WO2008037432A2 - METHODS FOR DIAGNOSING METASTASIS BY ANALYZING MUTATIONS IN β-CATENIN - Google Patents

Abstract

Activation of the Wnt/β-catenin pathway is frequently observed in colorectal cancers. The inventors' aim was to elucidate the impact of gain-of-function β-catenin on the metastasisassociated gene S100A4 in human colon cancer cell lines and tumors.

Description

Methods for diagnosing metastasis by analyzing mutations in /3-catenin

Introduction

Colorectal carcinomas carry mutations in a variety of oncogenes and tumor suppressor genes, which contribute to the pathogenesis of the disease. An important signaling pathway in the etiology of colorectal cancer is Wnt//3-catenin, and over 90% of colorectal cancers bear mutations that result in the activation of this pathway.^1"6 Activating mutations in genes of the Wnt//3-catenin pathway are observed early in the development of colon carcinomas. Mutations that activate the Wnt//3-catenin pathway generally affect /3-catenin phosphorylation and stability.⁷ Phosphorylated /3-catenin is degraded via the ubiquitin pathway; in the absence of efficient degradation, /3-catenin accumulates, is transported to the nucleus, where it interacts with transcription factors of the TCF family to control gene transcription. ' Phosphorylation of /3-catenin is regulated in a protein complex that contains, in addition to /3-catenin, APC, the axins as well as serine/threonine kinases such as glycogen synthase kinase-3/3 and casein kinase I.¹⁰'^{1 1} Mutations that interfere with /3-catenin phosphorylation affect either the assembly of the phosphorylation complex or the phosphorylation sites of /3-catenin. Mutations that affect the APC gene, and thus the assembly of the phosphorylation complex, are the most frequent in colon cancer and are observed in 80% of the tumors.¹² Furthermore, 10% of colon cancers carry mutations in /3-catenin that delete or exchange serine and threonine residues at the positions 45, 41, 37 and 33, and such mutations are associated with aggressive tumor growth and poor prognosis.^13"18 Phosphorylation of /3-catenin at these sites facilitates binding of the β- TrCP ubiquitin ligase, ubiquitination and degradation of /3-catenin in the proteasome.¹⁹'²⁰

During further tumor progression, additional mutations accumulate which eventually result in development of malignant colon carcinomas. The mutations are observed mainly in K-ras, p53, Rb, and in genes that encode components of the TGF/3 signaling pathway.¹'⁶ The effect of such mutations on the control of the cell cycle and on proliferation has been extensively studied. Much less is known about mutations that contribute to the formation of metastases of colon cancer. Although mutations of components of the Wnt//3-catenin pathway generally occur early in colon cancer progression, accumulation of /3-catenin in the nucleus has been associated with late stages of tumor progression and the development of metastases.^21"23 The S100A4 gene (also known as metastasin, mtsl, FSPl, 18A2, pEL98, p9Ka, 42, A, CAPL, calvasculin) is a member of the multigene SlOO family of EF-hand, calcium-binding proteins; genes of this family are clustered on human chromosome one. High levels of S100A4 expression play an important role in metastasis and correlate with a negative prognosis in several types of cancer.^24"29 In human colorectal cancer, high expression levels of S100A4 correlate with aggressive tumor growth and poor prognosis.^30"33 Transfection experiments demonstrated that S100A4 conferred a metastatic phenotype on several cell types, whereas treatment with antisense-S100A4-oligonucleotides or specific ribozymes led to a decreased metastatic phenotype.³⁴'³⁵ Metastatic activity of S100A4 was also shown in transgenic mouse models that overexpress S100A4.³⁶'³⁷ Tumor development and metastasis formation were suppressed in S100A4-deficient mice.³⁸

The present invention in a first aspect thereof relates to a method for diagnosing metastasis of cancer, comprising analyzing a mutation at amino acid S³⁷ and/or amino acid S⁴⁵ of human β- catenin, or in a nucleic acid encoding for amino acid S³⁷ and/or amino acid S⁴⁵ of human β- catenin, or a homologous position in a human /3-catenin homolog, wherein a mutation in said at least on position is indicative for metastasis. Preferably, said cancer is a Wnt//3-catenin pathway mediated cancer.

In the context of the present invention, said cancer can be selected from colorectal cancer, hepatocellular carcinoma, lung cancer, prostate cancer, gastrointestinal tumors, ovarian tumors, and papillary thyroid cancer.

Preferably, said analysis according to the present invention comprises the use of /3-catenin specific antibodies, sequencing, hybridization and/or PCR. Preferably, said analysis according to the present invention is based on restriction fragment length polymorphism using restriction enzyme BsI I.

Preferred is a method according to the present invention, wherein said human /3-catenin homolog is selected from mouse, rat, pig, goat, cow, dog, cat, and monkey. Further preferred is a method according to the present invention, wherein said method is performed in vitro and/or in vivo. In a method according to the present invention, said mutation can be preferably selected from an in-frame deletion, a transition, a transversion, a phosphorylation inhibiting mutation, and a /3-catenin-accumulating mutation.

Another aspect of the method according to the present invention further comprises an analysis of nuclear /3-catenin localization and/or S100A4 expression. The context of the mutated /3- catenin with nuclear /3-catenin localization and/or S100A4 expression is explained herein. A most preferred method according to the present invention, further comprises an estimation of the risk for a metastasis of said cancer, based on said analysis.

Yet another aspect of the present invention relates to a method for the prevention and/or treatment of metastasis in cancer, comprising a method according to the present invention as above or below, and providing a respective treatment to the patient in need thereof. Preferably said treatment as provided comprises a radio- and/or chemotherapy.

Yet another aspect of the present invention relates to a method for screening for an agent for prevention and/or treatment of metastasis in cancer, comprising contacting a human /3-catenin polypeptide carrying a mutation at amino acid S³⁷ and/or amino acid S⁴⁵ or a homolog of a human /3-catenin with at least one potentially interacting compound, and measuring binding of said compound to said human /3-catenin. This method is suitable for the determination of compounds that can interact with the proteins of the present invention and to identify, for example, inhibitors, activators, competitors or modulators of proteins of the present invention, in particular inhibitors, activators, competitors or modulators of the activity of the proteins of the present invention on the expression of SlOO A4 (see also Figure 4).

The potentially binding substance, whose binding to the protein of the present invention is to be measured, can be any chemical substance or any mixture thereof. For example, it can be a substance of a peptide library, a combinatory library, a cell extract, in particular a plant cell extract, a "small molecular drug", a protein and/or a protein fragment.

The term "contacting" in the present invention means any interaction between the potentially binding substance(s) with the proteins of the invention, whereby any of the two components can be independently of each other in a liquid phase, for example in solution, or in suspension or c aann be bound to a solid phase, for example, in the form of an essentially planar surface or in the form of particles, pearls or the like. In a preferred embodiment a multitude of different potentially binding substances are immobilized on a solid surface like, for example, on a compound library chip and the protein of the present invention is subsequently contacted with such a chip.

The proteins of the present invention employed in a method of the present invention can be full length proteins or a fragments with N/C -terminal and/or internal deletions.

Measuring of binding of the compound to the protein can be carried out either by measuring a marker that can be attached either to the protein or to the potentially interacting compound. Suitable markers are known to someone of skill in the art and comprise, for example, fluorescence or radioactive markers. The binding of the two components can, however, also be measured by the change of an electrochemical parameter of the binding compound or of the protein, e.g. a change of the redox properties of either the protein or the binding compound, upon binding. Suitable methods of detecting such changes comprise, for example, potentiometric methods. Further methods for detecting and/or measuring the binding of the two components to each other are known in the art and can without limitation also be used to measure the binding of the potential interacting compound to the protein or protein fragments of the present invention. The effect of the binding of the compound or the activity of the protein can also be measured indirectly, for example, by assaying the activity of the protein on the expression of SlOO A4 after binding.

As a further step after measuring the binding of a potentially interacting compound and after having measured at least two different potentially interacting compounds at least one compound can be selected, for example, on grounds of the measured binding activity or on grounds of the detected increase or decrease of protein activity, in particular the activity of the protein on the expression of S100A4 upon binding.

The thus selected binding compound is then in a preferred embodiment modified in a further step. Modification can be effected by a variety of methods known in the art, which include without limitation the introduction of novel side chains or the exchange of functional groups like, for example, introduction of halogens, in particular F, Cl or Br, the introduction of lower alkyl groups, preferably having one to five carbon atoms like, for example, methyl, ethyl, n- propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl or iso-pentyl groups, lower alkenyl groups, preferably having two to five carbon atoms, lower alkynyl groups, preferably having two to five carbon atoms or through the introduction of, for example, a group selected from the group consisting of NH₂, NO₂, OH, SH, NH, CN, aryl, heteroaryl, COH or COOH group.

The thus modified binding substances are than individually tested with the method of the present invention, i.e. they are contacted with the protein and subsequently binding of the modified compounds to the protein is measured. In this step, both the binding per se can be measured and/or the effect of the function of the protein like, e.g. the activity of the protein on the expression of S100A4 can be measured. If needed the steps of selecting the binding compound, modifying the binding compound, contacting the binding compound with a protein of the invention and measuring the binding of the modified compounds to the protein can be repeated a third or any given number of times as required. The above described method is also termed "directed evolution" since it involves a multitude of steps including modification and selection, whereby binding compounds are selected in an "evolutionary" process optimizing its capabilities with respect to a particular property, e.g. its binding activity, its ability to activate, inhibit or modulate the activity, in particular the activity of the protein on the expression of S100A4.

In a further embodiment of the method of the present invention the interacting compound identified as outlined above, which may or may not have gone through additional rounds of modification and selection, is admixed with suitable auxiliary substances and/or additives. Such substances comprise pharmacological acceptable substances, which increase the stability, solubility, biocompatibility, or biological half-life of the interacting compound or comprise substances or materials, which have to be included for certain routs of application like, for example, intravenous solution, sprays, Band- Aids or pills.

Here the inventors demonstrate that /3-catenin signaling regulates the expression of the S100A4 gene. These studies began with microarray analyses of colon cancer cell lines that contain mutant or wild-type (wt) /3-catenin alleles. The inventors observed that activated (stabilized) β- catenin induced S100A4 expression. This correlated with an increased migration and invasion of the cultured cells, which was reverted by transfection of S100A4 siRNA or /3-catenin siRNA. Transfection of S100A4 cDNA led to increased motility. Furthermore, the inventors identified a functional TCF binding site in the S100A4 gene promoter, which is essential for activation of S100A4 gene expression. Moreover, the inventors demonstrated induction of in vivo metastasis by cells with gain-of- function /3-catenin and high S100A4 levels. The inventors investigated the relevance of S100A4 mRNA expression to clinical cancer with surgical samples of non-metastasized and metachronically metastasized primary colon carcinomas that demonstrate the potential value of S100A4 expression levels for prognosis of metastasis formation.

Gene expression profiling of colon cancer cells and of cells that lack /3-catenin revealed that expression of the S100A4 gene correlates with activation of /3-catenin. /3-Catenin mutation and/or high levels of S100A4 expression resulted in increased cell migration and invasion of extracellular matrix. A functional TCF binding site was identified in the S100A4 gene promoter, demonstrating that the /3-catenin/TCF pathway directly controls S100A4 expression. Furthermore, the effects of /3-catenin on migration and invasion required activation of the S100A4 gene, and could be reversed by the expression of siRNA against S100A4. Increased in vivo metastasis was observed following transplantation of mutant /3-catenin and high S100A4 expressing colon cancer cells. Finally, the inventors show that S100A4 mRNA expression is higher in metachronously metastasized primary tumors than in non-metastasized tumors, demonstrating a relevance of the inventors' findings for clinical cancer.

S100A4 was previously linked to metastasis in several experimental systems.^34"38'⁴⁹ For instance, antisense expression of S100A4 suppressed the metastatic potential of a lung carcinoma cell line and bile duct adenocarcinoma cell lines, as assessed by cell motility and their invasion of matrigel. The inventors observed here that S100A4 is an important regulator of cell migration and invasion in colon cancer cell lines. Mutations that affect the Wnt//3- catenin pathway are frequently observed in colon cancer, and are well known to affect gene expression. Genes that are directly regulated by the Wnt//3-catenin pathway in such tumors are for instance c-myc or cyclin D, well known to affect cell cycle progression and proliferation. Other target genes, like cryptic or EphB, have been identified, which might be important for normal epithelial architecture of the intestine, but might not contribute to tumor progression. Activation of the Wnt//3-catenin pathway can also result in changes in epithelial cell morphology, for instance epithelial-mesenchymal transition, and can activate migration and invasion.^50"53 The inventors show here that such effects on motility and invasion of /3- catenin/TCF signaling, at least in colon carcinoma cells, are mediated by activating the expression of S100A4. Currently, the molecular mechanism by which S100A4 affects cell migration and metastasis remains unclear. S100A4 can bind, in a Ca²⁺-dependent manner, to F- actin, tropomyosin, the heavy chain of non-muscle myosin-II or tubulin, and such interactions with cytoskeletal proteins might contribute to the effects of SlOO A4 on cell motility.^{reviewed in 29} S100A4 has also been identified as an interaction partner of liprin-bl, which in turn can bind the transmembrane phosphotyrosine phosphatase LAR (leukocyte common antigen related).⁵⁴ LAR forms a complex with Trio, a protein with Rac- and Rho-specific GEF domains, which are well known regulators of cell motility and cell shape.⁵⁵ Interactions with LAR might thus provide a molecular basis of the effects of SlOO A4 on cell motility and invasiveness.

In order to evaluate whether S100A4 is a direct or an indirect target of /3-catenin signaling, the inventors examined S100A4 promoter fragments. The inventors could define a specific sequence in the 5 '-untranslated sequence of the S100A4 gene, which contains a TCF binding site and binds TCF in EMSA experiments. Furthermore, ChIP experiments demonstrated the presence of /3-catenin/TCF complexes in this promoter fragment. Expression of a reporter gene that was driven by S100A4 promoter fragments was dependent on two prerequisites: the presence of the TCF binding site, and the availability of /3-catenin. Both Δ45- and Δ37-mutant /3-catenin rescued reporter expression. The inventors' data are in line with those of Usami et al., describing a relative TCF activity increase in transiently Ser37Cys-mutated /3-catenin transfected NCI-H28^nu11 cells.⁵⁶

Other signaling cascades can also impinge on the expression of S100A4. For instance, ErbB2 signals can activate S100A4 expression in medulloblastoma cell lines; for this effect, the activation of the PBK/ Akt and Erkl/2 signaling pathways is required, which is mediated by a specific response element in the S100A4 gene promoter.⁴⁴ Several signaling cascades can therefore contribute to the control of S100A4 gene expression, which might be used to a different extent in distinct types of tumors.

Metastatic activity of S 100 A4 was demonstrated in transgenic mouse models that overexpress S100A4. In such animal models, S100A4 expression has no effect on the tumor incidence, but acts co-operatively with tumor susceptibility genes or with ErbB2 to increase the incidence of metastatic tumors.³⁶'³⁷ The inventors also demonstrated increased in vivo metastasis following both intrasplenal as well as intracardiac transplantation of S100A4 overexpressing cells. However, in the inventors' models, high S100A4 expression was achieved by transfection of mutant /3-catenin. Recently, after transplantation of S100A4-positive tumor cells into S100A4- deficient mice, a reduction in tumor incidence but no metastasis were observed. These experiments indicate that S100A4 might not only act in a cell autonomous manner, but S100A4 expression in the tumor stroma cells might also contribute to the development of cancer.

The expression of S100A4 has been detected in various human tumors, for instance in breast, colorectal, gall bladder, bladder, esophageal, non-small-cell lung, gastric, medulloblastoma, pancreatic and hepatocellular cancers. High S100A4 levels had been repeatedly correlated with a reduced patient survival and poor prognosis.^{reviewed in 28} In colorectal cancer, S100A4 expression was found to be elevated during tumor progression; with increased levels in the primary colon cancer when compared to normal mucosa, and the expression was even further elevated in the liver metastases.³⁰'³¹'³³ Furthermore, the presence of S100A4 protein, as assessed by immunohistochemisty, was correlated with a significant decrease in the survival time.³² The inventors investigated the relevance of S100A4 to clinical cancer in a series of archival colon cancer specimens, which had not metastasized at the time of surgery. Remarkably, S100A4 mRNA levels were found to be higher in those primary tumors, which later developed distant metastases. Patients whose tumors were heterozygous for activating β- catenin mutation were identified, and the tumors showed both, nuclear /3-catenin staining and high S100A4 expression. All of these patients developed distant metastases in the liver. To the best of the inventors' knowledge, the inventors demonstrate for the first time that mRNA expression of S100A4, determined in primary tumors in a quantitative manner, is of value for the prediction of metastatic cancer.

The results presented here relate two previously unconnected molecular pathways which play important roles in tumor progression and metastasis, the /3-catenin/TCF signaling pathway and S100A4, that controls motility and invasiveness. The inventors' finding demonstrates that β- catenin/TCF directly regulates the expression of the S100A4, and that /3-catenin-induced effects on cell migration and invasion are mediated by S100A4 in colon cancer cells. New therapeutic strategies aimed at disrupting this regulation or the function of the S100A4 protein may be of particular value for prevention of colon cancer metastasis.

For the purposes of the present invention all references as cited herein are incorporated by reference in their entireties.

Figure legends Figure 1. S100A4 expression in colon cancer cells with mutant, wt or no /S-catenin

(A) PCR-based RFLP for mutant and wt /3-catenin; the mutant /3-catenin product (120 bp) is cut by BsI I, whereas the wt /3-catenin product (123 bp) is not. (B) Magnified sections of microarray analyses with reciprocal Cy5/Cy3 labeling (arrows indicate the S100A4 position), representing a 40-fold up-regulated S100A4 expression in HCTl 16 cells when compared to HAB-92^wt cells. (C,D) S100A4 expression; determined by quantitative real-time RT-PCR; values represent the ratios of S100A4 and G6PDH control mRNA (C, HCTl 16 cells: set 100%; D, vector-transfected HCTl 16 or HAB-68^mut cells, respectively: set 100%). C, high SlOO expression is demonstrated in mutant /3-catenin expressing cell lines, low S100A4 expression in cell lines with wt or no /3-catenin. D, transfection of dnTCF strongly reduced S100A4 expression in mutant /3-catenin expressing cell lines. Two experiments were averaged, each performed in duplicate. At the protein level, S100A4, /3-catenin, and /3-tubulin were determined by Western blot analysis. (E) S100A4 and /3-catenin were detected by immunofluorescence (bars, 50 Dm) and immunocytochemistry (bars, 20 Dm).

Figure 2. Cell migration and invasion depend on the /3-catenin genotype

(A) Cell migration assay; values represent the number of migrating cells (HCTl 16 cells: set 100%). Experiments were performed in triplicates. (B) Cell invasion assay; values represent the number of invading cells (HCTl 16 cells: set 100%). The average of triplicate experiments is plotted.

Figure 3. S100A4 cDNA induces cell migration and invasion in cells with wt or no /3- catenin

(A,D) S100A4 expression in HAB-92^wt and NCI-H28^nu" cells, both transfected with S100A4 cDNA; determined by quantitative real-time RT-PCR; values represent the ratios of S100A4 and G6PDH control mRNA (vector-transfected HAB-92^wt or NCI-H28^πu" cells, respectively: set 100%). Two experiments were averaged, each performed in duplicate. At the protein level, S100A4, /3-catenin, and /3-tubulin were determined by Western blot analysis. (B,E) Cell migration assay; values represent the number of migrating, S100A4 cDNA-transfected HAB- 92^ or NCI-H28^nu" cells (vector-transfected HAB-92^ or NCI-H28^nu11 cells, respectively: set 100%). Experiments were performed in triplicate. (C,F) Cell invasion assay; values represent the number of invading S100A4 cDNA-transfected HAB-92^wt or NCI-H28^nu" cells (vector- transfected HAB-92^wt or NCI-H28^nu" cells, respectively: set 100%). Experiments were performed in triplicate. Figure 4. /3-catenin siRNA knocks down S100A4 expression and blocks cell migration and invasion in HCTl 16 cells

(A) S100A4 expression in HCTl 16 cells following treatment with /3-catenin siRNA; determined by quantitative real-time RT-PCR; values represent the ratios of S100A4 and G6PDH control mRNA (HCTl 16 cells: set 100%). Two experiments were averaged, each performed in duplicate. Reduction of S100A4 expression by /3-catenin siRNA is shown. At the protein level, S100A4, /3-catenin and /3-tubulin were determined by Western blot analysis. (B) Cell migration assay for HCTl 16 cells, following treatment with /3-catenin siRNA; reduction of migration by S100A4 siRNA is shown. Values represent the number of migrating cells (HCTl 16 cells: set 100%). Experiments were performed in triplicate. (C) Cell invasion assay for HCTl 16 cells, following treatment with /3-catenin siRNA; reduction of invasion by /3- catenin siRNA is shown. Values represent the number of invading cells (HCTl 16 cells: set 100%). Experiments were performed in triplicate.

Figure 5. S100A4 siRNA knocks down S100A4 expression and blocks cell migration and invasion in NCI-H28""" cells, which were transfected with mutant or wt β-catenin

(A) PCR-based RFLP for wt and mutant /3-catenin in NCI-H28^nu" cells, transfected with wt /3- catenin, mutant /3-catenin, or both; the mutant /3-catenin product is cut by BsI I (fragments 72 and 48 bp), whereas the wt /3-catenin product (123 bp) is not. (B) S100A4 expression in wt or mutant, and in wt and mutant /3-catenin-transfected NCI-H28^nu" cells, respectively, following treatment with S100A4 siRNA; determined by quantitative real-time RT-PCR. Values represent the ratios of S100A4 and G6PDH control mRNA (non-transfected NCI-H28^nu" cells: set 100%). Two experiments were averaged, each performed in duplicate. At the protein level, S100A4 and /3-tubulin were determined by Western blot analysis. Reduction of S100A4 expression by S100A4 siRNA is shown. (C) Cell migration assay for wt or mutant, and for wt and mutant /3-catenin-transfected NCI-H28^nu11 cells, following treatment with S100A4 siRNA; reduction of migration by S100A4 siRNA is shown. Values represent the number of migrating cells (non-transfected NCI-H28^nu" cells: set 100%). Experiments were performed in quadruplicate. (D) Cell invasion assay for wt or mutant, and for wt and mutant /3-catenin- transfected NCI-H28^nu11 cells, following treatment with S100A4 siRNA; reduction of invasion by S100A4 siRNA is shown. Values represent the number of invading cells (non-transfected NCI-H28^nu" cells: set 100%). Experiments were performed in triplicate. Figure 6. Δ37-mutated /3-catenin induces S100A4 expression, migration, and invasion in

NCI-H28^nu" cells

(A) S100A4 expression in NCI-H28^nu11 cells following transfection with Δ37-mutant |3-catenin; determined by quantitative real-time RT-PCR; values represent the ratios of S100A4 and G6PDH control mRNA (NCI-H28^nu" cells: set 100%). Two experiments were averaged, each performed in duplicate. Induction of S100A4 expression by Δ37-mutated /3-catenin cDNA is shown. At the protein level, S100A4, /3-catenin and /3-tubulin were determined by Western blot analysis. (B) Cell migration assay for NCI-H28^nu" cells, following transfection with Δ37- mutant /3-catenin; induction of migration by Δ37-mutated /3-catenin cDNA is shown. Values represent the number of migrating cells (NCI-H28^πu11 cells: set 100%). Experiments were performed in triplicate. (C) Cell invasion assay for NCI-H28^nu" cells, following transfection with Δ37-mutant /3-catenin; induction of invasion by Δ37-mutant /3-catenin is shown. Values represent the number of invading cells (NCI-H28^nu" cells: set 100%). Experiments were performed in triplicate.

Figure 7. S100A4 siRNA knocks down S100A4 expression, and reduces cell migration and invasion in colon cancer cells with mutant or wt, and mutant and wt /3-catenin

(A) PCR-based RFLP for wt and mutant /3-catenin; the mutant /3-catenin product is cut by BsI I (fragments 72 and 48 bp), whereas the wt /3-catenin product (123 bp) is not. In HCTl 16 cells, the wt /3-catenin fragment (123 bp, not cut) and the fragments of the mutant /3-catenin (72 and 48 bp, cut by BsI I) are observed; in HAB-68^mut cells, mutant /3-catenin was determined, and in HAB-92^wt cells, wt |8-catenin was detected; in HAB-68^mut cells transfected with wt /3-catenin, and in HAB-92^wt cells, transfected with gain-of-function /3-catenin, mutant and wt /3-catenin were determined; (B) S100A4 expression in HCTl 16 cells, in non-transfected and wt /3- catenin-transfected HAB-68^mut, and in non-transfected and mutant /3-catenin-transfected HAB- 92^ cells, following treatment with S100A4 siRNA; determined by quantitative real-time RT- PCR. Values represent the ratios of S100A4 and G6PDH control mRNA (HCTl 16 cells: set 100%). Two experiments were averaged, each performed in duplicate. At the protein level, S100A4 and /3-tubulin were determined by Western blot analysis. Reduction of S100A4 expression by S100A4 siRNA is shown. (C) Cell migration assay for HCTl 16 cells, for non- transfected and wt /3-catenin-transfected HAB-68^mut, and for non-transfected and mutant /3- catenin-transfected HAB-92^wt cells, following treatment with S100A4 siRNA. Reduction of migration by S100A4 siRNA is shown. Values represent the number of migrating cells (HCTl 16 cells: set 100%). Experiments were performed in quadruplicate. (D) Cell invasion assay for HCTl 16 cells, for non-transfected and wt /3-catenin-transfected HAB-68^mut, and for non-transfected and mutant /3-catenin-transfected HAB-92^wt cells, following treatment with S100A4 siRNA. Reduction of invasion by S100A4 siRNA is shown. Values represent the number of invading cells (HCTl 16 cells: set 100%). Experiments were performed in triplicate.

Figure 8. S100A4 promoter activity is regulated by /3-catenin/TCF

(A) Schematic drawing of the S100A4 promoter and mutants thereof: pCAT-1097-TCFwt (- 1097 to +33), the TCF binding site variants with mutated or deleted TCF sites, pCAT-1097- TCFmutam and pCAT-1097-TCF_deieted, and the promoter deletion mutant pCAT-671; the TCF binding site TTTTGTT (-679 to -673) is marked. (B) CAT-ELISA in the cell lines HCTl 16, HAB-68^mut, HAB-92^wt, HAB-92^ transfected with mutant (3-catenin, NCI-H28™¹¹, and NCI- H28^nu" transfected with mutant (D45 or D37) or with mutant (D45) and wt /3-catenin; the amount of CAT protein was normalized to the protein content of the respective lysate and expressed as pg CAT/mg protein. The promoter-less plasmid pCAT3-Basic and transfections without DNA served as controls. Transfer efficiency was controlled by transfection of pCAT- Control (harboring the SV40 promoter). Experiments were performed in quadruplicate. (C) EMSA for binding of /3-catenin/TCF complex and/or of TCF to the S100A4 promoter region in HCTl 16, HAB-68^mut, HAB-92^wt, and NCI-H28^nu" cells. Binding of TCF to the TCF site harboring oligonucleotide is seen in all cell lines, whereas binding of the /3-catenin/TCF complex is only detectable in the /3-catenin-expressing lines. Excess of unlabeled wt TCF oligo prevents binding of the /3-catenin/TCF complex as well as of TCF to the TCF binding region of the S100A4 promoter, but excess of unlabeled mutant TCF oligo did not. (D) Electrophoretic mobility supershift assays for /3-catenin in HCTl 16 and HAB-68^mut cells, in HAB-92^wt cells and its mutant /3-catenin transfectant, as well as in NCI-H28^nu" cells, and its mutant or wt /3- catenin transfectants. Addition of /3-catenin antibody led to supershifting of the /3-catenin/TCF band in /3-catenin expressing cells. (E) ChIP for binding of /3-catenin and TCF-4 to the S100A4 promoter in HAB-68^mut cells; S100A4-specific PCR products were amplified following ChIP with both, a /3-catenin and a TCF-4 antibody, as well as from the inputs of both ChIP assays. No S100A4 product was detectable in the IgG controls. PCR products for the non-related fos gene were amplified from the inputs of both ChIP assays, whereas no fos products were detectable following EP with /3-catenin or TCF-4 antibody.

Figure 9. Mutant /3-catenin and high S100A4 levels induce metastasis in vivo. (A) Intraspinal transplantation of HAB-92^wt cells, transfected with vector or mutant /3-catenin, respectively. The tumors in the spleens are shown. Expression of mutant /3-catenin and high S100A4 led to 6-fold increase in liver metastases formation, as exemplified for one mouse per group (P=.O313). (B) Intracardiac transplantation of HAB-92^wt cells, transfected with vector or mutant /3-catenin, respectively. The tumors in the hearts are shown. Expression of mutant /3- catenin and high S100A4 led to 40-fold increase in number of metastases, observed in lung, brain, liver, spleen, and/or pleura cavity, as exemplified for one mouse per group (P=.O313).

Figure 10. S100A4 expression and metastasis formation in human colon adenocarcinomas

(A) S100A4 mRNA expression in 33 primary colon adenocarcinomas, non-metastasized at the time point of surgery, and corresponding normal tissue, determined by quantitative real-time RT-PCR. S100A4 expression was significantly increased in tumor tissues compared to normal tissues (P=.0001), and was clearly higher in those primary tumors, which developed metachronously distant metastases; a, 0.1 (median); b, 3.8; c, 7.1. The black column exemplifies the high S100A4 mRNA expression of a tumor, which was heterozygous for the /3- catenin Δ45 mutation as determined by PCR-based RFLP, and showed high S100A4 protein expression as well as nuclear /3-catenin staining by immunohistochemistry (see this Figure C and D). This patient also developed later metastases in the liver. (B) Kaplan-Meier analysis for metastasis-free survival and overall survival of patients with low and high S100A4 expression; d. median of all tumors analyzed. (C) Three of the 33 colon carcinomas, which were heterozygous for /3-catenin mutation, were determined by PCR-based RFLP, as exemplified for one patient (see also A,D). (D) S100A4 and /3-catenin were determined by immunohistochemistry in consecutive sections of these heterozygous tumors. Sections without primary antibodies served as controls; bars, low magnification 100 μm, high magnification 20 μm (see also A,C).

Materials and methods Abbreviations:

CAT, chloramphenicol acetyltransferase; ChIP, chromatin immunoprecipitation; dnTCF, dominant negative TCF; EMSA, electrophoretic mobility shift assay; G6PDH, glucose-6- phosphate dehydrogenase; mut, Δ45 in frame deletion of S45 in /3-catenin exon 3; RFLP, restriction fragment length polymorphism; TCF, T-cell factor; wt, wild-type.

Tumor cell lines and transfections HCTl 16 cells (heterozygous for Δ45, exon 3) and the /3-catenin knock-out cell lines were obtained from Todd Waldman, Georgetown University, Washington D.C.³⁹ HAB-68^mut cells express only a mutant allele, and HAB^^ cells express only one wt allele of /3-catenin. /3- Catenin genotypes were confirmed by sequencing exon 3 and by RT-PCR-based restriction fragment length polymorphism (RFLP). NCI-H28^nu" cells (nullosomic for /3-catenin) were from Adi Gazdar and John Minna, University of Texas, Southwestern Medical Center, Dallas, TX.⁴⁰ Transfections of wt and Δ45-mutant (mut) /3-catenin cDNA (kindly provided by Bert Vogelstein, Johns Hopkins University, Baltimore MD), of Δ37-mutant /3-catenin (generated by site-directed mutagenesis in the inventors' lab; sense 5'- cctggactctggaatccatggtgccactaccacagctcc-3 ', antisense 5 '- ggagctgtggtagtggcaccatggattccagagtccagg-3'), S100A4 cDNA, and dominant negative TCF (dnTCF) cDNA (upstate, Lake Placid, NY) were performed using lipofectin.¹⁵'⁴¹ S100A4 siRNA (S100A4_l sense 5'-gggugacaaguucaagcuc-3', S100A4_l antisense 5'- gagcuugaacuugucaccc-3', S100A4_2 sense 5'-ggacagaugaagcugcuuu-3', S100A4_2 antisense 5'-aaagcagcuucaucugucc-3'), /3-catenin siRNA (/3-catenin_l sense 5'-gguggugguuaauaaggcu- 3', /3-catenin_l antisense 5'-gccuuauuaaccaccacc-3', /3-catenin_2 sense 5'ccuauacuuacgaaaaacu-3', /3-catenin _2 antisense 5'-aguuuuucguaaguauagg-3') or scrambled control siRNA (all from Ambion, Austin, TX) were transfected using oligofectamine. For each transfection experiment, at least three independent transfected clones of each cell line were analyzed; one representative clone thereof is shown, respectively.

Patients and tumor tissues

Tissue specimens from 33 colon cancer patients, who were not metastasized at the time point of surgery were obtained with written consent. All patients (20 male, 13 female; age range 54- 93) were previously untreated, did not have a history of familial colon cancer, and underwent surgical resection at the Robert-Rδssle Cancer Hospital, Berlin. Tumor specimens, all were adenocarcinomas, and corresponding normal mucosa were snap-frozen in liquid nitrogen, and blinded for analysis. In order to ensure a correlation of SlOO A4 expression at both expression levels, serial consecutive cryosections for RNA isolation and immunohistochemistry were made. Following evaluation by a pathologist, tumor cell populations were microdissected, and total RNA was isolated, including a DNase step. RNA quality was proven (2100 Bioanalyzer, Agilent, Karlsruhe, Germany), and concentration was measured (RiboGreen RNA Quantitation Kit, Invitrogen, Groningen, The Netherlands). Statistical analysis

Statistical significance of in vivo experiments was evaluated with the Wilcoxon Signed Rank test. Statistical analysis of S100A4 expression in human tissues, e.g. normal vs. malignant tissues, or non-metastasized vs. metachronously metastasized primary tumors, was performed by non-parametric Mann- Whitney Rank Sum test. Statistical significance of Kaplan-Meier curves for metastasis-free survival and for overall survival was evaluated with the Log Rank test.

Gene expression proΩling

Human OncoChip 1OK arrays (NCI/CCR Microarray Center Gaithersburg, MD) were used for gene expression analysis. Total RNA were reverse transcribed with Cy3- or Cy5-labeled dUTP incorporation. The fluorescence was quantified using a GenePix 4000A microarray scanner (Axon Instruments Inc. Union CA; GenePix Pro 3.0 software). Further analysis was conducted by uploading the files to NCI/CCR Microarray Center mAdb Gateway (http://nciarray.nci.nih.gov/), utilizing a simple group retrieval tool, which allows the use of filtering options to determine up-regulation and down-regulation of gene expression; the ad hoc query tool, which searches for specific identified genes; and the 1 or 2 group logic retrieval tool, which compares and contrasts the difference between 2 groups of arrays. Reciprocal Cy3/Cy5 fluorescence labeling confirmed the results.

Quantitative S100A4 real-time RT-PCR, RT-PCR-based 0-catenin RFLP, Western blotting, immunocytochemistry and immunohistochemistry

Quantitative real-time RT-PCR for S100A4 and for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH) were performed in parallel and in duplicate per sample (Roche Diagnostics, Mannheim, Germany)⁴². For S100A4: forward-primer 5'- gagctgcccagcttcttg-3', reverse-primer 5'-tgcaggacaggaagacacag-3', FITC -probe 5'- tgatgagcaacttggacagcaaca-3', LCRed640-probe 5'-gacaacgaggtggacttccaagagt-3'. Mutation status of /3-catenin S45/Δ45 exon 3 was determined by real-time RT-PCR by replacing a wt FITC-probe with a mutation-specific probe: for wt /3-catenin, a 123 bp amplicon was generated, and for mutant /3-catenin, a 120 bp amplicon was produced. The inventors found, that BsI I digested exclusively the mutant /3-catenin amplicon (fragments 72 bp and 48 bp). The wt /3-catenin amplicon remained intact. For analyses at the protein level, the inventors used a polyclonal S100A4 antibody (Dako Glostrup, Denmark), a monoclonal S100A4 antibody (kindly provided by M. Grigorian and E. Lukanidin, Institute of Cancer Biology, Copenhagen, Denmark), a monoclonal /3-catenin and a monoclonal /3-tubulin antibody (both BD Biosciences, Heidelberg, Germany). Immunofluorescent staining was performed as previously described.⁴³ For immunocytochemistry, cells were cultured on double-chamber slides; cells in the chamber without primary antibody served as controls. For immunohistochemistry, consecutive cryosections were incubated with S100A4 or /3-catenin antibodies. Detections were performed with the StreptABComplex/HRP Duet system (Dako).

Cell migration and cell invasion assays

Cells were added to the transwell membrane chambers (pore size 12.0 Dm, Corning, Schiphol- Rijk, The Netherlands). The number of cells, which migrated through the membrane to the lower chamber, was counted after 24 h. For siRNA experiments, cells were seeded 24 h after S100A4 siRNA or control siRNA transfection, and migration assays were performed for another 24 h. For the invasion assays, matrigel (1:5, BD Biosciences) was added to the transwell membrane chambers, incubated for 5 h, and cells were seeded. Cells, which had migrated to the lower chamber were counted after 48 h. The migration and the invasion assays were performed in quadruplicate or triplicate, respectively, for each cell line tested.

S100A4 gene promoter analysis

For chloramphenicol acetyltransferase (CAT)-ELISA, the promoter fragment was taken from the S100A4 promoter construct pDA-L49 and inserted into pCAT3-Basic plasmid (Clontech, Heidelberg, Germany) resulting in pCAT-1097-TCF_w1 (-1097 to +33; TCF binding site -679 to -673).⁴⁴ TCF binding site variants pCAT-1097-TCF_mutant and pCAT-1097-TCF_dei_eted were generated by site directed mutagenesis (Stratagene, Amsterdam, The Netherlands) using the following oligonucleotides: TCF_mutant sense 5'-ggatccccaccccagtttgcggctctgaatctttatttttttaag-3', antisense 5'-cttaaaaaaataaagattcagagccgcaaactggggtggggatcc-3', TCFd_eieted sense 5'- ggatccccaccccagttctgaatctttatttttttaag-3 ' , antisense 5 ' -cttaaaaaaataaagattcagaactggggtggggatcc- 3'. The control construct pCAT-671 was generated by PCR. Promoter constructs were sequenced for correct in frame orientation. The plasmids pCAT3-Basic (promoter-less) and transfections without DNA served as controls. Transfer efficiency was controlled by transfection of pCAT-Control, harboring the SV40 promoter (Clontech). Transfections and CAT-ELISA were carried out as described previously.⁴³ The amount of CAT protein was normalized to the protein content of the respective lysate and expressed as pg CAT/mg protein. Values are given as average of quadruplicates. Electrophoretic mobility shift assay (EMSA) was performed with 3 μg of lysate and with biotin-endlabeled double-stranded oligonucleotides for the human S100A4 promoter (synthesized by Leo Lee, NCI-Frederick, MD) containing the wt (sense 5'- ccgggcatggggatccccaccccagtttttgtttctgaatctttatttttttaagagaca-3', antisense 3'- ggcccgtacccctaggggtggggtcaaaaacaaagacttagaaataaaaaaattctctgt-5'), or mutant (sense 5'- ccgggcatggggatccccaccccagtttttggctctgaatctttatttttttaagagaca-3 ' , antisense 3 ' - ggcccgtacccctaggggtggggtcaaaaaccgagacttagaaataaaaaaattctctgt-5') TCF binding site. Unlabeled double-stranded oligonucleotides were used to control the binding specificity. For supershift experiments, 6 μg of lysate and 0.5 μg of the monoclonal /3-catenin antibody were used. Chromatin immunoprecipitation (ChIP) was performed using the monoclonal /3-catenin antibody and a polyclonal TCF-4 antibody (Santa Cruz Biotechnology, Heidelberg, Germany).⁴⁵ S100A4 PCR (forward-primer 5'-tgttcccctccagatccc-3'; -764 to -747, reverse- primer 5'-ggctatgctcaagccactg-3'; -616 to -598) and fos PCR (forward-primer 5'- ccttaatattcccacacatggc-3', reverse-primer 5'-ctgcgtttggaagcagaaagt-3') produced 167 or 149 bp amplicons, respectively.

In vivo metastasis following intrasplenal and intracardiac transplantation

Intraspinal (2,5xlO⁶ cells/animal) and intracardiac (IxIO⁶ cells/animal) transplantation of HAB-92^wt cells, either transfected with vector or mutant /3-catenin, were performed into NOD/SCID mice (Epo GmbH, Berlin, Germany). Each animal group consisted of 6 mice. Animals were sacrificed at day 19 due to ethical reasons. Spleen and heart (transplantation sites, respectively), as well as liver, lung, and brain (potential metastasis target organs) were removed and metastases were counted.

S100A4 expression is regulated by /3-catenin

The inventors compared gene expression profiles of the human colon carcinoma cell line HCTl 16, which carries a gain-of-function and a wt /3-catenin allele, with the HAB-92^wt derivative, in which the mutant /3-catenin allele was ablated by homologous recombination (Figure IA).³⁹ Expression profiling was performed using the Human OncoChip 1OK cDNA arrays (NCI/CCR Microarray Center Gaithersburg, MD). Remarkably, a 40-fold up-regulated expression of S100A4 was observed in the cell line containing the mutant /3-catenin (Figure IB). Among the genes present on the array, S100A4 exhibited the largest change in gene expression. BMP-4 expression was up-regulated 15 -fold; BMP-4 was previously observed to be up-regulated in these cells.³⁹ Quantitative real-time RT-PCR and Western blot analysis were used to verify the enhanced expression of S100A4 (Figure 1C). HAB-68^mut cells, which contain only a mutant /3-catenin allele, also showed high levels of S100A4 mRNA and protein. NCI-H28^nu" cells that carry a loss-of-function mutation in /3-catenin did not express S100A4. To assess if the enhanced expression is mediated via /3-catenin/TCF, the inventors examined S100A4 expression in HCTl 16 and HAB-68^mut cells transfected with dnTCF cDNA.⁴⁶ Following transfection of dnTCF, reduced expression and protein production of S100A4 were observed (Figure ID). Immunofluorescence and immunocytochemistry confirmed these data: strong S100A4 signals were observed in the cells with mutant /3-catenin, and much lower, almost undetectable signals were observed in the cells that express wt or no /3-catenin (Figure IE). S100A4 was located in cytoplasm and nucleus, as previously described.³²'³³

Cell migration and invasion depend on the /S-catenin genotype and on S100A4 expression

Cell migration was evaluated in transwell chambers, in which cells need to pass 12 μm pores to migrate from one to the other well. The inventors found that the cells with gain-of-function /3- catenin, HCTl 16 and HAB-68^mut, exhibited a high degree of migration, while moderate migratory activity was seen in cells expressing wt /3-catenin (Figure 2A). Migration activity of the /3-catenin null-mutant cells was distinctly lower. Cell invasion through extracellular matrix was examined using membranes coated with matrigel. High invasive activity was observed in cell lines expressing mutant /3-catenin, and moderate or low activity in cell lines expressing wt or no /3-catenin (Figure 2B).

Transfection of SlOO A4 cDNA into cells that express wt or no /3-catenin, HAB-92^wt and NCI- H28^nu11, increased the migratory and invasive activity. Data obtained by the analysis of one transfected clone from each cell line are displayed in Figure 3 (independent clones of both cell lines showed a similar change in migratory behavior, see Materials and methods for further detail).

The inventors used siRNA to evaluate if cell migration and invasion induced by activated /3- catenin requires S100A4 expression. The inventors first transfected HCTl 16 cells with /3- catenin siRNA, which led to reduced S100A4 expression, as well as to reduced numbers of migrating and invading cells (Figure 4). Next, the inventors transfected wt or mutant /3-catenin cDNA into NCI-H28^nu" cells, which resulted in strong increase of S100A4 gene expression, migratory and invasive activity in the transfected clones (Figure 5). Co-transfection of both wt and mutant /3-catenin cDNA did not further increase S100A4 expression, cell migration and invasion. Importantly, transfection of S100A4 siRNA led to a strong decrease of S100A4 expression, migratory and invasive activity: up to 80-90% reduction of S100A4 expression, migration and invasion were observed (Figure 5B, C, D). Transfection of control siRNA had no effect.

Next, the inventors evaluated the impact of gain-of function /3-catenin by generating an additional mutant form, an in frame deletion of the phosphorylation site S37 in exon 3 of /3- catenin. Transfection of the Δ37 mutant /3-catenin cDNA also increased S100A4 expression at both levels, and led to elevated migration and invasion properties (Figure 6).

The inventors also transfected HAB-68^mut cells with wt /3-catenin and HAB-92^wt cells with mutant /3-catenin cDNA (Figure 7A). The inventors observed a strong increase in S100A4 expression and a concomitant elevation in cell migration and invasion in HAB-92^wt cells transfected with mutant /3-catenin. Transfection of wt /3-catenin into HAB-68^mut did neither increase S100A4 expression nor cell migration and invasion. Transfection of SlOO A4 siRNA resulted in reduced S100A4 expression in all cell lines, including the HCTl 16 cells, and more importantly, was accompanied by a reduction in cell migration and invasion (Figure 7B, C, D). Transfection of control siRNA had no effect (not shown). These data suggest that the effect of /3-catenin signaling on cell migration and invasion is mediated via the increased expression of the S100A4 gene.

The S100A4 gene is a direct target of /S-catenin/TCF

To examine whether S100A4 is directly regulated by /3-catenin, the inventors analyzed transcriptional control sequences of the S100A4 gene for binding sites of TCF proteins. A putative TCF binding site was identified in the 5 '-untranslated region of the promoter at position -679 to -673 (Figure 8A).⁹'⁴⁷ This sequence is conserved between human and mouse. The inventors examined the functional importance of this TCF binding site by transient transfection of CAT reporter gene constructs, driven by the S100A4 promoter. Constructs containing promoter sequences with wt, mutant, or deleted TCF binding sites were transfected into the various cell lines, which express either no /3-catenin, wt or activated /3-catenin genes. The inventors observed that HCTl 16 and HAB-68^mut cells showed high reporter activity with the wt S100A4 promoter constructs, while reporter activity in the HAB-92^wt cells were lower. Transfection of mutant /3-catenin cDNA into HAB-92^ cells led to a 7-fold increase in CAT expression. The reporter activity in NCI-H28^nu" cells was almost undetectable. Very remarkably, additional transfection of mutant (Δ45 or Δ37) or mutant (Δ45) and wt /3-catenin into NCI-H28^nu" rescued reporter gene expression by more than 200-fold. Expression from reporter constructs that harbor mutated or deleted TCF binding were 90% lower than the expression from the construct with the wt promoter sequence (Figure 8B). hi comparison, the inventors analyzed also the expression of the /3-catenin/TCF-dependent TOP reporter;⁴⁸ the TOP reporter was expressed at high levels in cells that express activated /3-catenin, at moderate levels in cells that express wt /3-catenin, and no expression was observed in the nullosomic cells (data not shown).

hi EMSA, endogenous TCF from nuclear extracts of all cell lines bound effectively to a labeled oligonucleotide that contained the wt TCF binding site (Figure 8C). Binding of the endogenous /3-catenin/TCF complex to the wt TCF binding site was observed in the /3-catenin expressing cells, but was not detectable in the nullosomic line. Excess of unlabeled oligonucleotide with a wt TCF binding site, but not of mutated oligonucleotide, prevented the formation of the labeled complexes. Moreover, addition of /3-catenin antibody led to supershifts in the /3-catenin- harboring cell lines HCTl 16, HAB-68^mut, HAB-92^ and HAB-92^ transfected with mutant /3- catenin, as well as in NCI-H28^nu11 cells stably transfected with wt or mutant /3-catenin (Figure 8D). No supershift was observed in NCI-H28^nu" cells. Moreover, the intensity of the supershift bands was increased when mutant /3-catenin was expressed. Thus, the interaction of /3-catenin, either intrinsically expressed or following transfection, with the S100A4 promoter region was demonstrated.

Furthermore, the inventors were able to PCR amplify S100A4-specifϊc promoter sequences from chromatin immunoprecipitates of HAB-68^mut cells, using /3-catenin- or TCF-4-specific antibodies (Figure 8E). No S100A4-specific promoter sequences were amplifyable when control IgG was used for precipitation. PCR amplification of fos promoter sequences served as a control. Taken together, these data indicate that the S100A4 gene is a direct transcriptional target of /3-catenin/TCF signaling.

In vivo metastasis of colon cancer cell lines depends on the /3-catenin genotype and on S100A4 expression

The impact of mutant /3-catenin and concomitant increased S100A4 expression was proven on in vivo metastasis by using HAB-92^wt cells, either transfected with vector or mutant /3-catenin. The importance of increased S100A4 expression for cell migration and invasion in HAB-92^wt cells transfected with mutant /3-catenin is shown in Figure 7. As a first in vivo approach, intrasplenal transplantation of these cells was performed (Figure 9A). Metastases formation was exclusively observed in the liver, in 66% of mock-transfected and in 100% of mutant β- catenin-transfected animals. Interestingly, mutant β-catenin and concomitant high S100A4 led to a 6-fold increase in number of metastases/mice (P=. 0313).

Second, the inventors performed intracardiac transplantation of HAB^T"¹ cells, mock- or mutant /3-catenin-transfected, respectively (Figure 9B). Only one animal of the mock group developed one metastasis in the lung. In the group transplanted with mutant /3-catenin- expressing HAB-92^wt cells, all animals developed metastases, preferentially to the lung, but also to liver, brain, spleen and pleura cavity. Remarkably, transplanted cells expressing mutant /3-catenin and high levels of SlOO A4 induced metastases by more than 40-fold (P=.O313).

S100A4 expression and metastasis formation in human colon carcinomas

S100A4 expression was determined by quantitative real-time RT-PCR in specimens of 33 primary colon adenocarcinomas, non-metastasized at the time point of surgery, and corresponding normal tissues. S100A4 mRNA levels were significantly higher in the tumors than in normal tissues (Figure 10A). Remarkably, S100A4 expression was higher in those primary tumors that later developed distant metastases, compared to the tumors that did not develop metastases within 36 months after surgery. Kaplan-Meier analysis revealed a longer overall and longer metastasis-free survival of patients with low S100A4 expression in the primary tumor (Figure 10B). These data indicate that the mRNA expression levels of SlOO A4 in primary colon tumors can predict the incidence of metastases. Furthermore, three patients were identified whose colon carcinomas were heterozygous for activated /3-catenin (as exemplified for one representative patient; Figure 10C). In sections of these tumors, nuclear β- catenin and high S100A4 protein levels were observed (as exemplified for one representative patient; Figure 10D). The high mRNA S100A4 expression of this patient is marked in black in Figure 1OA. Further observation of the patients that had harbored these tumors demonstrated that they developed liver metastases.

References

1. Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell 1990;61 :759- 767.

2. Ilyas M, Straub J, Tomlinson IP, Bodmer WF. 1999. Genetic pathways in colorectal and other cancers. Eur J Cancer 1999;35:1986-2002.

3. Polakis P. Wnt signaling and cancer. Genes Dev 2000;14:1837-1851. 4. Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell 2000;103:311-320.

5. Giles RH, van Es JH, Clevers H. Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys Acta 2003;1653:l-24.

6. Vogelstein B, Kinzler KW. Cancer genes and the pathways they control. Nat Med 2004; 10:789-799.

7. Liu C, Li Y, Semenov M, Han C, Baeg GH, Tan Y, Zhang Z, Lin X, He X. Control of beta- catenin phosphorylation/degradation by a dual-kinase mechanism. Cell 2002;108:837-847.

8. Behrens J, von Kries JP, Kuhl M, Bruhn L, Wedlich D, Grosschedl R, Birchmeier W. Functional interaction of beta-catenin with the transcription factor LEF-I. Nature 1996;382:638-642.

9. Tetsu O, McCormick F. Beta-catenin regulates expression of cyclin Dl in colon carcinoma cells. Nature 1999;398:422-426.

10. Ikeda S, Kishida S, Yamamoto H, Murai H, Koyama S, Kikuchi A. Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. EMBO J 1998;17:1371- 1384.

11. Behrens J, Jerchow BA, Wurtele M, Grimm J, Asbrand C, Wirtz R, Kuhl M, Wedlich D, Birchmeier W. Functional interaction of an axin homolog, conductin, with beta-catenin, APC, and GSK3beta. Science 1998;280:596-599.

12. Sparks AB, Morin PJ, Vogelstein B, Kinzler KW. Mutational analysis of the APC/beta- catenin/Tcf pathway in colorectal cancer. Cancer Res 1998;58:1130-1134.

13. Ilyas M, Tomlinson IP, Rowan A, Pignatelli M, Bodmer WF. Beta-catenin mutations in cell lines established from human colorectal cancers. Proc Natl Acad Sci U S A 1997;94:10330-10334.

14. Rubinfeld B, Robbins P, El-Gamil M, Albert I, Porfiri E, Polakis P. Stabilization of beta- catenin by genetic defects in melanoma cell lines. Science 1997;275: 1790- 1792.

15. Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, Kinzler KW. Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 1997;275: 1787- 1790.

16. Polakis P. The oncogenic activation of beta-catenin. Curr Opin Genet Dev 1999;9:15-21.

17. Kim IJ, Kang HC, Park JH, Shin Y, Ku JL, Lim SB, Park SY, Jung SY, Kim HK, Park JG. Development and applications of a beta-catenin oligonucleotide microarray: beta-catenin mutations are dominantly found in the proximal colon cancers with microsatellite instability. Clin Cancer Res 2003;9:2920-2925. 18. Provost E, Yamamoto Y, Lizardi I, Stern J, D'Aquila TG, Gaynor RB, Rimm DL. Functional correlates of mutations in beta-catenin exon 3 phosphorylation sites. J Biol Chem 2003;278:31781-31789.

19. Orford K, Crockett C, Jensen JP, Weissman AM, Byers SW. Serine phosphorylation- regulated ubiquitination and degradation of beta-catenin. J Biol Chem 1997;272:24735-24738.

20. Aberle H, Bauer A, Stappert J, Kispert A, Kemler R. beta-catenin is a target for the ubiquitin proteasome pathway. EMBO J 1997;16:3797-3804.

21. Brabletz T, Jung A, Reu S, Porzner M, Hlubek F, Kunz-Schughart LA, Knuechel R, Kirchner T. Variable beta-catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci USA 2001;98:10356-10361.

22. Zhang B, Ougolkov A, Yamashita K, Takahashi Y, Mai M, Minamoto T. beta-Catenin and ras oncogenes detect most human colorectal cancer. Clin Cancer Res 2003;9:3073-3079.

23. Wong SC, Lo ES, Lee KC, Chan JK, Hsiao WL. Prognostic and diagnostic significance of beta-catenin nuclear immunostaining in colorectal cancer. Clin Cancer Res 2004;10:1401- 1408.

24. Grigorian MS, Tulchinsky EM, Zain S, Ebralidze AK, Kramerov DA, Kriajevska MV, Georgiev GP, Lukanidin EM. The mtsl gene and control of tumor metastasis. Gene 1993;135:229-238.

25. Barraclough R. Calcium-binding protein S100A4 in health and disease. Biochim Biophys Acta 1998;1448:190-199.

26. Mazzucchelli L. Protein S100A4: too long overlooked by pathologists? Am J Pathol 2002;160:7-13.

27. Marenholz I, Heizmann CW, Fritz G. SlOO proteins in mouse and man: from evolution to function and pathology (including an update of the nomenclature). Biochem Biophys Res Commun 2004;322:l 111-1122.

28. Helfman DM, Kim EJ, Lukanidin E, Grigorian M. The metastasis associated protein S100A4: role in tumour progression and metastasis. Br J Cancer 2005;92:1955-1958.

29. Garrett SC, Varney KM, Weber DJ, Bresnick AR. S100A4, a mediator of metastasis. J Biol Chem 2006;281:677-680.

30. Takenaga K, Nakanishi H, Wada K, Suzuki M, Matsuzaki O, Matsuura A, Endo H. Increased expression of S100A4, a metastasis-associated gene, in human colorectal adenocarcinomas. Clin Cancer Res 1997;3:2309-2316. 31. Taylor S, Herrington S, Prime W, Rudland PS, Barraclough R. S100A4 (p9Ka) protein in colon carcinoma and liver metastases: association with carcinoma cells and T-lymphocytes. Br J Cancer 2002;86:409-416.

32. Gongoll S, Peters G, Mengel M, Piso P, Klempnauer J, Kreipe H, von Wasielewski R. Prognostic significance of calcium-binding protein S100A4 in colorectal cancer. Gastroenterol. 2002;123:1478-1484.

33. Flatmark K, Pedersen KB, Nesland JM, Rasmussen H, Aamodt G, Mikalsen SO, Bjornland K, Fodstad O, Maelandsmo GM. Nuclear localization of the metastasis-related protein S100A4 correlates with tumour stage in colorectal cancer. J Pathol 2003;200:589-595.

34. Takenaga K, Nakamura Y, Sakiyama S. Expression of antisense RNA to S100A4 gene encoding an SlOO-related calcium-binding protein suppresses metastatic potential of high- metastatic Lewis lung carcinoma cells. Oncogene 1997; 14:331-337.

35. Bjornland K, Winberg JO, Odegaard OT, Hovig E, Loennechen T, Aasen AO, Fodstad O, Maelandsmo GM. S100A4 involvement in metastasis: deregulation of matrix metalloproteinases and tissue inhibitors of matrix metalloproteinases in osteosarcoma cells transfected with an anti-S100A4 ribozyme. Cancer Res 1999;59:4702-4708.

36. Ambartsumian NS, Grigorian MS, Larsen IF, Karlstrom O, Sidenius N, Rygaard J, Georgiev G, Lukanidin E. Metastasis of mammary carcinomas in GRS/A hybrid mice transgenic for the mtsl gene. Oncogene 1996;13: 1621-1630.

37. Davies MP, Rudland PS, Robertson L, Parry EW, Jolicoeur P, Barraclough R. Expression of the calcium-binding protein S100A4 (p9Ka) in MMTV-neu transgenic mice induces metastasis of mammary tumours. Oncogene 1996;13:1631-1637.

38. Grum-Schwensen B, Klingelhofer J, Berg CH, El-Naaman C, Grigorian M, Lukanidin E, Ambartsumian N. Suppression of tumor development and metastasis formation in mice lacking the S100A4(mtsl) gene. Cancer Res 2005;65:3772-3780.

39. Kim JS, Crooks H, Dracheva T, Nishanian TG, Singh B, Jen J, Waldman T. Oncogenic beta-catenin is required for bone morphogenetic protein 4 expression in human cancer cells. Cancer Res 2002;62:2744-2748.

40. Shigemitsu K, Sekido Y, Usami N, Mori S, Sato M, Horio Y, Hasegawa Y, Bader SA, Gazdar AF, Minna JD, Hida T, Yoshioka H, Imaizumi M, Ueda Y, Takahashi M, Shimokata K. Genetic alteration of the beta-catenin gene (CTNNBl) in human lung cancer and malignant mesothelioma and identification of a new 3p21.3 homozygous deletion. Oncogene 2001;20:4249-4257. 41. Engelkamp D, Schafer BW, Erne P, Heizmann C. SlOO alpha, CAPL, and CACY: molecular cloning and expression analysis of three calcium binding proteins from human heart. Biochem 1992;31 :10258-10264.

42. Stein U, Jϋrchott K, Schlafke M, Hohenberger P. Expression of multidrug resistance genes MVP, MDRl, and MRPl determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients. J Clin Oncol 2002;20:3282-3292.

43. Stein U, Jϋrchott K, Walther W, Bergmann S, Schlag PM, Royer HD. Hyperthermia- induced nuclear translocation of transcription factor YB-I leads to enhanced expression of multidrug resistance-related ABC transporters. J Biol Chem 2001;276:28562-28569.

44. Hernan R, Fasheh R, Calabrese C, Frank AJ, Maclean KH, Allard D, Barraclough R, Gilbertson RJ. ERBB2 up-regulates S100A4 and several other prometastatic genes in medulloblastoma. Cancer Res 2003 ;63: 140-148.

45. Spencer VA, Sun JM, Li L, Davie JR. Chromatin immunoprecipitation: a tool for studying histone acetylation and transcription factor binding. Methods 2003;31:67-75.

46. van de Wetering M, Sancho E, Verweij C, de Lau W, Oving I, Hurlstone A, van der Horn K, Batlle E, Coudreuse D, Haramis AP, Tjon-Pon-Fong M, Moerer P, van den Born M, Soete G, Pals S, Eilers M, Medema R, Clevers H. The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell 2002;l 11 :241-250.

47. Ghiselli G, Coffee N, Munnery CE, Koratkar R, Siracusa LD. The cohesin SMC3 is a target the for beta-catenin/TCF4 transactivation pathway. J Biol Chem 2003;278:20259-20267.

48. Roose J, Molenaar M, Peterson J, Hurenkamp J, Brantjes H, Moerer P, van de Wetering M, Destree O, Clevers H. The Xenopus Wnt effector XTcf-3 interacts with Groucho-related transcriptional repressors. Nature 1998;395:608-612.

49. Katayama N, Murao S, Ajiki T, Kitazawa S, Onoyama H, Kuroda Y, Maeda S. The role of S100A4 gene encoding an SlOO-related calcium-binding protein in human bile duct adenocarcinoma cell lines: correlation of SlOO A4 expression and invasive growth in matrigel matrix. Int J MoI Med 2000;6:539-542.

50. Hay ED, Zuk A. Transformations between epithelium and mesenchyme: normal, pathological, and experimentally induced. Am J Kidney Dis 1995;26:678-690.

51. Ben-Ze'ev A, Geiger B. Differential molecular interactions of beta-catenin and plakoglobin in adhesion, signaling and cancer. Curr Opin Cell Biol 1998; 10:629-639. 52. Crawford HC, Fingleton BM, Rudolph-Owen LA, Goss KJ, Rubinfeld B, Polakis P, Matrisian LM. The metalloproteinase matrilysin is a target of beta-catenin transactivation in intestinal tumors. Oncogene 1999;18:2883-2891.

53. Brembeck FH, Schwarz-Romond T, Bakkers J, Wilhelm S, Hammerschmidt M, Birchmeier W. Essential role of BCL9-2 in the switch between beta-catenin's adhesive and transcriptional functions. Genes Dev 2004; 18:2225-2230.

54. Kriajevska M, Fischer-Larsen M, Moertz E, Vorm O, Tulchinsky E, Grigorian M, Ambartsumian N, Lukanidin E. Liprin beta 1, a member of the family of LAR transmembrane tyrosine phosphatase-interacting proteins, is a new target for the metastasis-associated protein S100A4 (Mtsl). J Biol Chem 2002;277:5229-5235.

55. Debant A, Serra-Pages C, Seipel K, O'Brien S, Tang M, Park SH, Streuli M. The multidomain protein Trio binds the LAR transmembrane tyrosine phosphatase, contains a protein kinase domain, and has separate rac-specific and rho-specific guanine nucleotide exchange factor domains. Proc Natl Acad Sci USA 1996;93:5466-5471.

56. Usami N, Sekido Y, Maeda O, Yamamoto K, Minna JD, Hasegawa Y, Yoshioka H, Imaizumi M, Ueda Y, Takahashi M, Shimokata K. Beta-catenin inhibits cell growth of a malignant mesothelioma cell line, NCI-H28, with a 3p21.3 homozygous deletion. Oncogene 2003;22:7923-7930.

Claims

Claims

1. A method for diagnosing metastasis of cancer, comprising analyzing a mutation at amino acid S³⁷ and/or amino acid S⁴⁵ of human /3-catenin, or in a nucleic acid encoding for amino acid S³⁷ and/or amino acid S⁴⁵ of human /3-catenin, or a homologous position in a human /3-catenin homolog, wherein a mutation in said at least on position is indicative for metastasis.

2. The method according to claim 1, wherein said cancer is a Wnt//3-catenin pathway mediated cancer.

3. The method according to claim 1 or 2, wherein said cancer is selected from colorectal cancer, hepatocellular carcinoma, lung cancer, prostate cancer, gastrointestinal tumors, ovarian tumors, and papillary thyroid cancer.

4. The method according to any of claims 1 to 3, wherein said analysis comprises the use of /3-catenin specific antibodies, sequencing, hybridization and/or PCR.

5. The method according to any of claims 1 to 3, wherein said analysis is based on restriction fragment length polymorphism using restriction enzyme BsI I.

6. The method according to any of claims 1 to 5, wherein said human /3-catenin homolog is selected from mouse, rat, pig, goat, cow, dog, cat, and monkey.

7. The method according to any of claims 1 to 6, wherein said method is performed in vitro and/or in vivo.

8. The method according to any of claims 1 to 7, wherein said mutation is selected from an in- frame deletion, a transition, a transversion, a phosphorylation inhibiting mutation, and a /3-catenin-accumulating mutation.

9. The method according to any of claims 1 to 8, further comprising an analysis of nuclear /3-catenin localization and/or S100A4 expression.

10. The method according to any of claims 1 to 9, further comprising an estimation of the risk for a metastasis of said cancer, based on said analysis.

11. A method for the prevention and/or treatment of metastasis in cancer, comprising a method according to any of claims 1 to 10, and providing a respective treatment to the patient in need thereof.

12. The method according to claim 11, wherein said treatment as provided comprises a radio- and/or chemotherapy.

13. A method for screening for an agent for prevention and/or treatment of metastasis in cancer, comprising contacting a human /3-catenin polypeptide carrying a mutation at amino acid S³⁷ and/or amino acid S⁴⁵ or a homolog of a human /3-catenin with at least one potentially interacting compound, and measuring binding of said compound to said human /3-catenin.

14. The method according to claim 13, further comprising the steps of a) selecting said binding compound, b) modifying the binding compound, to generate a variety of modified binding compounds, c) contacting said human /3-catenin with each of the modified binding compounds, and d) measuring binding of said compound to said human /3-catenin, and optionally, repeating steps a) to d) for one or more times.

15. The method according to claim 13 or 14, further comprising the steps of measuring the effect of said human /3-catenin on the expression of SlOO A4 in the presence or absence of said binding compound.

16. The method according to any of claims 13 to 15, further comprising the step of admixing the interacting, preferably inhibiting the expression of S100A4, compound with suitable auxiliary substances and/or additives.