion by the ectopically expressed milt gene.

[0088] Fig. 5A - Exclusive expression oϊmili (piwil2) gene in pCSCs: Total

RNA isolated randomly from 2C4, 3B5C and 3B6C cell cultures at various times; or from the purified CD34⁺Lin^" and CD34^'Lin^' BM cells of B6 mice by FACS Aria in 3 separate experiments, was subject to RT-PCR analysis for embryonic, germ-line and adult stem cell-related sternness genes and oncogenic genes. The data shown are a representative of at least 3 experiments.

[0089] Fig. 5B - Inhibition of pCSC expansion in vitro by mili-specific siRNA: 2C4 cells (100/well) were transfected or not transfected by mili-specific siRNA (100 nMol), or mock-transfected in triplicate in 24-well plates. The number of cells was counted at indicated times. The data shown are a representative of 5 experiments. **, p < 0.01 as compared to the mock- or non-transfected groups.

[0090] Fig. 5C - Knockdown of mili mRNA by mili-specific siRNA: 2C4 cells

(1 xlO⁶/well) were transfected by mili-siRNA or scramble nucleotide (nt) RNA, and harvested 48 hrs post transfection. The expression of Mili mRNA was revealed by RT- PCR. The data shown are a representative of 3 experiments.

[0091] Fig. 6A - Biological comparison between NSCs, pCSCs, and CSCs.

[0092] Fig. 6B - Schematic model of pCSC development: mili may play an important role in pCSC development.

[0093] Figures 7A-7C - Incomplete differentiation of pCSCs in the CFC assay. The cells (2C4, 3B5C or 3B6C) were plated (100 or 200 cells/well) in semisolid methylcellulose medium of MethoCult™ GF M3434 (StemCell Technologies Inc. Canada) for CFC assay. The colonies were counted 2 wks after culture (Fig. 7A and Fig. 7B). The lineage-specific gene expression was analyzed by RT-PCR before or at day 11 of culture, and the BM cells were used as a positive control (Fig. 7C). The experiments were repeated 3 times with similar results. The data shown in A are expressed as mean ± SD.

[0094] Figures 8A-8E - effect of cytokines on pCSC differentiation in vitro.

[0095] Figs. 8A and 8B - The effect of G-CSF on pCSC differentiation: The cells (75,000/flask) of 2C4, 3B5C and 3B6C clones were cultured in 10 ml RlOF medium containing 10% of G-CSF-supernatant. The medium was replenished with 30 ml of medium containing 10% G-CSF supernatant starting from d 5 of culture every other day. The viable cells were counted every other day until they died (Fig. 8A). The cytological alterations of the pCSCs were monitored by Wright-Giemsa staining at each time point. The micrographs (Fig. 8B) show a representative from the clone 3B6C of three experiments. Control cultures in the absence of G-CSF supernatant did not cause cell death (data not shown).

[0096] Fig. 8C - The effect of GM-CSF on pCSC differentiation: 2C4 cells were cultured (100 cells/well) in RlOF containing 5 ng/ml recombinant murine GM-CSF (PeproTech, Inc, Rocky Hill, NJ) in 24-well plates. The data shown are representative from the cultures in the absence (left panel) or presence of GM-CSF (right panel) of three experiments.

[0097] Figs. 8D and 8E - The effect of IL-7 and IL- 15 on pCSC differentiation:

2C4 cells (100/well) were cultured in the presence of IL-7 (50 ng/ml) or IL- 15 (50 ng/ml) or in a combination of them. The cells were harvested on days 9 and 12 of culture, and stained with mAbs to NK 1.1 and B220 (Fig. 8D) or cytospined for Wright- Giemsa staining (Fig. 8E). The data shown are representative of three experiments.

[0098] Fig. 9 - pCSCs can repopulate in various organs of recipients. 2C4 cells (5 x 10⁵) were transplanted into lethally irradiated CD45.1 B6 mice along with 2 x 10⁵ recipient type BM cells. The mice were sacrificed 5 months later, and various organs were harvested for analysis of pCSC-derived neo^r gene, using HANDS-Nested DNA PCR. The data shown were from one of 3 experiments. The organs from control (ctrl) mice were used as negative control, and 2C4 and 2C4G2 cell lines were used as positive controls.

[0099] Fig. 10 - generation of stable eGFP expressing cell lines. 2C4 cells were transduced with Lenti-GFP viral vectors, and selected in the presence of puromycin for > 2 months. The drug-resistant cells were cloned by limiting dilution, and eEGP+ clones were identified by flow cytometry. The histogram depicted the fluorescent intensity of a representative clone 2C4G2, which was used throughout the experiments.

[00100] Figs. HA and HB - CSC-derived metastatic tumors in various organs.

[00101] Fig. HA - metastatic tumor in the spleen, liver, pancreas and prostates.

The data shown are the tissues derived from the mice inoculated with 2C4 (spleen and liver) or 3B5C (pancreas and prostate). Original magnification: x400. [00102] Fig. HB - Benign differentiation of pCSCs in the liver with metastatic cancers, (a) H & E staining of a liver section with metastatic cancers from a mouse inoculated i.p. with 2C4 cells (original magnification: x200). (b) Immunohistochemical staining of the liver section from the same mouse with antibody to neomycin, showing neomycin^"1" cancer cells (original magnification: x400). (c) Immunohistochemical staining of pCSC-derived hepatoid cells in the regenerative area of the liver sections from the same mouse (original magnification: x200). (d) The enlarged micrographs of hepatoid cells demonstrated in (c).

[00103] Figures 12A-12D - estrained tumorigenesis of pCSCs after intravenous inoculation. SCID mice were injected i.v. with 5 x 10 2C4, 3B5C or

3B6C (n=3/group). As a control, the lethally irradiated B6 mice were injected i.v. with the same number of 2C4, 3B5C or 3B6C cells (n=4/group) together with 5 x 10⁵ recipient-type BM cells. The mice were sacrificed 5 months later, and various organs or tissues including spleen, liver, kidney, lung, intestines, pancreas and blood were harvested from the SICD and BMreconstituted B6 mice for pathological examination.

None of the organs developed a cancer except for spleen of SCID mice.

[00104] Fig. 12 A - The structure of normal spleen of SCID mice.

[00105] Fig. 12B - The leukemic alteration in the spleen of SCID mice injected i.v. with pCSCs: the micrograph shown is from a mouse inoculated i.v. with 36BC cells.

[00106] Fig. 12C - Blast cells detected in the blood smears: a representative from a SCID mouse inoculated with 2C4 cells.

[00107] Fig. 12D - Normal appearance of the spleens from the BM-reconstituted mice: the micrograph shows a representative from a mouse inoculated with pCSCs

(2C4 clone). Original magnification for H& E. staining sections: x400; blood smear: x 1000. The insets are enlargement from where indicated by an arrow.

[00108] Fig. 13 - Table 1 which shows the effect of environments on the tumorigenesis of pCSCs.

[00109] Figs. 14A and 14B - Table 2 which shows the sequence of the primers used.

[00110] Figs. 15A-15C - ectopic expression and the function of mili in pCSCs.

[00111] Fig. 15A - Stem cell related-gene expression, total RNA was isolated from pCSC lines CD34⁺Lin^" and CD34^"Lin^' bone marrow cells, which were depleted of Lin+ cells followed by FACS sorting.

[001 12] Figs. 15B & 15C - Effect of mili on pCSC proliferation: M9-2C4 cells were transfected with mili siRNA (UCGUACCUACCGAAUCGAU) [Seq. ID No. 6] or scramble siRNA (CACGUGAGGAUC ACCAUCA) [Seq. ID No. 7] using a siRNA transfection kit, manufacture (Qiagen), and the cells were counted at indicated times (B; 100 cells/well), or were harvested 48 hr after transfection for RT-PCR (C; 1 x 10⁶ cells/well). **, p < 0.01 as compared to the treatment with scrambled nucleotide (nt)

RNA.

[00113] Figs. 16A & 16B - Piwil2 constitutively expressed in mouse and human tumor cell lines. The cell lines of murine and human tumors were extracted for total RNA.

The MiIi and hili expression in mouse (Fig.16A) and human (Fig. 16B) cancer cell lines were analyzed, respectively by RT-PCR The testis RNA from male C57BL/6 mice was used as a positive control for murine mili, and a negative control for human hili.

[00114] Figs. 17A-17I - Piwil2 expression in various types of cancer. The samples from the patients with cervix breast and thyroid cancer were stained with rabbit anti piwil2 (Figs. 17A, B, D, E, G, & H) or normal rabbit IgG (Figs. 17C, F, &

I). Strong nuclei and cytoplasmic staining were noted in cervical squamous cell carcinoma in situ (Figs. 17A & B), invasive breast ductal carcinoma (Figs. 17D & E), and metastatic papillary thyroid carcinoma (Figs. 17G & H). Arrows in the Figs. 17 A,

D & E indicates the enlarged areas shown in the middle column. An arrow head in A indicates moderate dysplastic lesion, and an arrow indicates high grade dysplasia.

[001 15] Figs. 18A-18I - Piwil2 expressed in premalignant lesions in the cervix. The cervical tissue from a patient with high-grade squamous intraepithelial neoplasia (cervical intraepithelial neoplasia, CIN-3). The Piwi l2 was moderately expressed in metaplastic squamous epithelium, even in the early parabasal squamous cell proliferation, the Piwil2 was mildly expressed.

[00116] Fig. 18A - H & E staining.

[00117] Fig. 18B - Piwil2 expression in hyperplastic squamous epithelia and surrounding pathologically "normal" areas.

[00118] Fig. 18C - The basal and parabasal cells in the pathologically "normal" area express piwil2. Yellow arrow indicates piwil2-negative basal cells.

[00119] Fig. 18D - Piwil2 expression in the epithelial layers of cervical mucosa with hyperplastic squamous epithelia than "normal" area.

[00120] Fig. 18E - Piwil2 expression is not associated with pl6 expression.

[00121] Fig. 18F - Rabbit IgG control.

[00122] Figs. 19A-19I - Piwil2 expression in "normal tissues" proximately to pre- or malignant lesions. [00123] Figs. 19A, 19B, & 19C-2 - Piwi 12 was moderately expressed in normal breast tissue adjacent to invasive ductal carcinoma .

[00124] Figs. 19E & 19E - cervical glandular epithelia near high-grade squamous intraepithelial neoplasia (carcinoma in situ).

[00125] Figs. 19G & 19H - and normal thyroid follicular cells near thyroid carcinoma.

[00126] The number in Figs. 19A & 19D indicate the area enlarged in Figs. 19B

& 19C or Figs. 19E & 19F, which demonstrate positive (Figs. 19B, 19C-2, & 19E) and negative (Figs. 19C-3 & 19F) staining of piwil2 in normal cells, respectively.

Micrographs of Figs. 19G, 19H & 191 show piwil2⁺ (Figs. 19G & 19H) and piwil2^"

(Fig. 191) thyroid follicular cells from the same section.

[00127] Fig. 20 - PiwiI2, pl6 and Ki67 expression in normal tissue near neoplasia. The consecutive sections from a patient with cervical neoplasia were staining with antibody to piwil2 (hili), pi 6, Ki67 or rabbit IgG. The Piwi 12 (HiIi) was positive in endocervical glands near high-grade squamous intraepithelial neoplasia while P16 and Ki67 have only focal positive staining.

[00128] Figs. 21a-21F - Piwil2, pl6 and Ki67 expression in cervical neoplasia.

[00129] Figs. 21 A, B & C. The Pi wi 12 was positive in high-grade squamous intraepithelial neoplasia as strong as P16 and Ki67 except Piwi 12 was also positive in the adjacent columnar and metaplastic squamous epithelium where the Pl 6 and Ki67 were negative (arrows).

[00130] Figs. 21 D & E. The enlarged micrographs from the square areas of

Figs. 21A & E, respectively. A few of stromal cells (arrows in Fig. 21D) also expressed the moderate level of piwil2, but not Ki67 (Fig. 21E).

[00131] Fig. 22 - chart showing that piwil2 regulates the expression of stem cell gene and oncogenes.

[00132] Fig. 23 - Mouse # 6 was diagnosed as leukemia infiltrated in thymus, lung, liver, kidney, spleen, lymph nodes (not shown), but not brain and intestines.

[00133] Fig. 23B - The cytology of the cells grew out from BM and thymoma cell cultures with H5X.

[00134] Fig. 24 - A comparison of the phenotypes between CSCs and pCSCs. [00135] Fig. 25A - percent of survival as compared to the days after inoculation for 326t (iv), 326T (sc),326T (ip), 2C4 (iv), 2C4 (sc), and 2C4 (ip). The data shown are from 2 experiments (n=8/group).

[00136] Fig. 25B - data obtained from peripheral blood of the mice that were injected with 326T cells 4 wks later.

[00137] Fig. 27 - karyotype analysis of CSCs and pCSCs, for 326T and 2C4. It is to be noted that the genetic alterations of CSCs are not necessarily more rigorous than that of the pCSCs.

[00138] Fig. 28 - a comparison of the molecular signatures between CSCs and pCSCs.

[00139] Fig. 29 - protein sequence of piwil2-l 10 and piwil2-80.

[00140] Fig. 30 - DNA sequence of piwil2- 110 and piwil2-80.

[00141] Fig. 31 - the protein sequence of piwil2-60.

[00142] Fig. 32 - the DNA sequence of piwilόO.

[00143] Fig. 33 - the expression of piwil2 isoforms in cancer and primary cell lines.

[00144] Fig. 34 - Protocol for vaccination with pCSCs.

[00145] Figs. 35A & 35B - The mice vaccinated with pCSCs rejected or suppressed challenging EL-4 tumor.

[00146] Figs. 36A & 36B - Piwil2 mediates pCSC-induced anti-tumor activity.

[00147] Fig. 37 - Piwil2 expression in cervical precancerous lesions.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [00148] The piwil2 gene, called mili in mouse and hili in human, respectively, is a member of the piwi gene family. The piwil2 is exclusively expressed in the germline stem cells of testis. The genes of the piwi family are defined by conserved PAZ and Piwi domains and play important roles in stem-cell self-renewal, RNA silencing and translational regulation in various organisms.

[00149] Thus, in one broad aspect, there is provided herein biomarkers that are proteins and/or genes whose overexpression is indicative of cancer prognosis. The biomarkers are involved in cell cycle regulation, DNA replication, transcription, signal transduction, cell proliferation, invasion, or metastasis. The detection of overexpression of the biomarker genes or proteins of the invention permits the evaluation of cancer prognosis and facilitates the separation of cancer patients into good and poor prognosis risk groups for the purposes of, for example, treatment selection.

[00150] Biomarker expression can be assessed at the protein or nucleic acid level. In some embodiments, immunohistochemistry techniques are provided that utilize antibodies to detect the expression of biomarker proteins in samples. In this aspect, at least one antibody directed to a specific biomarker of interest is used. Expression can also be detected by nucleic acid-based techniques, including, for example, hybridization and RT-PCR.

[00151] Compositions include monoclonal antibodies capable of binding to biomarker proteins. Antigen-binding fragments and variants of these monoclonal antibodies, hybridoma cell lines producing these antibodies, and isolated nucleic acid molecules encoding the amino acid sequences of these monoclonal antibodies are also encompassed herein. Kits comprising reagents for practicing the methods of the invention are further provided.

[00152] While investigating tumor incidence in mice with targeted mutation of p53 and stat-1 genes, the inventors herein found that a mouse developed dendritic cell (DC)-like leukemia, which was characterized by massive infiltration of CDl lc⁺CD8a⁺ DCs in spleen, lymph nodes, and liver. Upon cloning DC-like lines from the spleen of this leukemic mouse, 3 of 24 clones (designated as 2C4, 3B5C and 3B6C) expressed neither hematopoietic and lineage (Lin) markers nor hematopoietic stem cell (HSC) markers (CD45^"c-kit^'Sca-l^*Lin^"). These pCSC cells have the potential for both benign and malignant differentiation, and their fate appears to be determined by environmental cues. Since these cells have the properties of both normal stem cells and CSCs, we termed them pCSCs. The progression of pCSCs to cancer cells is associated with up- regulation of c-kit and Sca-1 as well as lineage markers. Mechanistically their expansion is regulated by a PIWI/ AGO gene mili. The finding will allow us to target a much earlier stage of cancer development in cancer prevention and cancer therapy. [00153] EXAMPLE I

[00154] 1. pCSCs exhibit stem-like cell phenotypes

[00155] The phenotypes of pCSCs were characterized. The pCSCs of 2C4, 3B5C and 3B6C did not express hematopoietic pan-marker CD45 and lineage markers CD3ε, CD4, CD8, B220, Ter-119, CDl Ib and Gr-I (Fig. IA). Further analysis of the stem cell related markers revealed a unique phenotype: CD34^", CD38^low, c-Kit\ Sca-1^", CD90^", Ly6C^" and CD44^high (Fig. IA), somewhat distinct from normal hematopoietic stem/progenitor cells. Cytological analysis demonstrated that all the clones exhibited stem-like cell morphology with large numbers of cytoplasmic vacuoles or granules, somewhat distinct from normal BM-derived CD34⁺Lin^" and CD34^"Lin^' blast cells (Figs. IB & C). These clones seemed derived from a single parent clone because cytogenetic analysis revealed that each clone carried a pseudodiploid karyotype with multiple chromosomal translocations of an identical pattern (Fig. ID). Overall, the pCSCs exhibit a stem-like cell phenotype: CD45^"c-kit^" Sca-lTin CD44^high (CD45KSLCD44^high).

[00156] 2. pCSCs have incompletely abolished multipotency

[00157] Since a stem cell has multipotency of differentiation, we evaluated the multipotency of pCSCs using colony-forming cell (CFC) assay. About 30 ~ 50% of the input cells had colony-forming activity (CFU) in the medium of Methocult GF M3434 (Fig. 7A).

[00158] Although we did not observe all types of CFUs that may be differentiated from normal HSCs, such as burst forming units-erythroid (BFU-E), CFU- M (macrophage), and CFU-G (granulocyte), three types of CFUs were identified from these clones, including CFU-E (erythroid), CFU-mix, and CFU-GM (Fig. 7B). [00159] Accordingly, early lineage differentiation markers hemoglobin Hbb-1 for erythrocytes, CD41 for megakaryocytes, and c-fms for granulocytes/macrophage were either constitutively expressed (i.e. CD41) or up-regulated (i.e. Hbbl and c-fms), as demonstrated by RT-PCR (Fig. 7C). Conversely, EpoR, vWF and G-CSFRl, which are differentiation markers for late stages of erythrocytes, megakaryocytes and granulocytes/monocytes/ macrophages, respectively, were undetectable in all the clones of pCSCs (Fig. 7C). The results suggest that the normal development program of the pCSCs was impaired but incompletely abolished.

[00160] To further confirm the conclusion, we cultured the pCSCs in the suspension medium in the presence of myeloid or lymphoid lineage-specific cytokines. In the presence of G-CSF, all the clones of pCSCs differentiated toward myeloid cells, but became apoptotic within 3 wks of culture (Fig. 8A).

[00161] The cell death appeared to be associated with their inability to complete the differentiating program, even though some of the cells had acquired the ability to phagocytose apoptotic cells (Fig. 8B).

[00162] In addition, the 2C4 cells died at day 6 - 7 of culture in the presence of recombinant murine GMCSF (Fig. 8C), suggesting that the GM-CSF-mediated differentiating program led to earlier death of the pCSCs than the G-CSF-mediated.

Moreover, the pCSCs also have the potential to differentiate into lymphoid cells when co-cultured with IL-7 and/or IL-15, as the lymphoid markers such as B220 and NKl.1 were significantly up-regulated on the pCSCs, although variable (Fig. 8D).

[00163] However, they also failed to complete the differentiation program, and underwent apoptosis within two wks of culture (Fig. 8E). Taken together, the results suggest that the pCSCs retain incomplete multipotency of differentiation toward various hematopoietic lineages.

[00164] The aborted in vitro hematopoietic differentiation may reflect the strict requirement for environmental cues of the pCSC differentiation and/or survival. To test the hypothesis, a competitive in vivo repopulating assay was performed. Lethally irradiated CD45.1 congenic B6 mice were injected i.v. with 2C4, 3B5C or 3B6C cells together with recipient-type bone marrow (BM) cells. Donor-derived CD45.2⁺ lymphoid (CD3a⁺) and myeloid (CDl Ib⁺ or Gr-I⁺) cells in the peripheral blood were monitored by flow cytometry starting from 4 wks after transplant. CD45.2⁺ donor cells were not significantly detected until 8 wks after transfer (Fig. IE). About 0.5 ~ 10% more CD45.2⁺CD1 Ib⁺ and CD45.2⁺Gr-1⁺ cells were detected depending on individuals

(5 - 10 mice/expt) (Fig. IE). Unexpectedly, the pCSC-derived CD45.2⁺ cells dramatically decreased to less than 0.5% in the peripheral blood 2 wks later, and were not detected 5 wks later at all (Fig. IE). These results suggest that, like in vitro situation, the pCSCs have multipotent but incomplete differentiation in vivo, eventually leading to cell apoptosis. We define the process as differentiation-induced cell death (DICD), probably a protective mechanism for pCSCs from progressing to malignant cells.

[00165] 3. pCSCs have long-term repopulating activity

[00166] In addition to differentiation-induced cell death, the transient in vivo expansion of pCSC-derived hematopoietic cells in the recipients (Fig. IE) might be associated with the pCSC lacking long-term repopulating activity. To test the possibility, neomycinresistant (neo^r) gene was used as an indicator of long-term repopulating activity in competitive repopulating assay as described above, because the pCSCs were derived from a p53^"ΛStat-r^Λ mouse, which carried genome-integrated neo^r gene. The neo^r gene was detected in the blood or BM cells of recipients even 10 months after transplantation by HANDS-Nested DNA-PCR, a combined technique of HANDS (HomoTag Assisted No-Dimer System) PCR with Nested PCR, used to ensure the specificity and sensitivity of detection. The neo^r was detected in all of the recipients, though not in all the tissues examined (Fig. IF). [00167] The repopulating activity was transferable, because the neo^r was detected in various organs of secondary recipients that received BM cells from the primary recipients (Fig. IG). Interestingly, while the neo^r gene was undetectable in the BM cells of some primary recipients (Fig. IF), it was readily detected in the secondary recipients receiving these BM cells (Fig. IF). Thus, the lack of detectable neo^r in the BM of primary recipients does not show that the pCSCs are unable to repopulate the BM of these recipients, but rather reflects rare, quiescent pCSCs that repopulated the BM of primary recipients. These results suggest that, unlike in vitro, the pCSCs rarely divide in vivo, but retain self-renewal capacity, similarly to the leukemic stem cells. Taken together, pCSCs have the properties expected of a stem cell: self-renewal and multipotency, although incomplete.

[00168] 4. pCSCs can differentiate into various types of nonmalignant cells

[00169] The lethally irradiated mice receiving both pCSCs and BM cells survived tumorfree for up to 10 months, except for 10 ~ 20% of the mice, which died within 10 d after injection, probably due to an effect of the irradiation. In addition to the BM and blood, neo^r was also detected in the liver, kidney, intestine, heart or lung of both primary (Fig. 9) and secondary recipients (Fig. IF), implying that the pCSCs either distributed in various organs in a quiescent status or differentiated into tissue- specific cells in these organs or tissues.

[00170] To test these two possibilities, we stably transduced 2C4 cells with lentiviruses carrying enhanced green fluorescent protein (eGFP) gene to track the fate of pCSCs in recipients. Several clones stably expressing high level of eGFP, such as clone 2C4G2 (Fig. 1OA), were obtained. The 2C4G2 and parent 2C4 cells were intravenously transplanted, respectively, into lethally irradiated, BM-reconstituted CD45.1 congenic mice, which should provide stem cells with a vigorously regenerative environmental cue. The donor-derived eGFP⁺ cells, albeit lower in frequency, were readily detected in various organs, such as spleen, liver, kidney, intestines, or adipose tissues, of all the mice having received 2C4G2, but not 2C4 cells for 5 months (Fig. 2A and data not shown). Some eGFP⁺ cells exhibited the morphology of tissue origin, including endothelial cells, tubular epithelial cells, Kupffer's cells, histiocytes, macrophages/monocytes, and hepatoid cells (Fig. 2A). In the liver, eGFP⁺ Kupffer's cells and hepatoid cells were usually found in the regenerative areas (Fig. 2A). Interestingly, none of the observed eGFP⁺ cells exhibited significant dysplastic changes (Fig 2A). The results suggest that while the pCSCs were generally unable to completely differentiate into mature hematopoietic cells in vitro (Figs. 7 & 8); some of them may differentiate into tissue-specific cells in a regenerative environment. Interestingly, none of the recipients developed tumors under the conditions. [00171] To further confirm the importance of environmental cues for the differentiation of pCSCs, we investigated their fates during embryo development using a blastocyst complementary assay, in which abnormal genetic programs may be corrected. 2C4G2 cells or 2C4 cells were injected into 3.5 d old murine blastocysts (~ 8 cells per blastocyst). The chimeric progenies were normally delivered from foster mothers, and healthily grew to adulthood. As shown in Fig. 2B, eGFP⁺ red blood cells (RBCs) were detected in the peripheral blood of 88% (7/8) of the mice chimeric with 2C4G2, although their morphology was abnormal compared to the host RBCs and the eGFP expression pattern in the RBCs individually varied. The number of eGFP⁺ RBC was < 50 in each slide of blood smears. About 0.5% of the gated white blood cells (WBCs) expressed both eGFP and CD45, as revealed by flow cytometry (Fig. 2C). [00172] Consistently, eGFP signals were also detected in all 2C4G2 chimeric mice by IVIS™ imaging systems (Xenogen Inc.) (Figs. 2D & E). The results suggest that the pCSCs bypassed the checkpoint of differentiation-induced cell death, "normally" developed in the blastocysts, and at least were able to differentiate into RBCs and WBCs in the chimera mice despite of low frequency. Importantly, the chimeric mice did not develop tumors within 20 months of follow up. The results indicate that the embryonic (juvenile) environment can support "benign" development of pCSCs, probably through correcting an altered oncogenic genetic program. While not wishing to be bound by theory, the inventors herein propose that pCSCs have the potential to differentiate into various types of nonmalignant tissue cells in appropriate environments, although we can not absolutely exclude the possibility of cell fusion. [00173] 5. pCSCs develop into cancers in immunodeficient mice

[00174] While pCSCs were detected in the lethally irradiated, BM reconstituted mice (Figs. IE-G & 2A) and blastocyst chimeras (Figs. 2B-E); they developed into neither leukemia nor solid tumors despite the fact that they are genetically instable and immortalized (Fig. ID). This may be due to immune surveillance of the immune system, by which the pCSCs were eliminated when they were progressing to CSCs or cancer cells, or due to the route of inoculation, which provide an environment affecting the developmental fate of pCSCs.

[00175] To test the hypothesis, pCSCs were injected s.c, i.p. or i.v. into severe combined immune deficient (SCID) mice, BM reconstituted or naive B6 mice, which may provide different levels of immune surveillance (see discussion). The results demonstrated that both immune system and inoculation route had an impact on pCSC development in the recipients; they developed into either solid or leukemic tumors in immunodeficient mice (Fig. 13).

[00176] In Fig. 13, Table 1, the following footnotes include: 1. SCID mice were injected s.c. or i.p. with 5 x 10⁶ pCSCs; or i.v. with 5 x 10⁵ pCSCs. 2. Lethally irradiated, BM-reconstituted mice were injected s.c. or i.p. with 5 x 10⁶ pCSCs, or i.v. with 2 x 10⁶ pCSCs along with 5 x 10⁵ recipient-type of BM cells. 2C4 cells developed solid tumors in situ within 3 wks of i.p. or s.c. inoculation, whereas a sole 3B5C tumor in situ was eliminated after being palpable. 3. B6 mice were injected with 5 x 10⁶ pCSCs, and monitored more than 5 months. 4. None: Mice did not develop solid or leukemic tumors; solid: progressive tumors in situ. 5. The SCID mice injected s.c. or i.p. were observed until they developed tumors and sacrificed, and the mice injected i.v. were sacrificed 5 months or later after injection with no overt clinical symptoms. Leukemia was verified by microscopic examination of spleens. The number shown is total numbers of mice used for experiments. The percentage of tumor incidence was variable with experiments. 6. One mouse developed a 3 x 3 tumor, which was shrunk in a few days.

[00177] As shown in Fig. 3, the 2C4 cells, the 2C4G2 cells and the 3B5C cells, but not the 3B6C cells developed into solid tumors at the site of inoculation in about 40 ~ 80% of the SCID recipients, regardless of i.p. or s.c. (Fig. 3A). The latency of tumor development was variable with the experiments: for example, the tumors were palpable at dlO and d21 post inoculation for expt 1 and expt 2, respectively (Fig. 3B). However, the kinetics of tumor growth was similar between the tumors, once they were established, as most of the tumor growth curves rose so steeply that the mice were sacrificed within one wk after they were palpable (Fig. 3B). Some large tumors grossly showed sharply delineated tan-pink and gray region from gelatinous fleshy area (Fig. 3C), suggesting that the composition of the tumors was heterogeneous. Consistent with the gross appearance, microscopically the tumors were composed of Various types of cancer cells, such as lymphoid, sarcomatoid (spindle) and histiocytic cancer cells (Fig. 3D).

[00178] Although 3B6C cells did not develop into solid tumor in situ, they infiltrated in the spleens of about 80% mice, resembling chronic leukemic alterations (Fig. 3A). Large numbers of atypical neutrophils or eosinophils were observed in the spleen (Fig. 3E), suggesting that 3B6C cells were distinct from 2C4 and 3B5C clones with regard to the resultant tumor type, although the karyotype between them were identical (Fig. ID). The results indicate that pCSCs from a single clone were able to differentiate into various types of cancer cells.

[00179] In addition, metastatic cancers were detected in the spleens, liver, prostate, pancreas, or brain, but not lung (Fig. HA and data not shown). Some of them demonstrated spindle/oval cell morphology (Fig. HA). Interestingly, benign differentiation of pCSCs in the liver with metastatic cancer was also observed in the regenerative area of liver parenchyma, which was revealed by the scattered neomycin- positive hepatoid cells (Fig. HB), suggesting that the benign and malignant differentiation of pCSCs are delicately regulated by microenvironments. [00180] Interestingly, the pCSCs did not develop into tumor in solid organs of

SCID mice when they were inoculated i.v. even 5 months later (See Fig. 13). All the mice looked healthy, but chronic leukemic alterations were observed in the spleens of all the mice inoculated by 2C4, 3B5C or 3B6C clones (Fig. 12B). Fewer pCSC-like cells were detected in the peripheral blood (Fig. 12C). Moreover, all the organs examined including the liver, kidney, lung, intestine and pancreas were histologically normal (data not shown). In contrast, no leukemic alterations were observed in the spleens of the naive, or BM-reconstituted immunocompetent B6 mice, which were inoculated i.v. with 2C4, 3B5C or 3B6C cells (Fig. 12D; Fig. 13). [00181] Taken together, the results suggest several important points for the tumorigenesis of the pCSCs. First, the pCSCs require an appropriate environmental cue, such as tissue extracellular matrix to acquire tumorigenicity. This may explain why the pCSCs can develop into solid tumor only when inoculated s.c. or Lp., but not i.v. Second, the immune system may suppress pCSCs progressing to cancer cells because they did not develop into tumors when inoculated into immunocompetent mice. Finally, the pCSCs may represent an early developmental stage of CSCs, namely precancerous stage; they may undergo differentiation benignly or malignantly, or remain quiescent, depending on the environmental cues.

[00182] If the pCSCs were at an early developmental stage of CSCs; we should observe the phenotype changes when they progress to a cancer. To verify the hypothesis, we analyzed 2C4 and 2C4G2 cell-derived tumors. As shown in Fig. 4A, CD45⁺Lin⁺ and CD45^"Lin⁺ tumor cells were detected in both tumors. These cells were developed from the inoculated pCSCs, because both populations expressed eGFP in the 2C4G2-, but not 2C4-derived tumors. Interestingly, eGFP was somewhat down- regulated with the pCSCs differentiating into Lin⁺ cells (Fig. 4A). Further analysis of the tumor cells after 2 d of culture revealed that CD45+eGFP^{low or +} (pi, 2 & 3) and CD45^"eGFP^low populations (p4) abnormally expressed all the lineage markers (CD3ε, CDl Ib, B220, Ter-119 and Gr-I) with variable levels. Other lineage markers, such as NKl .1, were also expressed when CD45 was up-regulated (Fig. 4B: pi, 2 & 3). Importantly the up-regulation of CD45 and lineage markers was accompanied by expression of c-kit (CDl 17) (Fig. 4B: pi ~ 4) and Sca-1 (Fig. 4B: pi ~ 3). The expression of CDl 17 and Sca-1 may signify the malignancy of the Lin⁺ cells, because CDl 17, a transmembrane tyrosine kinase receptor encoded by proto-oncogene c-kit, and Sca-1, a glycosylphosphatiylinositol-linked cell surface protein , have been identified as the markers of cancer progression in various types of cancer. Based at least in part on the results (Figs. 4A & 4B), we propose a road map for the pCSCs progressing to cancer cells: CD45^"c-kif Sca-l^"Lin^" : CD45^"c-kit⁺Sca-l^"Lin⁺ : CD45⁺c-

Kit⁺Sca-1⁺Lin⁺.

[00183] 6. Ectopically expressed mili gene regulates pCSC expansion in vitro

[00184] Since the pCSCs exhibited the properties of stem cells as well as the potency of tumori genesis, we examined expression of embryonic and adult sternness- related genes in these cells, such as mili, a mouse homologous of piwil2, Bmi-1, Notch- l, Endoglin, ABCG-2 POUFl/Oct-4, Nαnog, TDGFl/Cripto, Zfp42/REX1, Fzd2, Fzd5, ά-cαtenin, Smo, c-Myc, FltSBcl-2 and stαtSsome of which are also associated with tumor development. BM-derived CD34⁺Lin^" and CD34^"Lin^" cells, which were enriched with hematopoietic stem cells (HSCs), were used for comparison. [00185] As shown in Fig. 5A, both embryonic and adult stem cell-related genes were detected in the pCSCs except for Nαnog and ABCG-2. Adult stem cell- and tumorigenesis-related genes, such as Bmi-1, Notch-1, Fzd2, Fzd5, FlU, Smo, ά- cαtenin, Stαt-3, αndBcl-2 were detected in both pCSCs and NSCs. Interestingly, embryonic stem cell-related genes including Poufl/Otc4, TDGFl, Zfp42/REX1 and Mili (piwil2), whose homologs have been shown to have a conserved function in stem cell division, were exclusively expressed in pCSCs. Among them, only was mili stably expressed in all the clones of pCSCs; in contrast, Miw, a member of mouse PIWI/AGO gene family with no stem cell function was not detectable in these pCSCs (Fig. 5A). [00186] The inventors now believe that mili may play an important role in pCSCs. Thus, the inventors further examined the role oimili for pCSC expansion in vitro. The inventors knocked down the mili gene in 2C4 cells using mili-specific siRNA, resulting in a significant decrease of 2C4 cell expansion (Figs. 5B & 5C). The results suggest that the mili may promote pCSC proliferation, consistent with the recent observations for the mili-overexpressing NIH3T3 cell line. [00187] Discussion

[00188] It is has been considered that a cancer can arise from a stem-like cell called CSC. However, little is known about the mechanisms for CSC development. Extensive investigations have revealed that human tumorigenesis is a complex, multistep process often requiring concordant expression of a number of genes, including multiple genetic and epigenetic alterations in oncogenes, tumor-suppressor genes, cell-cycle regulators, cell adhesion molecules and DNA repair genes, genetic instability as well as telomerase activation. Since stem cells are long lived cells, it is likely that they are the subject of accumulating mutations leading to their malignant transformation and tumor initiation.

[00189] Thus, the cells that hierarchically transit from normal stem cells (NSCs) or committed tissue cells to CSCs are defined herein as precancerous stem cells (pCSCs), which are now believed by the inventors herein to be an ideal target for cancer diagnosis, prevention and therapy. Here, we have experimentally defined several stem-like cell clones as pCSCs, because they have the potential for both benign and malignant differentiation, seemingly reflecting an early stage of CSC development (Fig. 6).

[00190] The pCSCs have the characteristics of a stem cell: self renewal and multipotency, albeit incomplete. The property of benign differentiation of the pCSCs distinguishes them from malignant stem cells (CSCs); whereas the property of malignant differentiation distinguishes them from normal stem cells (Fig. 6A). In other words, pCSCs are believed by the inventors herein to be an intermediate between normal and cancer stem cells if a cancer arises from a stem cell, or an intermediate between committed tissue cells and CSCs if a cancer arises from a committed tissue cell, which has acquired the properties of stem cells.

[00191] In fact, the existence of pCSCs has been implicated in human LSCs. In the human acute myelogenous leukemia (AML), the frequency of LSCs is extremely low and is approximately 0.1 -1 per million AML blasts. By tracking individual human LSCs in NOD/Scid mice serially transplanted with AML cells, LSCs were found not to be functionally homogeneous but, like the normal HSC compartment, comprise distinct hierarchically arranged LSC classes; and two important features for LSCs/CSCs were revealed: i) some LSCs are quiescent or divided rarely and undergo self-renewal rather than commitment after cell division; and, ii) normal developmental processes are not completely abolished during leukemogenesis. The incompletely abolished normal developmental processes is believed to reflect a precancerous stage of LSC/CSC development, although it is not clear whether these cells, like pCSCs defined herein, have the potential for benign differentiation. In non-hematopoietic tumors, pCSCs may be responsible for the reversible precancerous lesion such as metaplasia and dysplasia in tumor pathology. The potential of pCSCs for both benign and malignant differentiation is instrumental for the understanding of the complex process of cancer development.

[00192] While not wishing to be bound by theory, it is believed that the developmental fate of a pCSC is determined by the status of host immune system and the environmental cues (the site of cell colonization or route of inoculation). The pCSCs appear to be scrutinized by the mechanism of tumor immune surveillance, because the pCSC clones 2C4, 3B5C and 3B6C, which have an identical phenotype and identical karyotype, had different fates in three animal models with different levels of immune surveillance (Fig. 13). The pCSCs developed into neither solid tumors nor leukemia in IC mice when inoculated s.c, Lp., or i.v.; however, they developed into tumors (2C4 and 3B5C) or leukemia (3B6C) in the T and B cell-, but not NK cell- deficient SCID mice with a variation of latency of tumor initiation and tumor incidence in different experiments. Interestingly, while all the clones of pCSCs did not develop into chronic leukemia when they were inoculated i.v. into the lethally irradiated, BM- reconstituting mice that have a defective, but recovering immune system, they differentiated into non-malignant cells in the regenerative area of tissues. It would be possible that the pCSC-derived non-malignant cells could dedifferentiate into pCSCs or CSCs in tumorigenic environments, leading to tumorigenesis (Fig. 6B). [00193] In addition, the pCSCs retained the capability of self-renewal, as evidenced by their transferable long-term repopulating activity. The long-term repopulation of pCSCs or pCSC-derived cells in various organs of the BM- reconstituted mice suggests that the immune system may not directly eliminate the quiescent or benignly differentiating pCSCs, but rather recognizes the pCSCs developing to CSCs and eliminates them timely. As a consequence, the quiescent pCSCs can be maintained in a limited clonal size. Thus, the fate of pCSCs is associated with the levels of tumor immune surveillance in the host.

[00194] In addition to tumor immune surveillance, pCSCs may also be checked by differentiation-induced cell death (DICD). Transient detection of pCSC-derived hematopoietic cells, in the peripheral blood of the BM-reconstituted recipients, suggests that the differentiating cells are short-lived, and may spontaneously undergo apoptosis. This is supported by the fact that the pCSCs inevitably underwent apoptosis when their incompletely abolished hematopoietic differentiation programs are activated by lineage-specific cytokines such as G-CSF, GM-CSF, IL-7 and IL-15. Thus, DICD may be a protective mechanism from pCSCs progressing to CSCs. [00195] Since cancer can be caused by hierarchically genetic and epigenetic alterations, it has been difficult to define a common phenotype or genetic markers for CSCs with regard to their sternness and tissue origin. In the support of this notion, although the pCSC clones were derived from the spleen of a mouse with lymphoma, they expressed neither HSC marker c-kit and Sca-1 nor lineage markers CD45, Ter- 119, CD3, B200, Gr-I and CDl Ib. However, the c-kit and Sca-1 and lineage markers were identified when pCSCs developed into a tumor, suggesting that the markers of pCSCs or CSCs likely vary with their developmental stages.

[00196] Genetically, it has also been difficult to define a gene marker for CSCs, because the oncogenic genes expressed in CSCs are overlapped with those expressed in normal adult stem cells, such as such as Bmi-1.

[00197] The inventors herein have found that pCSCs exclusively expressed

ESC-related sternness genes, including PO UFl/Oct-4, TDGFl/Cripto, and Zfp42/REX1. It is possible that these genes confer pCSCs the multipotency of differentiation or the capability of benign differentiation. Although these genes were ambiguously expressed in pCSCs, they were undetectable in a CSC line established in our laboratory (Li et al., unpublished), suggesting that they may be subverted at the early stage of CSC development.

[00198] Moreover, mili, a member of PIWI/ AGO gene family, which is exclusively expressed in testis and essential for stem cell self-renewal, gametogenesis, and small RNA-mediated gene silencing, was stably expressed in pCSCs. The mili was also detected in various tumor cell lines with variable levels, probably related to the number of CSCs in each line. It is likely that ectopic expression of mili may contribute to the development of pCSCs and CSCs (Fig. 6B), because knocking-down of mili mRNA led to the contained pCSC proliferation in vitro. The results are consistent with the recent observations from the mili-overexpressing NIH3T3 cell line. However, mili was not required for the self-renewal of HSCs, because the number and repopulation activity of hematopoietic stem cells from the BM of ^///-disrupted mice was not affected. [00199] Overall, the inventors herein have now experimentally defined and characterized the pCSCs, which are useful for the understanding of mechanism underlying CSC development. The inventors provide the first evidence that a single clone of pCSCs has the potential for both benign and malignant differentiation, depending on environmental cues. A broad therapeutic approach to the cure of various types of cancers may be achievable through rational targeting of pCSCs. [00200] Experimental Data

[00201] 1. Mice, cell lines, and reagents

[00202] C57BL/C (B6) and SCID CB17 mice were used at age of 8 - 12 wk. We bred and maintained mice in the animal pathogen-free facility at The Ohio State University Medical Center. Cell lines 2C4, 3B5C and 3B6C were cloned from a mouse with dendritic cell-like leukemia as described in Gao, J. X., X. Liu, J. Wen, H. Zhang, J. Durbin, Y. Liu, and P. Zheng. 2003. Differentiation of Monocytic Cell Clones into Cd8alpha(+) Dendritic Cells (Dc) Suggests That Monocytes Can Be Direct Precursors for Both Cd8alpha(+) and Cd8alpha(-) Dc in the Mouse. J Immunol 170:5927-35. [00203] All mAbs and cytokines used in experiments were purchased from BD

PharMingen and PeproTech, respectively, except where indicated. [00204] 2. Cell culture

[00205] The cell lines were maintained in Rl OF (RPMI 1640 plus 10% fetal calf serum supplemented with 5 mM glutamine, 50 iM 2-mecaptoethonal, 100 U/ml penicillin, and 100 ig/ml streptomycin). In some experiments, the cells were cultured in the presence or absence of cytokines, including the supernatant of G-CSF secreting U87MG cell culture, recombinant GM-CSF, IL-7 and IL-15. The cytology was examined at various time points by Giemsa-staining of cytospin preparations, or directly monitored under a phase contrast microscope. [00206] 3. Purification of BM marrow stem cells

[00207] Lin^"CD34⁺ and Lin^"CD34^" BM cells were purified using MACS beads followed by FACS sorting. Briefly, BM cells were isolated and stained with a cocktail of biotinylated mAbs to lineage (Lin) markers CD3a, CDl Ib, B220, Gr-I, and Ter-119 followed by incubation with MACS beads coated with mAb to biotin (Miltenyi, Biotech Inc.). Lin^" cells were negatively selected as instructed by the manufacturer (Miltenyi Biotech Inc.), stained with mAb to FITC-conjugated CD34 and PerCP-Cy5- conjugated streptavidin, and sorted for Lin^"CD34⁺ and Lin^"CD34^" populations using

FACS Aria (BD Science). The purity of each population was > 98%.

[00208] 4. Generation of eGFP⁺ cell lines

[00209] To track the fate of pCSCs in vivo, 2C4 cells were transduced with pseudo-lentiviruses caring enhanced green fluorescent protein (eGFP) gene and blasticidin-resistant gene. The eGFP⁺ cells were cloned by limiting dilution and maintained in RlOF for more than 2 months . The fluorescent intensity for each clone that stably expressed eGFP was determined by flow cytometry. A clone, 2C4G2, which expressed appropriate intensity of eGFP was used for experiments, and parent 2C4 cells were used as a control.

[00210] 5. Hematopoietic CFU assay

[00211] Mouse clonogenic hematopoietic progenitor assays were performed to assess the capacity of multilineage differentiation by pCSCs. pCSCs were plated into

MethoCult GF M3434 (StemCell Technologies), and colonies (> 50 cells) were scored after 12 ~ 14 d incubation at 37⁰C and 5% CO2, as instructed by manufacturer.

[00212] 6. In vivo competitive repopulating assay

[00213] pCSCs or eGFP⁺ pCSCs (0.5 ~ 10 x 10⁵) were injected into the tail vein of lethally irradiated (900 rad) CD45.1 congenic B6 mice, along with or without 2 ~ 5 x

10⁵ host type BM cells. Donor-derived CD45.2 cells in the peripheral blood were assessed by flow cytometric analysis for lymphoid (CD3⁺) and myeloid (CDl Ib⁺ and

Gr-I⁺) cells every 2 wks starting from 4 wks up to 20 wks after transplant. Then the mice were maintained and sacrificed 5 or 10 months after transplant. Peripheral blood,

BM and various organs were harvested and examined for neo^r gene integrated in the genome of donor cells by HANDS-Nested DNA PCR.

[00214] 7. Secondary repopulation assay

[00215] The BM cells (1 x 10 ) isolated from primary recipient mice 10 months after transplant were injected i.v. into lethally irradiated CD45.1 congenic B6 mice.

The secondary recipients were sacrificed 5 moths after transplant. Donor-specific cells in the blood, BM and liver were determined by neo^r gene, using HANDS-Nested DNA

PCR.

[00216] 8. Tumorigenesis assay

[00217] SCID CB 17 mice were injected i.p., s.c, or i.v. with 5 x 10⁶ pCSCs. Tumor incidence and size were monitored starting from 1 wk after inoculation, once every other day. The mice were sacrificed when one of the mice in a group bearing tumor more than 15 ~ 20 mm in diameter. Tumors and various organs were harvested for histological analysis, immunochemical staining, and/or flow cytometric analysis. [00218] 9. Generation and characterization of blastocyst chimera mice

[00219] Four weeks old FVB/N female mice (Taconic Farm) were superovulated by subcutaneous injection of 5 IU of Pregnant Mare's Serum (PMSG, NHPP) followed 4648 h later with 5 IU of Human Chorionic Gonadotropin (hCG, Sigma). Females were subsequently mated with FVB/N stud male mice. Embryos were flushed from uterine horn of the female mice (3.5 dpc), which were sacrificed humanely. Blastocysts were collected and maintained in HEPES buffered CZB during microinjection. [00220] Microinjection was primarily the same as injecting embryonic stem cells into blastocysts. The Peizo-Micromanipulator was used to inject 2C4G2 or 2C4 pCSCs. The injection pipette was prepared to the inner diameter 10 - 15 μm with Narishige Microforge. Approximately 8 — 10 cells were injected into fully expanded 3.5 dpc blastocysts. The injected blastocysts were incubated in CZB culturing medium at 37⁰C, 5% CO2 incubator for 30 minutes, and then surgically transferred to the oviduct of 0.5 dpc pseudopregnant ICR mice. Adult progenies were characterized for eGFP⁺ red blood cells (RBC) in peripheral blood under fluorescent microscope, CD45⁺eGFP⁺ white blood cells (WBC) by flow cytometry, and eGFP signals (photon counts) in the living body by IVIS imaging system 100 Series (Xenogen Inc.). [00221] 10. RT-PCR

[00222] Total RNA was extracted from cell lines or de novo isolated HSCs.

The cDNA was generated by reverse transcription using Superscriptase II ( Invitrogen, CA) and oligo (dT) in a 20 μl reaction containing 1 μg of total RNA, which was pretreated with RNase-free DNase I (Invitrogen, CA) to eliminate contaminating genomic DNA. PCR was performed as described with necessary modifications. Briefly, an aliquot of 0.5 μl cDNA was used in each 20 μl PCR reaction, using PCR Master Mix (Promega, Ca). The following conditions were used: an initial denaturation at 95⁰C for 5 min followed by denaturation at 94⁰C for 30 seconds, annealing at 65⁰C for 1 min, touchdown -I⁰C per cycle, and extension at 72⁰C for 1 min for a total of 10 cycles. Then, the condition was fixed for 25 cycles of denaturation at 94⁰C for 30 seconds, annealing at 5O⁰C for 1 min, and extension at 72⁰C for 1 min with a final extension at 72⁰C for 10 min. PCR products were analyzed by 1.5% agarose gel. The sequence of the primers used is listed in Fig. 14.

[00223] 11. Genomic DNA isolation:

[00224] Genomic DNAs of all tissues except blood were isolated following overnight digestion with 500 il of DNA lysing buffer (10OmM NaCl, 1OmM Tris-HCl,

25mM EDTA, 1%SDS, and 50 ug/ml proteinase K) at 56 ⁰C. The supernatant (400-

450 il) was transferred to a new 1.5 ml tube after 10 min centrifugation at 13,200 RPM, and genomic DNA was extracted using silica-gel method. For blood samples red blood cells were removed with ACK lysing buffer (NH4C1 8.29 g/L, KHCO3 1.00 g/L,

EDTA 0.037 g/L, pH 7.4) before digestion with DNA lysing buffer.

[00225] 12. HANDS-Nested DNA PCR

[00226] HANDS-Nested DNA PCR is a combined technique of HANDS

(Homo-Tag Assisted Non-Dimer System) PCR with Nested PCR, and was used to reduce primer-dimer formation and amplify genes of low copy numbers. The genomic neo^r gene was first amplified using HANDS-PCR followed by Nested -PCR. The primary PCR was performed for 45 cycles followed by 25 cycles of secondary PCR with the primary PCR product as templates in a 1 :2500 dilution (final). All reactions are in a 20 il of volume. In the primary HANDS-PCR two hybrid primers and one Tag primer were used: 5'-

CGTACTAGCGTACCACGTGTCGACTATTCGGCTATGACTGGGCACAACA -

3'(Tl-Neo-forward) at 0.02μM, 5'- : [Seq. ID No. 1]

[00227] GCGTACTAGCGTACCACGTGTCGACTGTCAAGAAGGCGAT

AGAAGGCGAT-3'fTl- Neo-reverse) at 0.02μM, [Seq. ID No. 2]

[00228] and 5'-GCGTACTAGCGTACCACGTGTCGACT-STn) at

0.25μM. [Seq. ID No. 3]

[00229] The following touchdown thermal conditions were used : 95°C for 5 min, 5 cycles of 94°C for 30 s, 70°C for 1 min, touchdown -1 °C /cycle, and 72 °C for 1 min; 5 cycles of 94°C for 30 s, 68°C for 1 min, touchdown -1 ⁰C /cycle, and 72 °C for

1 min; 35 cycles of 94°C for 30 s, 6O⁰C for 1 min, and 72 ⁰C for 1 min; 72 ⁰C for 15 min at the final extension. The expected size of amplicon was 792bp. The primary

PCR products were diluted with lxTris buffer (pH 8.0) and used as templates (1 :1250, final ) in nested-PCR using the nested-primer 5'-

TGAATGAACTGCAGGACGAGGCA3' (forward, 0.25μM) [Seq. ID No. 4]

[00230] and 5'-GGGTAGCCAACGCTATGTCCTGATA-S' (reverse, 0.25μM)

[Seq. ID No. 5].

[00231] The PCR conditions were: 95°C for 5 min, 10 cycles of 94°C for 30 s,

65⁰C for 1 min, touchdown -1 ⁰C /cycle, 15 cycles of 94°C for 30 s, 50°C for 1 min, and 72 ⁰C for 1 min; 72 °C for 10 min at the final extension step. All the nested-PCR products were separated on a 1.5% agarose gel at the 5 v/cm for 60 min. The expected

PCR products were 507 bp.

[00232] House-keeping gene 18SrRNA (Fig. 14) was amplified using the primary PCR thermal conditions and 10 μl were loaded as an internal loading control.

PCR Master Mix (Promega, Cat No. M7502) was used in all the reactions.

[00233] 13. RNA interference

[00234] pCSCs cells were transfected with mili-specific small interference (si)

RNA (UCGUACCUACCGAAUCGAU) [Seq. ID No. 6], or

[00235] scramble siRNA (CACGUGAGGAUCACCAUCA) [Seq. ID No. 7]

[00236] using an siRNA transfection kit, as instructed by the manufacturer

(Qiagen). For the effect of mili siRNA on cell expansion, a low density of transfected cells (100/well) were seeded, and counted at indicated times. For RT-PCR analysis of mili gene expression, a high density of transfected cells (lxlO⁶/well) were seeded and harvested at 48 hrs of culture.

[00237] 14. Karyotype analysis

[00238] Exponentially growing cells were fixed using standard laboratory procedures. The cell suspension was dropped onto pre-cleaned, warm, wet, slides. The slides were aged at 90° C for 1 hour, banded with trypsin and stained with Wright stain.

Banded metaphases were analyzed using a Zeiss Axioskop 40. For each cell line 10 metaphases were karyotyped using an Applied Imaging Karyotyping System.

[00239] 15. Flow cytometry

[00240] Single cells prepared from blood and tumors were stained with corresponding mAbs, and then analyzed by flow cytometry.

[00241] 16. Histology

[00242] Tumors or tissue were fixed in formalin and embedded in paraffin for pathological and immunohistochemical analysis. Sections were stained by H. & E. for pathological analysis. To identify neomycin in tissues, the sections were immunostained with a polyclonal rabbit anti-neomycin (Upstate Cell Signaling Solutions, Lake Placid, NY) followed by horseradish peroxidase-conjugated goat anti- rabbit IgG. Sections were counterstained with haematoxylin. [00243] EXAMPLE II

[00244] Stem Cell Protein PiwiU Is Useful as a Biomarker for Early Diagnosis,

Prevention, Prognosis, and Therapy of Various Types of Cancer [00245] 1. Ectopic expression of Piwil2 gene in precancerous stem cells and mouse and human tumor cell lines

[00246] The inventors herein have established three clones of precancerous stem cells (pCSCs) from the spleens of mice with dendritic-cell like lymphoma, which have manifestly different phenotypical and tumorigenic properties from both normal stem cells (NSCs) and cancer stem cells (CSCs). Their unique phenotype has been demonstrated as CD45-c-kit(K)-Sca-l(S)Lin(L)-CD44^hlgh (CD45KSL-CD44^hl8h). [00247] These pCSC cells also demonstrate incompletely abolished multipotency, long term repopulating activity, differentiation into various nonmalignant cells types in the regenerative areas of immunocompetent (IC) mice, and development into cancers in severe combined immunodeficient (SCID) mice. [00248] The pCSCs are believed by the inventors herein to be a unique precancerous stage of cancer stem cell development because of their ability for both malignant and benign differentiation contingent on environmental cues (Fig. 6A). [00249] Examination of genes known with embryonic and adult stem cell development as well as oncogenesis revealed exclusive expression of the mili or piwil2 gene, a member of the "Piwi gene family" expressed mainly in the germline stem cells of testes, in pCSCs but not in normal CD34+Lin- and CD34-Lin- bone marrow cells (Fig. 15A).

[00250] This is the first class of genes known to be required for stem-cell self- renewal and plays a critical role in diverse organisms in RNA interference (RNAi) probably through binding Piwi-interacting RNAs (piRNAs), gametogenesis, and stem- cell division. The overexpressed Piwil2 in testicular seminomas appeared to be associated with increased expression of the signal transducer and activator of transcription 3 (Stat3) and upregulation of the antiapoptotic gene BcI-XL, and both important factors for tumorigenesis. The knockdown of the mili gene using mili- specific siRNA resulted in markedly inhibited pCSC expansion in vitro (Figs. 15A &

15B).

[00251] Interestingly, the mRNAs of mili, and its human homolog, hili, were also detected in all murine tumor cell lines and most of the human cancer cell lines examined, respectively (Fig. 16).

[00252] The inventors now believe that the mili may exclusively play a role for

NSC transformation and tumorigenesis, distinct from Bmi-1, which is required for the maintenance of both Stem cells and CSCs.

[00253] 2. Piwil2 expression in various types of cancer

[00254] Although piwil2 can be detected in pCSCs and a variety of tumor cell lines, it was possible that the piwil2 expression resulted from the long-term in vitro culture. To exclude the possibility, the inventors investigated whether piwil2 was expressed in various types of cancer at various developmental stages. The samples from the patients with cervix (n=3), breast (n=169) and thyroid cancer (n=5) were examined by immunohistochemical staining with anti-piwil2 antibody. The piwil2 was detected in all the samples examined.

[00255] Figures 17A-17I show the representative area of cervix, breast, and thyroid cancer at various developmental stages. Strong nuclei and cytoplasmic staining were observed in cervical squamous cell carcinoma in situ (Fig. 17A & 17B), invasive breast ductal carcinoma (Fig. 17D & 17E), and metastatic papillary thyroid carcinoma

(Fig. 17G & 17H), in contrasting to the normal expression of piwil2 in the germline stem cells of testis, in which piwil2 was detected as granules in the nuclei (data not shown).

[00256] In cervical squamous cell carcinoma in situ, piwil2 expression was differentially expressed in low and high grade dysplastic cells, respectively (Fig. 17A).

[00257] The high grade dysplastic cells expressed high level of piwil2 comparable to invasive and metastatic cancer cells in the invasive ductal carcinoma and metastatic papillary thyroid carcinoma (Figs. 17B, 17E & 17H); whereas the low grade dysplastic cells expressed moderate level of piwil2 (Fig. 17A). In addition, piwil2 was also detected in some tumor stromal cells (Figs. 17A, 17D & 17G; and Fig. 21D). [00258] The results suggest that piwil2 gene expression in pCSCs and tumor cell lines is unlikely caused by long-term in vitro culture, rather reflecting a common feature of cancer development regardless of its tissue origin. Thus, piwil2 is now believed by the inventors herein to be useful as a common specific marker of various types of cancer

[00259] 3. Piwil2 expression in the metaplastic cells

[00260] Metaplasia is defined as the transformation of one type of mature differentiated cell type into another mature differentiated cell type, as an adaptive response to some insult or injury, including carcinogens. In tumorigenesis, it is usually a reversible stage earlier than dysplasia. If the piwil2 was required for cancer initiation, it was possible that piwil2 gene was activated in metaplastic cells. To verify the hypothesis, the inventors examined whether piwil2 was expressed in metaplastic cells. [00261] As shown in Figs. 18A-F, in a cervical sample from a patient with high- grade squamous intraepithelial neoplasia (cervical intraepithelial neoplasia, CIN-3), squamous metaplastic changes close to the neoplastic lesion were observed (Fig. 18A). Piwil2 was moderately expressed in the metaplastic squamous epithelia (Fig. 18B & 18D), even in the early premature proliferative parabasal squamous cells (Fig. 18B & 18C), although not all the cells in these areas expressed piwil2 (indicated by arrows in Fig. 18C & 18D). The results suggest that piwil2 can be activated in the very early, probably initial stage of tumorigenesis.

[00262] 4. Piwil2 expression in "normal" tissues adjacent to cancer

[00263] Based on the findings described above, we now believe that piwil2 may be activated in the initial stage of tumorigenesis. In colorectal, gastric, and breast cancers, aberrant DNA methylation has been detected in normal tissues adjacent to cancer, suggesting that the occult precancerous alterations at molecular level exist in histologically normal tissues surrounding cancer region.

[00264] The inventors herein now believe that piwil2 can be useful to serve as an initiation marker of cancer development.

[00265] The inventors herein investigated the piwil2 expression in "normal" tissues adjacent to breast, cervical cancers, and thyroid cancers. As shown in Figs. 19A-19I, piwil2 was readily detected in the "normal" tissue surrounding the cancers of breast, cervical or thyroid gland (Figs. 19A, 19D & 19G). [00266] Some of the piwil2-expressing cells were hyperplastic (Figs. 19B, 19C2

& 19E); and some of them appeared to be completely "normal" in tissue structure (Fig. 19H). The inventors herein now believe that piwil2 gene activation occurs before the formation of morphologically identifiable precancerous lesion, and may be useful as a marker of tumor initiation.

[00267] This is supported by the piwi's specific, rather than ubiquitous, expression in the normal tissue adjacent to cancers (as evidenced by a substantial number of cells in the normal tissues did not express piwil2) (Figs. 19C-3, 19F & 191). [00268] Importantly, the piwil2-expressing cells were exposed to the environments same as the piwil2 -negative cells, suggesting the piwil2-expressing cells were at a very early, yet to be defined stage of tumor initiation. It is now believed by the inventors herein that the piwil2-expressing cells have undergone genetic and/or epigenetic alterations but yet to be sufficient to lead to precancerous stages such as dysplasia. While not wishing to be held to theory, it is believe that the piwil2 is thus useful to screen cancer-risk population earlier than precancerous stage. [00269] 5. Advantage of piwil2 over other biomarker for early cancer diagnosis

[00270] Although there is no reliable marker available for early cancer diagnosis, some of the markers have been used for cancer diagnosis such as pi 6 for cervical cancer. The pi 6, a CDKN2A gene product, is a cyclin-dependent kinase (CDK) inhibitor that decelerates the cell cycle by inactivating the CDKs that phosphorylate retinoblastoma (Rb) protein. The pi 6 expression is associated with human papillomavirus (HPV) infection in cervix, which has been considered as an important cause of cervical cancer . Human HPV E7 protein can functionally inactivate Rb protein, and pi 6 overexpression has been demonstrated in cervical carcinoma and premalignant lesions . Since piwil2 was found expressed in the cells of hyperplasia (Figs. 19a-19I), metaplasia (Figs. 18A-18F), dysplasia (Figs. 17A-17I), and various stages of cancer (Figs. 17A-17I) as well as the cells in normal tissues adjacent to caner (Figs. 18A-18F), the inventors further investigated the association of piwil2 expression with pi 6 in cervical cancers.

[00271] As a result, piwil2 was not necessarily proportionally correlated with pi 6 expression in cervical cancer. For examples, in the metaplastic tissue close to cancer, piwil2, but not pi 6, was detected (Figs. 18B & E). Moreover, while pi 6 was focally detected in the normal tissue adjacent to cancer, piwil2 was widely expressed the same area (Fig. 20).

[00272] In primary cancer, high level pi 6 could be detected, but was not detectable in the adjacent normal area, in contrasting to piwil2, which was detected in the same area (Fig. 21).

[00273] The pi 6 expression implicated the expressing cells were infected by

HPV, undergoing proliferation. The Ki67, a molecule that can be easily detected in proliferating cells within a tumor, was proportionally detected in the area with pi 6 expressing cells (Fig. 20 and Fig. 21). However, piwil2 expression was neither proportionally correlated with Ki67 expression (Fig. 20 and Fig. 21). Collectively, it is believed that piwil2-expressing cells represented both proliferating and non- proliferating cells, probably with increasing accumulation of genetic and/or epigenetic alterations. In addition to cancer cells and adjacent normal epithelial cells, piwil2 was also detected in stromal cells, distinct from pi 6 and Ki67 (Figs. 21D & 21E). Taken together, piwil2 may be a sensitive and specific marker for early cancer diagnosis. [00274] Discussion of Examples I and II

[00275] The piwil2, identified herein as a marker of cancer, is expressed in the cells of hyperplasia, metaplasia, dysplasia, and various stages of cancer as well as the cells in normal tissues adjacent to cancer.

[00276] Thus, piwil2 as a biomarker provides high sensitivity and specificity for early diagnosis of cancer.

[00277] In addition, piwil2 is useful as a biomarker for cancer prognosis since the level of piwil2 is variable with regard to primary, invasive and metastatic cancer. [00278] Also, since piwil2 is exclusively expressed in various stages, as well as various types of cancer, piwil2 is useful as a target for anti-cancer drug as well as for prevention and therapy of cancer through an immunological approach. [00279] EXAMPLE III

[00280] Piwil2 regulates the expression of stem cell gene and oncogenes

[00281 ] Cervical (HeLa) or breast (MDA-MB-468) cancer cell lines were transfected with piwil2 siRNA for 48 hours, and embryonic and adult stem cell-related genes were examined by RT-PCR. The fold of changes for embryonic stem cell related genes (ESC-related genes) and for adult tissue cell related genes (ASC-related genes) is shown in Fig. 22.

[00282] The piwil2 siRNA efficiently knocked down piwil2 mRNAs including full length and isoform piwil2. As a result, knocking down of piwil2 mRNA led to significant reduced expression of embryonic stem (ES) cell-related genes including

REX-I, TEGF-I, SOX2 and Oct-4, and adult tissue stem (ASC) cell-related genes including Bmi-1, Smo, Stat3, ABCG2. In contrast, c-Myc, Notch-1, and endolin were up-regulated. Bcl2, Fzd5, Fzd2 and β-catenin genes were slightly affected. The results show that piwil2 can regulate large number stem cell-related genes as well as oncogenes.

[00283] EXAMPLE IV

[00284] While the cancer stem cells (CSCs) have been identified in the solid and leukemic tumors, their biological behaviors relevant to their precursors, namely precancerous stem cells (pCSCs), have not been investigated. As shown in the

Examples herein, the inventors have experimentally defined the precancerous stem cells (pCSCs), which have the potential for both benign and malignant differentiation.

In particular, the pCSCs have the capacity of tumorigenesis in the severe combined immunodeficient (SCID) mice, but not in the immunocompetent (IC) mice.

[00285] In this Example, the inventors show that they have established a CSC line (326T), which was derived from a murine thymoma, exhibiting the phenotype of

CD45+c-kit-Sca-l-Lin- (CD45+KSL-).

[00286] In contrast to pCSCs (CD45-KSL-), the CSCs have the capacity of tumorigenesis in both SCID and IC mice and express little germline stem cell gene piwil2 and /?zw/72-regulated embryonic stem cell genes Oct-4, TDGF-I and Rex-1, which were expressed in pCSCs in a high level.

[00287] The 326T cells developed into acute leukemia in SCID mice, whereas they developed into chronic myelogenous leukemia in IC mice. Interestingly, the quantity of the genetic mutation of CSCs seems not to be correlated with their capacity of tumorigenesis because the 326T cells exhibited a karyotype of t(2;8)(Fl;El), a single chromosome translocation, strikingly contrasting to the multiple chromosome translocations in pCSCs. The inventors herein now believe results suggest that the magnitude of malignancy of genetic altered stem or progenitor cells is determined by the level of piwil2 and piwil2-regulated embryonic stem cell genes rather than their quantity of mutations.

[00288] XLCM™ selectively supported cancer stem cell growth from bulk cell cultures. A total of 10 lethally irradiated CD45.1 congenic B6 mice that were injected i.v. with IxIO⁶ precancerous stem cells (pCSCs) 2C4 or 2C4G2 together with 0.5 x 10⁶ recipient-type bone marrow (BM) cells which were observed for six months. Two of them developed thymoma and intestinal tumors, respectively, three hours after irradiation (900 Rad). Six months later only 10 mice still survived and were sacrificed. Among them mouse 6, male and injected with 2C4 cells, and mouse 3, male and injected with 2C4G2, were found to develop an intestinal tumor and a thymoma. [00289] Single cells from the BM of all the mice and from both thymomas and spleen were seeded at 1 x 10⁶ cells in 24-well plates in triplicate in 2ml RlOF (RPMI plus 10% FCS) or H5X (serum-free HBCM™ plus 5% XLCM™). [00290] One month after culture the wells seeded with cells from BM and thymoma of mouse 6 showed a cobble-stone like cell clone. Both clones showed blast morphology with differentiated granuocytes. (See Fig. 32B). [00291] However, only the clone from thymoma cell of -mouse 6 cultured in

H5X media could be passaged, which is designated as 326T. Other clones gradually died within 8 weeks.

[00292] The 326T cells were maintained in H5X for three months before attempting to subclone in RlOF by limiting dilution at the concentrations of 0.5, 1, 10 cells well in 96-well plate, but all the efforts failed. Then, the cells were passaged in both RlOF and H5X. Compared to cells cultured in H5X media, cells maintained in RlOF looked healthier but grew slowly. The cells were successfully subcloned in cell/well in 96-well plates after culturing them in RlOF for 4 more months. Five weeks later 10 clones grew out from four 96-well plates. These clones have a phenotype similar to parent cells (326T) (see Fig. 24), and were originated from recipients (CD45.1+, neomycin-).

[00293] As shown in Fig. 23A, mouse # 6 was diagnosed as leukemia infiltrated in thymus, lung, liver, kidney, spleen, lymph nodes (not shown), but not brain and intestines. As shown in Fig. 23B the cytology of the cells grew out from BM and thymoma cell cultures with H5X. [00294] Fig. 24 provides a comparison of the phenotypes between CSCs and pCSCs, as follows:

[00295] CSC(326T): CD45⁺c-Kit^"/lowSca-r^/lowLin^'/lowCD44⁺CD24⁺ (CS45⁺KLS^"

^/|OWCD44CD24⁺); and

[00296] pCSC (2C4): CD45-c-KifSca-rLm ^/lowCD44^hl8hCD24χCS45-KLS-

CD44^hlghCD24-).

[00297] The 326T cells developed into acute leukemia in the immunodeficient

(SCID) mice or chronic leukemia in the immunocompetent (IC) mice. Either CSCs

(326T) or pCSCs (2C4) were injected (500 cells/mouse) i.v., i.p., or s.c. into SCID mice, and tumor growth and survival rate were monitored. No tumors were palpable during observation.

[00298] Fig. 25A shows the percent of survival as compared to the days after inoculation for 326t (iv), 326T (sc),326T (ip), 2C4 (iv), 2C4 (sc), and 2C4 (ip). The data shown are from 2 experiments (n=8/group).

[00299] CSCs or pCSCs were injected iv into B6 congenic mice (5 x

106/mouse), and donor-specific cells were analyzed by flow cytometry. The data shown in Fig. 25B are obtained from peripheral blood of the mice that were injected with 326T cells 4 wks later. No donor specific cells were detected by flow cytometry in the mice that were injected with 2C4 cells (data not shown).

[00300] The effect of environment on the tumorigenesis of CSCs. 326T cells (5 x

106/mouse) were injected i.v ., i.p., or s.c. into SCID mice (n = 10), and tumor growth and size were monitored. None of the mice injected iv with 326T cells developed solid tumors instead of acute leukemia, as shown by the data in Figs. 26A & 26B. The mice injected i.p. with 326T cells developed both palpable solid tumor and leukemia (2 mice with ascites), and all the mice injected s.c. develop solid tumors. Fig. 26A shows the tumor growth kinetics; and Fig. 26B show the survival curves.

[00301] Fig. 27 shows the karyotype analysis of CSCs and pCSCs, for 326T and

2C4. It is to be noted that the genetic alterations of CSCs are not necessarily more rigorous than that of the pCSCs.

[00302] Fig. 28 shows a comparison of the molecular signatures between CSCs and pCSCs. The expressions of the pCSC-associated proteins piwil2, embryonic stem cell-related proteins Oct4, TDGFl, REXl and Nanog, adult stem cell related genes Bmi-1, Notch- 1, ABCG-2, Endoglin, and SMO, and oncogenes and growth related genes Fzd2, Fzd5, b-catenin, Flt3, Stat3, BcI -2, and c-Myc were compared between pCSCs (2C4, 3B5C and 3B6C), CSC (326T), BM stem cells (CD34Xin and

CD34⁺Lin^"). It is to be noted that 326T expressed little or a low level of piwil2, depending on experiments, while pCSCs expressed a stable level of piwil2.

[00303] As disclosed herein, the inventors have developed new methods to establish cancer stem cell lines, which may not be obtained through regular culture approaches. This method can be used to establish human CSC lines.

[00304] Also, the 326T CSC line is useful for investigating CSC development at molecular levels.

[00305] EXAMPLE V

[00306] Fig. 29 and Fig. 30 show the cDNA and protein sequence of piwil2-80 and piwil2-l 10, respectively.

[00307] Piwil2-80 is a truncated protein of full length of piwil2, which has been cloned by our laboratory. The levels of piwil2-80 expression in cancer cell lines are associated with their capacity of tumorigenesis, and is believed by the inventors herein to be useful as a biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions.

[00308] Fig 29 shows the protein sequence of piwil2-80, and Fig. 30 shows the

DNA sequence of piwil2-l 10 and piwil2-80.

[00309] The cDNA sequence has been deposited in NBCI gene bank by Ota et al., which is defined as "Homo sapiens cDNA FLJ14591 fis, clone NT2RM4002034, weakly similar to Homo sapiens hiwi mRNA (AK027497)".

[00310] The inventors herein confirm that this sequence is similar to that of piwil2-60, which can be detected in malignant tumor cell lines. The piwil2-60 is the product of piwil2-l 10 truncated at N-terminal. The ectopic expression of piwil2-60 appeared to be associated with the survival of pCSCs.

[00311] Fig. 31 shows the protein sequence of piwil2-60 and Fig. 32 shows the

DNA sequence of piwil-60.

[00312] The expression of piwil2 isoforms in cancer and primary cell lines was determined. Although piwil2 can not be detected normal organs( except for testis), piwil2-l 10 can be detected in long-term cultured primary cell lines, such as human dermal fibroblasts (HDF), human lung fibroblasts (HLF), and breast epithelial cells

(HTl 25), in addition to cancer cell lines. (See Fig. 33)

[00313] In contrast, piwil2-80 and piwil2-60 can be detected in various cancer cell lines such as cervical cancer cells (HeLa), and breast cancer cells (468, 231 and

HT126). The levels of piwil2-80 and/or piwil2-60 are associated with tumorigenic capacity of the cancer cell lines in SCID mice.

[00314] EXAMPLE VI

[00315] Precancerous stem cells can induce piwil2-specific anti-tumor immunity.

[00316] To test whether immunization of mice with precancerous stem cells

(pCSCs) can induce anti-tumor immunity, the inventors herein developed a model for the testing (see Fig. 34).

[00317] C57BL/6 (n=6 group) mice were injected i.v. with 5x 10⁶ pCSCs

(2C4G2, 3B5C or 3B6C cells).

[00318] None of the mice developed tumor within 8 months of injection. Then, the mice injected with 3B5C and 3B6C cells were challenged subcutaneously with 2 x

10⁶ unrelated tumor cells (EL-4). Tumor incidence and tumor size were monitored every other day (see Fig. 35).

[00319] The mice injected with 2C4G2 were sacrificed and splenocytes were harvested. Single splenocytes were prepared and adoptively transferred i.p. into SCID mice (10 x 10⁶/mouse; n = 3). Control groups received none or equal number of normal splenocytes. At the same time the mice were simultaneously challenged s.c. with 2C4G2 cells (5 x 10⁶/mouse). The mice were sacrificed 5 wk after adoptive transfer, and T cell proliferation assay was performed in the presence or absence of various concentration of free piwil2 peptide (see Fig. 36).

[00320] The results show that the C57BL/6 mice that received pCSCs (3B5C or

3B6C) rejected challenging tumor by 40% a 60%, compared to the mice that were not vaccinated with pCSCs (Fig. 35A). Importantly, the tumors that grew in the mice vaccinated with pCSCs were significantly smaller compared to control group (Fig.

35B). The inventors herein believe that vaccination with pCSCs can efficiently induce anti-tumor immunity in the hosts.

[00321] The anti -tumor immunity can be transferred into SCID mice (Fig. 36A).

The mice that received the splenocytes from the pCSC-vaccinated, but not from unimmunized mice have the ability to reject or suppress challenging tumor (Fig. 36A).

In the mice that completely rejected pCSCs have higher activity of spontaneous T cell proliferation than control groups; the enhanced proliferation can be blocked by free piwil2 peptide in a dose-dependent manner (0.1 - 100 pM). The inhibitory activity of the free peptide appeared to be reversed by increased concentration (1000 pM). The inventors herein now believe that pCSC-induced anti-tumor immunity may be mediated by piwil2 (Fig. 36B).

[00322] EXAMPLE VII

[00323] Conventional cervical Papanicolaou smears were prepared and stained with rabbit anti-piwil2 followed by HRP-conjugated secondary antibody. The data show that piwil2 (hili) was specifically expressed in the various types of precancerous lesions, such as AGCNOS (atypical glandular cells, not otherwise specified), LSIL

(low-grade squamous intraepithelial lesion), and HSIL (high-grade squamous intraepithelial lesion). In contrast, pi 6 was not be detected. The result suggests that piwil2 is more useful than pi 6 as a biomarker of cervical neoplasm. See Fig. 37 which shows piwil2 expression in cervical precancerous lesions. (Original magnification of the micrographs: x600).

[00324] EXAMPLE VIII

[00325] A synthetic peptide which induces a piwil2 antibody can be used to immunize animals (mice), generate B cell hybridoma, and screen isoform specific antibodies. In particular, the clones piwil2-l 10, piwil2-80 and piwil2-60, which otherwise can be used as immunogens or antigens for screening, are useful.

[00326] Generation of piwil2 isoform specific monoclonal antibody: The piwil2 peptides used to generate polyclonal antibodies to piwil2 isoform can be used to immunize mice. The splenocytes from immunized mice can be fused with myeloma cells to generate B cell hybridoma.

[00327] The supernatants from hybridoma cultures can be screening for piwil2 isoform specific antibodies using recombinant piwil2-l 10, piwil2-80, and piwil2-60 proteins, respectively. The isoform specific antibodies can then be used to develop diagnostic tools and kits for cancer screening and therapy.

[00328] In another aspect, with respect to anti-tumor immunity, piwil2 and its regulated protein such as embryonic stem cell proteins are useful as tumor vaccines. [00329] EXAMPLE IX

[00330] Described herein are many uses for the inventions disclosed herein.

[00331 ] Among the uses for the present invention is a method for screening patients for high risk of developing cancer, comprising detecting pCSCs in peripheral blood, secreting fluids and other non-invasive specimens from the patient.

[00332] In another aspect, piwil2 and its isoforms are useful as biomarkers for precancerous lesions, including, but not limited to AGC-NOS (atypical glandular cells, not otherwise specified), LSIL (low-grade squamous intraepithelial lesion), and HSIL

(high-grade squamous intraepithelial lesion).

[00333] In certain embodiments, Piwil2 and its isoforms are useful as a biomarker for cervical neoplasms.

[00334] EXAMPLE X

[00335] In another aspect, there is provided herein synthetic peptides which induce a piwil2 antibody useful to immunize animals.

[00336] In another aspect, there is provided herein synthetic peptides which induce a piwil2 antibody useful to generate B cell hybridoma.

[00337] In another aspect, there is provided herein synthetic peptides which induce a piwil2 antibody useful to screen isoform specific antibodies.

[00338] In certain embodiments, the synthetic can be one or more of piwil2-l 10, piwil2-80 and piwil2-60.

[00339] In another aspect, there is provided herein one or more of clones piwil2-

1 10, piwil2-80 and piwil2-60 that are useful as immunogens or antigens for screening samples.

[00340] In another aspect, there is provided herein a method for generating a piwil2 isoform specific monoclonal antibody, comprising using a piwil2 peptide to generate polyclonal antibodies to piwil2 isoform.

[00341] In another aspect, there is provided herein a diagnostic kit comprising one or more antibodies of any of the preceding claims.

[00342] In another aspect, there is provided herein a Piwil2 and its regulated proteins, including embryonic stem cell proteins, useful as tumor vaccines.

[00343] In another aspect, there is provided herein a purified antibody that binds specifically to piwil2-l 10. [00344] In another aspect, there is provided herein a purified antibody that binds specifically to piwil2-80.

[00345] In another aspect, there is provided herein a purified antibody that binds specifically to piwil2-60.

[00346] In another aspect, there is provided herein a purified antibody that binds specifically to an epitope in the receptor-binding domain of piwil2-l 10. In certain embodiments, the epitope is within the sequence shown in Fig. 30.

[00347] In another aspect, there is provided herein a purified antibody that comprising the sequence shown in Fig. 30 for piwil2-l 10.

[00348] In another aspect, there is provided herein a purified antibody that binds specifically to an epitope in the receptor-binding domain of piwil2-80. . In certain embodiments, the epitope is within the sequence shown in Fig. 30.

[00349] In another aspect, there is provided herein a purified antibody that comprising the sequence shown in Fig. 30 for piwil2-80.

[00350] In another aspect, there is provided herein a purified antibody that binds specifically to an epitope in the receptor-binding domain of piwil2-60. . In certain embodiments, the epitope is within the sequence shown in Fig. 32.

[00351 ] In another aspect, there is provided herein a purified antibody that comprising the sequence shown in Fig. 32 for piwil2-60.

[00352] EXAMPLE XI

[00353] In another aspect there is provided herein a peptide that is useful to induce antibody to three isoforms. The peptide has the sequence:

[00354] NH₂-ipekmkkdframkdl-CONH₂

[00355] This peptide is also useful for the development of tumor vaccines.

[00356] While the invention has been described with reference to various and preferred embodiments, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the essential scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed herein contemplated for carrying out this invention, but that the invention will include all embodiments falling within the scope of the claims.

[00357] All scientific and patent publications referenced herein are hereby incorporated by reference. The invention having now been described by way of written description and example, those of skill in the art will recognize that the invention can be practiced in a variety of embodiments, that the foregoing description and example is for purposes of illustration and not limitation of the following claims

[00358] References

[00359] The references discussed above and the following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

[00360] Aravin, A., D. Gaidatzis, S. Pfeffer, M. Lagos-Quintana, P. Landgraf, N.

Iovino, P. Morris, M. J. Brownstein, S. Kuramochi-Miyagawa, T. Nakano, M. Chien, J.

J. Russo, J. Ju, R. Sheridan, C. Sander, M. Zavolan, and T. Tuschl. 2006. A Novel

Class of Small RNAs Bind to MiIi Protein in Mouse Testes. Nature 442:203-7.

[00361] Al-Hajj, M., and M. F. Clarke. 2004. Self-Renewal and Solid Tumor

Stem Cells. Oncogene 23:7274-82.

[00362] Baldassarre, G., A. Romano, F. Armenante, M. Rambaldi, I. Paoletti, C.

Sandomenico, S. Pepe, S. Staibano, G. Salvatore, G. De Rosa, M. G. Persico, and G.

Viglietto. 1997. Expression of Teratocarcinoma-Derived Growth Factor-1 (Tdgf-1) in

Testis Germ Cell Tumors and Its Effects on Growth and Differentiation of Embryonal

Carcinoma Cell Line Ntera2/Dl . Oncogene 15:927-36.

[00363] Benitah, S. A., M. Frye, M. Glogauer, and F. M. Watt. 2005. Stem Cell

Depletion through Epidermal Deletion of Racl. Science 309:933-5.

[00364] Bissell, M. J., V. M. Weaver, S. A. Lelievre, F. Wang, O. W. Petersen, and K. L. Schmeichel. 1999. Tissue Structure, Nuclear Organization, and Gene

Expression in Normal and Malignant Breast. Cancer Res 59:1757-63s; discussion 63s-

64s.

[00365] Boom, R., C. J. Sol, M. M. Salimans, C. L. Jansen, P. M. Wertheim-Van

Dillen, and J. Van Der Noordaa. 1990. Rapid and Simple Method for Purification of

Nucleic Acids. J Clin Microbiol 28:495-503.

[00366] Bonnet, D., and J. E. Dick. 1997. Human Acute Myeloid Leukemia Is

Organized as a Hierarchy That Originates from a Primitive Hematopoietic Cell. Nat Med 3:730-7.

[00367] Brownie, J., S. Shawcross, J. Theaker, D. Whitcombe, R. Feme, C.

Newton, and S. Little. 1997. The Elimination of Primer-Dimer Accumulation in PCR. Nucleic Acids Res 25:3235-41.

[00368] Bums, C. E., D. Traver, E. Mayhall, J. L. Shepard, and L. I. Zon. 2005.

Hematopoietic Stem Cell Fate Is Established by the Notch-Runx Pathway. Genes Dev 19:2331-42.

[00369] Carmell, M. A., Z. Xuan, M. Q. Zhang, and G. J. Hannon. 2002. The

Argonaute Family: Tentacles That Reach into Rnai, Developmental Control, Stem Cell Maintenance, and Tumorigenesis. Genes Dev 16:2733-42.

[00370] Casserly, I. P., and E. J. Topol. 2002. Glycoprotein Iib/Iiia Antagonists-- from Bench to Practice. CeI MoI Life Sci 59:478-500.

[00371] Chambers, I., D. Colby, M. Robertson, J. Nichols, S. Lee, S. Tweedie, and A. Smith. 2003. Functional Expression Cloning of Nanog, a Pluripotency Sustaining Factor in Embryonic Stem Cells. Cell 113:643-55. [00372] Chiarle, R., W. J. Simmons, H. Cai, G. Dhall, A. Zamo, R. Raz, J. G.

Karras, D. E. Levy, and G. Inghirami. 2005. Stat3 Is Required for Alk-Mediated Lymphomagenesis and Provides a Possible Therapeutic Target. Nat Med 11 :623-9. [00373] Chen, E. H., and E. N. Olson. 2005. Unveiling the Mechanisms of Cell-

Cell Fusion. Science 308:369-73.

[00374] Chen, C. Z., M. Li, D. De Graaf, S. Monti, B. Gottgens, M. J. Sanchez,

E. S. Lander, T. R. Golub, A. R. Green, and H. F. Lodish. 2002. Identification of Endoglin as a Functional Marker That Defines Long-Term Repopulating Hematopoietic Stem Cells. Proc Natl Acad Sci U S A 99:15468-73. [00375] Constantinescu, S. 2003. Sternness, Fusion and Renewal of

Hematopoietic and Embryonic Stem Cells. J Cell MoI Med 7:103-12. [00376] Cotter, F. E. 2004. Unraveling Biologic Therapy for Bcl-2-Expressing

Malignancies. Semin Oncol 31 :18-21 ; discussion 33.

[00377] Cox, D. N., A. Chao, and H. Lin. 2000. Piwi Encodes a Nucleoplasm^

Factor Whose Activity Modulates the Number and Division Rate of Germline Stem Cells. Development 127:503-14. [00378] Cox, D. N., A. Chao, J. Baker, L. Chang, D. Qiao, and H. Lin. 1998. A Novel Class of Evolutionarily Conserved Genes Defined by Piwi Are Essential for

Stem Cell Self-Renewal. Genes Dev 12:3715-27.

[00379] Darnell, J. E. 2005. Validating Stat3 in Cancer Therapy. Nat Med

11:595-6.

[00380] Demetri, G. D. 2001. Targeting C-Kit Mutations in Solid Tumors:

Scientific Rationale and Novel Therapeutic Options. Semin Oncol 28:19-26.

[00381] Deng, W., and H. Lin. 2002. Miwi, a Murine Homolog of Piwi, Encodes a Cytoplasmic Protein Essential for Spermatogenesis. Dev Cell 2:819-30.

[00382] Drexler, H. G., and H. Quentmeier. 2004. Flt3: Receptor and Ligand.

Growth Factors 22:71-3.

[00383] Dontu, G., M. Al-Hajj, W. M. Abdallah, M. F. Clarke, and M. S. Wicha.

2003. Stem Cells in Normal Breast Development and Breast Cancer. Cell Prolif 36

Suppl 1:59-72.

[00384] Dunn, G. P., L. J. Old, and R. D. Schreiber. 2004. The Three Es of

Cancer Immunoediting. Annu Rev Immunol 22:329-60.

[00385] Dunn, G. P., L. J. Old, and R. D. Schreiber. 2004. The Immunobiology of Cancer Immunosurveillance and Immunoediting. Immunity 21:137-48.

[00386] Durbin, J. E., R. Hackenmiller, M. C. Simon, and D. E. Levy. 1996.

Targeted Disruption of the Mouse Statl Gene Results in Compromised Innate

Immunity to Viral Disease. Cell 84:443-50.

[00387] Durr, M., F. Harder, A. Merkel, G. Bug, R. Henschler, and A. M.

Muller. 2003. Chimaerism and Erythroid Marker Expression after Microinjection of

Human Acute Myeloid Leukaemia Cells into Murine Blastocysts. Oncogene 22:9185-

91.

[00388] Gao, J. X., H. Zhang, X. F. Bai, J. Wen, X. Zheng, J. Liu, P. Zheng, and

Y. Liu. 2002. Perinatal Blockade of B7-1 and B7-2 Inhibits Clonal Deletion of Highly

Pathogenic Autoreactive T Cells. J Exp Med 195:959-71.

[00389] Gao, J. X., X. Liu, J. Wen, H. Zhang, J. Durbin, Y. Liu, and P. Zheng.

2003. Differentiation of Monocytic Cell Clones into Cd8alpha(+) Dendritic Cells (Dc)

Suggests That Monocytes Can Be Direct Precursors for Both Cd8alpha(+) and

Cdδalpha(-) Dc in the Mouse. J Immunol 170:5927-35.

[00390] Gao, J. X., J. Madrenas, W. Zeng, M. J. Cameron, Z. Zhang, J. J. Wang, R. Zhong, and D. Grant. 1999. Cd40-Deficient Dendritic Cells Producing Interleukin- 10, but Not Interleukin-12, Induce T-CeIl Hyporesponsiveness in Vitro and Prevent Acute Allograft Rejection. Immunology 98:159-70.

[00391] Geiger, H., S. Sick, C. Bonifer, and A. M. Muller. 1998. Globin Gene

Expression Is Reprogrammed in Chimeras Generated by Injecting Adult Hematopoietic Stem Cells into Mouse Blastocysts. Cell 93:1055-65.

[00392] Hanahan, D., and R. A. Weinberg. 2000. The Hallmarks of Cancer. CeI

100:5770.

[00393] Hecker, K. H., and K. H. Roux. 1996. High and Low Annealing

Temperatures Increase Both Specificity and Yield in Touchdown and Stepdown Per. Biotechniques 20:478-85.

[00394] Hogge, D. E., P. M. Lansdorp, D. Reid, B. Gerhard, and C. J. Eaves.

1996. Enhanced Detection, Maintenance, and Differentiation of Primitive Human Hematopoietic Cells in Cultures Containing Murine Fibroblasts Engineered to Produce Human Steel Factor, Interleukin-3, and Granulocyte Colony-Stimulating Factor. Blood 88:3765-73.

[00395] Hope, K. J., L. Jin, and J. E. Dick. 2004. Acute Myeloid Leukemia

Originates from a Hierarchy of Leukemic Stem Cell Classes That Differ in Self- Renewal Capacity. Nat Immunol 5:738-43.

[00396] Houghton, J., C. Stoicov, S. Nomura, A. B. Rogers, J. Carlson, H. Li, X.

Cai, J. G. Fox, J. R. Goldenring, and T. C. Wang. 2004. Gastric Cancer Originating from Bone Marrow-Derived Cells. Science 306:1568-71. [00397] Ishikawa, T., Y. Tamai, A. M. Zorn, H. Yoshida, M. F. Seldin, S.

Nishikawa, and M. M. Taketo. 2001. Mouse Wnt Receptor Gene Fzd5 Is Essential for Yolk Sac and Placental Angiogenesis. Development 128:25-33. [00398] Iwama, A., H. Oguro, M. Negishi, Y. Kato, Y. Morita, H. Tsukui, H.

Ema, T. Kamijo, Y. Katoh-Fukui, H. Koseki, M. Van Lohuizen, and H. Nakauchi. 2004. Enhanced Self-Renewal of Hematopoietic Stem Cells Mediated by the Polycomb Gene Product BmM. Immunity 21:843-51.

[00399] Jacks, T., L. Remington, B. O. Williams, E. M. Schmitt, S. Halachmi, R.

T. Bronson, and R. A. Weinberg. 1994. Tumor Spectrum Analysis in P53-Mutant Mice. Curr Biol 4:1-7. [00400] Jamieson, C. H., L. E. Ailles, S. J. Dylla, M. Muijtjens, C. Jones, J. L.

Zehnder, J. Gotlib, K. Li, M. G. Manz, A. Keating, C. L. Sawyers, and I. L. Weissman.

2004. Granulocyte-Macrophage Progenitors as Candidate Leukemic Stem Cells in

Blast-Crisis CmI. N Engl J Med 351 :657-67.

[00401] Kawase, Y., T. Iwata, M. Watanabe, N. Kamada, O. Ueda, and H.

Suziki. 2001. Application of the Piezo-Micromanipulator for Injection of Embryonic

Stem Cells into Mouse Blastocysts. Contem. Top. Lab. Anim. Sci. 40:31-4.

[00402] Kuramochi-Miyagawa, S., T. Kimura, T. W. Ijiri, T. Isobe, N. Asada, Y.

Fujita, M. Ikawa, N. Iwai, M. Okabe, W. Deng, H. Lin, Y. Matsuda, and T. Nakano.

2004. MiIi, a Mammalian Member of Piwi Family Gene, Is Essential for

Spermatogenesis. Development 131 :839-49.

[00403] Kuramochi-Miyagawa, S., T. Kimura, K. Yomogida, A. Kuroiwa, Y.

Tadokoro, Y. Fujita, M. Sato, Y. Matsuda, and T. Nakano. 2001. Two Mouse Piwi-

Related Genes: Miwi and MiIi. Mech Dev 108:121-33.

[00404] Lapidot, T., C. Sirard, J. Vormoor, B. Murdoch, T. Hoang, J. Caceres-

Cortes, M. Minden, B. Paterson, M. A. Caligiuri, and J. E. Dick. 1994. A Cell Initiating

Human Acute Myeloid Leukaemia after Transplantation into Scid Mice. Nature

367:645-8.

[00405] Lau, N. C, A. G. Seto, J. Kim, S. Kuramochi-Miyagawa, T. Nakano, D.

P. Bartel, and R. E. Kingston. 2006. Characterization of the Pirna Complex from Rat

Testes. Science 313:363-7.

[00406] Lee, J. H., D. Schutte, G. WuIf, L. Fuzesi, H. J. Radzun, S. Schweyer,

W. Engel, and K. Nayernia. 2006. Stem-Cell Protein Piwil2 Is Widely Expressed in

Tumors and Inhibits Apoptosis through Activation of Stat3/Bcl-Xl Pathway. Hum MoI

Genet 15:201-11.

[00407] Lelievre, S. A., V. M. Weaver, J. A. Nickerson, C. A. Larabell, A.

Bhaumik, O. W. Petersen, and M. J. Bissell. 1998. Tissue Phenotype Depends on

Reciprocal Interactions between the Extracellular Matrix and the Structural

Organization of the Nucleus. Proc Natl Acad Sci U S A 95:14711-6.

[00408] Lessard, J., and G. Sauvageau. 2003. Bmi-1 Determines the Proliferative

Capacity of Normal and Leukaemic Stem Cells. Nature 423:255-60.

[00409] Lewis, C. M., L. R. Cler, D. W. Bu, S. Zochbauer-Muller, S. Milchgrub, E. Z. Naftalis, A. M. Leitch, J. D. Minna, and D. M. Euhus. 2005. Promoter

Hypermethylation in Benign Breast Epithelium in Relation to Predicted Breast Cancer

Risk. Clin Cancer Res 11 : 166-72.

[00410] Maekita, T., K. Nakazawa, M. Mihara, T. Nakajima, K. Yanaoka, M.

Iguchi, K. Arii, A. Kaneda, T. Tsukamoto, M. Tatematsu, G. Tamura, D. Saito, T.

Sugimura, M. Ichinose, and T. Ushijima. 2006. High Levels of Aberrant DNA

Methylation in Helicobacter Pylori-Infected Gastric Mucosae and Its Possible

Association with Gastric Cancer Risk. Clin Cancer Res 12:989-95.

[0041 1] Massung, R. F., K. Slater, J. H. Owens, W. L. Nicholson, T. N. Mather,

V. B. Solberg, and J. G. Olson. 1998. Nested PCR Assay for Detection of Granulocytic

Ehrlichiae. J Clin Microbiol 36:1090-5.

[00412] Matz, M., D. Shagin, E. Bogdanova, O. Britanova, S. Lukyanov, L.

Diatchenko, and A. Chenchik. 1999. Amplification of Cdna Ends Based on Template

Switching Effect and Step-out PCR. Nucleic Acids Res 27:1558-60.

[00413] Mazurier, F., O. I. Gan, J. L. Mckenzie, M. Doedens, and J. E. Dick.

2004. Lentivector-Mediated Clonal Tracking Reveals Intrinsic Heterogeneity in the

Human Hematopoietic Stem Cell Compartment and Culture-Induced Stem Cell

Impairment. Blood 103:545-52.

[00414] Molofsky, A. V., R. Pardal, T. Iwashita, I. K. Park, M. F. Clarke, and S.

J. Morrison. 2003. Bmi-1 Dependence Distinguishes Neural Stem Cell Self Renewal from Progenitor Proliferation. Nature 425:962-7.

[00415] Myakishev, M. V., G. I. Kapanadze, G. O. Shaikhayev, S. Aumalahova,

G. P. Georgiev, and D. R. Beritashvili. 1995. Use of Perchlorate Precipitation to

Improve Plasmid Isolation. Institute of Gene Biology, Moscow.

[00416] Nagy, A., M. Gertsenstein, K. Vintersten, and B. Behringer. 2003.

Manipulating the Mouse Embryo - a Laboratory Manual. Cold Spring Harbor

Laboratory Press, New York.

[00417] Neviani, P., R. Santhanam, R. Trotta, M. Notari, B. W. Blaser, S. Liu, H.

Mao, J. S. Chang, A. Galietta, A. Uttam, D. C. Roy, M. Valtieri, R. Bruner-Klisovic,

M. A. Caligiuri, C. D. Bloomfield, G. Marcucci, and D. Perrotti. 2005. The Tumor

Suppressor Pp2a Is Functionally Inactivated in Blast Crisis CmI through the Inhibitory

Activity of the Bcr/Abl-Regulated Set Protein. Cancer Cell 8:355-68. [00418] Palmqvist, L., C. H. Glover, L. Hsu, M. Lu, B. Bossen, J. M. Piret, R. K.

Humphries, and C. D. Helgason. 2005. Correlation of Murine Embryonic Stem Cell Gene Expression Profiles with Functional Measures of Pluripotency. Stem Cells 23:663-80.

[00419] Pardal, R., M. F. Clarke, and S. J. Morrison. 2003. Applying the

Principles of Stem-Cell Biology to Cancer. Nat Rev Cancer 3:895-902. [00420] Park, J. S., S. M. Dong, H. S. Kim, J. Y. Lee, S. J. Um, I. S. Park, S. J.

Kim, and S. E. Namkoong. 1999. Detection of P16 Gene Alteration in Cervical Cancer Using Tissue Microdissection and Loh Study. Cancer Lett 136:101-8. [00421] Park, I. K., D. Qian, M. Kiel, M. W. Becker, M. Pihalja, I. L. Weissman,

S. J. Morrison, and M. F. Clarke. 2003. Bmi-1 Is Required for Maintenance of Adult Self-Renewing Haematopoietic Stem Cells. Nature 423:302-5. [00422] Park, I. K., S. J. Morrison, and M. F. Clarke. 2004. Bmil, Stem Cells, and Senescence Regulation. J Clin Invest 113:175-9.

[00423] Patrawala, L., T. Calhoun, R. Schneider-Broussard, J. Zhou, K.

Claypool, and D. G. Tang. 2005. Side Population Is Enriched in Tumorigenic, Stem- Like Cancer Cells, Whereas Abcg2+ and Abcg2- Cancer Cells Are Similarly Tumorigenic. Cancer Res 65:6207-19.

[00424] Perrotti, D., V. Cesi, R. Trotta, C. Guerzoni, G. Santilli, K. Campbell, A.

Iervolino, F. Condorelli, C. Gambacorti-Passerini, M. A. Caligiuri, and B. Calabretta. 2002. Bcr- AbI Suppresses C/Ebpalpha Expression through Inhibitory Action of Hnrnp E2. Nat Genet 30:48-58.

[00425] Petrovic, S., M. Cross, and A. M. Muller. 2004. Differentiation Potential of Fdcpmix Cells Following Injection into Blastocysts. Cells Tissues Organs 178:7886. [00426] Polyak, K., and W. C. Hahn. 2006. Roots and Stems: Stem Cells in

Cancer. Nat Med 12:296-300.

[00427] Potti, A., A. K. Ganti, S. A. Tuchman, K. Sholes, E. Langness, V. Koka, and M. Koch. 2005. Her-2/Neu and CdI 17 (C-Kit) Overexpression in Patients with Pesticide Exposure and Extensive Stage Small Cell Lung Carcinoma (Essclc). J Carcinog 4:8.

[00428] Raaphorst, F. M. 2003. Self-Renewal of Hematopoietic and Leukemic

Stem Cells: A Central Role for the Polycomb-Group Gene Bmi-1. Trends Immunol 24:522-4.

[00429] Raaphorst, F. M., C. J. Meijer, E. Fieret, T. Blokzijl, E. Mommers, H.

Buerger, J. Packeisen, R. A. Sewalt, A. P. Otte, and P. J. Van Diest. 2003. Poorly Differentiated Breast Carcinoma Is Associated with Increased Expression of the Human Polycomb Group Ezh2 Gene. Neoplasia 5:481-8.

[00430] Reya, T., S. J. Morrison, M. F. Clarke, and I. L. Weissman. 2001. Stem

Cells, Cancer, and Cancer Stem Cells. Nature 414:105-11.

[00431] Reya, T., A. W. Duncan, L. Ailles, J. Domen, D. C. Scherer, K. Willert,

L. Hintz, R. Nusse, and I. L. Weissman. 2003. A Role for Wnt Signalling in Self- Renewal of Haematopoietic Stem Cells. Nature 423:409-14. [00432] Sakurada, K., M. Ohshima-Sakurada, T. D. Palmer, and F. H. Gage.

1999. Nurrl, an Orphan Nuclear Receptor, Is a Transcriptional Activator of Endogenous Tyrosine Hydroxylase in Neural Progenitor Cells Derived from the Adult Brain. Development 126:4017-26.

[00433] Sano, T., T. Oyama, K. Kashiwabara, T. Fukuda, and T. Nakajima.

1998. Expression Status of P16 Protein Is Associated with Human Papillomavirus Oncogenic Potential in Cervical and Genital Lesions. Am J Pathol 153:1741-8. [00434] Sasaki, T., A. Shiohama, S. Minoshima, and N. Shimizu. 2003.

Identification of Eight Members of the Argonaute Family in the Human Genome Small Star, Filled. Genomics 82:323-30.

[00435] Singh, S. K., C. Hawkins, I. D. Clarke, J. A. Squire, J. Bayani, T. Hide,

R. M. Henkelman, M. D. Cusimano, and P. B. Dirks. 2004. Identification of Human Brain Tumour Initiating Cells. Nature 432:396-401.

[00436] Spangrude, G. J., S. Heimfeld, and I. L. Weissman. 1988. Purification and Characterization of Mouse Hematopoietic Stem Cells. Science 241 :58-62. [00437] Stier, S., T. Cheng, D. Dombkowski, N. Carlesso, and D. T. Scadden.

2002. Notch 1 Activation Increases Hematopoietic Stem Cell Self-Renewal in Vivo and Favors Lymphoid over Myeloid Lineage Outcome. Blood 99:2369-7. [00438] Tahara, E. 2004. Genetic Pathways of Two Types of Gastric Cancer.

IARC Sci Publ:327-49.

[00439] Tagoh, H., A. Schebesta, P. Lefevre, N. Wilson, D. Hume, M.

Busslinger, and C. Bonifer. 2004. Epigenetic Silencing of the C-Fms Locus During B- Lymphopoiesis Occurs in Discrete Steps and Is Reversible. Embo J 23:4275-85.

[00440] Vogelstein, B., and K. W. Kinzler. 2004. Cancer Genes and the

Pathways They Control. Nat Med 10:789-99.

[00441] Wang, J. C, and J. E. Dick. 2005. Cancer Stem Cells: Lessons from

Leukemia. Trends CeI Biol 15:494-501.

[00442] Wang, H. Y. 2004. Wnt-Frizzled Signaling Via Cyclic Gmp. Front

Biosci 9:1043-7.

[00443] Wang, T., G. Niu, M. Kortylewski, L. Burdelya, K. Shain, S. Zhang, R.

Bhattacharya, D. Gabrilovich, R. Heller, D. Coppola, W. Dalton, R. Jove, D. Pardoll, and H. Yu. 2004. Regulation of the Innate and Adaptive Immune Responses by Stat-3

Signaling in Tumor Cells. Nat Med 10:48-54.

[00444] Warner, J. K., J. C. Wang, K. J. Hope, L. Jin, and J. E. Dick. 2004.

Concepts of Human Leukemic Development. Oncogene 23:7164-77.

[00445] Willert, K., J. D. Brown, E. Danenberg, A. W. Duncan, I. L. Weissman,

T. Reya, J. R. Yates, 3rd, and R. Nusse. 2003. Wnt Proteins Are Lipid-Modified and

Can Act as Stem Cell Growth Factors. Nature 423:448-52.

[00446] WeIm, B. E., S. B. Tepera, T. Venezia, T. A. Graubert, J. M. Rosen, and

M. A. Goodell. 2002. Sca-l(Pos) Cells in the Mouse Mammary Gland Represent an

Enriched Progenitor Cell Population. Dev Biol 245:42-56.

[00447] Xin, L., D. A. Lawson, and O. N. Witte. 2005. The Sca-1 Cell Surface

Marker Enriches for a Prostate-Regenerating Cell Subpopulation That Can Initiate

Prostate Tumorigenesis. Proc Natl Acad Sci U S A 102:6942-7.

[00448] Yarden, Y., W. J. Kuang, T. Yang-Feng, L. Coussens, S. Munemitsu, T.

J. Dull, E. Chen, J. Schlessinger, U. Francke, and A. Ullrich. 1987. Human Proto-

Oncogene C-Kit: A New Cell Surface Receptor Tyrosine Kinase for an Unidentified

Ligand. Embo J 6:3341-51.

[00449] Yilmaz, O. H., R. Valdez, B. K. Theisen, W. Guo, D. O. Ferguson, H.

Wu, and S. J. Morrison. 2006. Pten Dependence Distinguishes Haematopoietic Stem

Cells from Leukaemia-Initiating Cells. Nature.

[00450] Yu, H., and R. Jove. 2004. The Stats of Cancer-New Molecular Targets

Come of Age. Nat Rev Cancer 4:97-105.

Claims

CLAIMS What is claimed is:

1. A biomarker for detecting precancerous stem cells (pCSCs) in a sample wherein the biomarker comprises piwil2.

2. A method for detecting precancerous stem cells (pCSCs) in a sample, the method comprising detecting a piwil2 in the sample.

3. The method of claim 2, including detecting the expression of piwil2 in cells of hyperplasia, metaplasia, dysplasia, and various stages of cancer as well as the cells in normal tissues adjacent to cancer.

4. The method of any of the preceding claims, wherein measurement of the piwil2 gene activation occurs before the formation of morphologically identifiable precancerous lesion, whereby pipwl2 is useful as a biomarker of tumor initiation.

5. The method of any of the preceding claims , wherein piwil2 is identified by its specific, rather than ubiquitous, expression in the normal tissue adjacent to cancers.

6. The method of any of the preceding claims, wherein the piwil2 is thus useful to screen cancer-risk population earlier than at a precancerous stage.

7. A method of detecting precancerous stem cells (pCSC), the method comprising: a) providing a tissue sample from a subject; and b) detecting at least one biomarker comprising piwil2 in the tissue sample under conditions such that the presence or absence of precancerous cells in the tissue sample is determined.

8. The method of any of the preceding claims, wherein the subject comprises a human subject.

9. The method of any of the preceding claims, wherein the tissue sample comprises tumor tissue.

10. The method of claim 7s, further comprising the step of c) providing a prognosis to the subject.

11. A method for killing or inhibiting the proliferation of precancerous stem cells (pCSC) comprising contacting the pCSC with a biologically effective amount of a composition comprising at least one agent targeted to at least one cancer biomarker comprising piwil2.

12. The method of claim 11 , further comprising identifying the death of or the prevention of the growth of the precancerous cells following the contacting.

13. A method of distinguishing tumorigenic from non-tumorigenic cancer cells, comprising detecting the presence of piwil2 in a precancerous cell.

14. The method of any of the preceding claims, wherein piwil2 is detected in premalignant lesions as well as in histologically "normal" areas surrounding premalignant or malignant lesions.

15. A composition comprising the biomarker of claim 1.

16. A screening test for a pre-cancerous condition comprising contacting one or more of the biomarkers an in any of the preceding claims with a test agent, and determining whether the test agent modulates the activity of the biomarker.

17. A method of identifying a potential for the initiation or development of at least one cancer-related disease in a subject, the method providing measuring one or more of the biomarkers as in any of the preceding claims.

18. A cell line selected from the group consisting of 2C4, 2C4G2, 3B5C and 3B6C which are deposited as Budapest Treaty patent deposit at ATCC on DATE##,200x, under Accession Numbers xxxxx, xxxxx, xxxxx, and xxxxx, respectively, which cell lines are characterized as expressing neither hematopoietic and lineage (Lin) markers nor hematopoietic stem cell (HSC) markers (CD45^"c-kit^"Sca-l^' Lin^'), and having the potential for both benign and malignant differentiation.

19. The cell line of claim 18, wherein the cells have the properties of both normal stem cells and CSCs

20. Use of any one of the cell lines of any of the preceding claims in the formulation of a treatment of a precancerous condition.

21. An expression library derived from at least one cell line of any of the preceding claims which can be used in screening experiments to discover cancer- associated or specific antigens for use as immunotherapeutics and diagnostics.

22. Use of one or both of the cells of any of the preceding claims in specific proliferation experiments utilizing whole blood to determine the precursor frequency of cells that recognize antigens derived from the cell lines.

23. Use of the cell lines of any of the preceding claims in genomic screens for drug target identification and identification of antigens which may be used in diagnostic assays to screen for early phase detection of pre-cancerous conditions.

24. A precancerous stem cell (pCSC) useful as a target for anti-cancer drug development, cancer prevention, and cancer therapy.

25. The pCSC of claim 24, wherein the pCSC is one or more of: 2C4, 2C4G2, 3B5C or 3B6C.

26. A clone of the pCSC of claim 24 useful determining both benign and malignant differentiation of cells.

27. A diagnostic tool for evaluating one or more of the developmental stages of initiation, premalignancy (hyperplasia, metaplasia, and dysplasia), carcinoma in situ, invasion, and metastasis comprising a pCSC on any of the preceding claims.

28. The pCSCs of any of the preceding claims, wherein the pCSCs of 2C4, 3B5C and 3B6C: do not express hematopoietic pan-marker CD45 and lineage markers CD3ε, CD4, CD8, B220, Ter-119, CD l I b and Gr-I; have the phenotype: CD34^', CD38^low, c-Kit^", Sca-1^", CD90^", Ly6C^" and CD44^hlgh; and, are distinct from normal hematopoietic stem/progenitor cells

29. The pCSCs of any of the preceding claims wherein cytological analysis demonstrates that all the pCSCs exhibit stem-like cell morphology with large numbers of cytoplasmic vacuoles or granules, somewhat distinct from normal BM-derived CD34⁺Lin^" and CD34^"Lin^" blast cells.

30. The pCSCs of any of the preceding claims wherein the pCSCs exhibit a stem-like cell phenotype: CD45^"c-kit^"Sca-l^'Lin^"CD44^high (CD45KSLCD44^high).

31. The pCSCs of any of the preceding claims, wherein the pCSCs retain incomplete multipotency of differentiation toward various hematopoietic lineages.

32. The pCSCs of any of the preceding claims, wherein the pCSCs have one or more properties expected of a stem cell, including one or more of self-renewal and multipotency.

33. The pCSCs of any of the preceding claims, wherein the pCSCs have the property of benign differentiation which distinguishes the pCSCs from malignant stem cells (CSCs); and further have the property of malignant differentiation which distinguishes them from normal stem cells.

34. In pCSCs of claim 33, wherein at least one of the pCSCs has the potential for both benign and malignant differentiation, depending on environmental cues.

35. A therapeutic approach to the cure of various types of cancers achievable through rational targeting of pCSCs.

36. A clone of a precancerous stem cell (pCSC) from a spleen of a mouse with dendritic-cell like lymphoma, the clone having manifestly different phenotypical and tumorigenic properties from both normal stem cells (NSCs) and cancer stem cells (CSCs).

37. A clone of claim 36, having a phenotype demonstrated as CD45-C- kit(K)-Sca- 1 (S)Lin(L)-CD44^high (CD45KSL-CD44^hish).

38. Use of Piwil2 to regulate expression of stem cell gene.

39. Use of piwil2 to regulate expression of oncogenes.

40. Use of a piwil2 siRNA to alter expression of piwil2 mRNAs, including full length piwil2 and isoform piwil2.

41. A method for reducing expression of one or more embryonic stem cell- related genes in a cell comprising transfecting the cell with a piwil2 siRN A.

42. The method of claim 41 ,wherein the embryonic stem cell-related genes include one or more of: REX-I, TEGF-I, SOX2 and Oct-4.

43. A method for reducing expression of one or more adult stem cell-related genes in a cell comprising transfecting the cell with a piwil2 siRNA.

44. The method of claim 43, wherein the adult stem cell-related genes include one or more of: Bmi-1, Smo, Stat3 and ABCG2.

45. A method for increasing expression of one or more of one or more adult stem cell-related genes in a cell comprising transfecting the cell with a piwil2 siRNA.

46. The method of claim 45, wherein the adult stem cell-related genes include one or more of: c-Myc, Notch- 1, and endolin.

47. A method for altering expression of one or more adult stem cell-related genes in a cell (including Bcl2, Fzd5, Fzd2 and β-catenin), comprising transfecting the cell with piwil2 siRNA.

48. A cancer stem cell (CSC) line (326T), derived from a murine thymoma, and exhibiting the phenotype of CD45+c-kit-Sca-l-Lin- (CD45+KSL-).

49. A CSC cell line having the capacity of tumorigenesis in both SCID and IC mice.

50. A CSC cell line wherein the CSC cell line expresses little of the germline stem cell gene piwil2 and piwil2 -regulated embryonic stem cell genes Oct-4, TDGF-I and Rex- 1.

51. A CSC 326T cell line capable of developing into acute leukemia in SCID mice and developing into chronic myelogenous leukemia in IC mice.

52. A 326T cell line exhibiting karyotype of t(2;8)(Fl ;E1), a single chromosome translocation.

53. A method for determining a magnitude of malignancy of genetic altered stem or progenitor cells, comprising determining a level of piwil2 and piwil2 -regulated embryonic stem cell genes in a cell.

54. A CSC cell line having a phenotype as follows: CD45⁺c-Kif ^ΛowSca-l ^" /iow_Lin-/iow_CD44+CD24+ (CS45+KLS-/IOW CD44CD24⁺).

55. A pCSC cell line having a phenotype as follows: CD45^"c-Kit^"Sca-l^'Lin^{" /l0W}CD44^highCD24^"(CS45^'KLS^"CD44^highCD24-).

56. A method for establishing cancer stem cell lines, comprising: selectively supporting cancer stem cell growth from bulk cell cultures; injecting lethally irradiated CD45.1 congenic B6 mice precancerous stem cells

(pCSCs) 2C4 or 2C4G2 together with recipient-type bone marrow (BM) cells until one or more tumors are developed; seeding single cells from the BM of all the mice and from any tumor and mouse in 2ml RlOF (RPMI plus 10% FCS) or H5X (serum-free HBCM™ plus 5% XLCM™) and culturing to develop one or more clones that show blast morphology with differentiated granuocytes; and culturing the clone in H5X media such that the clone could be passaged.

57. The method of claim 56, useful to establish human CSC lines.

58. An isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a Piwil2-110, comprising a protein sequence substantially as shown in Fig. 29.

59. An isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a Piwil2-110, comprising a DNA sequence substantially as shown in Fig. 30.

60. A biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the piwill2-l 10 protein sequence of Fig. 29.

61. A biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the piwill2-l 10 DNA sequence of Fig. 30.

62. An isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a Piwil2-80, comprising a protein sequence substantially as shown in Fig. 29.

63. An isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a Piwil2-80, comprising a DNA sequence substantially as shown in Fig. 30.

64. A biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the piwil 12-80 protein sequence of Fig. 29.

65. A biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the piwil 12-80 DNA sequence of Fig. 30.

66. An isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a piwil2-60, comprising a protein sequence substantially as shown in Fig. 31.

67. An isolated and purified polynucleotide acid encoding a biologically active piwi family polypeptide comprising a Piwil2-60, comprising a DNA sequence substantially as shown in Fig. 32.

68. A biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the piwil 12-60 protein sequence of Fig. 31.

69. A biomarker for predicting the progression of premalignant lesions that regress or progress to malignant lesions, comprising the DNA piwil 12-60 sequence of Fig. 32.

70. A biomarker for determining the survival of a patient with cervical neoplasms, comprising monitoring the ectopic expression of piwil2-60.

71. A biomarker for detection of one or more long-term cultured primary cell lines, including, but not limited to human dermal fibroblasts (HDF), human lung fibroblasts (HLF), and breast epithelial cells (HTl 25), comprising monitoring expression of piwil2-l 10.

72. A biomarker for detecting one or more cancer cell lines, including but not limited to as cervical cancer cells (HeLa), and breast cancer cells (468, 231 and HTl 26), comprising monitoring expression of one or more of: pwiwl2-l 10, piwil2-80 and piwil2-60.

73. A biomarker for detecting tumorigenic capacity of a cancer cell line in SCID mice, comprising monitoring expression of one or more of: piwil2-80 and piwil2- 60.

74. Precancerous stem cells useful to induce piwil2-specific anti-tumor immunity.

75. A method for testing whether immunization of a subject with precancerous stem cells (pCSCs) can induce anti-tumor immunity, comprising: injecting the subject with pCSCs (2C4G2, 3B5C or 3B6C); challenging the 3B5C- and 3B6C- injected subjects with unrelated tumor cells (EL-4); harvesting splenocytes from 2C4G2-injected subjects; preparing single splenocytes and adoptively transferring into an SCID subject; preparing a control group that receives none or equal number of normal splenocytes, and simultaneously challenging the control subject with 2C4G2 cells; sacrificing after adoptive transfer; and performing a T cell proliferation assay in the presence or absence of various concentration of free piwil2 peptide.

76. A method for inducing anti-tumor immunity in a subject in need thereof, comprising vaccinating the subject with one or more pCSCs.

77. A method for inducing anti-tumor immunity in a subject in need thereof, comprising vaccinating the subject with one or more of: piwil2-l 10, piwil2-80 and piwil2-60.

78. A method for blocking enhanced T cell proliferation by administering free piwil2 peptide in a dose-dependent manner.

79. A method of reversing the inhibitory activity of the free piwil2 peptide by increasing the concentration of the piwil2 being administered.

80. A method for mediating pCSC-induced anti-tumor immunity comprising controlling piwil2 activity.

81. A method for screening patients for high risk of developing cancer, comprising detecting pCSCs in peripheral blood, secreting fluids and other noninvasive specimens from the patient.

82. Piwil2 useful as a biomarker for precancerous lesions, including, but not limited to AGCNOS (atypical glandular cells, not otherwise specified), LSIL (low- grade squamous intraepithelial lesion), and HSIL (high-grade squamous intraepithelial lesion).

83. Piwil2 useful as a biomarker for cervical neoplasms.

84. A synthetic peptide which induces a piwil2 antibody useful to immunize animals.

85. A synthetic peptide which induces a piwil2 antibody useful to generate B cell hybridoma.

86. A synthetic peptide which induces a piwil2 antibody useful to screen isoform specific antibodies.

87. A synthetic peptide of any of the preceding claims comprising one or more of piwil2-l 10, piwil2-80 and piwil2-60.

88. One or more of clones piwil2-l 10, piwil2-80 and piwil2-60 useful as immunogens or antigens for screening samples.

89. A method for generating a piwil2 isoform specific monoclonal antibody, comprising using a piwil2 peptide to generate polyclonal antibodies to piwil2 isoform;

90. A diagnostic kit comprising one or more antibodies of any of the preceding claims.

91. Piwil2 and its regulated proteins, including embryonic stem cell proteins, useful as tumor vaccines.

92. A purified antibody that binds specifically to piwil2- 110.

93. A purified antibody that binds specifically to piwil2-80.

94. A purified antibody that binds specifically to piwil2-60.

95. A purified antibody that binds specifically to an epitope in the receptor- binding domain of piwil2-l 10.

96. The antibody of the preceding claim, wherein the epitope is within the sequence shown in Fig. 30.

97. A purified antibody that comprises the sequence shown in Fig. 30 for piwil2-1 10.

98. A purified antibody that binds specifically to an epitope in the receptor- binding domain of piwil2-80.

99. The antibody of the preceding claim, wherein the epitope is within the sequence shown in Fig. 30.

100. A purified antibody that comprises the sequence shown in Fig. 30 for piwil2-80.

101. A purified antibody that binds specifically to an epitope in the receptor- binding domain of piwil2-60.

102. The antibody of the preceding claim, wherein the epitope is within the sequence shown in Fig. 32.

103. A purified antibody that comprises the sequence shown in Fig. 32 for piwil2-60.

104. A peptide that useful to induce antibody to the piwil2-100, piwil2-80 and piwil2-60.

105. A peptide having the sequence: NH₂-ipekmkkdframkdl-CONH_2.

106. Use of the peptide of the preceding claim in the development of tumor vaccines.

107. A tumor vaccine comprising: NH₂-ipekmkkdframkdl-CONH_2.