WO2008048466A2 - Troubles de résorption osseuse - Google Patents

Troubles de résorption osseuse Download PDF

Info

Publication number
WO2008048466A2
WO2008048466A2 PCT/US2007/021725 US2007021725W WO2008048466A2 WO 2008048466 A2 WO2008048466 A2 WO 2008048466A2 US 2007021725 W US2007021725 W US 2007021725W WO 2008048466 A2 WO2008048466 A2 WO 2008048466A2
Authority
WO
WIPO (PCT)
Prior art keywords
sh3bp2
seq
tnf
cells
inhibitor
Prior art date
Application number
PCT/US2007/021725
Other languages
English (en)
Other versions
WO2008048466A3 (fr
Inventor
Bjorn R. Olsen
Yasuyoshi Ueki
Original Assignee
President And Fellows Of Harvard College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by President And Fellows Of Harvard College filed Critical President And Fellows Of Harvard College
Publication of WO2008048466A2 publication Critical patent/WO2008048466A2/fr
Publication of WO2008048466A3 publication Critical patent/WO2008048466A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10—Peptides having 12 to 20 amino acids

Definitions

  • the present invention related to bone homeostasis.
  • Cherubism involves loss of cancellous or trabecular bone, followed by loss of cortical bone, accompanied by inflammation.
  • Cherubism is a dominantly inherited syndrome characterized by excessive bone resorption in jaws and accumulation of inflammatory/fibrous tissue in the lower face (Jones, 1933). These pathological facial changes appear 2-4 years after birth and regress after puberty. The association between osteoclast-mediated bone resorption and inflammation suggests an activation of processes controlling differentiation of osteoclasts and inflammatory cells.
  • the disorder was mapped to chromosome 4p and we identified amino acid missense mutations in the SH3-binding protein SH3BP2 in several cherubism families (Mangion et al., 1999; Tiziani et al., 1999; Ueki et al., 2001). Since the SH3BP2 gene is located within a region that frequently is deleted in individuals with Wolf-Hirschhorn syndrome and patients with this syndrome do not have cherubism (Hirschhorn et al., 1965; Zollino et al., 2000) it is unlikely that the missense mutations in SH3BP2 represent loss-of-function mutations (Ueki et al., 2001).
  • Sh3bp2 was initially identified in a screen for proteins that bind to the SH3 domain of the tyrosine kinase c-Abl (Ren et al., 1993). Subsequently, it was also identified as a Syk kinase, Vav and 14-3-3 interacting protein (Deckert et al., 1998; Foucault et al., 2005;
  • Sh3bp2 Interactions between Sh3bp2 and a range of other proteins, including ZAP70, Lyn kinase, PLCD, LAT and c-Cbl/Cbl-b, have also been described (Jevremovic et al., 2001; Maeno et al., 2003; Qu et al., 2005; Saborit-Villarroya et al., 2005; Sada et al., 2002). The binding of Sh3bp2 to several of these proteins requires phosphorylation of tyrosine and serine residues (Foucault et al., 2003; Qu et al., 2005).
  • Syk can phosphorylate tyrosyl residues Y174, Yl 83, and Y446 (in the mouse protein) within Sh3bp2 and phosphorylation of at least one of these residues (Y446) has been suggested to be critical for the ability of Sh3bp2 to stimulate Syk tyrosine phosphorylation (Maeno et al., 2003). Interaction of Sh3bp2 with 14-3-3 proteins requires phosphorylation of S225 and S277 (in the mouse protein) in Sh3bp2, and PKC is one of the potential Ser/Thr kinases that can catalyze this phosphorylation (Foucault et al., 2003).
  • Sh3bp2 The function of Sh3bp2 is not defined, but studies of T and B lymphoid cells suggest that Sh3bp2 may act as stimulator of NFAT- mediated transcription and this stimulatory activity is negatively regulated by interaction of Sh3bp2 with 14-3-3 proteins (Deckert et al., 1998; Foucault et al., 2003). A recent study of Sh3bp2 -deficient T- and B-cells suggests that Sh3bp2 is particularly important for signaling in B cells (de Ia Fuente et al., 2006).
  • the invention provides a pharmaceutical composition containing an inhibitor of Sh3bp2.
  • the composition is formulated for administration to a human subject, e.g., the inhibitor is in the form of a capsule or tablet, a dermal patch, or an solid, semi-permeable, or permeable implant that is placed into a mammal.
  • the compositions are formulated as a slow-release or slowly degrading composition to deliver the inhibitor to tissues over an extended period of time, e.g., 4, 6, 12, 18, or 24 hours or over a period of days or weeks.
  • the inhibitor preferably binds to a domain of human Sh3bp2 that contains an amino acid motif XSPXDXQSFRSF (SEQ ID NO: 1), e.g., HLQRSPPDGQSFRSF (SEQ ID NO:2) or RSPPDGQSFRSF (SEQ ID NO:3).
  • SEQ ID NO: 1 amino acid motif XSPXDXQSFRSF
  • HLQRSPPDGQSFRSF SEQ ID NO:2
  • RSPPDGQSFRSF SEQ ID NO:3
  • the inhibitor binds to a motif selected from the group consisting of RSPPDG (SEQ ID NO:4), QSPPDG (SEQ ID NO:5), PSPPDG (SEQ ID NO:6), RSPLDG (SEQ ID NO:7), RSPRDG (SEQ ID NO:8), RSPHDG (SEQ ID NO:9), RSPPDE (SEQ ID NO: 10), and RSPPDR (SEQ ID NO: 11).
  • the inhibitory compound reduces tumor necrosis factor alpha (TNF- ⁇ ) expression or production by a cell that has been contacted with the compound.
  • the inhibitor is a cell membrane permeable polypeptide such as a peptide conjugated to a hydrophobic moiety.
  • the hydrophobic moiety or tether mediates traverse of the peptide through the cell membrane.
  • the inhibitor is a non- protein compound the molecular mass of which permits membrane permeability, e.g,. the mass is less than 1000 daltons.
  • a method of inhibiting a production of a pro-inflammatory cytokine, e.g., TNF- ⁇ , is carried out by contacting a myeloid cell with an inhibitor of Sh3bp2, and a method of inhibiting an inflammatory condition in a mammal is carried out by administering to the mammal, e.g., a human patient, an inhibitor of Sh3bp2 described above.
  • Patients to be treated in this manner include those that have been diagnosed as suffering from or at risk of developing an inflammatory condition selected from the group consisting of rheumatoid arthritis, inflammatory bowel disease, ankylosing spondylitis, psoriasis, and psoriatic arthritis.
  • the methods of reducing TNF- ⁇ levels in an individual are also used to reduce TNF- ⁇ -mediated pathologies associated with microbial infections, TNF- ⁇ -mediated hematopoetic disorders, inflammatory bone loss, drug induced jaw bone loss, inflammation in liver or lungs, giant cell tumors, conditions characterized by huge osteoclasts (e.g., cherubism), macrophase-related bone loss associated with arthritic conditions such as rheumatoid arthritis and osteoarthritis, atherosclerosis.
  • a method of inhibiting bone loss Such methods are carried out by contacting an osteoclast or precursor thereof with an inhibitor of Sh3bp2.
  • Such inhibitors include antibodies or fragments thereof that bind to Sh3bp2.
  • a method of inhibiting osteoporosis involves identifying a subject suffering from or at risk of developing osteoporosis and administering to the subject an inhibitor of Sh3bp2.
  • Sh3bp2 inhibitory compounds modulate formation of osteoclasts and as a result inhibit bone resorption.
  • the inhibitors are administered alone or in combination with other therapeutic compounds for treatment of osteoporosis such as bisphosphonate or calcitonin.
  • Sh3bp2 inhibition confers clinical benefit by reducing osteoclast formation in a different manner, i.e., by targeting a different signal transduction pathway, compared to conventional therapies such as bisphosphonate.
  • advantages of Sh3bp2 inhibition include avoidance of adverse side effects of bisphosphonate therapy such as osteonecrosis of the jaw bone (ONJ), e.g., necrosis of the maxilla and/or mandible.
  • Bone resorption associated with cherubism is inhibited by comprising administering to a subject a TNF- ⁇ inhibitor.
  • Subjects to be treated are diagnosed as suffering from or at risk of developing clinical cherubism, a hereditary disease marked by an enlargement of the jawbones in children.
  • diagnosis is performed by swabbing buccal mucosa and detecting a mutation in the Sh3bp2 gene (WO 03/025197).
  • DNA of the subject contains a mutation in exon 9 of the gene encoding Sh3bp2 (GENBANK Z68279).
  • wild type Sh3bp2 polypeptide is encoded by
  • TNF inhibitors include infliximab, etanercept, or a combination thereof as well as Sh3bp2 inhibitors described above. This disorder is characterized by an age-dependent metabolic change that improves at puberty.
  • Inhibition of the pathologic inflammatory process in the within the first decade of live e.g., by administering a composition that reduces TNF- ⁇ levels in the subject, leads to prevention or amelioration of the disease.
  • the symptoms Noonan syndrome a pathological condition characterized by face and other malformations, including congenital heart disease, bleeding diathesis, as well as skeletal, neurologic, genitourinary, lymphatic, eye, and skin disorders, is also reduced or prevented using the methods described herein.
  • TNF inhibitors include Infliximab (RemicadeA®), mouse-human chimeric anti- huTNF mAb; D2E7 (HumiraTM), fully human anti-huTNF mAb; Etanercept (Enbrel®), p75sTNF-RII-Fc (dimeric); PEG-p55sTNF-RI (monomeric); Lenercept, p55sTNF-RI-IgGl (dimeric).
  • Other inhibitors of TNF- ⁇ include small molecules (e.g., those described by He et al.., 2005 Science 310:1022-1025; Haraguchi et al, AIDS Res Ther. 2006; 3: 8. Published online 2006 March 31.
  • TNF- ⁇ inhibitory antibodies include those describe in USPN 7,160,542; US Patent Application No. 20070009524; and 20070003548.
  • inhibitors of TNF- ⁇ include soluble TNF- ⁇ receptor polypeptides or inhibitors of TNF- ⁇ receptors.
  • Other inhibitors include nucleic acids such as siRNAs that are specific for inhibiting TNF- ⁇ expression.
  • Inhibitors of TNF- ⁇ expression or production are identified by contacting a Sh3bp2 peptide with a panel of candidate compounds and detecting binding of one or more of the compounds to the Sh3bp2 peptide such as a Sh3bp2 peptide that contains, consists essentially of, or consists of residues 415-420 (RSPPDGQ; SEQ ID NO: 16). Binding indicates that the compound inhibits TNF- ⁇ expression or production.
  • the panel includes a phage display library of random peptides. Cell permeability of peptides is conferred by tethering to the peptide a hydrophobic moiety such as a fatty acid..
  • the invention also provides methods for treating a bone homeostasis disorder by delivering anti-TNF- ⁇ therapy. Examples of therapy include delivery of a therapeutic amount of infliximab, a monoclonal antibody against TNF- ⁇ .
  • the bone disorder is osteoporosis
  • the therapy reduces the level of bone loss.
  • the bone loss can be in cortical bone and/or trabecular bone.
  • the bone homeostasis disorder causes inflammation around the bones.
  • anti-TNF- ⁇ therapy is provided as an effective means for decreasing the effects of the bone homeostasis disorder on a patient. Delivery of the anti-TNF- ⁇ therapy decreases both inflammation and bone loss that are associated with the disorder.
  • the bone homeostasis disorder is osteoporosis. In another specific embodiment, the bone homeostasis disorder is inflammation around the bone.
  • the bone homeostasis disorder is cherubism. In a further specific embodiment, the bone homeostasis disorder is Paget's disease.
  • the invention provides methods and compounds for decreasing the effects of a bone homeostasis disorder or disease on a patient genetically predisposed to the disorder or disease. While details relating to the disease cherubism are provided in this document, the invention wherein certain aspects are described herein is equally applicable to other diseases or disorders involving bone loss and inflammation around the bones, such as osteoporosis.
  • Sh3bp2 animal models such as those described in US Patent Application No. 2006/0019248 and the knock-in model (gain-of-function model) described below are useful to screen for compounds useful in treatment and reduction of the severity of diseases characterized by increases in TNF- ⁇ .
  • Protein-based and animal screens are carried out to identify compositions that bind to the SH3 domain of tyrosine kinase. Compounds identified in such screens are useful to prevent or inhibit osteoporosis and other bone degenerative disease. All references cited herein are hereby incorporated by reference.
  • FIGURES Figure 1 Generation of knock-in mouse model of cherubism Strategy for generation of cherubism mouse. Partial restriction map of Sh3bp2 gene and targeting construct, the targeted allele, as well as the structure of the targeted allele following cross with deleter mouse. RV: EcoRV. P416R substitution was introduced into exon 9.
  • B Genomic Southern for ES cell screening. Location of 3' and 5' probes is shown in A.
  • C Genotyping after crossing with deleter mouse strain. Pl and P2 primers flanking loxP sequence are in A.
  • D Sequencing of RT-PCR DNA fragment spanning exon 9 from heterozygous mutant spleen.
  • E Wild-type and P416R Sh3bp2 protein expression in bone marrow-derived pre-and mature osteoclasts (pOC, mOC) and spleen.
  • FIG. 2 Microarray analysis of transcript levels in stimulated bone marrow cells 2.5 x 10 6 bone marrow cells (per well) from wild-type and heterozygous mutants were cultured in 6-well plates with 50 ng/ml M-CSF for 48 hours; then 50 ng/ml RANKL was added. Cells were harvested 0, 2, 24 and 72 hours after RANKL addition and RNA was isolated for microarray analysis. Y axis indicates fold increase compared to wild-type transcript level at time 0 (open columns; wild-type, filled columns: heterozygous mutant).
  • B Closed eyelids in 10- weeks old homozygous mouse.
  • C Swollen snout and facial tissue in 30-weeks old homozygous mutant.
  • Figure 4 Fibrous inflammatory infiltrates in facial tissues Trichrome staining of fibrotic inflammatory infiltrates in palate and mandibula.
  • C Three-dimensional microCT images of femoral (top) and trabecular bone above the distal femoral growth plate (bottom) in 10-weeks old male littermates.
  • Figure 6 Enhanced osteoclastic differentiation in mutant bone tissue and with mutant bone marrow cells
  • Hematoxylin/eosin (HE, left) and TRAP (right) staining of sections through maxillary first molar of 8-weeks old mouse.
  • B Bone marrow cells cultured with M-CSF (50 ng/ml) and RANKL (10, 50 and 100 ng/ml) for 5 days, followed by TRAP staining. Cultures on dentine slices (Immunodiagnostic Systems Inc., Fountain Hills, AZ) for 14 days (50 ng/ml M-CSF and 50ng/ml RANKL) stained with toluidine blue to visualize resorption pits.
  • C TRAP-positive multinucleated cells on day 5 of culture (50 ng/ml M-CSF and 50 ng/ml RANKL).
  • D Number of nuclei per TRAP-positive cell on day 5 (50ng/ml M-CSF and 50ng/ml RANKL).
  • E TRAP 5b in culture supernatants on day 5.
  • Figure 7 Macrophage-rich inflammatory infiltrates in homozygous mutant tissues HE staining of humerus of 8-weeks old wild-type and homozygous mutant mouse (top). Inflammatory infiltrate in cortical bone is indicated by arrow. MicroCT images of cross-sections of femoral bone from 10-weeks old males (middle). Staining of inflammatory lesion at periosteum of 10-weeks old homozygote with F4/80 and CDl Ib antibodies (bottom). (B) HE staining of frontal section of facial tissues from 10-weeks old wild-type and homozygous mutant mice.
  • FIG. 1 Shows indicate inflammatory infiltrates in zygomatic bone and periodontal ligament of maxillary first molar (see high magnification inset) in homozygous mutant.
  • C HE staining of palate section of 10-weeks old wild-type and homozygous mice (top). Staining of inflammatory lesion in palate from 10-weeks old homozygous mutant with F4/80 and CDl Ib antibodies (middle). HE staining of mandibula from 10-weeks old mouse (bottom) .
  • D HE staining of eyelid from 10-weeks old wild-type and homozygous mice (left).
  • E HE staining of 20-weeks old homozygous knee joint showing complete destruction of articular cartilage and subchondral bone.
  • F TRAP-positive multinucleated cells (arrow heads) in inflammatory bone infiltrates in distal humerus.
  • G X- ray images of ankle regions of 10-weeks old homozygous and wild-type littermates. Arrow indicates cystic bone lesions at distal tibia.
  • FIG. 8 Systemic inflammation in internal organs and elevated TNF- ⁇ expression in mutant macrophages
  • B Staining of inflammatory lesions in liver, lung, stomach (from top to bottom) of 10-weeks old homozygotes with F4/80 and CDl Ib antibodies.
  • D FACS analysis of TNF- ⁇ in peritoneal macrophages.
  • E TNF- ⁇ concentration in culture supernatant of peritoneal macrophages.
  • B Increased and sustained ERKl /2 phosphorylation in bone marrow- derived macrophages, following stimulation with RANKL and 1 ng/ml M-CSF.
  • C Increased phosphorylation at Syk Y346 in bone marrow cells cultured with M-CSF for 48 hours and stimulated further with M-CSF and RANKL.
  • B Staining of mutant lymph nodes with F4/80 and CDl Ib antibodies.
  • C CDl Ib- positive cells in wild-type and mutant bone marrow (10 weeks).
  • D Decreased bone mineral density in 10-weeks old KI/KI Ragl+/+ and KI/KI Ragl-/- mice and enhanced bone marrow- derived osteoclast formation from KI/KI Ragl+/+ and KI/KI Ragl-/- mice following M- CSF/RANKL stimulation.
  • E HE staining of spleen and liver (top), lung (middle) and periosteum (bottom) of 10-weeks old KI/KI Ragl-/- mice.
  • F High serum TNF- ⁇ concentration of 10-weeks old KI/KI Ragl-/- mice. Average indicated by red bar.
  • G MicroCT images of distal end of femoral bone from 10-weeks old KI/KI+/+ and KI/KI op/op littermates (top). HE staining of stomach (middle) and lymph node (bottom) of KI/KI+/+ and KI/KI op/op mice.
  • TNF- ⁇ may stimulate M-CSF and RANKL production by stromal cells and thus further enhance macrophage and osteoclast formation.
  • TNF- ⁇ mediated inflammation and osteoclast mediated bone loss are the pathological hallmarks of cherubism.
  • TNF- ⁇ prevents osteoclast formation via sensing mechanism. This mechanism plays a role int the inhibition of formation of osteoclasts in skeleton.
  • An increase in Sh3bp2 leads to an increase TNF- ⁇ and an inhibition of osteoclast formation.
  • Sh3bp2 acts as a macrophage-dependent thermostat that is set at high or low level and therefore represents a major regulatory switch.
  • Sh3bp2 sensitizes myeloid cells to external stimulus. With the mutation, activity of Sh3bp2 is set at high regardless of the level of the protein. When phosphorylated, the protein is more active and when bound to phosphatase, less active.
  • the present invention provides, among other benefits, methods for detecting a bone homeostasis disorder in a patient.
  • Bone erosion and inflammation are often associated with such disorders.
  • osteoporosis is an example of a disorder with bone erosion resulting in bone loss.
  • Other bone homeostasis disorders include cherubism and Paget's Disease.
  • mice as a model system, we demonstrated that heterozygous mammals carrying Sh3bp2 alleles with the most common cherubism mutation exhibit trabecular bone loss with increased numbers of osteoclasts on bone surfaces.
  • Homozygotes have an additional TNF- ⁇ -dependent phenotype of systemic inflammation and cortical bone erosion.
  • the mutant phenotype is lymphocyte-independent and can be transferred to mice carrying wild-type Sh3bp2 alleles through transfer of mutant fetal liver cells.
  • Mutant myeloid cells show enhanced sensitivity, through ERK1/2 and Syk associated mechanisms, to macrophage and osteoclast-inducing cytokines in vitro and form macrophages expressing enhanced levels of TNF- ⁇ and osteoclasts with unusually large numbers of nuclei.
  • Overexpression of wild- type Sh3bp2 in myeloid cells indicates that the mutant phenotype reflects gain of Sh3bp2 function.
  • M-CSF macrophage colony stimulating factor
  • RNKL receptor activator of NF-kB ligand
  • Sh3bp2 a targeting construct containing a 20 kb gene fragment, a Neo-cassette flanked by loxP sites inserted between exons 8 and 9, a mutated exon 9, and a thymidine kinase cassette at the 3' end was made.
  • Construct DNA was electroporated into ES cells (Jl), and the cells were cultured in a medium containing G418 and Fiau for selection. After screening ES cell colonies by Southern blotting, four clones were selected and used for generation of chimeras. After confirmation of germline transmission, mice were crossed with a cre-deleter strain (CMV-cre) to remove the Neo cassette in the Sh3bp2 gene.
  • CMV-cre cre-deleter strain
  • mice carrying Sh3bp2 knock-in (KI) alleles were backcrossed to C57BL6/J mice for at least 4 generations. All animals in the study were housed in pathogen free facilities and monitored carefully, following strict guidelines for humane care and treatment of animals.
  • PCR with primers (Pl and P2) from within intron 8 of the Sh3bp2 gene was used.
  • the sequences of these primers are: Pl (sense): 5' CCACTATATGACAATACCTG 3' (SEQ ID NO:12); P2 (antisense): 5' CATAGTCTTCATCTGAGTCC 3' (SEQ ID NO: 13).
  • Pl sense
  • P2 antisense
  • mRNA was isolated from spleens of 10- weeks old animals using Qiagen (Valencia, CA) RNA isolation kit. Sequencing was done in an ABI 3100 DNA sequencer.
  • mice mice were purchased from Jackson Laboratory and bred with KI/+ mice.
  • KI/+ Ragl+/-, KI/+ TNF- ⁇ +/- or KI/+ Csflop/+ mice were crossed to generate KI/KI Ragl- /-, KI/KI TNF- ⁇ -/- or KI/KI op/op double mutants. Double mutant mice were analyzed at 10 weeks of age.
  • MicroCT (mCT20; Scano Medical AG, Bassersdorf, Switzerland) was performed on femoral, calvarial and mandibular specimens using groups of 6 wild-type (+/+), 6 heterozygous (KI/+) and 6 homozygous (KI/KI) 10-weeks old mice.
  • MicroCT was also performed on femoral specimens of KI/KI op/op and KI/KI TNF- ⁇ -/- mutant mice and on humerus of Ragl-/- recipients of KI/KI fetal liver cells. Individual bones were dissected, fixed in 4% paraformaldehyde and stored at 4°C. Trabecular measurements were taken at the distal femoral growth plate in 80 consecutive slices of 12 ⁇ m resolution.
  • Volumetric regions were rendered as 3-dimensional arrays. 50 cross-sectional slices of 12 ⁇ m at mid-diaphysis were used to calculate cortical bone parameters. Mandibular cortical thickness was analyzed by measuring vertical sections at the mandibular foramen. Calvaria were analyzed over 100 slices using the sagittal suture at the central parietal region as reference point. Data were analyzed for statistical significance using Student's t-test or one-way ANOVA with Bonferroni correction..
  • Histomorphometric measurements were made in a blinded, nonbiased manner, using the OsteoMeasure computerized image analysis system (OsteoMetrics Inc., Atlanta, GA) interfaced with an Optiphot Nikon microscope (Nikon Inc., Melville, NY). The terminology and units used are those recommended by the Histomorphometry Nomenclature Committee of the American Society for Bone and Mineral Research (Parfitt et al., 1987). All measurements were confined to the secondary spongiosa and restricted to an area between 400 and 2000 ⁇ m proximal to the growth plate-metaphyseal junction of the distal femur. Cortical measurements were taken from the middle of the femur.
  • Tissues were fixed for 48 hours at 4 0 C in phosphate-buffered saline (pH 7.4) containing 4% paraformaldehyde and embedded in paraffin. Bone samples were decalcified by incubation in 0.5 M EDTA (pH 7.2) for 2 weeks before paraffin embedding. Six ⁇ m sections were cut (Microm HM355, Richard- Allan Scientific, Kalamazoo MI) and dried at 37°C on Superfrost plus slides (VWR International, West Chester, PA). Sections were used for hematoxylin-eosin (HE, Richard-Allan Scientific, Kalamazoo MI), modified Masson trichrome, and TRAP staining. For TRAP staining, a kit from Sigma-Aldrich (387-A, St. Louis, MO) was used. Immunohistochemistry
  • Tissues were quickly frozen in OCT compound (Sakura, Japan) in an ethanol-dry ice bath.
  • OCT compound Sakura, Japan
  • Six ⁇ m sections were cut (CM3000, Leica Instruments, Nussloch, Germany), dried for 1 hour at room temperature on Superfrost plus slides and stored at -8O 0 C until use. Just before staining, sections were fixed with acetone for 10 minutes at -20 0 C.
  • Vectastain Elite ABC kit Vector Laboratories Inc., Burlingame, CA was used for HRP based immunohistochemistry.
  • CDl Ib (clone Ml/70) and F4/80 (clone CI: A3-1) antibodies were purchased from BD Biosciences Pharmingen (San Diego, CA) and Caltag (Burlingame, CA), respectively. Negative controls included sections incubated without the primary antibodies.
  • TRAP 5b and TNF- ⁇ ELISA TRAP 5b in serum and culture media was measured with a mouse TRAP assay kit purchased from SBA Sciences (Turku, Finland).
  • TNF- ⁇ in serum and conditioned media of macrophage cultures was measured using Duo Set ELISA Development kit (R&D, Minneapolis, MN).
  • Bone marrow cultures Bone marrow (BM) cells from tibia and femur of 6-10-weeks old mice were flushed out with ice-cold ⁇ -MEM containing 10% non-heat-inactivated FBS and penicillin/streptomycin. Cell suspension was filtered through 70 ⁇ m Nylon cell strainer (BD Falcon, Bedford, MA); red blood cells were lysed with RBC lysis buffer (eBioscience, San
  • BM cells were plated at 4.3 x 10 5 cells/well in 48 well culture plates in the presence of M-CSF and RANKL.
  • Recombinant M-CSF and RANKL were purchased from Peprotech Inc. (Rocky Hill, NJ). Medium was changed every 2 days. After 5 days, TRAP-positive cells with more than 3 nuclei were counted as osteoclasts. Alkaline phosphatase-positive stromal cells were fewer than 0.1% on day 5 of culture and no osteoclast differentiation was observed without RANKL.
  • the cells were starved for 2 hours in medium containing 0.1% FBS without M-CSF and with or without 10 ⁇ M U0126 (Cell Signaling Technology, Inc., Beverly, MA).
  • non-adherent BM cells cultured for 3 days with 50 ng/ml M-CSF were harvested in M-CSF-free ⁇ -MEM containing 10% FBS and replated at a concentration of 3x10 5 cells per well in 96-well plates. The cells were incubated for 2 hours with or without 20 ⁇ M NEMO binding domain peptide in ⁇ -MEM containing 10% FBS, before being restimulated with 50 ng/ml M-CSF for an additional 36 hours.
  • the sequence of the NEMO binding domain peptide was drqikiwfqnrrmkwkk (SEQ ID NO:14)-TALDWSWLQTE (SEQ ID NO: 15) (the Antennapedia sequence in lower case and the IKK ⁇ sequence in upper case).
  • Peptide stock solutions contained peptide were purified using reverse phase HPLC, dissolved in DMSO at a concentration of 2OmM.
  • RANKL For studies of long-term effects of RANKL on osteoclastogenesis, 5.5 x 10 6 BM cells were cultured with M-CSF (50 ng/ml) in 6 cm culture plates for 2 days, then stimulated by adding RANKL (50 ng/ml) for an additional 3 days. Cells were washed with ice-cold PBS and lysed with 1% Triton X-100 or 1% NP-40, 150 mM NaCl, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, 2.5 mM sodium-pyrophosphate and 1.0 mM ⁇ -glycerophosphate, including protease and phosphatase inhibitor cocktails (Sigma). Ten ⁇ g of protein were separated on SDS-PAGE gels and transferred to nitrocellulose. Antibodies against total and phosphorylated Syk (Y346, Y317 and Y519/520), HA-tag and actin were purchased from
  • M-CSF For studying effects of M-CSF stimulation of macrophages, 4.0 x 10 6 non-adherent BM cells were cultured with M-CSF (50 ng/ml) in 6 cm culture plates for 3 days, starved for 2 hours with M-CSF free medium containing 0.1 % FBS and then stimulated by M-CSF (50ng/ml).
  • Antibodies against IDB and actin were purchased from Santa Cruz Biotechnology and Sigma, respectively. All other antibodies were purchased from Cell Signaling Technology Inc.
  • Sh3bp2 in mutant tissues were harvested, snap frozen in liquid nitrogen and homogenized in cell lysis buffer as described above. Ten ⁇ g of total protein were used for Western blotting with anti-Sh3bp2 antibodies purchased from Santa Cruz Biotechnology Inc. Although anti-phospho-Syk (Y346) antibodies cross-react with phospho-Zap70, specificity for phospho-Syk was confirmed by molecular weight comparison to total Syk, and immunoprecipitation using total Syk antibody followed by Western blotting and staining with anti-phospho-Syk (Y346). For all western blots, bands were detected using Supersignal west pico or femto chemiluminescent substrate (Pierce Biotechnology Inc., Rockford, IL).
  • mice After euthanasia of mice, 6 ml of DMEM were injected into peritoneal cavity and aspirated back. Peritoneal cells were pelleted by centrifugation and 1 x 10 s cells in 200 ⁇ l DMEM were plated in each well of a 96-well culture plate and incubated at 37 0 C for 1 hour. The plate was then vigorously vibrated on a titer plate shaker for 10 minutes. Culture supernatants containing non-adherent cells were discarded. These steps were repeated until non-adherent cells were completely washed out. 99.9% of attached cells were CDl Ib- and F4/80-positive. Macrophages were further cultured in DMEM containing 10% FBS. After collection of culture supernatants, the number of macrophages per well were counted and TNF- ⁇ concentrations assayed in supernatants were normalized to 1 x 10 5 cells. FACS
  • Bone marrow cells were harvested from tibia and femur of 10-weeks old mice. After RBC lysis, cells were stained with anti-CDl Ib (PE, clone: Ml/70) antibodies and analyzed using FACS Calibur (BD Biosciences, San Jose, CA). Peritoneal cells were harvested from 6- 10-weeks old mice and stained with anti-CDl Ib (PE, clone: Ml/70), F4/80 (PE-Cy5, clone: BM8) antibodies, and permeabilized cells were then stained with anti-TNF- ⁇ (FITC, clone: MP6-XT22) antibody and analyzed by FACS Calibur (BD). All antibodies for FACS were purchased from eBiosciences (San Diego, CA). Retroviral infection of bone marrow-derived macrophages
  • HA-tagged wild-type and P416R Sh3bp2 cDNAs were subcloned into the pMXs-IG vector (from Prof. T. Kitamura at Tokyo University). Transfection into Plat E packaging cells (also from Prof. T. Kitamura) was performed using FuGENE 6 (Roche, Alameda, CA). After 48 hours of transfection, supernatants were collected and used for infection. Bone marrow cells were cultured with M-CSF (50 ng/ml) alone for 48 hours and further cultured for 24 hours in medium containing retrovirus and polybrene (8 ⁇ g/ml). Infection efficiency was evaluated and normalized based on GFP expression. After infection, cells were stimulated with RANKL (50 ng/ml) for additional 72 hours, visualized by TRAP staining (Sigma) or lysed for Western blotting.
  • Fetal livers (E 15.5) were removed and dissociated in 10% FBS RPMI. After genotyping, 1 x 107 viable fetal liver cells were injected i.v. into sublethally (250 cGy, 137Cesium source) ⁇ -irradiated 4-5-weeks old Ragl null mice. After 6 weeks, successful transplantation was confirmed by the presence of ⁇ TCR- and B220-positive cells in peripheral blood. In recipient mice, the proportion of homozygous donor cells in M-CSF dependent osteoclast precursor cells was about 70%, as determined by semi-quantitative genomic PCR.
  • RNAs were extracted using Trizol and cDNAs were synthesized by Superscript II (Invitrogen).
  • Real-time PCR analysis was carried out with ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) using TaqMan PCR kit protocol.
  • TaqMan gene expression assay mix containing unlabeled PCR primers and FAM labeled TaqMan MGB probes for mouse TNF- ⁇ (Cat. no. Mm00443258_ml) or mouse GAPDH (Cat. no. Mm99999915_gl) and Ix TaqMan universal PCRmastermix were purchased from Applied Biosystems. All raw data were analyzed using Sequence Detection System software Version 2.1 (Applied Biosystems).
  • the threshold cycle (CT) values were converted to absolute transcript numbers of TNF- ⁇ and GAPDH using standard curves from plasmid DNA containing mouse TNF- ⁇ and mouse GAPDH. Expression levels of TNF- ⁇ transcripts were normalized to the number of 10 6 GAPDH transcripts.
  • Embryonic stem cells were transfected with a targeting construct encoding mutant Sh3bp2, and used to generate chimeras ( Figures IA, IB). Mice with germline transmission of the targeted allele were crossed with a CMV-cre mouse to excise the Neo-cassette ( Figures IA, 1C). Sequencing of cDNA synthesized with mRNA from spleens of heterozygous knock- in (KI) animals confirmed heterozygosity for the P416R missense mutation (Figure ID).
  • the mutation did not affect Sh3bp2 protein expression in osteoclastic progenitors, mature osteoclasts generated in vitro by stimulation of bone marrow cells with M-CSF and RANKL, or in spleen cells, as demonstrated by Western blotting (Figure IE). Mutant animals were born in the expected mendelian ratio. Heterozygotes showed no abnormalities by visual inspection and had a normal life span. However, homozygotes showed loss of survival with age (Figure 3A).
  • MicroCT of calvarial and jaw bones in 10-weeks old wild-type and mutant littermates demonstrated reduced bone volume in calvaria, loss of bone around teeth, and reduced cortical bone thickness in jaws in homozygotes, but not in heterozygotes ( Figures 5A, 5B). Histology showed no difference between wild-type and heterozygous mice. In contrast, sections of homozygous jaws showed large numbers of tartrate-resistant acid phosphatase (TRAP)-positive osteoclasts along bone surfaces (Figure 6A). In long bones, microCT demonstrated bone loss in both heterozygotes and homozygotes. Three-dimensional reconstruction of trabecular bone showed reduced trabecular bone volume and reduced number of trabeculae ( Figures 5C, 5D). However, only a small change (and only in homozygotes) was seen in trabecular thickness ( Figure 5D).
  • TRIP tartrate-resistant acid phosphatase
  • Homozygous limb bones such as femoral bones, showed pitting of the cortical surface, particularly at the distal end (Figure 5C). Histomorphometric analyses of femoral trabecular bone from 10-weeks old animals confirmed loss of bone in both hetero- and homozygotes. The fraction of the total perimeter of bone profiles occupied by osteoclasts and the number of osteoclasts were increased ( Figure 5E). The fraction of total perimeter of bone profiles occupied by osteoblasts was increased as well ( Figure 5E), suggesting that bone loss in mutant mice is associated with increased osteoclast and osteoblast activities.
  • the P416R mutation in Sh3bp2 causes enhanced osteoclast differentiation
  • Heterozygous mutants did not show swelling of facial soft tissues and enlargement of lymph nodes seen in patients with cherubism (Tiziani et al., 1999), but homozygous mutants developed swollen eyelids, starting about 6 weeks afterbirth. Swelling of facial features, similar to what is seen in cherubism, remained in the few homozygotes surviving until 30 weeks ( Figures 3B, 3C). Soft tissue swelling was caused by the presence of inflammatory lesions. Such lesions were present in cortical regions of long bones ( Figure 7A) and in maxilla, palate and mandible of homozygotes (Figures 7B, 7C). Eyelids were significantly thickened (Figure 7D) and the tissues contained macrophages positive for markers F4/80 and CDl Ib ( Figures 7A, 7C, 7D). The cellular infiltrates developed postnatally.
  • Macrophage-rich infiltrates containing TRAP-positive cells and areas of fibrosis was not limited to craniofacial and limb bones and associated muscles and soft tissues.
  • Inflammatory lesions with F4/80- and CDl lb-positive cells were seen in skin and major internal organs, including liver, lung and stomach ( Figures 8A, 8B). The inflammation first started at 1 week in the liver and lungs as small foci containing neutrophils and macrophages; at 2 weeks, we observed evidence of mild gastritis, and more severe lung and liver inflammation; at 7 weeks, the process appeared in the spine. No evidence of bacterial or fungal infection was seen. Increased levels of TNF- ⁇ in homozygous mutants
  • TNF- ⁇ serum levels were not be detected in sera of wild- type and heterozygous mutants, but homozygous sera contained TNF- ⁇ levels ranging from 200 to 700 pg/ml ( Figure 8C).
  • FACS analyses of F4/80-gated peritoneal macrophages isolated from 10-weeks old mice demonstrated dramatic increase in the proportion of TNF- ⁇ expressing cells in homozygous mutants ( Figure 8D).
  • Increased production of TNF- ⁇ by mutant macrophages was also evident from assays of TNF- ⁇ released into conditioned media of peritoneal macrophages cultured as adherent cells for up to 48 hours (Figure 8E). Under these conditions, only low levels of TNF- ⁇ could be detected in culture supernatants of heterozygous cells after 16 hours. However, after 48 hours, the same high levels of TNF- ⁇ were detected in both hetero-and homozygous cultures.
  • TNF- ⁇ transcript levels were measured by real-time PCR in bone marrow-derived, M-CSF-dependent macrophages.
  • re-stimulation of M-CSF-dependent macrophages with M-CSF, following incubation in M-CSF-free media for 2 hours led to a large increase in TNF- ⁇ transcripts in mutant cells within 24 hours. This increase could be inhibited by 10 ⁇ M concentrations of the MEK inhibitor UO 126.
  • the P416R mutation enhances M-CSF-dependent ERK 1/2 phosphorylation
  • the above results indicate that the cherubism mutation in Sh3bp2 enhances the sensitivity of macrophages to M-CSF by affecting a U0126-sensitive pathway regulating TNF- ⁇ transcription.
  • homozygous cells showed increased levels as well as sustained phosphorylation of ERK 1/2, and increased levels of p38 and IkBa. Increased and sustained levels of phosphorylated ERK 1/2 in homozygous mutant cells were also seen when bone marrow cells were grown with M-CSF for 3 days, starved for 6 hours with 1 ng/ml of M-CSF, and then stimulated with RANKL for up to 2 hours (Figure 9B). High levels of ERK 1/2 phosphorylation were seen even after 6 hours in the presence of only 1 ng/ml of M-CSF, indicating that homozygosity for the cherubism mutation in Sh3bp2 significantly increases the sensitivity of myeloid cells to M-CSF.
  • the P416R mutation causes gain of Sh3bp2 function and affects a Svk kinase-dependent step in osteoclast progenitors
  • Cell extracts were prepared at different time points following addition of RANKL to cultures of bone marrow-derived cells that had been "primed” by incubation with M-CSF for 48 hours. No significant differences were seen between wild-type and mutant cells either at protein or phosphorylation levels for a number of signaling intermediates and transcription factors, except that the level of phosphorylation at Syk Y346 was increased in both heterozygous and homozygous cells compared with wild- type cells at 48-72 hours (Figure 9C).
  • lymph nodes were noticeably larger in homozygotes, and histological analysis demonstrated increased medullary regions of lymph nodes and red pulp in spleen (Figure 10A). These regions were strongly positive with F4/80 and CDl Ib staining ( Figure 10B). FACS analysis of lymph node cells demonstrated a higher proportion of B cells in mutant nodes. Wild-type lymphocytes contained 24.9% CD19-positive cells compared with 48.8% CD19-positive cells from homozygotes. In contrast, no significant difference was found between wild-type and heterozygous cell populations.
  • Sh3bp2 has been implicated as a positive regulatory adapter in T cells (Deckert et al., 1998), B cells (Foucault et al., 2005) and NK cells (Jevremovic et al., 2001) and lymphocytes are known to produce factors that induce osteoclastic differentiation and promote inflammation (Nathan, 2002), the above results raised the possibility that the phenotype in mutant mice may, at least in part, be caused by Sh3bp2-dependent abnormal lymphocyte signaling. To examine this possibility, Sh3bp2 mutant mice were crossed with Rag 1 -deficient mice.
  • mice that were homozygous for the Sh3bp2 mutant allele and null for Ragl exhibited no improvement in the degree of bone loss when compared with Sh3bp2 mutants (Figure 10D). Furthermore, bone marrow cells stimulated with M-CSF and RANKL showed similar enhanced formation of large osteoclasts as marrow cultures from mice carrying only mutant Sh3bp2 alleles ( Figure 10D). Also, double mutants contained the same macrophage-rich inflammatory infiltrates in internal organs and periosteal regions as seen in homozygous Sh3bp2 single mutants ( Figure 10E). Finally, double mutants contained elevated serum levels of TNF- ⁇ ( Figure 10F). TNF- ⁇ -dependent hematopoietic disorders
  • Sh3bp2 is a stimulator of myeloid progenitor cell sensitivity to c-Fms- and RANK-mediated signaling.
  • M-CSF myeloid progenitor cell sensitivity to c-Fms- and RANK-mediated signaling.
  • mutant Sh3bp2 is primarily on differentiation of myeloid cells to macrophages and osteoclasts.
  • Sh3bp2 deficient B cells impairment of several processes, including proliferation, has been noted, but defects are relatively subtle and do not result in defective antibody responses in Sh3bp2 null mice (de Ia Fuente et al., 2006).
  • mutant Sh3bp2 In addition to affecting the level of Syk Y346 phosphorylation in myeloid cells stimulated with M-CSF and RANKL (Figure 9C), mutant Sh3bp2 also affects a mechanism that controls phosphorylation of ERK 1/2 kinases and expression of the downstream target TNF- ⁇ in M-CSF stimulated cells ( Figures 8F, 8G, 8H). The enhanced sensitivity of mutant myeloid cells to M-CSF is most clearly seen with homozygous cells, but is also evident in heterozygous cells.
  • TNF- ⁇ expression is increased in freshly isolated homozygous peritoneal macrophages (Figure 8D) and in adherent short-term (16 hours) cultures (Figure 8E) and is significantly upregulated even in heterozygous cells after 48 hours of culture ( Figure 8E).
  • Sh3bp2 can bind to Syk via its C- terminal SH2 domain and the two proteins can cooperatively activate NFAT activity in T cells by a mechanism that requires both the N-terminal pleckstrin homology and the C- terminal SH2 domains in Sh3bp2 (Deckert et al., 1998). Furthermore, it has been reported that Sh3bp2 can stimulate NFAT reporter activity in cooperation with the Syk kinase substrate Vav in B cells (Foucault et al., 2005).
  • Sh3bp2 may be a threshold-setting adapter in a Syk-containing protein complex in osteoclastic progenitors (Figure 1 IG), and cherubism mutations, all located in a small region upstream of the SH2 domain (Deckert et al., 1998; Ueki et al., 2001), may enhance the ability of Sh3bp2 to stimulate phosphorylation of Syk Y346.
  • Sh3bp2 when overexpressed with Syk in 293T cells, can be immunoisolated as a component of a Syk-containing complex.
  • This inhibitor prevents multinucleation of TRAP-positive cells in wild-type cultures at a concentration where heterozygous mutant cells are still able to form large multinucleated osteoclasts (Figure 9F). It is consistent with reports that Syk deficient bone marrow-derived cells exhibit impaired multinucleation and spreading in the presence of M-CSF and RANKL (Faccio et al., 2003; Mocsai et al., 2004) as well as the role of Syk kinase as an upstream regulator of the guanine nucleotide exchange protein Vav3 in osteoclasts (Faccio et al., 2005).
  • TNF- ⁇ induces RANKL expression in bone marrow stromal cells and stimulates formation of CDl lb-positive osteoclastic progenitors (Kitaura et al., 2005; Li et al., 2004; Yao et al., 2006).
  • ERK kinase Activation of ERK kinase is known to result in induction of TNF- ⁇ (Dumitru et al., 2000). Sustained phosphorylation of ERK 1/2 in mutant Sh3bp2 marrow cells suggests that induction of TNF- ⁇ may be a consequence of enhanced ERK 1/2 signaling. Since TNF- ⁇ stimulation can also result in ERK 1/2 activation (Eliopoulos et al., 2006), the high levels of ERK 1/2 and sustained levels of ERK 1/2 phosphorylation in homozygous marrow cells exposed to M-CSF are likely maintained through a positive autocrine feed-back loop.
  • TNF- ⁇ in M-CSF stimulated myeloid cells is associated with increased levels of TNF- ⁇ transcripts.
  • the TNF- ⁇ gene promoter is known to contain several NF-kB-like motifs and these are thought to play a prominent role in TNF- ⁇ transcription (Shakhov et al., 1990) in primary macrophages.
  • addition of a cell-permeable NEMO binding domain peptide did not inhibit TNF- ⁇ production in wild-type and mutant bone marrow cells.
  • the MEK inhibitor the MEK inhibitor
  • Sh3bp2 can interact with 14-3-3 proteins and 14-3-3 proteins are known to bind to kinase suppressor of Ras (KSR) (Kolch, 2005), we have considered the possibility that the cherubism mutation may affect the binding of Sh3bp2 to 14-3-3 proteins and that this could result in enhanced ERK 1/2 activation.
  • KSR kinase suppressor of Ras
  • Miah et al. (2004) have reported that mutant Sh3bp2 proteins fail to bind to 14-3-3 when overexpressed in COS-7 cells.
  • Myeloid cell-dependent disorders The transfer of the mutant phenotype to recipient mice through transplantation of fetal liver cells from homozygous mutants indicates that cherubism is a hematopoietic disorder.
  • the contribution of lymphoid cell abnormalities to the disorder in mice is negligible since crossing the Sh3bp2 homozygous mutants with Ragl-/- mice did not affect bone loss, enhanced osteoclastogenesis, macrophage tissue infiltration and the high serum levels of TNF- ⁇ .
  • the phenotype is therefore primarily a consequence of abnormal myeloid cell function. In heterozygous mutants these abnormalities result in trabecular bone loss associated with increased numbers of osteoclasts. Histomorphometry also shows an increase in osteoblast numbers (Figure 5E).
  • TNF- ⁇ stimulates M-CSF production by bone marrow stromal cells in an IL-I -dependent manner and this, in turn, results in an increase in osteoclastic progenitors in bone marrow (Kitaura et al., 2005; Wei et al., 2005). This effect of TNF- ⁇ may explain our finding of increased numbers of CDl Ib- positive cells in bone marrow of homozygous mutant mice.
  • VEGF is a strong candidate as a factor that substitutes for loss of M-CSF function in op/op mice (Niida et al., 1999; Niida et al., 2005).
  • Cecchini M. G., Dominguez, M. G., Mocci, S., Wetterwald, A., Felix, R., Fleisch, H.,
  • TNF- alpha induction by LPS is regulated posttranscriptionally via a Tpl2/ERK-dependent pathway.
  • Adaptor protein 3BP2 is a potential ligand of Src homology 2 and 3 domains of Lyn protein-tyrosine kinase. J Biol Chem 278, 24912-24920. Mangion, J., Rahman, N., Edkins, S., Barfoot, R., Nguyen, T., NASAdsson, A., Townend, J. V., Fitzpatrick, D. R., Flanagan, A. M., and Stratton, M. R. (1999). The gene for cherubism maps to chromosome 4pl6.3. Am. J. Hum. Genet. 65, 151-157.
  • Vascular endothelial growth factor can substitute for macrophage colony-stimulating factor in the support of osteoclastic bone resorption. J Exp Med 190, 293-298.
  • VEGF receptor 1 signaling is essential for osteoclast development and bone marrow formation in colony-stimulating factor 1 -deficient mice. Proc Natl Acad Sci U S A 102, 14016-14021. Parfitt, A. M., Drezner, M. K., Glorieux, F. H., Kanis, J. A., Malluche, H., Meunier, P. J., Ott, S. M., and Recker, R. R. (1987). Bone histomorphometry: standardization of nomenclature, symbols, and units. Report of the ASBMR Histomorphometry Nomenclature Committee. J Bone Miner Res 2, 595-610. Pixley, F. J., and Stanley, E. R. (2004). CSF-I regulation of the wandering macrophage: complexity in action. Trends Cell Biol 14, 628-638.
  • Osteoclasts are essential for TNF-alpha- mediated joint destruction. J Clin Invest 110, 1419-1427.
  • the adaptor protein 3BP2 binds human CD244 and links this receptor to Vav signaling, ERK activation, and NK cell killing. J Immunol 175, 4226-4235.
  • Kappa B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor alpha gene in primary macrophages. J Exp Med 171,
  • Tnf increases circulating osteoclast precursor numbers by promoting their proliferation and differentiation in the bone marrow through up-regulation of c-fms expression. J. Biol. Chem. published online ahead of print Feburary 6, 2006.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne une composition pharmaceutique contenant un inhibiteur de Sh3bp2. La composition est formulée pour l'administrer aux mammifère dont les êtres humains, et utile pour inhiber la production d'une cytokine pro-inflammatoire, par exemple TNF-a, inhibant ainsi l'affection inflammatoire chez ledit mammifère. L'invention décrit également un procédé pour inhiber une perte osseuse en administrant un inhibiteur de Sh3bp2.
PCT/US2007/021725 2006-10-10 2007-10-10 Troubles de résorption osseuse WO2008048466A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US85092906P 2006-10-10 2006-10-10
US60/850,929 2006-10-10
US88035207P 2007-01-12 2007-01-12
US60/880,352 2007-01-12

Publications (2)

Publication Number Publication Date
WO2008048466A2 true WO2008048466A2 (fr) 2008-04-24
WO2008048466A3 WO2008048466A3 (fr) 2008-12-11

Family

ID=39314596

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/021725 WO2008048466A2 (fr) 2006-10-10 2007-10-10 Troubles de résorption osseuse

Country Status (1)

Country Link
WO (1) WO2008048466A2 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005076939A2 (fr) * 2004-02-09 2005-08-25 University Of Kentucky Research Foundation Test et procede de diagnostic et de traitement de la maladie d'alzheimer
US20060019248A1 (en) * 2001-02-02 2006-01-26 Valdenize Tiziani Mutant sh-3 binding protein compositions and methods

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060019248A1 (en) * 2001-02-02 2006-01-26 Valdenize Tiziani Mutant sh-3 binding protein compositions and methods
WO2005076939A2 (fr) * 2004-02-09 2005-08-25 University Of Kentucky Research Foundation Test et procede de diagnostic et de traitement de la maladie d'alzheimer

Also Published As

Publication number Publication date
WO2008048466A3 (fr) 2008-12-11

Similar Documents

Publication Publication Date Title
Ueki et al. Increased myeloid cell responses to M-CSF and RANKL cause bone loss and inflammation in SH3BP2 “cherubism” mice
Aliprantis et al. NFATc1 in mice represses osteoprotegerin during osteoclastogenesis and dissociates systemic osteopenia from inflammation in cherubism
Kekow et al. Modulation of the gene expression pattern in peripheral blood mononuclear cells by biologicals in rheumatoid arthritis
US20150352131A1 (en) Compositions and Methods for the Prevention and Treatment of Osteolysis and Osteoporosis
US20040115195A1 (en) Pharmaceutical compositions and methods of using secreted frizzled related protein
WO2008048466A2 (fr) Troubles de résorption osseuse
주지웅 Characterization of spontaneous osteopetrosis models on RANKL-dysfunctional mice
Skapenko et al. The Th2 cytokines IL-4 and IL-10 are internal controllers of human Th1-biased immunity in vivo
Yudoh et al. Oxidative stress induces chondrocyte telomere instability and chondrocyte dysfunctions in osteoarthritis
Kusunoki et al. Triptolide, an active compound identified in a traditional Chinese herb, induces apoptosis of rheumatoid synovial fibroblasts
Lu et al. Identification of kinectin as a novel Behcet's disease-related autoantigen
Reboul et al. Hepatocyte growth factor in osteoarthritis: when bone and cartilage decide to have a chat
Dahlberg et al. Exercise: medicine for knee cartilage?
Men Paternal Skeletal Size Predicts Neonatal Bone Mineral Accrual. NCW
Nishida et al. The role of IL-4 in the control of mechanical stress-induced inflammatory mediators by rat chondrocytes
Sfikakis et al. Infliximab for severe ocular inflammation in patients with Behcet's disease
Burkhardt et al. Antileukoproteinase: modulation of neutrophil function and therapeutic effects in anticollagen II antibody-induced arthritis
Kim et al. Overexpression of developmentally regulated GTP-binding protein 2 (DRG2) increases bone loss 2
Amano et al. Synoviolin as a novel pathogenic factor for arthropathy
Kurowska-Stolarska et al. IL-15 and its role in rheumatoid arthritis
Sun et al. Skewed T-cell receptor BV14 and BV16 expression, and shared complementarity-determining region 3 sequence and common sequence motifs in synovial T cells of rheumatoid arthritis
Shen et al. OLF1/EBF-associated zinc finger protein gene: a novel lupus susceptibility locus on chromosome 16q identified in a Chinese cohort
Boissier et al. TNF-alpha blockade by nonviral gene therapy in collagen-induced arthritis
Rischmueller Humoral, hormonal and genetic determinants of cholinergic dysfunction in Sjögren's syndrome
Fischer et al. Transplant-tolerance induction by CTLA-4Ig in liver-transplanted rats: a lesson for the treatment of autoimmune diseases?

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07861392

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07861392

Country of ref document: EP

Kind code of ref document: A2