WO2008039257A2 - Polymorphismes nucléotidiques simples et leur utilisation dans la sélection du bétail laitier - Google Patents

Polymorphismes nucléotidiques simples et leur utilisation dans la sélection du bétail laitier Download PDF

Info

Publication number
WO2008039257A2
WO2008039257A2 PCT/US2007/015136 US2007015136W WO2008039257A2 WO 2008039257 A2 WO2008039257 A2 WO 2008039257A2 US 2007015136 W US2007015136 W US 2007015136W WO 2008039257 A2 WO2008039257 A2 WO 2008039257A2
Authority
WO
WIPO (PCT)
Prior art keywords
adrb2
animal
allelic
group
locus
Prior art date
Application number
PCT/US2007/015136
Other languages
English (en)
Other versions
WO2008039257A3 (fr
WO2008039257A8 (fr
Inventor
Fengxing Du
Michael Grosz
Michael Lohuis
Natascha Vukasinovic
Robert J. Collier
Original Assignee
Monsanto Technology Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Monsanto Technology Llc filed Critical Monsanto Technology Llc
Publication of WO2008039257A2 publication Critical patent/WO2008039257A2/fr
Publication of WO2008039257A8 publication Critical patent/WO2008039257A8/fr
Publication of WO2008039257A3 publication Critical patent/WO2008039257A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • a sequence listing is contained in the file named "ADRB2 Seq Listing.ST25.txt" which is 4096 bytes (4.00 kilobytes) (measured in MS-Windows XP) and was created on June 28, 2007 and is located in computer readable form on a compact disc (in accordance with 37 C.F.R. ⁇ 1. 52(e) and 37 C.F.R. ⁇ 1. 1.821) is enclosed herewith and incorporated herein by reference.
  • the invention relates to the field of Animal genomics. More particularly it relates to the field of dairy cattle selection and the improvement of milk production.
  • ADRB2 bovine beta2-adrenergic receptor
  • Various embodiments of the present invention provide methods and products for improving milking characteristics in dairy animals. Certain embodiments of the invention provide for methods of selecting animals for breeding so as to improve milking characteristics. According to some of these embodiments at least one animal being considered as a potential sire or dam is evaluated for its allelic composition at one or more loci. According to preferred aspects of this embodiment genetic samples from one or more animals are analyzed for the allelic composition at one or more loci or single nucleotide polymorphism (SNP) within the beta2-adrenergic receptor (ADRB2) gene.
  • SNP single nucleotide polymorphism
  • the sire or dam is either selected as more favorable for use to enhance the milking characteristics of its progeny or it is determined to have genetics considered less favorable. Accordingly, the animal is either selected, or not, to act as a sire or dam to serve as the parent of an animal with genetics providing improved milking characteristics.
  • Other embodiments of the invention provide methods for breeding an animal to improve milking characteristics by selecting at least one potential parent animal based on its having a favorable allelic composition at a particular locus and then breeding the animal to produce offspring.
  • the instant invention also provides methods and kits for the detection of allelic variations, including SNPs, that are associated with improved milking characteristics and/or increased net merit.
  • Certain embodiments of the instant invention further provide methods for detecting and/or identifying allelic variations including SNPs that are in linkage disequilibrium and/or allelic association with the SNPs specifically recited herein.
  • allelic association preferably means: nonrandom deviation of f(AiB j ) from the product of f(Aj) and f(B j ), which is specifically defined by r 2 >0.2, where r 2 is measured from a reasonably large animal sample (e.g., >100) and defined as
  • allelic composition is preferably used to describe the complement of alleles or genotype of an animal at a particular locus.
  • an animal may be either homozygous for the "A” or the "C” allele or it may be heterozygous for the Al 1C allele (this is the animal's allelic composition at that locus).
  • linkage disequilibrium preferably means allelic association wherein Ai and Bi are present on the same chromosome.
  • milking characteristics includes phenotypic traits associated with milk production. These include but are not limited to milk composition (including fat yield, fat percentage, protein yield, and protein percent), milk yield, milking rate, somatic cell score, mastitis resistance, productive longevity, daughter pregnancy rate, and indices derived from at least one trait from this list (such as net merit, fluid merit and cheese merit).
  • milk production preferably refers to: the volume of milk produced, the composition of the milk produced (which includes but is not limited to the fat content, the protein content, and the somatic cell count) and milking rate.
  • milking rate preferably refers to the speed at which milk is delivered through the teat.
  • net merit preferably means an index derived from component measurements of cow phenotypes, including milk production and composition, productive life, somatic cell score, size, udder conformation, and feet and legs score.
  • kits and methods that detect polymorphisms in the bovine genome that are associated with desirable traits. Certain aspects of this embodiment of the invention provide for polymorphisms that are associated with improved milking characteristics and increase net merit of the animals possessing them. Particular aspects of this embodiment of the invention provide kits and methods for detecting variant allelic composition, especially single nucleotide polymorphisms at positions in and around the bovine beta-2-adrenergic receptor (ADRB2) gene. More particularly, the kits and methods provide various means to detect allelic variation at Single Nucleotide Polymorphic loci (SNPs). The methods include, but not limited to direct sequencing, primer extension, PCR-RFLP, and allele-specific hybridization.
  • SNPs Single Nucleotide Polymorphic loci
  • DNA sequence for ADRB2 is available from the Genbank public DNA sequence database, accession numbers Z86037 (Einspanier et al., 1997) and AF331034 (Schimpf et al., 2001). Schimpf et al., further describe 2 sequence polymorphisms within the bovine ADRB2 gene, including the polymorphism defined as +1 143 (G/T) below.
  • This invention also provides for any kit(s) and kit components to be used to identify allelic composition at the loci described herein. [0024] More specific aspects of these embodiments of the invention provide for the detection of polymorphic nucleotides (and component alleles) identified as part of the instant invention.
  • kits and methods useful to identify SNPs at one or more of the following base pair locations base-pair location is recited relative to the adenine nucleotide within the start methionine codon of the ADRB2 protein: -732 (AfT), -558 (A/C), -529 (CTT), -408 (AJC), -390 (AfT), -184 (A/C), -85 (A/G), +1 1 (A/C), +41 (C/T), +129 (CfT), +468 (AJG), +957 (CVT), +1027 (CfT), +1 143 (GfT), + 121 1 (C/T), +1251 (AJG), +2266 (AJC), +2345 (AJG), +2408 (AfT), and +2417 (GfT); or any subset thereof.
  • Preferred embodiments of the invention provide methods for selecting animals as part of a breeding program that comprise evaluating the allelic composition of at least one parent animal at one or more loci.
  • the allelic composition for multiple animals is evaluated. Even more preferably multiple animals are evaluated with respect to multiple loci.
  • one or more potential parent animals are evaluated for their allelic composition at one or more locus that comprises a SNP. Once their allelic composition is evaluated, one or more animals having the desired allelic composition may be selected as a potential parent animal.
  • various aspects of this embodiment of the invention provide for either breeding at least one animal, based on its allelic composition or, alternatively, selecting the animal as not suitable for breeding based on its allelic composition.
  • the loci evaluated are selected from the group of SNPs within or near the ADRB2 gene that consists of A-732T, A-558C, C-529T, A-408C, A-390T, A-184C, A-85G, C41T, C129T, A468G, C957T, C1027T, G1 143T, Cl 21 IT, A 125 IG, A2266C, A2345G, A2408T, and G2417T; or any subset thereof.
  • one or more SNPs are selected from the group consisting of A-408C, C41T, A468G, and C1027T.
  • Other embodiments of the invention provide methods for breeding animals, where the method comprises selecting whether or not at least one potential parent animal is used as a parent based on its allelic composition at one or more loci. Preferably, this selection is made for multiple animals and most preferably the selection is made for the majority of animals within a particular animal population/herd. Even more preferably the selection(s) of the animal(s) is/are based on their allelic compositions at multiple loci. In a particularly preferred aspect of this embodiment, one or more potential parent animals are selected for their allelic composition at one or more locus that comprises a SNP.
  • a suitable animal is selected (based on its allelic composition or, alternatively, selecting the animal as not suitable for breeding based on its allelic composition), it is then used in accordance with the breeding method. That is, animals having one or more desirable loci are used for breeding and those animals lacking desirable loci are not used for the breeding method.
  • the loci evaluated are selected from the group of SNPs within or near the ADRB2 gene that consists of A-732T, A-558C, C-529T, A-408C, A-390T, A-184C, A-85G, C41T, C129T, A468G, C957T, C1027T, Gl 143T, C 12 HT, A 125 IG, A2266C, A2345G, A2408T, and G2417T; or any subset thereof.
  • one or more SNPs are selected from the group consisting of A-408C, C41T, A468G, and C1027T.
  • kits comprising reagents for detecting one or more allelic variations.
  • Preferred aspects of this embodiment of the invention provide kits for detecting one or more single nucleotide polymorphisms within or near the beta2-adrenergic receptor (ADRB2) gene.
  • ADRB2 beta2-adrenergic receptor
  • the kit contains the reagents necessary to detect one or more of SNPs from the group consisting of A-732T, A-558C, C-529T, A-408C, A-390T, A-184C, A-85G, C41T, C129T, A468G, C957T, C1027T, G1 143T, C121 1T, A 125 IG, A2266C, A2345G, A2408T, and G2417T; or any subset thereof.
  • one or more SNPs are selected from the group consisting of A-408C, C41T, A468G, and C1027T.
  • Additional embodiments of the invention provide methods for detecting one or more allelic variations, including single nucleotide polymorphisms.
  • Various aspects of this embodiment of the invention provide for determining the allelic composition of one or more animal(s), each at one or more loci.
  • Preferred aspects of this embodiment of the invention provide for determining each of one or more animal's allelic composition for at least one locus in the ADRB2 gene.
  • the animal(s) allelic composition is determined for one or more SNPs selected from the group consisting of A-732T, A-558C, C-529T, A-408C, A-390T, A-184C, A-85G, C41T, C129T, A468G, C957T, C1027T, G1 143T, C 121 IT, Al 25 IG, A2266C, A2345G, A2408T, and G2417T; or any subset thereof.
  • one or more SNPs are selected from the group consisting of A-408C, C41T, A468G, and C1027T.
  • loci having allelic variations that are in allelic association with one or more of the SNPs selected from the group consisting of A-732T, A-558C, C-529T, A-408C, A-390T, A-184C, A-85G, C41T, C129T, A468G, C957T, C1027T, G1 143T, C121 IT, A 125 IG, A2266C, A2345G, A2408T, and G2417T.
  • the loci having allelic variations comprise SNPs.
  • the identified allelic variations are in linkage disequilibrium with one or more of the group of SNPs listed above.
  • Various aspects of these embodiments of the invention include (but are not limited to) identifying sequence in proximity to the bovine ADRB2 gene either through de novo sequencing or by accessing public sequence databases (hereafter referred to as "target regions").
  • target regions refers to any chromosomal distance over which linkage disequilibrium may exist, preferably up to 5 cM or (5 million base pairs).
  • Factors influencing linkage disequilibrium vary between populations and include effective population size, mating structure, generation interval, ancestry, and other factors.
  • a panel of animals is screened to determine the sequence of their genomes in the areas corresponding to the target regions.
  • the data generated from this screening is then analyzed to identify any single nucleotide polymorphisms (SNPs) present therein.
  • SNPs single nucleotide polymorphisms
  • the nature of any/all of the above listed ADRB2 allelic variants is also determined for each of these animals.
  • the SNP data is analyzed with respect to each newly identified SNP to determine which of the newly identified SNPs is in linkage disequilibrium/allelic association with any above listed ADRB2 polymorphisms.
  • the ADRB2 gene is from a species used to produce milk commercially.
  • the milk producing species is bovine.
  • the methods, and kits of the present invention may be used as part of a breeding program to increase, within an animal population, the frequency of genetic markers for one or more trait(s) associated with increased economic value in a dairy animal.
  • traits include, but are not limited to improved milk composition (including increased fat yield and/or fat percentage, and/or increased protein yield or protein percent), increased milk yield, increased milking rate, lowered somatic cell score, increased mastitis resistance, greater productive longevity, increased daughter pregnancy rate, and indices derived from at least one trait from this list (such as net merit, fluid merit and cheese merit).
  • Other embodiments of the current invention provide markers and methods that may be used to identify subsets of animals, or individual animals for forensic purposes and for identifying DNA fingerprints for animals.
  • Various embodiments of this application of the invention provide methods for proving that two samples were not derived from the same animal, or concluding that the probability of two samples containing the same allelic content at multiple loci is sufficiently low as to warrant a conclusion that the two samples must be derived from the same source.
  • subset refers to any population of animals that have a common distinguishable characteristic, such as genotype for at least one of the ADRB2 SNPs listed above.
  • Additional embodiments of the invention provide methods for the testing and selection of animals for breeding and for alternative management practices based on assay results.
  • Various aspects of these embodiments of the invention provide methods for managing milking speed, somatic cell score (SCS), and mastitis susceptibility.
  • SCS somatic cell score
  • Other embodiments of the present invention provide methods and tests improving milking characteristics for individual animals and animal populations as a group by selecting animals with favorable phenotypes for milking speed, SCS, and mastitis resistance.
  • One benefit of this technology would be to reduce power consumption and labor costs per cow pound or kilogram of milk produced by reducing the amount of time required to milk the animal.
  • Other embodiments of the invention provide methods for identifying allelic variation, including SNPs that are in linkage disequilibrium and/or allelic association with the specific loci described herein. Aspects of these methods may include (but are not limited to) identifying sequence in proximity to the bovine ADRB2 gene either through de novo sequencing or by accessing public sequence databases ("target regions"). Once one or more target regions are identified a panel of animals is screened to determine the sequence of their genomes in the areas corresponding to the target regions. The data generated from this screening is then analyzed to identify any single nucleotide polymorphisms (SNPs) present therein. The nature of any/all of the above listed ADRB2 allelic variants is also determined for each of these animals. Finally, the SNP data is analyzed with respect to each newly identified SNP to determine which of the newly identified SNPs is in linkage disequilibrium/allelic association with any above listed ADRB2 polymorphisms.
  • SNPs single nucleotide polymorphisms
  • DNA samples were obtained and assayed, and genotypic data were analyzed.
  • the genotypic results indicate: (a) a statistically significant association (p ⁇ 0.05) between C41T and Milking Speed and between A468G and Milking Speed; (b) a statistically suggestive association (p ⁇ 0.10) between C41T and Somatic Cell Score, and milk, fat, and protein yield; and (c) a suggestive association of A-408C genotypes and protein yield.
  • Genotypes at 4 loci were used in analysis. Genotypes on C1027T were not included because all animals in the data had the same homozygous genotype. Data were analyzed using the following models:
  • Equation 2b y lk - ⁇ + G 1 + e lk
  • y tJ (y uk ) is a proof (PTA) of bull k with genotype /
  • G, (G 1111 ) is the fixed effect of genotype i (at locus m)
  • S j (S J ) is the fixed (random) effect of sire/ ⁇ 7 is the random animal effect with mean 0 and variance Ac? a
  • e, k (e tj ⁇ ) is the random residual term.
  • part a) included fitting all 4 genotypes simultaneously.
  • genotypes were fitted one at a time.
  • Models 2-4 were run using SAS software (SAS, 1999-2001 ).
  • Model 5 was run using ASReml software (Gilmour et al., 2002), considering complete available pedigree information (bulls, sires, dams, and MGS - 1496 animals in total). Analyses were run separately for each trait.
  • AI lC 1.64 0.195 n.s. 1.61 0.201 n.s.
  • AI lC 1.22 0.543 n.s. 1.69 0.430 n.s.
  • AI lC 0.93 0.397 n.s. 1.84 0.160 n.s.
  • Model 1 The results of Model 1 (without sire effect) indicated significant association between genotype at locus AI l C and SCS, milk and protein yield, and fat%. However, this genotype effect was no longer significant when sire or animal effect was included in the model, indicating possible confounding between sire and genotype effect. Conversely, when random sire effect was included in the model, genotype at locus C41T showed marginal evidence of association with SCS in the joint analysis (in models that included the genotypes of the other 3 loci). This indicates possible interactions between the C41T locus and other loci in the model (interactions among loci were not explicitly tested in this analysis).
  • Results from the MS analyses revealed significant effect of both C41T and A486G genotypes when sire or animal effect was included in the model and the genotype effect is fitted separately for each locus.
  • all loci were analyzed simultaneously, only C41T locus was marginally significant; indicating tight linkage between C41T and A486G loci - i.e., when one of these loci was included in the model, including the other one did not significantly improve the model.
  • a large population (approximately 3400 animals) was used to identify marker associations between four ADRB2 SNPs and milk related traits. Semen samples were purchased from various sources, including Select Sires (www.selectsires.com) and ABS (www.absglobal.com). DNA from the semen samples was extracted. Samples were then genotyped for the four ADRB2 SNPs, namely A-408C, Al 1C, C41T, and A468G.
  • y, (y, j ) is the PTA of the i lh bull of the whole sample (PTA of the j th son of the i th sire); s, is the effect of the i th sire; x, (x, j ) is the number of a specific SNP allele that of the i lh bull of the whole sample (the j th son of the i th sire) has, and ⁇ 2 is the regression coefficient for x, (x, j ); (SPTA), is the sire's PTA of the i th bull of the whole sample; ⁇ is the mean; e, (e, j ) is the residual effect; and I, k (I, jk ) is the indicator variable defined as
  • genotype 1 and 3 are the two homozygous genotypes of two SNP alleles, and 2 is the heterozygous genotype.
  • the analyses were performed using SAS PROC GLM procedure, and the p value was estimated using the SAS Type I sum squares.
  • x, (x y ) is equal to the number of allele "G", "A", "C”, and "A”, respectively.
  • Equations [6] and [7] were referred as "Model 1"; and equations [8] and [9] were referred as "Model 2" in Table 5 .
  • Equations [6] and [81 are genotype models where genotypes were fitted as fixed effects; whereas, equations [71 and [9] are additive models where no dominance was assumed.
  • SNPs Al 1C, C41T, and A468G
  • A-408C the SNP with the broadest range of marker-trait associations resides 408 bases upstream to the mRNA transcription start site, in a region highly conserved with the human DNA sequence (which implies functionality) and that is predicted to be a transcriptional promoter (potentially regulating gene expression).
  • the A-408C SNP exists within an important regulatory element known as an SV40 EARLY-SEQl element (Fromm and Berg, 1982; Byrne et al., 1983).
  • the predominant (and negative) allele of this SNP is "C", which creates an element of TCCCGCCC (SEQ ID NO:2) (consistent); whereas the more rare (and advantageous) allele of this SNP is A, which creates an element of TACCGCC (SEQ ID NO:3), which is inconsistent with the published promoter element.
  • the published sequence indicates the presence of a guanidine ("G") at position 468, whereas the variant identified as part of instant invention has an adenine ("A") at that position.
  • substitution of A for G at position 468 alters the amino acid sequence of the ADRB2 protein by replacing methionine residue with an isoleucine residue at amino acid position 156 of the protein.
  • PCR- RFLP Polymerase Chain Reaction-Restriction Fragment Length Polymorphism
  • the assay is based on the presence or absence of the Fokl restriction enzyme recognition site GGATG (SEQ ID NO:6) in DNA fragments amplified by primer pair A468GF and A468GR (defined below). Use of these exact primers will introduce the restriction site through site-specific mutagenesis.
  • the A allele at the A468G locus changes this sequence to GGATA (SEQ ID NO:7), which is not recognized, and therefore not digested, by Fokl.
  • oligonucleotide primers were used to amplify and sequence the ADRB2 gene and adjacent DNA from bovine genomic sequence.
  • ADRB2-A1F AGGGCACCAAAAGTACTGGA (SEQ ID NO:8)
  • ADRB2-A1R GCGAGCTTACCAGCCAACTA SEQ ID NO:9
  • ADRB2-C1F TGGAACTGGCTGAACTGACA (SEQIDNO:12)
  • ADRB2-D1F TGGAACTGGCTGAACTGACA (SEQ ID NO: 14)
  • ADRB2-E1F ATTGTGCACGTGATCAAGGA (SEQIDNO:16)
  • ADRB2-G1F AACCCCTTGACTGGAGTGTG (SEQ ID NO:20)
  • ADRB2-G1R TTCTCTGGCTGAAAATGTTA (SEQIDNO:21) repAllCF AGGTCCGCTCGCTGAGG (SEQ ID NO:22) repAllCR GTTCCAGCGTGACGTTTTG (SEQ ID NO:23)
  • sequence detection methodologies including (but not limited to) identifying sequence either through random de novo sequencing or by accessing public sequence databases. Once one or more target regions are identified a panel of animals is screened to determine the sequence of their genomes in the areas corresponding to the target regions. The sequence data generated from this screening is then aligned and analyzed to identify any single nucleotide polymorphisms (SNPs) present therein.
  • SNPs single nucleotide polymorphisms
  • Such polymorphisms may be expressed as one or more individuals being heterozygous (showing roughly equal peak intensity for each of two base pairs) and/or as two or more animals showing alternate homozygote genotypes (for example, one sample containing only the A allele while another samples only shows the G allele).
  • Boettcher PJ Dekkers JC, Kolstad BW. 1998. Development of an udder health index for sire selection based on somatic cell score, udder conformation, and milking speed. J Dairy Sci 81(4): 1 157-1 168.
  • Valero FY Kobayashi Y, Hoeffer Jr. CA, Collier RJ. 2002. Relationship of Adrenergic receptor mRNA to Milking Rate in Dairy Cows. Proceedings of Plant and Animal Genome X, San Diego, CA, USA.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des polymorphismes nucléotidiques simples et leur utilisation dans la sélection du bétail laitier. Des modes de réalisation de la présente invention concernent des procédés et des coffrets pour aider la sélection d'animaux parents laitiers de façon à introduire et à améliorer plus rapidement des caractéristiques en relation avec le lait souhaitables. Des aspects préférés de l'invention se rapportent à l'utilisation d'une composition allélique d'un ou plusieurs animaux pour un ou plusieurs loci dans le récepteur adrénergique bêta-2 pour aider à déterminer la façon d'utiliser les animaux dans un programme d'amélioration génétique de façon à améliorer de la façon la plus efficace la valeur économique de la progéniture, en particulier par rapport à la production de lait.
PCT/US2007/015136 2006-06-13 2007-06-28 Polymorphismes nucléotidiques simples et leur utilisation dans la sélection du bétail laitier WO2008039257A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US81308806P 2006-06-13 2006-06-13
US60/813,006 2006-06-13

Publications (3)

Publication Number Publication Date
WO2008039257A2 true WO2008039257A2 (fr) 2008-04-03
WO2008039257A8 WO2008039257A8 (fr) 2008-05-22
WO2008039257A3 WO2008039257A3 (fr) 2008-08-07

Family

ID=43020820

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/015136 WO2008039257A2 (fr) 2006-06-13 2007-06-28 Polymorphismes nucléotidiques simples et leur utilisation dans la sélection du bétail laitier

Country Status (1)

Country Link
WO (1) WO2008039257A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102899395A (zh) * 2012-06-20 2013-01-30 山东省农业科学院奶牛研究中心 一种改善奶牛的抗乳腺炎能力的实现方法及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040076977A1 (en) * 2000-10-31 2004-04-22 Georges Michel Alphonse Julien Marker assisted selection of bovine for improved milk production using diacylglycerol acyltransferase gene dgat1

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040076977A1 (en) * 2000-10-31 2004-04-22 Georges Michel Alphonse Julien Marker assisted selection of bovine for improved milk production using diacylglycerol acyltransferase gene dgat1

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SCHIMPF ET AL.: 'Genetic mapping of the ADRB2 gene on cattle chromosome 7' ANIMAL GENETICS vol. 32, 2001, page 390 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102899395A (zh) * 2012-06-20 2013-01-30 山东省农业科学院奶牛研究中心 一种改善奶牛的抗乳腺炎能力的实现方法及其应用

Also Published As

Publication number Publication date
WO2008039257A3 (fr) 2008-08-07
WO2008039257A8 (fr) 2008-05-22

Similar Documents

Publication Publication Date Title
Ovilo et al. Fine mapping of porcine chromosome 6 QTL and LEPR effects on body composition in multiple generations of an Iberian by Landrace intercross
US20070105107A1 (en) Marker assisted best linear unbiased prediction (ma-blup): software adaptions for large breeding populations in farm animal species
US20110123983A1 (en) Methods of Using Genetic Markers and Related Epistatic Interactions
KR101929391B1 (ko) 돼지의 유두수 증대 예측용 유전자 마커 및 이의 용도
Ruan et al. Genetic variation at RYR1, IGF2, FUT1, MUC13, and KPL2 mutations affecting production traits in Chinese commercial pig breeds.
US20220389506A1 (en) Genetic test for liver copper accumulation in dogs
Alvarez et al. Influence of prion protein genotypes on milk production traits in Spanish Churra sheep
US20110054246A1 (en) Whole genome scan to discover quantitative trai loci (qtl) affecting growth, body composition, and reproduction in maternal pig lines
EP1651777B1 (fr) Utilisation de polymorphisme nucleotidique unique dans la region de codage du gene de recepteur de leptine porcin permettant d'augmenter la production en elevage porcin
Coddens et al. The possibility of positive selection for both F18+ Escherichia coli and stress resistant pigs opens new perspectives for pig breeding
US8003328B2 (en) Bovine polymorphisms and methods of predicting bovine traits
WO2009055805A2 (fr) Marqueurs génétiques et procédés permettant d'améliorer la génétique porcine
Schulman et al. Fine mapping of quantitative trait loci for mastitis resistance on bovine chromosome 11
WO2008039257A2 (fr) Polymorphismes nucléotidiques simples et leur utilisation dans la sélection du bétail laitier
JP2010533491A (ja) 乳生産動物および乳業産物のゲノムマーカー指数を改善する方法
CA2734364A1 (fr) Marqueur genique permettant d'evaluer le potentiel genetique de persillage chez les bovins et methode d'evaluation du potentiel genetique de persillage au moyen dudit marqueur
WO2008024227A2 (fr) Marqueurs génétiques et procédés permettant d'améliorer la génétique des porcs
Gharahkhani et al. Primary Lens Luxation in Australian Tenterfield and Miniature Bull Terriers is due to an old ADAMTS17 mutation and is an additive trait
Nikbakht Brujeni et al. Typing of Ovar-DRB1 second exon with PCR-RFLP technique in Iranian Shaul Sheep
CN113151509B (zh) 与鸡血清碱性磷酸酶水平相关的分子标记、检测引物、试剂盒及应用
AU2004276248A1 (en) Adrenergic receptor SNP for improved milking characteristics
US20070209084A1 (en) Adrenergic Receptor SNP for Improved Milking Characteristics
Sumreddee Assessment of inbreeding and inbreeding depression using runs of homozygosity
US20190226028A1 (en) Compositions and Methods for Determining Likelihood of an Increased Susceptibility to Contracting Johne's Disease
CN117660611A (zh) 一种鉴定奶牛产奶量、乳脂量和乳蛋白量的方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07861329

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

NENP Non-entry into the national phase in:

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 07861329

Country of ref document: EP

Kind code of ref document: A2