WO2008033042A2 - Method for identifying the origin of a compound biological product - Google Patents

Abstract

A method for subsequent identification of batch origin of a compound biological product, including the steps of: i) identifying at least one unique nucleotide sequence from a discrete source and creating a genetic profile thereof; ii) selecting at least one of said unique nucleotide sequence(s); iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to items within a batch of compound biological product so as to allow for subsequent detection thereof; iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

Description

IDENTIFICATION METHOD

STATEMENT OF CORRESPONDING APPLICATIONS

This application is based on the complete specification filed in relation to New Zealand Patent Application Number 549833, the entire contents of which are incorporated herein by reference.

Technical Field

The present invention relates to an identification method. In particular, a method for identifying the manufacturer and/or the batch of origin of a compound biological product.

Background Art

Many markets are becoming increasingly aware of food safety issues such as BSE (Smith, Cousens, Huillard g'Aignaux, Ward & Will, 2004), animal ethics (Hobbs, Hobbs, Isaac & Kerr, 2002) and genetic modification of foods (Miraglia et al., 2004). As a result of this awareness, maintaining market access is increasingly dependant on having auditable traceability technologies for meat and meat products and many countries have legislated or regulated traceability requirements for beef. A number of the paper and/or electronic traceability systems already in place can be adapted to include meat (Shackell, 2005).

There are two major considerations for tracing meat. Firstly, the whole animal is dismantled during processing for distribution either as primal cuts, which are further reduced prior to sale, or as pre-packaged individual cuts. As the procedure is usually non-linear, meat from different animals can become jumbled during processing and packaging, thus complicating traceability. Secondly, a label or identifier must be correctly attached to each individual piece of meat as it is created, and remain with that piece of meat at all times, for the process to allow full traceability. These problems increase several-fold in the manufacture of ground meat product, which uses trimmed off-cuts. Processing times would be considerably increased if each animal or each piece of trim meat was to be identified individually throughout the boning process.

For example, in Japan consumers are able to access information about a meat cut by typing a 10-digit traceability bar-code into a computer or WAP-enabled cell phone at the point of sale (Ozawa, Lopez-Villalobos & Blair, 2005).

DNA can be used to prove identity and/or audit in meat traceability systems (due to DNA being ubiquitous in all living organisms, tamper-proof and unique for all individuals other than clones or fully inbred animals.) (refer Shackell, 2005;

Shackell 2007). Accordingly, DNA is currently used for meat traceability

(Meghen, Scott, Bradley, MacHugh, Loftus & Cunningham, 1998; Cunningham &

Meghen, 2001 ; Shackell, Tate & Anderson, 2001), brand protection (Castaldo, 2003), fraud detection (Arana, Soret, Lasa & Alfons, 2002; Vazquez, Perez,

Ureήa, Gudin, Ablornoz & Dominguez, 2004) and detecting contamination with non-labeled species (Calvo, Osta & Zaragoza, 2002).

Methodologies referred to above make use of the variability in DNA sequence at specific loci. These are used for identifying the animal of origin of meat cuts, and require the analysis of 10-15 or more DNA Markers per sample to provide the level of variability that in combination enables the differentiation between individuals. The methodology described herein uses specific, DNA sequences for traceability by inclusion as a biological marker in batches of compound meat products, thereby considerably reducing the number of markers that need to be analysed. In addition, many of the current systems for tracing compound meat products are paper based, and can only supply batch information about the time, date and place of manufacture of the product. As DNA is the only way to unequivocally reverse audit a meat production plant. For example, even in a system, designed to meet USDA regulations requiring that carcasses and their parts can be identified "as being derived from a particular [live] animal", Heaton et. al. (2005) found that 9.5%-of liver samples did not match the animal they were purportedly derived from. This new method allows precise batching and/or place of manufacture to be identified.

Another patent application PCT/NZ06/000158 of the present inventors seeks to address and makes use of the DNA profile of either the compound product, or the DNA profile(s) of individual components of that product, for traceability purposes. However, in this method only the DNA inherent in each mixed batch is used as the traceability tool. This can therefore make identification of batch origin difficult:

• When there are a large number of contributor animals to a batch; and/or

• When an animal or animals contribute to more than one batch of compound meat products.

For example, individuals are usually identified by their unique genotype profile using a suite of informative polymorphic microsatellite markers. As soon as DNA from several individuals is mixed, the resultant "genotype" instead of being bi- allelic at each marker becomes multi-allelic at some or all markers. We have previously shown that determining the number of contributors to a mixture of randomly selected animals is not feasible when the mixture contains DNA from more than five or six individuals (Dodds & Shackell, 2004). We have also investigated the potential for using microsatellite markers as a tool for traceability of ground beef product. By using the multiallelic genotype profiles seen in a DNA mixture, we could match anonymous ground beef samples to the correct batch of manufacture with a high success rate. However, we concluded that further refinement was needed for microsatellite technologies to provide a basis for tracing individuals in compound meat products (Shackell, Mathias, Cave, & Dodds, 2005).

An obvious solution for traceability of ground beef products is to add trace amounts of a foreign material to the ground beef such as a fluorescent dye, a stable heavy isotope or any other easily detectable inert substance. This solution however conflicts with the marketing aspirations of retailers and/or consumers who wish the product to remain "100% pure" beef.

All references, including any patents or patent applications cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. The discussion of the references states what their authors assert, and the applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents form part of the common general knowledge in the art, in New Zealand or in any other country.

It is acknowledged that the term 'comprise' may, under varying jurisdictions, be attributed with either an exclusive or an inclusive meaning. For the purpose of this specification, and unless otherwise noted, the term 'comprise' shall have an inclusive meaning - i.e. that it will be taken to mean an inclusion of not only the listed components it directly references, but also other non-specified components or elements. This rationale will also be used when the term 'comprised' or 'comprising' is used in relation to one or more steps in a method or process. It is an object of the present invention to address the foregoing problems or at least to provide the public with a useful choice.

Further aspects and advantages of the present invention will become apparent from the ensuing description which is given by way of example only.

Disclosure of Invention

According to one aspect of the present invention there is provided a method for subsequent identification of batch origin of a compound biological product, including the steps of:

i) identifying at least one unique nucleotide sequence from a discrete source and creating a genetic profile thereof;

ii) selecting at least one of said unique nucleotide sequence(s);

iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to items within a batch of compound biological product so as to allow for subsequent detection thereof;

iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

Optionally an additional step, (after performing step one,) may be storing the discrete sources of said unique nucleotide sequence(s) for subsequent use with steps ii -iv) above.

According to another aspect of the present invention there is provided a method for identification of batch origin of a compound biological product, including the steps of: i) identifying at least one unique nucleotide sequence from a discrete source and creating a genetic profile thereof;

ii) selecting at least one of said unique nucleotide sequence(s);

iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to items within a batch of compound biological product so as to allow for subsequent detection thereof;

iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

characterised by the further steps of:

a) taking a test-sample of the compound biological product to be identified;

b) isolating the nucleic acid molecules present in the test-sample;

c) obtaining a genetic profile of the test-sample nucleic acid molecules isolated at step b);

d) comparing the test-sample genetic profiles against the recorded genetic profiles;

e) using a match at c) to assign a batch of origin.

According to one aspect of the present invention there is provided a method for subsequent identification of batch origin of a compound biological product, including the steps of:

i) identifying at least one specific unique nucleotide sequence from a discrete source and creating a genetic profile thereof;

ii) selecting at least one of said unique nucleotide sequence(s); iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to a predetermined position on each item of a batch of compound biological product so as to allow for subsequent detection thereof;

iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

According to another aspect of the present invention there is provided a method for identification of batch origin of a compound biological product, including the steps of:

i) identifying at least one unique nucleotide sequence from a discrete source and creating a genetic profile thereof;

ii) selecting at least one of said unique nucleotide sequence(s);

iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to a predetermined position on each item of a batch of compound biological product so as to allow for subsequent detection thereof;

iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

characterised by the further steps of:

a) taking from the predetermined position in iii) a test-sample of the compound biological product to be identified;

b) isolating the nucleotide sequence(s) present in the test-sample;

c) obtaining a genetic profile of the test-sample nucleic acid molecules isolated at step b); d) comparing the test-sample genetic profiles against the recorded genetic profiles;

e) using a match at c) to assign a batch of origin.

According to another aspect of the present invention there is provided the use of at least one artificially created unique nucleotide sequence as an identifier of batch origin for a compound biological product.

According to another aspect of the present invention there is provided the use of at least one unique nucleotide sequence which is not otherwise inherently present in the compound biological product as an identifier of batch origin for a compound biological product.

Optionally, in the present invention there may be provided an additional step, (after performing step i),) of storing the discrete sources of said unique nucleotide sequence(s) for subsequent use with steps ii - iv) above.

The term "compound biological product" refers to any product which includes a component (i.e. contributor) from more than one discrete biological source. In general, the biological sources may be from organisms such as a plants or animals, or part(s) thereof. Preferably, the compound biological product will be a food product.

For ease of reference, the term "compound biological product" will hereinafter be generally referred to as a compound meat product, such as ground beef. For the purposes of disclosing this methodology, the inventors have exclusively used meat patties made from ground beef. However, this should not be seen as limiting, as the present invention is applicable to animal products other than beef, and to compound biological products other than meat. For example, the present invention may be equally applicable in determining the composition and origin of components in other biological products such as processed foods including animal products therein, animal feed, or so forth.

In preferred embodiments of the present invention the compound biological product will be a compound meat product. Preferably, such as sausage meat, meat patties or the like.

The term "batch" as used herein should generally be taken to mean a defined quantity of compound biological product, identified as being produced from components obtained from exactly the same biological sources at a specific time, date and place of manufacture. Batch production and recording of batch information is standard practice within the food industry.

The term "nucleic acid molecule" as used herein may be an RNA, cRNA, genomic DNA or cDNA molecule, and may be single - or double - stranded. The nucleic acid molecule may also optionally comprise one or more synthetic, non- natural or altered nucleotide bases, or combinations thereof.

The term 'nucleotide sequence' as used herein refers to the specific order of nucleotides in a nucleic acid molecule.

The term 'nucleotide(s)' as used herein refers to the subunits of DNA (i.e. adenosine (A), guanine (G), thymine (T), or cytosine (C)), and the subunits of RNA (i.e. adenosine (A), guanine (G), uracil (U), or cytosine (C)), which form the basis of the genetic code by the order in which the subunits appear in a DNA or RNA molecule.

For ease of reference only the term 'unique nucleotide sequence' will now be referred to as a 'unique DNA sequence'. In a similar manner any references to 'DNA' herein should not be seen as limiting unless context clearly dictates otherwise. Throughout this description, the term 'specific unique DNA sequence' or 'unique DNA sequence' refers to a clearly identifiable nucleotide sequence which is sufficiently rare having regard to the compound biological product so as to be capable of acting as a meaningful identifier of a given batch.

Where the unique DNA sequence is obtained from the same biological source (i.e. same type of plant, animal or other organism) as that forming the major constituent of the compound biological product, the term 'unique DNA sequence' includes:

a) a 'rare allele' being an allele at a specific DNA marker that is known to occur at a very low frequency in the extant population;

b) a 'unique genetic mutation' being a DNA polymorphism that is known to occur only in a very low frequency of animals at a specific locus;

c) any combination of a) and/or c) and/or together with one or more wild- type-alleles.

Ideally, a 'rare allele', found in an individual or sub-population of animals, will be sufficiently rare, if it occurs naturally in less than 1% of the extant general population, or has an allele frequency of less than 0.01.

In further preferred embodiments, where the compound biological product is made from an animal, the animals from which the rare allele is obtained may be of the same general type of animal as that predominantly used in the manufacture of the compound biological product.

Alternatively, if the unique nucleotide sequence is obtained from a different biological source to the compound biological product, or is an artificially created sequence, said sequence should be sufficiently rare to be-capable of specifically identifying a batch.

The term 'sufficiently rare' refers to a sequence being unique with respect to other sequences used to identify other batches for a given time period. In general, the given time period will be determined after a consideration of the time period over which batch information for a particular compound biological product needs to be retrievable.

Thus, in some embodiments where a specific unique nucleotide sequence has been used beforehand for a previous batch, and wherein said unique nucleotide sequence is also proposed to be used to identify a further batch, then step ii) may require selection of either at least one further unique nucleotide sequence and/or alternately other nucleotide sequences, so as to distinguish the subsequent batch from the earlier batch.

The term 'wild-type' refers to the DNA sequence at the locus of a unique genetic mutation that does not have the mutation and therefore occurs naturally in the majority of the extant population. Thus, it should be appreciated by those skilled in the art that the term 'unique DNA sequence' also encompasses non-wild^type DNA sequences.

In general, the unique nucleotide sequence may contain 1 or more polymorphisms of which at least one may be regarded as being sufficiently rare.

It is envisaged the identification of unique DNA sequences may be achieved in a variety of different ways without departing from the scope of the present invention.

In general, the unique DNA sequences may be identified via a multistep process which may include one or more of the following steps: • locating discrete sources of potential unique DNA sequence(s);

• creating a synthetic or semi-synthetic unique DNA sequence(s);

• creating a potentially unique DNA sequence from a combination of discrete DNA sequences;

• confirming that a potential unique DNA sequence is an actual unique

DNA sequence.

The location of potential discrete sources of unique DNA sequences will be dependent on a number of factors, including the nature of the compound biological product itself.

In preferred embodiments, potential discrete sources of unique DNA sequences may be obtained via genetic screening techniques of animals such as, but not limited to, direct DNA sequencing, amplifying microsatellite markers, or detecting Single Nucleotide Polymorphisms looking for rare alleles or unique genetic mutations and combinations of same.

A number of criteria may be employed for selecting a unique nucleotide sequence which will be self evident to those skilled in the art. In general, the unique nucleotide sequence selected should be compatible with the compound biological product, any processing of the compound biological product, and/or any end use of the compound biological product.

What constitutes a sufficient amount of a unique DNA sequence depends on a plurality of factors including, but not limited to:

• the total weight of the batch before it is dismantled into its smaller parts; • the manufacturing method employed to make the compound biological product;

• the mixing efficiency of the batching process;

• the methodology used for detecting the unique DNA sequence in the laboratory;

• the method of including the unique DNA sequence in the mixture; and

• the expected sample size used for detecting the presence of the unique DNA sequence.

In general, a sufficient amount may be a quantity of the unique nucleotide sequence which has a sufficient concentration within the compound biological product to be detected after taking a sample of the patty.

Thus, in some embodiments where a random sample is to be taken (i.e. in compound biological products) where the unique DNA sequence is added to the overall mixture, the concentration of said unique DNA sequence will have to be sufficient to minimise the chances of wrongly not detecting in a test-sample due to non-homogenous mixing of the mixture during manufacture of the compound biological product.

For example, if the compound biological product is a meat patty and the unique DNA sequence is added to the mixture during manufacture of the compound biological product as ground meat, said ground meat containing the unique DNA sequence would need to be at least 10% of the total weight of the batch. As the inventors have found that a rare allele added as ground meat to a mixture of ground beef at less than 10% of the total weight of the mixture cannot reliably be detected using routine methodologies. In further preferred embodiments, the unique nucleotide sequence is placed in a predetermined position on, or within, the compound biological product, to aid subsequent detection thereof, such that the amount of unique nucleotide sequence required for identification purposes will be less.

The unique nucleotide sequence(s) that is/are added to the items of a batch may be obtained:

• directly from the discrete source (e.g. meat from an animal having a rare allele); or

• indirectly from the discrete source (e.g. an artificially assembled nucleotide sequence based on the original nucleotide sequence of the discrete source).

In preferred embodiments of the present invention unique natural, semisynthetic, DNA sequence, may be added to each batch of ground beef as it is produced, for the purposes of future identification.

In some embodiments, unique synthetic bovine DNA sequences will be used. These may take the form of short single strand sequences of synthetic DNA designed with specific recognition sequences at the both the 3' and 5' ends to be used for positive identification. For example, a suitable synthetic sequence could be something along the lines of:

AAACCCGGGTTTNNNNNNNNACGTACGTACGTACGTACGT .

Although, those skilled in the art will recognise that this is an illustration only and such recognition sequence is not limited to the example given.

In preferred embodiments a natural unique DNA sequence in the form of meat from an animal that has a known low-frequency (i.e. rare) allelic polymorphism, may be mixed through, or placed strategically, during the manufacturing process within the mixture for future identification.

In preferred embodiments the natural unique nucleotide sequence may be in the form of meat that has been freeze dried and reduced to a powder. Preferably, said meat containing one or more known unique polymorphisms.

The use of freeze dried powdered meat containing a unique nucleotide sequence in a compound biological product.

The inventors have found reducing the size of the meat particles improved the distribution of the unique nucleotide sequence throughout a compound biological product such as a meat patty.

In some embodiments the natural unique DNA sequence may be in the form of a small quantity of whole blood.

In some embodiments a number of natural and/or synthetic unique DNA sequences may be available for use in any given batch, with varying combinations being used to mark specific batches of ground beef.

In some embodiments the known unique DNA sequence may be added to a compound biological product in such a way that its location is specified and it can only be found in a predetermined place.

In one preferred embodiment the unique DNA sequence may be added to a meat patty in the predetermined position an example of which is shown in, but not limited, to Figure 1.

In some embodiments, analysis of the specific site allows the determination of the presence or absence of the known specific DNA sequence to confirm or refute batch and/or manufacturer. When a sample of ground beef thought-to come from a certain batch needs to be identified, the sample can be screened to determine whether the appropriate combination of known specific DNA sequences are present in the sample. If a match with the expected known specific DNA sequences cannot be confirmed, the sample can then be analysed with primers for the whole suite of known specific DNA sequences available, to confirm or refute whether the ground beef product was in fact produced by the factory concerned. It is envisaged such testing may also be expanded to determine country of origin of compound biological products.

As the synthetic sequences will be added in minute quantities and may be merely copies of known bovine DNA sequences, it is likely these will be exempted from labeling requirements, being classed as processing aids for their technical or functional effect.

Further, as the exact sequences will be known and in a pre-specified location, it will be possible to identify the batch of ground beef that any given sample originated from with very high levels of certainty, further improving methods of identification and traceability. The natural DNA sequence, allows a ground beef sample to be matched to the manufacturer, and where appropriate to the batch it originated from, very accurately.

The genetic profile of the unique DNA sequence may be recorded in a database. Most preferably, a computer database.

According to a further aspect of the present invention there is provided a computer database which includes a plurality of genetic profiles corresponding to unique nucleotide sequences each profile being assigned to batch information for compound biological products. In general, once a unique DNA sequence has been selected the genetic profile on the database is assigned batch information.

In some embodiments a sample of the unique nucleotide sequence may be stored, in a DNA reference library, in addition to recording the genetic profile of the sample for a database.

The term "genetic profile" should generally be taken to refer to genetic information detailing one or more markers of interest for distinguishing individuals, or a group of individuals. A genetic profile can indicate the distribution of the alleles, or a number of polymorphic genetic markers, e.g. SNPs or microsatellites, or, can be information that indicates subtle changes in the pattern of allelic variation in samples that contain DNA or RNA from many individuals.

The term "database" as used herein refers to a structured set of data (i.e. genetic profiles) which is stored in a readily retrievable and secure location.

The term "computer database" is as used herein refers to a database which is stored in a computer or like device.

In general the term "computer" as used herein refers to a device which includes a central processing unit or the like and an associated memory device.

In preferred embodiments the database may contain batch information on each unique DNA sequence for the purposes of cross referencing during later identification.

The term "batch information" as used herein refers to any unique combination of symbols or other information which can be stored for subsequent retrieval that is capable of distinguishing one batch from another batch so as to act as an identifier. In preferred embodiments the batch information may be an alphanumeric identifier.

In preferred embodiments the batch information may be a unique combination of alphanumeric symbols.

In some preferred embodiments the batch information may be a unique combination of numeric symbols.

In some further embodiments prior to selecting a unique nucleotide sequence for use with a batch, the unique DNA sequence may be assigned to a specific manufacturer for subsequent use in relation to batches of compound biological product by that manufacturer.

The detection of the presence or absence of the known specific DNA sequence may be done using any suitable techniques, including those standard molecular biology techniques presently known in the art, or by those developed in the future. Suitable known techniques involve DNA extraction and preparation, and PCR/RFLP (Pourzand & Cerutti, 1993; Parsons & Heflich, 1997) or PCR with DNA sequencing of the PCR product.

The term "match" as used here refers to a genetic profile derived from a test sample being found to correspond to a genetic profile of a reference-sample record. In some cases X number of genetic profiles must be derived from the test sample and these profiles must correspond to X number of reference sample records in order for there to be a match.

The term "individuals" refers to animals, or parts thereof which are used in producing a compound biological product. In preferred embodiments of the present invention the compound biological product will be a compound meat product, such as sausage meat, meat patties or the like.

Throughout this specification, the term "allele" shall refer to a genetic variant of a genetic locus that is polymorphic.

As used herein, the term "locus" (pi. loci) refers to a position on a chromosome, gene or other DNA sequence.

As used herein, the term "marker" shall refer to an identifiable difference in nucleotide sequence at a known location, on a strand of DNA of an animal which is capable being used to distinguish individuals. The term "marker" includes: microsatellites, SNPs and DNA sequences, which are polymorphic.

Throughout the specification, the term "polymorphic" refers to something having two or more distinct forms - i.e. having at least two different nucleotide sequences.

Throughout the specification the term "microsatellite" refers to a type of marker which comprises a short sequence of nucleotides that is repeated. For example, the microsatellite ATAATAATAATA is a repeat of the ATA nucleotide sequence. Where individuals have microsatellites of different lengths (i.e. more or less repeats), these are useful markers to distinguish individuals.

In preferred embodiments, DNA is obtained and then processed to obtain a genetic profile. In some embodiments, RNA may be used to obtain a profile for subsequent analysis by the method of the present invention. In some embodiments, single nucleotide polymorphisms (SNPs) may be used to distinguish between different batches of a compound biological product. As used herein, the term "single nucleotide polymorphic" or "SNP" refers to a single nucleotide which differs from that usually found at a locus.

The term "test sample" as used herein refers to a sample taken from a compound biological product to be identified.

Groups of the markers may preferably be compared (i.e. analysed) simultaneously using standard techniques known in the art, such as multiplex or parallel analysis systems.

References: Shuber et. al.,1995. A simplified procedure for developing multiplex PCRs Genome Research 5: 488-493; Henegariu et. al., 1997. Multiplex PCR: Critical parameters and a step-by-step protocol are detailed in BioTechniques 23(3) 504-511.

In preferred embodiments, the genetic profiles may be obtained from at least one, but preferably more, unique genetic markers which may be able to be multiplexed (i.e. analysed together).

It is understood that with knowledge of the art multiplexing systems may be designed that group the markers in different groups and group sizes. Different multiplexes may used in some embodiments even though the aggregate marker group remains unchanged.

In some embodiments, different aggregate marker groups may be used for different applications.

In preferred embodiments, the microsatellite markers of the test sample and unique DNA sequences may be analysed in either an ABI PRISM 3100 or ABI PRISM 3730 Genetic Analyser (Applied BioSystems) and scored with Genotyper v3.7 or Genemapper v3.0 software respectively (Applied BioSystems), to produce a genetic profile. However, this should not be seen as limiting as other DNA analysers and software may be used, and improved technology may become available in the future.

Both programmes generate a DNA 'signal' profile and allow the assignment of values to each DNA fragment for fragment size (a form of speed of migration in the capillary and the number of base-pairs of DNA in the fragment) which, following analysis are represented as peaks with their height and area expressed in relative fluorescence units (r.f.u). Each sample should comprise peak scores at all of the markers.

In further embodiments of the present invention, the component particles of the test step may be reduced down to a single cell.

The isolation and extraction of single cells allows the present invention to be used in products where the size of the component particles is much smaller than those found in ground meat.

In preferred embodiments of the present invention, the genetic profiles may be obtained in relation to a set of known animal microsatellite markers. For example, genetic profiles for bovine microsatellite markers may be obtained, however this should not be seen as limiting. The markers may also be bovine SNPs or other unique DNA markers. Some such markers are commonly used for parentage testing. Although, to date, until the present invention, it has been difficult to use microsatellites as a method of tracing individual animals in compound mixtures as described by Egeland, Dalen and Mostad, 2003 and Dodds and Shackell, 2004.

The microsatellite markers preferably used contain two base pair repeats, giving length variants which are a minimum of two base pairs from their nearest neighbours. Frequently, small amounts of fragments two, four or occasionally six base pairs smaller than the actual allele are also amplified, a phenomenon referred to as stutter.

Thus, certain preferred embodiments of the present invention may have a number of advantages over the prior art which can include:

• the enhanced traceability of compound biological products by utilising unique DNA sequences as the indicators of batch origin;

• the enhanced traceability of compound biological products by positioning the unique DNA sequences in a predetermined location on the compound biological product;

• the ability to generate unique nucleotide sequences for use as markers of batch origin;

• providing a verifiable non-paper based batch identification method;

• helping reduce the time taken to obtain batch information about a compound biological product.

• providing a simple method for subsequent identification of batch origin where DNA is obtained from the compound biological product and then processed to detect the presence or absence of the known specific unique DNA sequence.

• providing a simplified batch identification method which does not require genotypes of all or any of the contributors to a compound biological product. • providing a batch identification method which can utilize a unique combination of known short nucleotide sequences to identify a batch.

Brief Description of Drawings

Further aspects of the present invention will become apparent from the following description which is given by way of example only and with reference to the accompanying drawings in which:

Figure 1 shows an example of a typical location point of a known DNA sequence added to a meat patty for identification purposes. The photo shows patties prior to final forming. The patty on the left is normal, the middle patty has meat carrying a specific low frequency allele added to it. The patty on the right has had the added meat covered over to incorporate the known DNA into the patty matrix. Note that in this series of pictures the size of the added material is considerably larger than would be used in preferred embodiments and is for illustration only.

Figure 2 shows observed values plotted against log 10 of the rare allele % and predicted curves of the mixtures.

Best Modes for Carrying out the Invention

As defined above, in its primary aspect, the present invention is directed to a method for the identification of a compound food product and the subsequent identification of the batch of origin. The invention has particular application to compound meat product such as ground beef. However, this should not be seen as limiting the scope of the present invention to other compound biological products. The batch being tested will be declared as not the probable source if the known specific DNA sequence is detected in none of the trace samples.

INITIAL STUDIES

Experimental trials

For the purposes of demonstrating the methodology, meat from an animal carrying a known unique genetic mutation was used. The animal was heterozygous for a mutation (nt419(del7-ins10)) in exon 2 of the myostatin gene. This DNA mutation occurs exclusively in some, but not all, Maine-Anjou cattle

(Grobet et al, 1998) and was chosen because of its rarity. The inventors found the mutation to occur at an allele frequency of 0.035 in a group of Maine Anjou animals that they screened.

Maine Anjou cattle are a minority breed in NZ contributing less than 1 in 20,000 of the national beef cow herd of approximately 1.6 million animals. Furthermore, because the polymorphism is associated with double-muscling, breeders actively select against the mutation phenotype. Therefore, the probability of this mutation being present naturally in ground beef sourced from New Zealand is extremely low.

It will be appreciated by those skilled in the art, that other mutations, either known or yet to be discovered, can be used for the purpose described.

It will also be appreciated by those skilled in the art, that each mutation or DNA sequence will require its own protocol and primer design and that the protocols described herein are not limiting in terms of the invention. Protocol

A series of experiments were designed to investigate the potential for using PCR/RFLP technology to identify batches of a compound meat product.

DNA Preparation

Laboratory meat mixture samples weighing 10g were homogenised in 15ml_ TE buffer for 10-15s at 11 ,000 rpm using a high-speed disperser (Ultra Turrax, IKA). The homogeniser probe was dismantled and cleaned between every sample. Factory mixture samples (whole patties) weighing approximately 15Og were homogenised in 50OmL RO water for 10-15s at maximum speed using a Breville Optiva kitchen blender. The blender was cleaned between every sample. In both cases DNA was extracted from a 180μL aliquot of the homogenate using a commercial DNA extraction kit (DNeasy, Qiagen).

Detection of the specific DNA sequence in the mixture:

The method to detect the specific DNA sequence in meat mixtures currently uses Platinum^® Taq DNA Polymerase High Fidelity and PCR amplifications were carried out using an Eppendorf Mastercycler ep Gradient machine with the following primers (5' →3');

AF 1 = GCTGATCTTCTAACGCAGGTGG

AR1 = GGATTTGCACAAACACTGTCG.

These primers amplify the region in exon2 of the cattle myostatin gene which contains the rare allele found exclusively in double muscled cattle of the Maine Anjou breed. It will be appreciated by those skilled in the art that other primers, reagents, equipment and methods can be used to detect the presence of known specific DNA sequences which may be employed in the present invention. Each 21 μl reaction contained approximately 50ng DNA, 1X High Fidelity PCR Buffer, 0.2mM dNTPs, 0.5pmol/μl of each primer, 2mM MgSO4, 1.0 unit Platinum® Taq DNA Polymerase High Fidelity and 0.5 Units Tsp509 I. PCR cycling was 2 min 94°C, 35X [30sec 94°C, 30 sec 60⁰C, 1 min 68°C], 1 min 68°C, hold 10⁰C.

An additional 0.5 units of Tsp509 I was added after the PCR reaction to each product in 10μl of 1X NEBuffer 1 and an 8 hour digestion at 65°C was carried out.

Agarose Gel Electrophoresis

10μl of the reaction product solution was analysed by electrophoresis on a 1x TBE buffer (89mM Tris-base, 89mM boric acid, 2mM EDTA) 2% Invitrogen UltraPure™ agarose gel alongside an Invitrogen 1kb plus DNA ladder standard. The gels were stained with 0.5ng/ml ethidium bromide to allow fluorescence detection of DNA bands under ultraviolet light excitation. The presence or absence of the specific DNA sequence product was recorded for each sample.

Trial 1

Genomic DNA was extracted from meat containing the known specific DNA sequence and from meat which did not contain the known specific DNA sequence (wild-type). The extracted DNA was suspended in 150μl of TE buffer and the concentration measured using a Nanodrop ND-100 spectrometer (Nanodrop technologies, USA). Each genomic DNA sample was diluted to give a final concentration of 50ng/μl. The DNA carrying the known specific DNA sequence was serially diluted 1 :3 with the wild-type DNA to give 20 samples with DNA containing the known specific sequence proportions ranging from 16.7% to * 0.000000014%. Analysis to detect the known specific DNA sequence was performed on the 20 serial dilutions.

A band was initially detected in the 0.0008% mixture. These experiments were replicated four times and although the detection end-point varied we consistently observed the MA allele at a dilution of 0.0025%

This shows that a known specific DNA sequence can be identified at levels as low as 0.0025% within a mixture.

Trial 2

Meat with the known specific DNA sequence was combined in the laboratory with meat from a wild-type animal to result in known specific DNA sequence concentrations of 10.00 %, 1.00 %, 0.1 %, 0.01% and 0.008% on a w/w basis.

Each mixture was made up to a constant total weight of 3.Og. Analysis to detect the known specific DNA sequence in laboratory mixtures of meat containing known specific DNA sequence mixed with supermarket beef mince, the known specific DNA sequence was reliably observed at 1.0% w/w was performed on duplicate samples from the 5 mixtures.

This demonstrates that it is possible to detect a known specific DNA sequence at 1.0% w/w within a meat mixture when the DNA has not been placed in a specific location, but is incorporated as part of the mixture.

Trial 3

Meat with the known specific DNA sequence was combined with anonymous frozen trim cuts at a factory manufacturing plant to result in known specific DNA sequence concentrations of 10.00%, 1.00%, 0.1%, and 0.008% on a w/w basis before being made into in batches of meat patties. All patties were collected from each batch as they were produced, numbered sequentially and frozen at - 20⁰C. Every 10^th patty from each batch was analysed to determine the batch with the highest concentration of the known specific DNA sequence at which the known specific DNA sequence was not seen in every patty sample. Subsequently, every patty in the 10% batch, and every 5^th patty in each of the other batches, was also analysed.

The known specific DNA sequence was detected in at least one of the patties tested from all batches. The proportion of the patties tested where the known specific DNA sequence was detected varied from 0.92 in the 10% factory batch to 0.031 in the patties tested in the 0.008% factory batch.

This demonstrates that the detection of the known specific DNA sequence becomes more difficult in meat mixtures created either in the laboratory or in a ground beef patty manufacturing plant, and consistent detection is lost with the known specific DNA sequence comprising 1% (lab mixes) and 10% (factory mixes) of the ground beef.

Trial 4

A small amount of freeze dried ground meat (approximately 0.01 gm) containing a known specific DNA sequence was added to the centre of four ground beef patties. These patties and two patties which did not have the meat containing the known specific DNA sequence added were then re-labelled anonymously by a third party and the correct identity of each patty recorded. DNA was extracted and analysis performed blind on the six patties in the group to detect the presence or absence of the known specific DNA sequence. In all cases the known specific DNA sequence was detected as present or absent correctly, according to the recorded identities of each patty by the third party. This demonstrates that detection of the known specific DNA sequence is possible when the known specific DNA sequence is placed in a specific place on the patty at very low concentrations (approximately 0.6x10*%, of the weight of a typical beef patty).

FURTHER STUDIES

Materials and Methods

We initially undertook further studies by adding meat from a sheep homozygous for the Booroola gene to beef mixtures at concentrations as low as 1 % w/w. The Booroola genotype is a mutation (Q249R) in the highly conserved intracellular kinase signalling domain of the BMP-IB receptor (Wilson et al, 2001), and is not known to occur in cattle.

In a series of further studies we investigated the detection limits when beef from a known individual was incorporated within a beef mixture at concentrations as low as 0.008% w/w, by selectively amplifying a short unique DNA sequence. The animal was heterozygous for a mutation (nt419(del7-ins10)) in exon 2 of the myostatin gene (hereafter referred to as the MA allele). This DNA mutation occurs exclusively in Maine-Anjou cattle (Grobet et al, 1998) and was chosen for the present study because of its rarity. Maine Anjou cattle are a minority breed in NZ contributing less than 1 in 20,000 of the national beef cow herd of approximately 1.6 million animals. Furthermore, because the polymorphism is associated with double-muscling, breeders actively select against the mutation phenotype. We screened 130 Maine Anjou animals and identified 7 that were heterozygous and 1 that was homozygous for the mutation (allele frequency = 0.035). On this basis, we assume that the New Zealand beef herd predominantly contains the wild-type allele and that the predicted allele frequency of the mutation in the extant population is <0.00002. Procurement and preparation of meat samples:

A ram known to be homozygous for the Booroola mutation was slaughtered at an approved factory slaughterhouse and the meat frozen at -2O⁰C until use.

In the laboratory, ground meat from an animal carrying the Booroola allele was combined with supermarket ground beef mince (B laboratory) to result in concentrations of 50.0%, 25.0%, 12.5%, 6.3%, 3.1%, 1.6%, 0.8%, 0.4%, 0.2% and 0.1% on a w/w basis. Analysis to detect the Booroola allele was performed on duplicate samples of the 10 mixtures.

Meat with the Booroola allele was also added during processing to a batch of meat patties manufactured from anonymous frozen beef trim at a factory manufacturing plant (B Factory) to result in a concentration of 10% on a w/w basis. All the patties were collected from the batch as they were produced, numbered sequentially and frozen at -20⁰C. Analysis to detect the Booroola allele was performed on a subset of every 10^th patty of the batch.

One hundred and thirty Maine Anjou cattle from two different herds were screened to find animals that carried the MA allele, of the myostatin gene. Seven heterozygous and one homozygous animal were identified. Because the homozygote animal was not available, one of the heterozygote animals was chosen to provide meat for the study. The animal was slaughtered at a factory abattoir and the meat kept frozen at -2O⁰C prior to use. When mixtures were created using this meat, the contribution of the MA allele in the mixture was calculated on the assumption that half was contributing the MA allele and half was contributing a wild-type allele due to the heterozygocity of the animal at this locus. For example, to create a meat mixture containing 5% w/w of meat containing the MA allele the meat from the heterozygous animal was included in the mixture at 10% w/w. DNA was extracted from meat containing the MA allele and from meat containing only the wild-type allele. The extracted DNA was suspended in 150πi of TE buffer and the concentration measured using a Nanodrop ND-100 spectrometer (Nanodrop technologies, USA). Each genomic DNA sample was diluted to give a final concentration of 50ng/Dl. The DNA carrying the MA allele was serially diluted 1 :3 with the wild-type DNA (MA DNA) to give 20 samples with MA allele proportions ranging from 16.7% to 0.000000014%. Analysis to detect the MA allele was performed on the 20 serial dilutions.

Meat with the MA allele was combined in the laboratory with meat from a wild- type animal (MA lab) to result in rare allele concentrations of 10.00 %, 1.00 %, 0.1 %, 0.01% and 0.008% on a w/w basis. Each mixture was made up to a constant total weight of 3.Og. Analysis to detect the MA allele was performed on duplicate samples from the 5 mixtures.

Minced meat with the MA allele was combined with anonymous frozen trim cuts at a factory manufacturing plant (MA factory 1) to result in concentrations of

10.00%, 1.00%, 0.1%, and 0.008% of the MA allele on a w/w basis before being made into in batches of meat patties. All patties were collected from each batch as they were produced, ordered sequentially and frozen at -20⁰C. Every 10^th patty from each batch was analysed to determine the batch with the highest concentration of the MA allele at which the allele was not seen in every patty sample. Subsequently, every patty in the 10% batch, and every 5^th patty in each of the other batches, was also analysed.

In a second experiment, minced meat with the MA allele was combined with anonymous frozen trim cuts at a factory manufacturing plant (MA factory 2) to result in rare allele concentrations of 2.50%, 0.50%, and 0.25% on a w/w basis before being made into in batches of meat patties. In a third experiment meat, meat with the MA allele was freeze dried for approximately 72 hrs in an FD 57 horizontal freeze drier (Cudden Ltd) and then reduced to a powder in a Breville Optiva kitchen Blender. The meat was weighed before and after freeze drying and the equivalent weight of the powder was calculated:(e.g. xg powder was equivalent to yg wet meat). The freeze dried meat was subsequently combined with the dry ingredients (black pepper, whey protein concentrate, food starch, and salt) of a batch of patties at a factory manufacturing plant (MA factory 3) to result in rare allele concentrations of 2.50%, 0.50%, and 0.25% on a w/w basis equivalent to the weight before freeze drying (1.3%, 0.25% and 0.12% w/w of dry freeze dried powdered meat weight in the total batch weight).

In experiments 2 and 3 all patties were collected from each batch as they were produced, packed into sleeves, which were ordered sequentially, and frozen at - 20⁰C. Three patties from each sleeve were selected from the top, middle and bottom of the sleeve and analysed.

DNA extraction

Laboratory meat mixture samples weighing 10g were homogenised in 15mL TE buffer for 10-15s at 11 ,000 rpm using a high-speed disperser (Ultra Turrax, IKA). The homogeniser probe was dismantled and cleaned between every sample. Factory mixture samples (whole patties) weighing approximately 15Og were homogenised in 50OmL RO water for 10-15s at maximum speed using a Breville Optiva kitchen blender. The blender was cleaned between every sample. In both cases DNA was extracted from a 180μL aliquot of the homogenate using a commercial DNA extraction kit (DNeasy, Qiagen). Detection of the Booroola allele in mixtures.

All PCR amplifications were carried out using an Eppendorf Mastercycler ep Gradient machine. The primary PCR reaction was in a volume of 5μL containing 0.2 pmol/μL of each of the following primers (5'→3');

Forward = ACGTTGGATGCCAAGATGTTTTCATGCCTC

Reverse = ACGTTGGATGTTCTTCACTACAGAGGAGGC

The primers were mixed with 1X HotStarTaq® buffer, 2.5mM MgCI2, 200μM dNTPs, 0.1 unit HotStarTaq® and 2.5ng DNA. PCR cycling was 15min 94°C, 45X [20 sec 94°C, 30 sec 56°C, 1 min 72°C], 3 min 72°C, hold 4°C. The primary PCR product was dephosphorylated using shrimp alkaline phosphatase and a mass extend reaction performed with the primer (5'→3') CATGCCTCATCAACACCGTC to produce allele specific products.

The reaction was spotted onto a Sequenom chip and analysed using a Biflex-3 Mass Spectrometer (Sequenom, USA) producing peaks of 6255.1 Daltons for nucleotide 'G' (Booroola allele) and 6599.3 for nucleotide 'A' (wild-type allele).

Detecting the Maine Anjou allele

Method for identification of MA allele in Maine Anjou animals

PCR amplifications were carried out using an Eppendorf Mastercycler ep Gradient machine with the following primers (5' →3');

AF1 = GCTGATCTTCTAACGCAGGTGG

AR1 = GGATTTGCACAAACACTGTCG. Each 21 μl reaction contained approximately 50ng DNA, 1X Eppendorf HotMasterMix^®, 0.5pmol/μl of each primer. PCR cycling was 2 min 94^CC, 35X[30sec 94°C, 30 sec 6O⁰C, 1 min 68°C], 1 min 68°C, hold 10⁰C.

0.5 units of Tsp509 I was added after the PCR reaction to each product in 10μl of 1X NEBuffer 1 and an 8 hour digestion at 65°C was carried out.

Products were analysed using agarose gel electrophoresis as described below

Method for detection of MA allele at low concentration in a mixture

To detect the MA allele we modified a previously published method, PCR/RFLP which allows for preferential amplification of a single nucleotide polymorphism allele by using a restriction enzyme to destroy the other allele as it is amplified (Pourzand & Cerutti, 1993; (Parsons & Heflich, 1997).

The limit of RFLP/PCR to detect rare alleles is influenced by the fidelity of the Taq polymerase used, as any mutation of the wild-type sequence that removes the Tsp509 I restriction site is selected for and interferes with amplification of the rare allele. For this reason we compared the detection limit of a "normal" Taq polymerase (Eppendorf HotMasterMix^®) with a high fidelity polymerase (Platinum^® Taq DNA polymerase High Fidelity). Concomitantly, we also examined the optimal number of amplification cycles required to detect the MA allele.

The wild-type allele of the rare MA allele, contains a restriction site for a thermostable restriction enzyme Tsp509 I. This enables the use of preferential selection by PCR/RFLP for the rare allele. The PCR product from the wild-type allele is selectively destroyed during PCR, thereby increasing the sensitivity of detection of the rare allele which gives a 151bp PCR product DNA containing the MA allele was serially diluted with DNA containing only the wild-type allele. Platinum^® Taq DNA Polymerase High Fidelity (Invitrogen™) and Eppendorf HotMasterMix^® (Progen Biosciences, USA) were compared to determine whether using High Fidelity Platinum^® Taq increased the sensitivity of the test. A PCR reaction was performed with each variety of Taq at both 32 cycles and 35 cycles. Detection of the rare allele for the wild-type DNA, DNA from a heterozygous animal, 20 serial dilutions of the rare allele in wild-type DNA samples and a negative control were compared.

The method using HotMasterMix^® followed the protocol described in the method for identification of MA allele above, with the addition of 0.5 Units Tsp509 I in the

PCR cocktail. PCR/RFLP amplifications using Platinum^® Taq DNA Polymerase

High Fidelity were carried out in an Eppendorf Mastercycler ep Gradient machine as described below. An additional 0.5 units of Tsp509 I was added after the

PCR reaction to each product in 10μl of 1X NEBuffer 1 and an 8 hour digestion at 65^CC was carried out. The PCR products were analysed by agarose gel electrophoresis and showed an uncut 151bp band for the MA allele when it was present.

Subsequent experiments to detect the MA allele in meat mixtures used Platinum^® Taq DNA Polymerase High Fidelity. Each 21 μl reaction contained approximately 50ng DNA, 1X High Fidelity PCR Buffer, 0.2mM dNTPs, 0.5pmol/μl of each primer, 2mM MgSO4, 1.0 unit Platinum® Taq DNA Polymerase High Fidelity and 0.5 Units Tsp509 I. PCR cycling was 2 min 94°C, 35X [30sec 94°C, 30 sec 60⁰C, 1 min 68°C], 1 min 68°C, hold 10⁰C.

Agarose Gel Electrophoresis

10μl of the reaction product solution was analysed by electrophoresis on a 1x TBE buffer (89mM Tris-base, 89mM boric acid, 2mM EDTA) 2% Invitrogen UltraPure™ agarose gel alongside an Invitrogen 1kb plus DNA ladder standard. The gels were stained with 0.5ng/ml ethidium bromide to allow fluorescence detection of DNA bands under ultraviolet light excitation. The presence or absence of the 151bp PCR product was recorded for each sample.

Statistical Analysis

The data were analysed using logistic regression by modelling the success of detecting the rare allele as a function of the rare allele frequency (log₁₀ transformed) and the mixture. The interaction between these effects was also tested and found to be not significant (p>0.05) so was not included in the final analysis model.

Results

Detection of the MA allele in genomic DNA mixtures

The results from varying the enzyme and cycle number in our RFLP/PCR detection of the MA allele are shown in Figure 2. When the PCR reaction was limited to 32 cycles we were able to detect the MA allele at 0.02% using Eppendorf HotMasterMix^® and 0.06% using Platinum^® Taq DNA polymerase High Fidelity. Increasing the number of cycles to 35 and using Eppendorf HotMasterMix^® gave us a false positive band in the wild-type control sample and bands occurred right along the dilution series. With the increased cycle number we believe we are showing selection of a mutation that has occurred in the TSP509 I site. When Platinum^® Taq DNA polymerase High Fidelity at 35 PCR cycles was used a band was initially detected in the 0.0008% mixture. These experiments were replicated four times and although the detection end-point varied for Platinum^® Taq DNA polymerase High Fidelity at 35 cycles we consistently observed the MA allele at a dilution of 0.0025% (see Figure 1). Detection of the Booroola allele and MA alleles in ground beef

A summary of the results of these tests are shown in Table 1. The Booroola allele was observed in 96% of factory-made patties containing 10.0% w/w Booroola meat. When a dilution series of mixtures of Booroola meat in supermarket beef mince were created in the laboratory detection of the Booroola allele was lost between 6.3 and 3.1% w/w.

Table 1 : Results of rare allele detection in four different mixtures of meat

Proportion in

Number of Samples Rare Allele which the

Mixture" % rare allele samples analysed* Observed rare allele was detected

B factory 10.0 355 55 53 0.96

B lab 50.0 2 2 2 1.00

25.0 2 2 2 1.00

12.5 2 2 2 1.00

6.3 2 2 2 1.00

3.1 2 2 0 0

1.6 2 1 0 0

0.8 2 2 0 0

0.4 2 2 0 0

0.2 2 2 0 0

0.1 2 2 0 0

MA factory 1 10.0 170 168 155 0.92

1.0 170 34 28 0.82

0.1 170 34 7 0.21

0.008 160 32 1 0.03

MA factory 2 2.5 200 28 26 0.93

0.5 200 27 21 0.78

0.25 200 29 20 0.69

MA factory 3 2.5 200 29 29 1.00

0.5 200 30 30 1.00

0.25 180 28 23 0.82

MA lab 10.0 2 2 2 1.00

1.0 2 2 2 1.00

0.1 2 2 0 0

0.01 2 2 0 0

0.008 2 2 0 0

Ten samples for which no genotype result was recorded were not included in the analysis

* see Materials and Methods for a full description of each mixture In laboratory mixtures of Maine Anjou meat mixed with supermarket beef mince, the MA allele mutation was reliably observed at 1.0% w/w. In factory patties containing Maine Anjou meat we detected the MA allele in at least one of the patties tested from all batches. When the meat containing the MA allele was included as ground beef the proportion of the patties tested where the MA allele was detected varied from 0.92 in the 10.0% MA factory batch to 0.031 in the patties tested in the 0.008% MA factory batch. When the MA allele was added as freeze dried meat and mixed with the dry ingredients the MA allele was detected in all patties tested in the 0.5% and 2.5% batches and 0.82 of the patties tested in the 0.25% batch.

As might be expected, the proportion of samples from batches or mixtures where the MA allele can be detected increases with the concentration of the allele in the mixture. We compared the sensitivity of detection of the various meat mixtures (Table 2), the detection level of the Booroola allele in factory patties was significantly lower than detection of the allele in laboratory mixtures (p<0.008), but not significantly different from either of the MA mixtures. There was no significant difference in detection of MA or Booroola alleles between the two laboratory mixtures. Detection of the MA allele did not differ significantly between the mixtures containing meat.

Table 2: Comparison of the Chi-square significance probabilities for the differences in observing a rare allele, in six different meat mixtures. For a comparison that is significant, it means that the ability to detect the allele (at a given %) differs between these mixture types.

MA lab MA factory 3 MA factory 2 MA factory 1 B lab

MA factory 3 0.0252

MA factory 2 0.3419 0.0068

MA factory 1 0.8897 < 0001 0.0019

B lab 0.0592 <.0001 <.0001 0.0013

B factory 0.8273 0.0163 0.3934 0.5895 0.0077 Discussion

Using the methodology we have described, it is possible to detect a specific known rare allele after mixing genomic DNA that carries an allelic mutation at very low concentrations (<0.01%) with DNA carrying the wild-type allele.

The detection of the rare allele becomes more difficult in meat mixtures created either in the laboratory or in a ground beef patty manufacturing plant, and consistent detection is lost with meat containing the rare allele comprising 1% (lab mixes), 10% (factory mixes experiment 1) and 0.25% (factory mixes experiment 3) of the ground beef. The most likely explanation for this is a loss in the efficiency of dispersing the rare allele throughout the mixture of ground beef

For the rare allele to be consistently detected it must be present in every sub- sample (patty) from the mixture. Therefore, as particle sizes increase the efficiency of mixing becomes crucial to detection. With the relatively gross particle size of ground beef this is an important issue and likely to be the limiting factor in any detection system using meat in this form.

A further factor in the poor detection in factory mixtures using meat containing the rare allele in ground beef form (factory experiments 1 and 2) may have been the 'stickiness' of the ground particles. The "wild-type" meat for the mixture is cut and ground at -4⁰C and is still relatively 'crumbly', whereas the 'rare allele" meat was close to ambient temperature prior to mixing. This variation could have influenced mixing efficiency. However, we believe the major influence on detection limits is the component size of ground product. The sheer particle size of ground beef does not allow very small quantities to mix through the matrix in such a way that the added meat can consistently be present in every patty at a detectable concentration. When the particle size of meat containing the rare allele is reduced by freeze drying and then crushing with a blender (factory experiment 3) the mixing improved to allow consistent detection in all the patties tested at a level of 0.5% w/w.

Including meat with a known rare allele as a component of a ground meat product offers potential use as a traceability marker for that product. A manufacturer could choose to engage a breeder or breeders to supply meat from animals with a known rare allele for inclusion in meat patties. We have shown that by using the meat with a rare allele in a freeze dried form, the mixing of the rare allele through the mixture was sufficient to allow detection at a level which may be commercially practical. When the meat with the known rare allele is freeze dried the amount needed to add to the mixture as a traceability marker is reduced by approximately 75% compared to ground beef. In addition, including the freeze dried meat to the dry ingredients was practicable in the factory setting and appeared to improve the mixing of the rare allele throughout the batch.

Conclusion

The notion of incorporating meat carrying a rare genetic mutation as a biological 'marker' traceability tool in ground beef product is limited by the efficiency of mixing the 'marker' meat through the product. This study indicates that a specific mutation can be detected when it is added as ground meat, and can be reliably detected at much lower concentrations in both a DNA mixture and a factory ground beef product if the meat used to disperse such a 'marker' is in a freeze dried powder form.

Aspects of the present invention have been described by way of example only and it should be appreciated that modifications and additions may be made thereto without departing from the scope thereof as defined in the appended claims. References

Arana, A., Soret, B., Lasa, I., & Alfonso, L. (2002) Meat traceability using DNA markers: application to the beef industry. Meat Science 61 , 367-373

Calvo, J. H., Osta, R., & Zaragoza, P. (2002). Quantitative PCR detection of pork in raw and heated ground beef and pate. Journal of Agricultural and Food Chemistry 50(19), 5265-5267. Castaldo, D. (2003). Brazilian beef labelled Irish. MeatNews.com Online, 26 September 2003

Cunningham, E. P., Meghen, C. M. (2001). Biological identification systems: genetic markers. OIE Scientific and Technical Review, 20 (2), 491-499 Dodds, K. G., Shackell, G. H. (2004). The number of alleles seen in a mixture. Abstract MTU42, in: XXIInd International Biometric Conference, Cairns, Australia, pp. 433.

Grobet, L., Poncelet, D., Royo, L. J., Brouwers, B., Pirottin, D., Michaux, C, Menissier, F., Zanotti, M., Dunner, S., & Georges, , M. (1998). Molecular definition of an allelic series of mutations disrupting the myostatin function and causing double-muscling in cattle. Mammalian Genome 9, 210-213.

Heaton, M.P., Keen, J. E., Clawson, M. L., Harhay, G. P., Bauer, N., Shultx, C, Green, BT. , Durso, L., Chitko-McKown, CG. and Laegried, W. W. (2005). Use of bovine single nucleotide polymorphism markers to verify sample tracking in beef processing. Journal of the American Veterinary Medicine Association 26 (8) 1311-1314. Hobbs, A. L., Hobbs, J. E., Isaac, G. E. & Kerr, W. A. (2002). Ethics, domestic food policy and trade law: assessing the EU animal welfare proposal to the WTO. Food Policy, 27, 437-454.

Loftus, R. (2005). Traceability of biotech-derived animals:application of DNA technology. Review of Science and Technology Off. Int. -¹EpJz .24( 1 ) : 231 -242 -

Meghen, C. N., Scott, C. S., Bradley, D. G., MacHugh, D. E., Loftus, R. T., & Cunningham, E. P. (1998). Animal Genetics 29 (Supplement 1), 48-49 Miraglia, M., Berdal, K. G., Brera, C, Corbisier, P., Hoist-Jensen, A., Kok, E J., Marvin, H. J. P., Schimmel, H., Rentsch, J., van Rie, J. P. P. F., & Zagon, J. (2004). Detection and traceability of genetically modified organisms in the food production chain. Food and Chemical Toxicology, 42: 1157-1180.

Ozawa, T., Lopez-Villalobos, N., & Blair, H. T. (2005). An update on beef traceability regulations in Japan. Proceedings of the New Zealand Society of Animal Production 65: 80-84. Pancaldi, M., Carboni, E., Paganelli, A., Righini, G., Salvi, A., Fontanesi, L., Russo, V., Davoli, R., Beretti, F., Ravaglia, S. (2006). Use of a natural tracer combined with the analysis of its DNA to guarantee the authenticity of agro-food products: the Authentifood system applied to typical dry-cured hams.. Industrie Alimentari 45(463): 1147-1153 Parsons, B. L., Heflich, R. H. (1997). Genotypic selection methods for direct analysis of point mutations. Mutation Research 387, 97-121 Pourzand, C₁ Cerrutti, P. (1993) Genotypic mutation analysis by RFLP/PCR. Mutation Research. 288, 113-121

Rust, S., Funke, H., & Assman, G. (1993). Mutagenically separated PCR (MS- PCR): a highly specific one step procedure for easy mutation detection. Nucleic Acids Research 21 (16): 3623-3629

Shackell, G. H., (2005). Traceability systems in the meat industry. Proceedings of the New Zealand Society of Animal Production 65:97-101 Shackell, G. H., Mathias, H. C, Cave, V. M., & Dodds, K. G. (2005). Evaluation of microsatellites as a potential tool for product tracing of ground beef mixtures. Meat Science 70 (2), 337-345

Shackell, G. H., Tate, M. L. & Anderson, R. M. (2001). Installing a DNA-based traceability system in the meat industry. In Proceedings of the Australasian Association for the Advancement of Breeding and Genetics 14, 533-536

Shackell, G. H. (2007) DNA traceability in the meat industry: a farm to plate continuum. New Zealand Institute of Food Safety and Technology Conference, Wellington, New Zealand. Conference handbook pp42.

Smith, P. G., Cousens, S. N., Huillard d'Aignaux, J. N., Ward, H. J. T. & Will, R. G. (2004). The epidemiology of Variant Creutzfeldt-Jacob Disease. Current Topics in Microbiology and Immunology 284, 161-191 Vazquez, J. F., Perez, T., Ureήa, F., Gudin, E., Ablornoz, J. & Dominguez, A. (2004) Practical application of DNA fingerprinting to trace beef. Journal of Food Protection 67 (5): 972-979

Wilson, T., Wu, X-Y., Juengel, J. L₁ Ross, I. K., Lumsden, J. M., Lord, E. A., Dodds, K. G., Walling, G. A., McEwan, J. C₁ O'Coniiell, A. R., McNatty, K. P., & Montgomery, G. W. (2001). Highly Prolific Booroola Sheep Have a Mutation in the Intracellular Kinase Domain of Bone Morphogenetic Protein IB Receptor (ALK-6) That Is Expressed in Both Oocytes and Granulosa Cells Biology of Reproduction 64, 1225-1235

Claims

WHAT WE CLAIM IS:

1. A method for subsequent identification of batch origin of a compound biological product, including the steps of:

i) identifying at least one unique nucleotide sequence from a discrete source and creating a genetic profile thereof;

ii) selecting at least one of said unique nucleotide sequence(s);

iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to items within a batch of compound biological product so as to allow for subsequent detection thereof;

iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

2. A method for identification of batch origin of a compound biological product, including the steps of:

i) identifying at least one unique nucleotide sequence from a discrete source and creating a genetic profile thereof;

ii) selecting at least one of said unique nucleotide sequence(s);

iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to items within a batch of compound biological product so as to allow for subsequent detection thereof; iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

characterised by the further steps of:

a) taking a test-sample of the compound biological product to be identified;

b) isolating the nucleic acid molecules present in the test-sample;

c) obtaining a genetic profile of the test-sample nucleic acid molecules isolated at step b);

d) comparing the test-sample genetic profiles against the recorded genetic profiles;

e) using a match at c) to assign a batch of origin.

3. A method for subsequent identification of batch origin of a compound biological product, including the steps of:

i) identifying at least one specific unique nucleotide sequence from a discrete source and creating a genetic profile thereof;

ii) selecting at least one of said unique nucleotide sequence(s);

iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to a predetermined position on each item of a batch of compound biological product so as to allow for subsequent detection thereof; iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

4. A method for identification of batch origin of a compound biological product, including the steps of:

i) identifying at least one unique nucleotide sequence from a discrete source and creating a genetic profile thereof;

ii) selecting at least one of said unique nucleotide sequence(s);

iii) adding a sufficient amount of selected unique nucleotide sequence(s) from the discrete source to a predetermined position on each item of a batch of compound biological product so as to allow for subsequent detection thereof;

iv) recording the genetic profile of the selected unique nucleotide sequence(s) and linking to batch information for purposes of later identification.

characterised by the further steps of:

a) taking from the predetermined position in iii) a test-sample of the compound biological product to be identified;

b) isolating the nucleotide sequence(s) present in the test-sample;

c) obtaining a genetic profile of the test-sample nucleic acid molecules isolated at step b);

d) comparing the test-sample genetic profiles against the recorded genetic profiles; e) using a match at c) to assign a batch of origin.

5. A method as claimed in any one of the preceding claims wherein (after performing step i),) there is provided the additional step of storing the discrete sources of said unique nucleotide sequence(s) for subsequent use with steps ii -iv) above.

6. A use of at least one artificially created unique nucleotide sequence as an identifier of batch origin for a compound biological product.

7. A use of at least one unique nucleotide sequence which is not otherwise inherently present in the compound biological product as an identifier of batch origin for a compound biological product.

8. The use of freeze dried powdered meat containing a unique nucleotide sequence in a compound biological product.

9. A method as claimed in any one of claims 1-4 wherein the unique DNA sequence is obtained from the same biological sample (i.e. same type of plant, animal or other organism) as that forming the major constituent of the compound biological product, theierm 'unique DNA sequence' includes:

a. a 'rare allele' being an allele at a specific DNA marker that is known to occur at a very low frequency in the extant population;

b. a 'unique genetic mutation' being a DNA polymorphism that is known to occur only in a very low frequency of animals at a specific locus;

c. any combination of a) and/or c) and/or together with one or more wild- type-alleles.

10. A method as claimed in claim 9 wherein the unique nucleotide sequence is a rare allele.

11. A method as claimed in claim 10 wherein the compound biological is made from an animal, the animals from which the rare allele is obtained may be of the same general type of animal as that predominately used in the manufacture of the compound biological product.

12. A method as claimed in claim 11 wherein the rare allele is sourced from cattle or sheep.

13. A method as claimed in claim 12 wherein the rare allele from cattle is the MA allele found in Maine Anjou cattle.

14. A method as claimed in claim 12 wherein the rare allele from sheep is the Booroola mutation.

15. A method as claimed in any one of claims 1-4 wherein the unique nucleotide sequence is sourced from a different source to the compound biological product, or is an artificially created sequence.

.*- <-

16. A method as claimed in either claim 1 or claim 2 wherein the unique nucleotide sequence is in the form of meat which has been freeze dried and reduced to a powder.

17. A method as claimed in claim 2 wherein the component particles of the test sample are reduced down to a single cell.

18. A method as claimed in any one of the preceding claims wherein the compound biological product is in the form of a compound meat product.

9. A computer database which includes a plurality of genetic profiles corresponding to unique nucleotide sequences each profile being assigned to batch information for compound biological products.