WO2008029871A1

WO2008029871A1 - Nerve fiber degeneration inhibitor

Info

Publication number: WO2008029871A1
Application number: PCT/JP2007/067375
Authority: WO
Inventors: Hiroyuki Yoneyama; Kenji Ishida; Jun Koyama
Original assignee: Stelic Institute Of Regenerative Medicine, Stelic Institute & Co.
Priority date: 2006-09-08
Filing date: 2007-09-06
Publication date: 2008-03-13

Abstract

It was verified that by an experiment using a gene-silencing nucleic acid (GalNAcST siRNA), which is a substance having an “action of inhibiting the synthesis” of chondroitin sulfate proteoglycan (CSPG), chondroitinase ABC, which is a substance having an “action of promoting the degradation” of CSPG and C4-sulfatase, which is a substance having an “action of desulfating” CSPG, a substance that “inhibits the production or accumulation of CSPG” in a totally different route of a totally different property has an effect of inhibiting nerve fiber degeneration. It was revealed that the substance that “inhibits the production or accumulation of CSPG” which is a feature common to these is useful for inhibiting nerve fiber degeneration. The invention relates to a nerve fiber degeneration inhibitor containing a substance that inhibits the production or accumulation of CSPG as an active ingredient and a screening method for the nerve fiber degeneration inhibitor.

Description

Specification

Neurofibrotic degeneration inhibitor

Technical field

[0001] The present invention relates to a therapeutic and prophylactic agent for neurofibrotic degenerative diseases based on control of accumulation of chondroitin sulfate proteoglycan (CSPG), a method for inhibiting neurofibrotic degeneration, and Alzheimer based on the method. Background art on methods of treating or preventing neurofibrotic degenerative diseases including AD Alzheimer's disease, PD (Parkinson's disease), and amyotro phic Lateral Sclerosis (ALS)

[0002] Cranial nerve fiber degenerative disease in neurofibrotic degenerative diseases is recognized as an intractable disease resulting from a decrease due to neuronal cell death. This neurofibrotic degenerative disease can be roughly divided into two groups representing symptoms related to memory and dementia, and symptoms related to movement. As a typical example, the former is Alzheimer's disease and the latter is Parkinson's disease. Alzheimer's disease is projected to increase to 34 million in 20 years in over 18 million patients worldwide (International Association for Alzheimer's Disease: ADI). Currently, it is estimated that there will be at least 300,000 patients in Japan and more than 800,000 in 2010, four years later. According to genetic analysis and statistical analysis, this disease is more common among elderly people who are more common in women than in men (survey by the Marumaya Japanese Medicine Research Institute).

[0003] Alzheimer's disease is due to genetically-onset familial Alzheimer's disease and abnormal metabolic balance (decreased acetylcholine) caused by a defect in the factors involved in the production of amyloid 0 peptide (A / 3) and its degradation. There are two types of sporadic Alzheimer's disease. Both factors are caused by the root cause of the accumulation of A / 3 in the brain, and are symptoms in which senile plaques appear in nerve cells. It has been reported that A / 3 is produced by cleaving from amyloid precursor protein (APP) with protease, and the proportion of β-sheet structure is increased, resulting in insolubility and aggregation. In addition, a major discovery in recent years was the identification of neprisin, a degrading enzyme that prevents amyloid accumulation. It has been demonstrated that accumulation of A / 3 increases in the brain as activity decreases. Along with this, there has been a report confirming a decrease in the amount of Aβ in the brain due to the expression of neprisin in the brain by adenovirus (Non-patent Document 1). Furthermore, it has been reported that genes that express apolipotanic protein (apo Ε) are greatly involved as a risk factor for Alzheimer's disease! (Non-patent document 2). In addition to the above-mentioned findings, research has been conducted energetically for various factors, and several causative proteins and gene mutations have been found. Examples include highly phosphorylated! /, Neurofibrillary degeneration due to accumulation of rutau protein and mutations in genes encoding amyloid precursor protein (APP) and presenilin 1 and 2. It has been reported to promote the accumulation of A13!

[0004] The power of many research reports as described above Alzheimer's disease is the only therapeutic drug for Alzheimer's disease that is still approved for sale in Japan. Symptoms have the effect of delaying the progression of dementia by about 9 months, but do not promote the recovery of cognitive function! This therapeutic drug is intended to increase the concentration of acetylcholine that has been reduced in the brain by inhibiting acetylcholinesterase, an enzyme that degrades acetylcholine, a neurotransmitter that is related to memory and learning. Donepezil hydrochloride does not serve as a curative for Alzheimer's disease and is only given to mild patients. Currently, each research institution for Alzheimer's disease has created animal models to discover disease-causing factors, trial and error, and treatments that are still a decisive factor because many factors are involved. No law or treatment has been established.

[0005] Next, among the central nervous fibrotic degenerative diseases, there are fewer than the number of patients with Alzheimer's disease! / There is Parkinson's disease, which is a disease but is listed as an intractable disease. This is due to the death of dopamine neurons in the part of the brain known as the substantia nigra, which reduces the amount of dopamine (a neurotransmitter made by neurons in the substantia nigra). This is a disease caused by a loss of balance with acetylcholine, another neurotransmitter, and a relative increase in acetylcholine. The symptoms include tremor, muscle stiffness, slow motion and posture maintenance. There are four major symptoms called disability. In Japan, this disease tends to be more common in women with a male-female ratio of 1: 1.5-2, and a wide range of people in their 30s and 80s It has developed in the age group. The current number of patients is around 100 per 100,000 population

It is estimated that there are about 120,000 patients in Japan throughout the country. In addition, 5 to 10% of all cases account for hereditary Parkinson's disease. Currently, research on the etiology has been actively conducted around the world, and from the results of gene analysis in patients with familial Parkinson's disease, a-synuclein (abnormality and accumulation of protein folding), Parkin (protein degradation system and mitochondrial function), PINK1 (mitochondrial function), DJ-1 (oxidation stress), LRRK2 (phosphorylation) have been identified how these genes are involved in Parkinson's disease It is not yet elucidated whether they are doing it. In addition, studies have been reported that protein accumulation is a factor in neurofibrotic degenerative diseases due to mutations in genes related to the protein folding mechanism in the brain and the protein degradation mechanism of aggregated proteins (Non-Patent Documents 4 to 4). 8).

[0006] In recent years, other neurofibrotic degenerative diseases that have been reported include polyglutamine disease, amyotrophic lateral sclerosis, spinal muscular atrophy, Huntington's disease, and multiple sclerosis. It has also been reported that endoplasmic reticulum stress due to abnormal protein accumulation leads to death of neurons. Originally, abnormal proteins are decomposed and eliminated by proteolytic system (UPR: unfolded protein response, ERAD: ER associated degrdation, ubiquitin-prosome). A death signal is emitted (Non-patent Document 9). In this way, complex signal transduction occurs in the cell and induces neurofibrotic degeneration through various pathways! / Therefore, studies on signal transduction and the like have been conducted for each disease, but all are complicated and it is extremely difficult to develop a therapeutic agent for signal transduction.

[0007] Currently, treatment for Parkinson's disease is advancing among treatments for various neurofibrotic degenerative diseases, which are divided into kinematic physical therapy, surgical treatment, and pharmacotherapy, but drug therapy is generally widely used. It has been. In particular, L-dopa (precursor of donomin), donomin receptor stimulant (increased L-dopa effect), anticholinergic agent (acetylcholine inhibitor), which is most effective for tremor and other symptoms , Dopamine release promoters, noradrenaline supplements (remedies for freezing), dopamine degradation inhibitors (MAO-B inhibitors, COMT inhibitors), etc. It is used according to the shape. However, these therapies do not act as curatives and are used to relieve symptoms. In addition, it has been confirmed that various problems may appear due to long-term administration. For example, in the case of L-Dopa, long-term administration such as 5 to 10 years can cause wearing off phenomenon (shortening of drug effect), on-off phenomenon (loss of drug effect), dyskinesia (involuntary movement), psychiatric symptoms such as hallucination and delusion. Appears.

[0008] As we are becoming an aging society in the future, we will try to find and prevent a completely different viewpoint, that is, the root cause of illness that is not merely by temporary relief of symptoms by drug treatment. There is a strong need for the development of new drugs that have excellent safety and can effectively prevent or suppress side effects. At present, cranial nerve disease is being researched mainly by research centers that are central to the world. Various drug discovery has been conceived, and recently, “brain gene therapy” has been expected as one of the fundamental treatment methods (Non-Patent Documents 10 to 12).

[0009] Here, proteodarican focused on the treatment of the above-mentioned neurofibrotic degenerative disease has a structure in which one or more glycosaminodarlican (GAG) chains are covalently bound to a protein called a core protein. It is thought that the specific sugar chain structure of the GAG chain is responsible for the various functions of proteolidicans. Proteolidicans are based on the type of GAG chains and chondroitin ¾¾ acid proteoglycans (CSPG: chondroitin) sulfate proteoglycans), denorematanite) ¾ acid proteoglycans (DSPGs: dermatan sulfate proteoglycans), heparan acid proteoglycans (HSPGs) Is done. (Non-Patent Documents 13 to 19) Among these, HSPGs have been extensively studied to bind to various site force-ins, adhesion molecules, and chemokines and greatly modify their functions. As a function in the month, HSPGs and co-protein strength GAG chain, which is extended as a side chain, converts non-fibrotic amyloid β-protein into neurotoxic fibrotic amyloid / 3-protein and amyloid against the proteolytic mechanism There is a report that protects 13-protein (Αβ) (Non-patent Documents 20 to 22). Similarly, heparan sulfate proteodarican and glycosaminodarlican are considered to be the most prominent etiology of Parkinson's disease and do not fibrize -synuclein! /, Or a protein that causes Alzheimer's disease Amyloid precursor protein (APP) is also denatured! / Hanare is considered to be a thing (Non-Patent Document 23).

[0010] On the other hand, CSPG is an essential molecule during the embryonic period and is abundant in each organ. Neural regeneration such as neural stem cell differentiation inducer (Patent Document 1), nerve regeneration using human / bone morphogenetic protein (Patent Document 2), human, nerve regeneration using bone morphogenetic protein (Patent Document 3) It is considered as a molecule that controls the processes involved! /, While treating the damage of the central nervous system (Patent Document 4), materials and methods for promoting the repair of nerve tissue (Patent Document) It is also involved in the inhibition of nerve regeneration at various sites such as 5) and blood vessel smooth muscle cell treatment inhibitory factor (Patent Document 6). As an example, neurocan, blebican, and NG2 were first identified as chondroitin sulfate proteodaricans, which are regenerative inhibitors that are expressed when the central nervous system is damaged (Non-patent Document 24), and chondroitinase ABC ( There is a report example that degrades CSPG by administration of an enzyme that selectively removes chondroitin sulfate, which is a type of GAG chain, and promotes regeneration of the central nerve (Patent Document 4). Further, in the expression of this CSPG, Lewy body in the brains of patients with Parkinson's disease: has been reported to be accumulated in (LB Le _Wy body) has become its biological function yet Akira et force, and No (Non-patent document 25). In addition, the significance of increasing CSPG in the brain is still known! /, NA! / (Non-patent Document 23).

[0011] Patent Document 1: Patent Publication 2005-278641

Patent Document 2: Patent Publication 2005-007196

Patent Document 3: Patent Publication No. 09-501932

Patent Document 4: Patent Publication 2005-526740

Patent Document 5: Patent Publication 2005-500375

Patent Document 6: Patent Publication 08-510209

Non-patent literature l: Iwata et al. J. Neurosci. (2004) 24 (4) 991-998

Non-Patent Document 2: Strittmatter, W.J et al. Proc. Natl. Acad. Sci. (1993) 90 8098-8102 Non-Patent Document 3: Forman et al. Nat. Med. (2004) 10 (10) 1055-1063

Non-Patent Document 4: Matthew, J. F. Nature, review (2006) 7 306-318

Non-Patent Document 5: Gsponer, J. et al. Protein Pept Lett. (2006) 13 (3) 287-293

Non-Patent Document 6: McNaught, .S.P. Et al. Neurobiol. Aging (2006) 27 530-545

Non-Patent Document 7: Hattori, N. et al. Lancet. (2004) 364 (9435) 722-724 Non-patent literature 8: Murakami, T. et al. Ann neurol. (2004) 55 (3) 439-442 Non-patent literature 9: Hisae Kadowaki et al. Experimental medicine (2006) 24, 10173-180

Non-patent literature 10: Muramatsu, S. et al. Rinsho Shinkeigaku. (2005) 45 (11) 902-904 Non-patent literature ll: Iwata. N. et al. J. Neurosci. (2004) 24 (4) 991- 998

Non-patent document 12: Hadaczek P, et al. Hum Gene Ther. (2006) 17 (3) 291-302 Non-patent document 13: Lindahl, U et al. (1972) In Glycoproteins (Gottschalk, A. ed) pp. 49

1-517, Elsevier, New York.

Non-Patent Document 14: Oegema, T et al. J. Biol. Chem. (1984) 259 1720-1726

Non-patent document 15: Sugahara, et al. J. Biol. Chem. (1988) 263 10168-10174 Non-patent document 16: Sugahara, et al. J. Biol. Chem. (1992) 267 6027-6035

Non-Patent Document 17: De Waard et al. J. Biol. Chem. (1992) 267 6036-6043

Non-Patent Document 18: Moses, J, Oldberg et al. Eur. J. Biol. (1992) 248 521-526

Non-Patent Document 19: Yamada, S et al. Trends in Glycoscience and Glycotechnology, (1998

) 10, 95-123

Non-patent literature 20: Castillo, GM et al. J. Neurochem. (1997) 69 2452-2465 Non-patent literature 21: Cotman, S. et al. Mol. Cell. Neurosci. 15 (2000) 183-198 Non-patent Reference 22: Snow, AD et al. Neurobiol. Aging (1989) 10 481-497

Non-Patent Document 23: Horsen, J.V. et al. J. Alzheimers Dis. (2004) 6 469-474

Non-Patent Document 24: Rhodes KE, Fawcett JW J. Anat. (2004) 204 33-48

Non-Patent Document 25: DeWitt, D.A. et al. Brain Res. (1994) 656 205-209

Disclosure of the invention

Problems to be solved by the invention

[0012] An object of the present invention is to provide a neurofibrous degeneration inhibitor, a therapeutic agent for a neurofibrotic degenerative disease containing the drug as an active ingredient, and a screening method for the neurofibrotic degeneration inhibitor. .

Means for solving the problem

[0013] While the present inventors have conducted intensive research to develop such a drug, it has so far been considered as the etiology of neurofibrotic degenerative diseases, and has an excessive accumulation power of CSPG neurons. In addition to promoting cell death, synaptic deficiency (Alzheimer's disease), dopamine neuron cell death (Parkinson's disease), and motor neuron degeneration (amyotrophic lateral sclerosis), various neurofibrotic degenerative diseases I thought that it would work on the factor of the day! /, Why not! / Based on this idea, the present inventors have conducted research on Parkinson's disease model mice, which are one of the neurofibrotic degenerative diseases. As a result, among the CSPG sulfotransferases, GalNAc4ST-l, GalNAc cPGST-2, GALNAC4S-6ST genes are knocked down by siRNA, or chondroitinase (chondroitinase) ABC is used to remove sugar chains in chondroitin sulfate. It was found that the product was suppressed and the neuronal function control, which is the role of astrocytes in glial cells, was activated. In addition, it suppresses infiltration of fountain fibroblasts, prevents cell death of donomin neuron, makes secretion of tyrosine hydroxylase (TH: Tyro sine hydroxylase) prominent, and treats symptoms of Parkinson's disease I found something to do. That is, it was demonstrated that neurofibrous degeneration can be suppressed by inhibiting the accumulation or biosynthesis of chondroitin sulfate proteodalycan, and completed the present invention. A substance that inhibits the production or accumulation of chondroitin sulfate proteodarican is useful as a neurofibrotic degeneration inhibitor. In addition, the drug is a drug for treatment or prevention of neurofibrotic degenerative diseases.

[0014] The above-mentioned chondroitinase ABC that degrades chondroitin sulfate and siRNA based on the concept of sulfating transferase knockdown were used to control proteodalycan accumulation and to observe pathological changes in neurodegenerative diseases of the brain No actual clinical treatment has been reported. As an example, N-acetylgalactosamine—4—0-sulfotransferase: N—acetylga ctosamine_4_0_sulrotransferae_1, N_acetylgalactosamine_4_0_smfotransfera se -2, N_acetylgactosamine_4_sulfate 6-O-sulfotransferase (GalNAc4ST-l, GalNAc4 ST-2, GALNAC4S-6ST) siRNA and chondroitinase ABC, which is a degrading enzyme of chondroitin sulfate, are shown in the examples.

[0015] Furthermore, the present inventors examined the fibrosis inhibitory effect of C4-sulfatase. As a result, it was shown that these substances have an effect of suppressing neurofibrotic mutation! [0016] That is, a gene silencing nucleic acid (GalNAcST siRNA) which is a substance having a “synthesis inhibitory action” of chondroitin sulfate proteodarican and a chondroitinase which is a substance having a “degradation promoting action” of chondroitin sulfate proteoglycan Through experiments using ABC and C4-sulfatase, a substance that has the “desulfating action” of chondroitin sulfate proteodarican, “inhibits the production or accumulation of chondroitin sulfate proteodarican” in completely different pathways. It has been demonstrated that the substance to suppress the neurofibrotic mutation. In other words, it has been clarified that a substance that “inhibits the production or accumulation of chondroitin sulfate proteodarican”, which is a feature common to these, has an action of suppressing nerve fiber degeneration.

[0017] The present invention relates to a neurofibrous degeneration inhibitor, a therapeutic agent for a neurofibrotic degenerative disease containing the drug as an active ingredient, a screening method for a neurofibrotic degeneration inhibitor, and more specifically, ,

[1] a neurofibrotic degeneration inhibitor comprising a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican as an active ingredient,

[2] The drug according to [1], wherein the substance is a substance having a chondroitin sulfate proteodarican degradation promoting action,

[3] The drug according to [1], wherein the substance is a substance having a chondroitin sulfate proteodarican synthesis inhibitory action,

[4] The drug according to [1], wherein the substance is a substance having a chondroitin sulfate proteodarican desulfation action,

[5] The drug according to [1], wherein the substance is a substance having an inhibitory action on chondroitin sulfate proteodarican sulfation,

[6] Characteristically characterized in that the production or accumulation of chondroitin sulfate proteodarican is inhibited in the brain. Specifically, it is characterized by suppressing chondroitin sulfate proteodarican deposition in brain tissue), [1] A drug according to any one of to [5], [7] a drug for treatment or prevention of neurofibrotic degenerative disease, a drug according to [1] to [6], or any of the above,

[8] The neurofibrotic degenerative disease is cerebrospinal nerve or peripheral nerve fibrotic degenerative disease The drug according to [7],

[9] The neurofibrotic degenerative disease is Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, polyglutamine disease, spinal muscular atrophy, Huntington's disease, or multiple sclerosis. Drugs,

[10] a dopamine neuron regeneration promoter in brain tissue, comprising as an active ingredient a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican;

[11] An agent for inhibiting the destruction of brain tissue in inflammatory cells, comprising as an active ingredient a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican,

[12] A screening method for a neurofibrotic degeneration inhibitor, comprising selecting a substance having an action of inhibiting the production or accumulation of chondroitin sulfate proteodarican from a test sample,

[13] The screening method according to [12], comprising a step of selecting a substance having the action described in any of the following (a) to (d)! /

( _a ) Promoting the degradation of chondroitin sulfate proteodarican

(b) Inhibition of chondroitin sulfate proteodarican synthesis

(c) Desulfation effect of chondroitin sulfate proteodarican

(d) Inhibitory effect of chondroitin sulfate proteodarican on sulfation

[14] A screening method for a neurofibrotic degeneration inhibitor comprising the following steps (a) to (c):

( _a ) contacting the test compound with chondroitin sulfate proteodarican or a part thereof;

(b) measuring the abundance of chondroitin sulfate proteodarican or a part thereof;

(c) A step of selecting a substance that reduces the abundance compared to the case where measurement is performed in the absence of the test compound.

[15] The screening method according to any one of claims 12 to 14, wherein the neurofibrotic degeneration inhibitor is for treating or preventing a neurofibrotic degenerative disease,

Is provided.

The present invention further relates to the following.

[16] In the manufacture of a neurofibrotic degeneration inhibitor, the drug according to [1] to [9]! Use.

[17] A method for treating a neurofibrotic degenerative disease, comprising a step of administering the drug according to any one of [1] to [9] to an individual (patient or the like).

[18] A method for suppressing neurofibrotic degeneration, comprising a step of administering a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican to an individual.

[19] A method for activating glial astrocytes, comprising a step of administering a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican to an individual.

[20] Promote regeneration of donomin neurons in brain tissue, including administering to individuals (for example, patients with impaired dopamine neuron function) a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican Method.

[21] A method for preventing the destruction of brain tissue in inflammatory cells, including the step of administering a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican (to prevent invasion such as infection or drug-induced encephalitis or trauma) How to protect against).

[22] A composition comprising the drug according to any one of [1] to [; 11] and a pharmaceutically acceptable carrier.

The invention's effect

[0019] According to the present invention, it has been clarified that the production and accumulation of chondroitin sulfate proteodalycan is related to the onset of neurofibrotic degeneration. Inhibition of chondroitin sulfate proteoglycan production and accumulation has been shown to suppress neurofibrotic degeneration. It will be possible to provide a therapeutic agent for neurofibrotic degenerative diseases with a new concept that has never existed before. In particular, neurofibrotic degeneration is closely related to Parkinson's disease, Alzheimer's disease, etc., where the number of patients is increasing in modern society, and a new concept of therapeutic drugs has important medical and industrial significance.

Brief Description of Drawings

[0020] [Fig. L] Untreated group, chondroitinase ABC, GalNAcST siRNA treatment in Parkinson's disease model mice induced by l-methyl-4-pheny 卜 1, 2, 3, 6 tetrahydropyridine (MPTP) This is a photograph examining the expression of β-actin, GalNAc4ST-1 and GALNAC4S-6ST by RT-PCR on the 8th day (final day) in the group. [Fig. 2] Photograph showing the deposition of chondroitin sulfate teodarican (CSPG) in MPTP-induced Parkinson's disease model mice in the untreated group, Gal NAcST siRNA-treated group and chondroitinase ABC-treated group .

FIG. 3 is a photograph showing infiltration of F4 / 80-positive inflammatory macrophage in an untreated group, a GalNAcST siRNA-treated group and a chondroitinase ABC-treated group in Parkinson's disease model mice induced by MPTP.

FIG. 4 is a photograph showing fibroblasts in the brain in an untreated group, a Gal NAcST siRNA-treated group and a chondroitinase ABC-treated group in a Parkinson's disease model mouse induced by MPTP.

FIG. 5 is a photograph showing glial cell astrocytes in an untreated group, a GalNAcST siRNA-treated group and a chondroitinase ABC-treated group in Parkinson's disease model mice induced by MPTP.

[Fig.6] Tyrosine hydroxylase (TH) secretion in MPTP-induced Parkinson's disease model mice in the untreated group, GalNAcS T siRNA-treated group and chondroitinase ABC-treated group! It is a photograph.

[Sono 7] This is a photograph showing the expression of CSPG in brain tissue. The results of CSPG expression in brain tissue are analyzed using enzyme antibody immunostaining. The primary antibody was stained using CS_56 (manufactured by Seikagaku Corporation) and a mouse stin kit. The picture shows the midbrain near the dentate gyrus.

Fig. 8] shows the results of analysis of inflammation and fibrosis-related gene expression by Real-time PCR. The result of examining the expression of TGF- / 3, which is a fibrosis marker, and TNF-a, which is an index of inflammation associated with macrophage infiltration, is shown by rea time PCR. The graph shows the relative ratio of TNF_a and TGF-β in the house keeping gene (β-actin).

FIG. 9 shows the results of Nurrl gene expression analysis by Real_time PCR method. Nurrl gene expression in brain tissue was performed using SYBR premix kit (Takara Bio) and Real-time PCR thermal cycler DICE (Takara Bio). The graph shows the dimensions of Nurrl and house keeping Gene (/ 3-actin).

[Sono 10] These are photographs showing the analysis results of DA neuron expression dynamics in brain tissue. Brain tissue The results of an analysis of the expression dynamics of dopamine neurons (DA neuron) using fluorescent immunostaining are shown. The primary antibody was an anti-TH antibody (manufactured by Carbiochem), and the secondary antibody was an Alexa-488 labeled anti-rabbit IgG antibody (manufactured by Invitrogen).

FIG. 11 is a diagram showing a comparison of survival rates between a treated group and an untreated group. The survival rate of each group (treated group, untreated group) was compared over time. The analysis was carried out using day 7 (day 7) as an endpoint, using the force planmeyer survival curve. The treatment group was treated with C4_sulfatase and GalNAc4S_6ST siRNA.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail.

As a pathological condition associated with Parkinson's disease, which is one of the typical neurofibrotic degenerative diseases, there is a degenerative condition such as fomentation due to infiltration of macrophages, lysen fibroblasts, etc. in brain neurons. The present inventors have focused on the function of chondroitin sulfate proteodarican in order to improve the degenerative state of neurons in the brain as an effective method for treating Parkinson's disease. A state in which the accumulation of chondroitin sulfate proteodarican was suppressed in Parkinson's disease model mice was analyzed in detail, and it was found that the accumulation of chondroitin sulfate proteodarican was improved compared to neurons in the wild-type brain. Many cells were observed and the inflammatory condition was improved. In other words, inhibiting the production or accumulation of chondroitin sulfate proteodarican promotes improvement of abnormal accumulation state of chondroitin sulfate proteodarican in brain neurons that are deeply involved in Parkinson's disease, leading to improvement of neurofibrotic degeneration. I found out.

[0022] The present invention relates to a neurofibrotic degeneration inhibitor comprising, as an active ingredient, a substance that inhibits the production or accumulation of chondroitin sulfate proteodalycan.

[0023] The "chondroitin sulfate proteodarican" of the present invention is one of the proteodaricans, and is a covalently bonded compound of chondroitin sulfate / dermatan sulfate, which is a typical sulfated mucopolysaccharide, and a protein (coprotein). It is a general term. The “chondroitin sulfate proteodarican” in the present invention is preferably a human chondroitin sulfate proteodarican, but the species from which it is derived is not particularly limited. Proteins equivalent to kan (homologs, orthologs, etc.) are also used in the present invention. It is included in "" Konkondoroloyichitin sulphate sulfate proteoteo daridarikankan "". . For example, for example, it has a tantalum protein that is equivalent to the human proteotheododalyricacan. As long as it is a living organism that has the same quality as that of coconut doroleutitin sulphate sulfate, it can be used as an inventor of this invention. This is the possibility of actually implementing this. . In addition, in the present invention, the coconut doroleutintin sulfate sulfate sulfate proteoteo odalyrikankan is temporarily affected by inflammatory inflammation and the like. Although the chain of guriglicosasamininodararirikakan ((GGAAGG)) binds to and becomes a proprotetheodaridarikankan, it is so loose.

[[00002244]] The following descriptions are as follows: As a conchondroleutintintin sulfate sulfate proteoglycan, aaggggrniccaann, ^ vveerrssiiccan, neurocan, brevican, β glycan, Decorin , Biglycan, Pibromodulin ^ PG-Lb ”5, etc. The chondroitin sulfate proteodarican in the present invention is not limited to these, and any substance having activity as a chondroitin sulfate proteodarican! /, Here The activity of chondroitin sulfate proteodarican includes, for example, cell adhesion ability or cell growth promotion force S. Those skilled in the art can evaluate the activity of chondroitin sulfate proteodarican as follows. A protein that includes a partial region of the amino acid sequence of chondroitin sulfate proteodarican, or a high homology with a partial region (typically 70% or more The proliferation of tumor cells (eg, Caco_2, HT-29 cells, etc.) is measured in the presence of a protein having preferably 80% or more, more preferably 90% or more, most preferably 95% or more. Proteins that have the effect of promoting mitotic proliferation can be identified as proteins with chondroitin sulfate proteodarican activity (Int J Exp Pathol. 2005 Aug; 86 (4): 219_29 and Histochem Cell Biol. 2005 Aug; 124 (2 ): 139-49) Here, high homology means 50% or more, preferably 70% or more, more preferably 80% or more, more preferably 90% or more (for example, 95% or more, further 96% , 97%, 98%, or 99% or higher), which is the mBLAST algorithm (Altschul et al. (1990) Proc. Natl. Acad. Sci. USA 8 7: 2264-8; arlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-7).

[0025] "Neural fibrotic degeneration" in the present invention refers to an abnormal state in nerve tissue. For example, the state of causing fountain fibrosis, the state of inflammation, the state of infiltrating fountain fibroblasts' inflammatory cells, the loss of specific cell types in nerve tissue, and cell death The power S that can be mentioned is not limited to these. In the present invention, “inhibiting production or accumulation” of chondroitin sulfate proteodarican means, for example, “degradation promotion”, “synthesis inhibition”, “desulfation”, “sulfation” of chondroitin sulfate proteodarican. Powers that include “inhibition” and the like are not limited to these, and it means that the abundance, function, or activity of chondroitin sulfate proteodarican is reduced or eliminated as compared with the comparison target. In the present invention, the “substance that inhibits the production or accumulation” of chondroitin sulfate proteodarican is not particularly limited, but preferably the “substance that has an activity of promoting degradation of chondroitin sulfate proteoglycan” and “the substance has an inhibitory effect on synthesis”. “Substance”, “Substance with desulfurization and oxidation”, or “Substance with sulfation-inhibiting action”.

“Degradation promotion” of chondroitin sulfate proteodarican includes, for example, inhibition of expression / reduction of the protein that is the core of chondroitin sulfate proteodarican. Here, the “protein that is the core of chondroitin sulfate proteoglycan” is, for example, matri X type chondroitene sulfate prosuclicans, and examples thereof include core proteins such as aggrican, versican, neurocan, and b revican. In the case of membrane-type chondroitin sulfate proteodlicans, for example, core proteins such as / 3 glycan, Decorin, Biglycan, Fibromodulin, and PG_Lb can be mentioned. These are only examples, and are not limited to these, and may be any protein that is widely used as the core of chondroitin sulfate proteodalycan.

[0028] "Expression" means "transcription" from a gene! /, And includes "translation" into a polypeptide and "degradation inhibition" of a protein. “Expression of the protein that is the core of chondroitin sulfate proteodarican” refers to the transcription and translation of the gene that encodes the protein that is the core of chondroitin sulfate proteodarican, or the chondroitin sulfate proteo This means that the protein that forms the core of Darican is produced. In addition, “the function of the protein serving as the core of chondroitin sulfate proteodarican” includes, for example, the function of the protein binding to chondroitin sulfate and the binding to other components in the cell. The various functions described above can be appropriately evaluated (measured) by those skilled in the art using common techniques. Specifically, the methods described in the examples described later, or the methods can be appropriately modified and carried out.

[0029] Furthermore, “degradation promotion” of chondroitin sulfate proteodarican is the expression of an enzyme that cleaves or degrades chondroitin sulfate proteodarican or an enzyme related thereto. May be a rise. Examples of these enzymes include, but are not limited to, meta-mouth proteinases (eg, AD AMTS-1, ADAMTS-4, ADAMTS-5, etc.) chondroitinase, Calpain I, and the like. Further, “degradation promotion” may be a decrease in the abundance of chondroitin sulfate proteodarican caused by administration of these enzymes or a part of the enzymes.

[0030] "Degradation promotion" may be caused by administration of a substance that promotes suppression of chondroitin sulfate proteodarican expression. These substances include, but are not limited to, n-butylate, Diethyl carbamazepine, i'umcamycin, non-steroidal estrogen ^ and yclofeml deipheno.

[0031] Preferable embodiments of the "substance having a decomposition promoting action" include, for example, a compound (nucleic acid) selected from the group consisting of the following (a) to (c).

( _a ) An antisense nucleic acid for a transcription product of a gene encoding the core protein of chondroitin sulfate proteodarican or a part thereof

(b) a nucleic acid having a ribozyme activity that specifically cleaves the transcription product of the gene encoding the core protein of chondroitin sulfate proteodarican

(c) Nucleic acid that acts to inhibit the expression of the gene encoding the core protein of chondroitin sulfate proteodarican by the RNAi effect

In addition, examples of the “substance having a decomposition promoting action” include compounds selected from the following groups (a) to (c):

( _a ) an antibody that binds to the core protein of chondroitin sulfate proteodarican

(b) Chondroitin sulfate proteodarican mutants having dominant negative properties for the core protein of chondroitin sulfate proteodarican

(c) Low molecular weight compound that binds to the core protein of chondroitin sulfate proteodalycan

[0033] “Synthetic inhibition” of chondroitin sulfate proteodarican includes, for example, inhibition of glycosaminodarlican biosynthesis, inhibition of enzymes involved in chondroitin sulfate proteodarican synthesis, but are not necessarily limited to these. This refers to inhibiting the process of chondroitin sulfate proteodarican synthesis.

[0034] As a substance that inhibits the synthesis of chondroitin sulfate proteodarican, glycosaminoglyca For example, / 3 -D-xyloside, 2-deoxy-D-glucose (2-DG, ethane-hydroxy-l, l-diphosphonate (b TDP), 5 -hexyl-2-deoxyundine HUdR). These and other substances inhibit the biosynthesis of glycosaminodarlicans and inhibit the synthesis of chondroitin sulfate proteodaricans.

On the other hand, examples of enzymes involved in chondroitin synthesis include GalNAc4ST-1, GalNAc4 ST-2, GALNAC4S_6ST, UA20ST, GalT_I, GalT_H, GlcAT_I, XylosylT, and the like. By inhibiting these and other enzymes and suppressing their expression, the synthesis of chondroitin sulfate proteodalycan is inhibited.

[0036] Preferable embodiments of the "substance having a synthesis inhibitory action" include, for example, compounds (nucleic acids) selected from the group consisting of the following (a) to (c).

( _a ) An antisense nucleic acid for a transcript or a part of a gene encoding chondroitin sulfate proteodarican synthase

(b) Nucleic acid with ribozyme activity that specifically cleaves the transcript of the gene encoding chondroitin sulfate proteodarican synthase

(c) a nucleic acid having an action of inhibiting the expression of a gene encoding chondroitin sulfate proteodarican synthase by the RNAi effect

[0037] In addition, examples of the "substance having a synthesis inhibitory action" include compounds selected from the following groups (a) to (c):

( _a ) an antibody that binds to chondroitin sulfate proteodalycan synthase

(b) Chondroitin sulfate proteodarican synthase mutant having dominant negative properties for chondroitin sulfate proteodarican synthase

(c) Low molecular weight compound that binds to chondroitin sulfate proteodarican synthase

[0038] “Desulfation” of chondroitin sulfate proteodarican refers to removal of sulfate groups in chondroitin sulfate proteodarican, for example, desulfation by endogenous or externally administered desulfating enzymes, or sulfation. This includes, but is not limited to, the process by which sulfate groups are removed.

[0039] Examples of the desulfating enzyme include Chondroitin-4-sulfatase, Chondroitin-6-sulfatase force S. Examples of compounds that inhibit sulfation include Chlorate and EGF rece. ptor antagonist and the like.

[0040] Preferable embodiments of the "substance having desulfating action" include, for example, a compound (nucleic acid) selected from the group consisting of the following (a) to (c).

( _a ) Antisense nucleic acid for a transcript of a gene encoding a chondroitin sulfate proteodarican desulfase inhibitor protein or a part thereof

(b) a nucleic acid having a ribozyme activity that specifically cleaves a transcript of a gene encoding a chondroitin sulfate proteodarican desulfase inhibitor protein

(c) a nucleic acid having an action of inhibiting the expression of a gene encoding a chondroitin sulfate proteodarican desulfase inhibitor protein by the RNAi effect

[0041] Examples of the "substance having desulfating action" include compounds selected from the following groups (a) to (c):

( _a ) an antibody that binds to _a chondroitin sulfate proteodarican desulfase inhibitor compound

(b) Chondroitin sulfate proteodarican desulfating enzyme inhibitory protein against chondroitin sulfate proteodarican desulfating enzyme inhibitory protein

(c) a small molecule compound that binds to a chondroitin sulfate proteodarican desulfase inhibitor compound

Here, the “desulfation-inhibiting compound” is not limited to a protein, and includes non-protein compounds such as coenzymes, for example.

[0043] The “sulfation inhibitory action” of chondroitin sulfate proteodarican is, for example, the force S including inhibition of sulfate group transfer enzyme, but is not limited to this, and occurs in the process of chondroitin sulfate proteodarican synthesis. It refers to inhibition of sulfation.

[0044] Examples of the sulfotransferase include C4ST-1 (Chondroitin D-N-acetylgalactosamine).

-4-O-sulfotransrerase 1), u4S ι ~ 2 (Cnondroitin DN-acetylgalactosamine-4-O-sulfotransferase 2), C4ST-J (Chondroitin DN-acetylgalactosamine-4-O-sulfotransfera se 3), D4ST, C6ST_ 1 And C6ST-2.

[0045] As a preferred embodiment of the "substance having sulfation inhibitory action", for example, a compound (nucleic acid) selected from the group consisting of the following (a) to (c) can be mentioned. ( _a ) An antisense nucleic acid for a transcript or a part of a gene encoding chondroitin sulfate proteodalycan sulfate transferase

(b) A nucleic acid having a ribozyme activity that specifically cleaves a transcript of a gene encoding chondroitin sulfate proteodarican sulfate transferase.

(c) Nucleic acid having the action of inhibiting the expression of the gene encoding chondroitin sulfate proteodarican sulfate transferase by the RNAi effect

In addition, examples of the “substance having a sulfation inhibiting action” include compounds selected from the group consisting of the following (a) to (c).

( _a ) an antibody that binds to chondroitin sulfate proteodalycan sulfate transferase

(b) Chondroitin sulfate proteodalycan sulfate transferase mutant

(c) A low molecular weight compound that binds to chondroitin sulfate proteodalycan sulfate transferase

[0047] The enzymes exemplified above include not only one enzyme corresponding to one gene but also an enzyme group sharing certain characteristics. For example, chondroitinase is a collective term for enzymes such as ABC, AC, and B that share the characteristics of mucopolysaccharide-degrading enzymes but differ in substrate specificity. For example, chondroitinase AC I cleaves the chondroitin sulfates (A, C or E), chondroitin, chondroitin sulfate-dermatan sulfate hybrid type and hyaluronic acid N-acetylhexoxide binding bond. Thus, an oligosaccharide having a Δ 4-glucuronic acid residue at the non-reducing end is generated. This enzyme does not act on dermatan sulfate (chondroitin sulfate B, which has L-iduronic acid as hexuronic acid), ketalan sulfate, heparan sulfate and heparin. In addition, chondroitinase AC II cleaves the N-acetyl hexosaminide bond of chondroitin, chondroitin sulfate A and chondroitin sulfate C in a desorbing reaction to produce 厶 4-unsaturated disaccharide (厶 0 卜 05, A Di-4S and A Di-6S). This enzyme also works well on hyaluronic acid. It does not act on dermatan sulfate (chondroitin sulfate B) and becomes a competitive inhibitor of this enzyme. Chondroitinase B (dermatanase) cleaves the N-acetyl galatatosaminide bond bound to L-iduronic acid of dermatan sulfate in an elimination reaction, and adds a Δ 4-hexuronic acid residue to the non-reducing end. Generate oligosaccharides (disaccharides and tetrasaccharides). This enzyme does not contain L-iduronic acid! /, Does not act on chondroitin sulfate A and chondroitin sulfate C! / ,. Dermatan, a derivative of dermatan sulfate with the sulfate group removed Is not a substrate for this enzyme. The site where the second position of the L-iduronic acid unit of dermatan sulfate is sulfated is more cleaved by this enzyme. Chondroitinase ABC cleaves the N-acetyl hexosaminide bond of chondroitin sulfate A, chondroitin sulfate C, dermatan sulfate, chondroitin, and hyaluronic acid in a reactive manner, and generates Δ 4-hexuronic acid at the non-reducing end. Mainly produces disaccharides with residues. This enzyme does not act on ketalan sulfate, heparin and heparan sulfate. Chondroitinase is a generic name for enzymes that have different properties but have a common property called mucopolysaccharide-degrading enzyme, and always ¾ Chondroitinase ACI, Chonaroitinase AC II, Cnondrotinase Not limited to B, Chondroitinase ABC.

[0048] In addition, the group of enzymes sharing such characteristics is not necessarily b for one gene on genomic DNA. For example, chondroitin-4-sulfatase chondroitin_6_sulfatase is a sequence referenced by multiple accession numbers in the genome database (for example, Gen bank accession number NT_039500 (part of which is accession number CAAA01098429 (sequence No .: 83)), and NT_078575, NT_039353, NW_001030904, NW_0 01030811, NW_001030796, NW_000349) are searched on the public gene database Genbank.

[0049] Among those exemplified above, those corresponding to individual genes are shown as follows. In other words, aggrican, versican, neurocan, brevican, β glycan, Decorin, Biglycan, ribromoduiin ^ PLT, and the enzymes that cleave or degrade chondroitin sulfate proteoglycan exemplified above as chondroitin sulfate proteoglycans or related thereto ADAMTS_1, ADAMTS-4, ADAMTS_5, Calpain I, examples of enzymes involved in chondroitin synthesis, GalNAc4ST-l, GalNAc4ST_2, GALNAC4 S_6ST, UA20ST, GalT-I, GalT_II, GlcAT_I, XylosylT, sulfate transfer Public gene databases of genes encoding C4ST-1, C4ST-2, C4ST-3, D4ST, C6ST_1, and C6ST-2, which are exemplified as enzymes, in humans The accession numbers, nucleotide sequences, and amino acid sequences in Genbank are as follows: It is as follows.

[0050] aggrican (accession number NM—007424, nucleotide sequence number: 1, amino acid sequence number: 2) versican (Accession number BC096495, SEQ ID NO: 3 for nucleotide sequence, SEQ ID NO: 4 for amino acid sequence)

neurocan (accession number NM_010875, nucleotide sequence SEQ ID NO: 5, amino acid sequence SEQ ID NO: 6)

brevican (Accession number NM_007529, nucleotide sequence number: 7, amino acid sequence number: 8)

β glycan (accession number AF039601, nucleotide sequence number: 9, amino acid sequence number: 10)

Decorin (accession number NM_007833, nucleotide sequence SEQ ID NO: 11, amino acid sequence SEQ ID NO: 12)

Biglycan (Accession number BC057185, SEQ ID NO: 13 for nucleotide sequence, SEQ ID NO: 14 for amino acid sequence)

Fibromodulin (Accession number NM_021355, nucleotide sequence number: 15, amino acid sequence number: 16)

PG-Lb (Accession number NM_007884, nucleotide sequence number: 17, amino acid sequence number: 18)

ADAMTS-1 (Accession number NM_009621, nucleotide sequence SEQ ID NO: 19, amino acid sequence SEQ ID NO: 20)

ADAMTS_4 (Accession number NM_172845, SEQ ID NO: 21 of nucleotide sequence, SEQ ID NO: 22 of amino acid sequence)

ADAMTS_5 (Accession number AF140673, SEQ ID NO: 23, Amino Acid IJ SEQ ID: 24)

Calpain I (Accession number NM_007600, nucleotide sequence SEQ ID NO: 25, amino acid sequence SEQ ID NO: 26)

GalNAc4ST-l (accession number NM_175140, nucleotide sequence number: 27, amino acid sequence number: 28)

GalNAc4ST-2 (Accession number NM_199055, nucleotide sequence SEQ ID NO: 29, amino acid sequence SEQ ID NO: 30) GALNAC4S-6ST (Accession number NM_029935, nucleotide sequence SEQ ID NO: 31, amino acid sequence SEQ ID NO: 32)

UA20ST (Accession number NM—177387, SEQ ID NO: 33 for nucleotide sequence, SEQ ID NO: 34 for amino acid sequence)

GalT-I (Accession number NM—016769, nucleotide sequence number: 35, amino acid sequence number: 36)

GalT-II (Accession number BC064767, nucleotide sequence number: 37, amino acid sequence number: 38)

GlcAT-I (accession number BC058082, nucleotide sequence number: 39, amino acid sequence number: 40, or accession number NM_024256, nucleotide sequence number: 41, amino acid sequence number: 42) )

XylosylT (Accession number NM—145828, nucleotide sequence number: 43, amino acid sequence number: 44)

C4ST-1 (Accession number NM_021439, nucleotide sequence SEQ ID NO: 45, amino acid sequence SEQ ID NO: 46)

C4ST-2 (Accession number NM_021528, nucleotide sequence number: 47, amino acid sequence number: 48)

C4ST-3 (Accession No. XM—355798, nucleotide sequence SEQ ID NO: 49, amino acid sequence SEQ ID NO: 50)

D4ST (Accession number NM— 028117, nucleotide sequence number: 51, amino acid sequence number: 52)

C6ST-1 (Accession number NM_016803, nucleotide sequence SEQ ID NO: 53, amino acid sequence SEQ ID NO: 54)

C6ST-2 (Accession number AB046929, nucleotide sequence number: 55, amino acid sequence number: 56)

Even proteins other than those described above have high homology (usually 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% or more) with the sequences described in the sequence listing. And the function of the protein (for example, it binds to the intracellular components) The protein having a function or the like) is included in the protein of the present invention. The above proteins are, for example, the following: IJ numbers: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36 , 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, the amino acid sequence in which one or more amino acids are added, calo, deletion, substitution, or insertion A protein consisting of a sequence, wherein the number of normally changing amino acids is within 30 amino acids, preferably within 10 amino acids, more preferably within 5 amino acids, most preferably within 3 amino acids.

Yes

[0052] Examples of the gene in the present invention include, for example, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, or 55, an endogenous gene in another organism corresponding to the DNA comprising the nucleotide sequence described in any one of the above (a homologue of the above human gene) Etc.).

[0053] Also, IJ numbers: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31,

33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55 DNA is generally sequence numbers: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, respectively. 39, 41, 43, 45, 47, 49, 51, 53, and 55. High homology means 50% or more, preferably 70% or more, more preferably 80% or more, more preferably 90% or more (for example, 95% or more, further 96%, 97%, 98% or 99% or more). Means the homology of (above). This homology is determined by the mBLAST algorithm (Altschul et al. (1990) Proc. Natl. Acad. Sci. USA 87: 2264-8; Karlin and Altschul (1993) Proc. Natl. Aca d. Sci. USA 90: 5873- 7) Power can be determined by S. Further, when the DNA is isolated from the living body, the IJ numbers: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55. It is considered that the DNA hybridizes under stringent conditions. Here, as “stringent conditions”, for example, “2 X SSC, 0.1% SDS, 50.C”, “2 X SSC, 0.1% SDS, 42 ° C”, “1 X SSC, 0.1% SDS, 37 ° C ”and more stringent conditions“ 2 X SSC, 0.1% SDS, 65.C ”,“ 0.5 X SSC, 0.1% SDS, 42.C ”and“ 0.2 X SSC, 0.1% SDS, 65 ° The ability S to raise the condition of “C”. [0054] A person skilled in the art will convert a protein functionally equivalent to the above protein from the above highly homologous proteins into a chondroitin sulfate proteodarican degradation promoting action, synthetic inhibitory action, desulfating action or sulfating action. It can be obtained appropriately by using an inhibitory activity measurement method. A specific activity measuring method will be described in the section of the screening method in the present invention. Moreover, those skilled in the art can appropriately obtain an endogenous gene corresponding to the above gene in another organism based on the base sequence of the above gene. In the present specification, the above-mentioned proteins and genes corresponding to the above-mentioned proteins and genes in organisms other than humans, or the above-mentioned proteins and genes functionally equivalent to the above-mentioned proteins and genes are also simply referred to as It may be described in.

[0055] The protein of the present invention can be prepared not only as a natural protein but also as a recombinant protein using a gene recombination technique. As a natural protein, for example, it can be prepared by a method using affinity chromatography using an antibody against the above protein against an extract of a cell (tissue) considered to express the above protein. It is. On the other hand, a recombinant protein can be prepared, for example, by culturing cells transformed with DNA encoding the protein. The above-mentioned protein of the present invention is suitably used, for example, in the screening method described later.

[0056] "Nucleic acid" in the present invention means RNA or DNA. Chemically synthesized nucleic acid analogs such as so-called PNA (p-mark tide nucleic acid) are also included in the nucleic acids of the present invention. PNA replaces the pentose / phosphate skeleton, which is the basic skeleton structure of nucleic acid, with a polyamide skeleton with glycine as a unit, and has a three-dimensional structure very similar to nucleic acid.

[0057] As a method for inhibiting the expression of a specific endogenous gene, a method using an antisense technique is well known to those skilled in the art. There are a number of factors that cause the antisense nucleic acid to inhibit the expression of the target gene. Inhibition of transcription initiation due to triplex formation, transcription inhibition due to hybridization with a site where an open loop structure was locally created by RNA polymerase, transcription inhibition due to hybridization with RNA undergoing synthesis, intron By splicing at the junction of Etason Inhibiting splicing, splicing inhibition by hybridization with spliceosome formation site, inhibition of translocation from nucleus to cytoplasm by hybridization with mRNA, inhibition of splicing by hybridization with cabbing site and poly (A) addition site, translation initiation factor Inhibition of translation initiation by hybridization with the binding site, inhibition of translation by hybridization with the ribosome binding site near the initiation codon, inhibition of peptide chain elongation by hybridization with the translation region of mRNA and polysome binding site, and nucleic acid and protein Gene expression inhibition by hybridization with the interaction site. Thus, antisense nucleic acids inhibit the expression of target genes by inhibiting various processes such as transcription, splicing or translation (Hirashima and Inoue, Shinsei Kagaku Kogaku Kenkyu 2 Nucleic acid IV gene replication and expression, Japan Biochemical Society, Tokyo Chemical Doujin, 1993, 319-347.).

[0058] The antisense nucleic acid used in the present invention can be any of the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase-suppressing protein, and sulfotransferase by any of the above-described actions. Expression and / or function of the gene encoding the force may be inhibited. In one embodiment, the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or a gene encoding a sulfate transfer enzyme is complementary to the untranslated region near the 5 'end of the mRNA. If an antisense sequence is designed, it would be effective to inhibit gene translation. In addition, an IJ complementary to the coding region or the 3 ′ untranslated region can also be used.

[0059] As described above, the antisense of the sequence of the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or untranslated region that includes not only the translation region of the gene encoding the sulfotransferase. Nucleic acids containing [I] are also included in the antisense nucleic acids used in the present invention. The antisense nucleic acid used is linked downstream of an appropriate promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side. The nucleic acid thus prepared can be transformed into a desired animal (cell) using a known method. The sequence of the antisense nucleic acid is the gene or gene encoding the endogenous chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or sulfate group of the animal (cell) to be transformed. It is preferably a sequence complementary to a part of it, but it effectively suppresses gene expression. As far as possible, they need not be completely complementary. The transcribed RNA preferably has a complementarity of 90% or more, most preferably 95% or more, to the target gene transcript. In order to effectively inhibit the expression of a target gene using an antisense nucleic acid, the length of the antisense nucleic acid is preferably at least 15 bases and less than 25 bases, but the antisense nucleic acid of the present invention is not necessarily of this length. For example, it may be 100 bases or more, or 500 bases or more.

[0060] The antisense nucleic acid of the present invention is not particularly limited. For example, the base sequence of the Versican gene (GenBank accession number BC096495, SEQ ID NO: 3), C4ST-1 (GenBank accession number NM_021439, SEQ ID NO: : 45), C4ST-2 (GenBank accession number NM_021528, SEQ ID NO: 47), C4ST-3 (GenBank accession number XM_35579 8, SEQ ID NO: 49), etc. .

[0061] Inhibition of the expression of the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfation enzyme inhibitory protein, or gene encoding sulfotransferase is performed using ribozyme or DNA encoding ribozyme. It is also possible to do this. Ribozyme refers to an RNA molecule that has catalytic activity. The ability of ribozymes to have various activities exists, and in particular, research focusing on ribozymes as enzymes that cleave RNA has made it possible to design ribozymes that cleave RNA in a site-specific manner. Some ribozymes have a size of 400 nucleotides or more, such as group I intron type and Ml RNA contained in RNase P, but some have an active domain of about 40 nucleotides called hammerhead type or hairpin type. (Makoto Koizumi and Eiko Otsuka, Protein Nucleic Acid Enzyme, 1990, 35, 2191 ·).

[0062] For example, the self-cleaving domain of the hammerhead ribozyme cleaves 3 ′ of C15 in the sequence G13U14C15, but base pairing between U14 and A9 is important for its activity. Shows that A15 or U15 can also be cleaved (Koizumi, M. et al., FEBS Lett, 1988, 228, 228.). By designing a ribozyme whose substrate binding site is complementary to the RNA sequence in the vicinity of the target site, it is possible to create a restriction RNA-cleaving ribozyme that recognizes the sequence UC, UU or UA in the target RNA (Koizumi , M. et al., FEBS Le tt, 1988, 239, 285, Makoto Koizumi and Eiko Otsuka, Protein Nucleic Acid Enzymes, 1990, 35, 2191. Oizumi, M. et al., Nucl Acids Res, 1989, 17, 7059.).

[0063] Hairpin ribozymes are also useful for the purposes of the present invention. This ribozyme is found, for example, in the minus strand of tobacco ring spot virus satellite RNA (Buzayan, JM., Nature, 1986, 323, 349). It has been shown that hairpin-type ribozymes can also produce target-specific RNA cleavage ribozymes (Kikuchi, Y. & Sasaki, N., Nucl Acids Res, 1991, 19, 6751., Hiroshi Kikuchi, Biology, 1992, 30, 112.). In this way, the ribozyme is used to specifically cleave the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or transcript of a gene encoding a sulfotransferase. Gene expression can be inhibited.

[0064] Inhibition of endogenous gene expression may also be caused by RNA interference (hereinafter abbreviated as "RNAi") using double-stranded RNA having the same or similar sequence as the target gene sequence. can be fi.

[0065] With the completion of recent genome projects, the entire human base sequence has been decoded and many disease-related genes have been actively identified. Currently, therapeutic methods and drug discovery targeting specific genes are being actively implemented. ing. Of particular interest is the application of small interfering RNA (siRNA), which exerts a specific post-transcriptional inhibitory effect, to gene therapy. RNAi is a technique that is currently attracting attention because when double-stranded RNA (dsRNA) is directly taken into cells, the expression of genes with a sequence homologous to this dsRNA is suppressed. In mammalian cells, RNAi can be induced by using short dsRNA (siRNA). RNAi is more stable, easier to experiment, and less expensive than knockout mice. Has many advantages.

[0066] A nucleic acid having an inhibitory action by the RNAi effect is generally also called siRNA or shRNA. RNAi is a short double-stranded RNA (hereinafter abbreviated as “dsRNA”) consisting of a sense RNA consisting of a sequence homologous to the mRNA of the target gene and an antisense RNA consisting of a complementary sequence. This is a phenomenon that induces destruction by specifically and selectively binding to the target gene mRNA, and efficiently inhibiting (suppressing) the expression of the target gene by cleaving the target gene. For example, when dsRNA is introduced into a cell, the expression of the gene homologous to the RNA is suppressed (knocked down). Thus RNAi is the target Since gene expression can be suppressed, it has been attracting attention as a simple gene knockout method to replace conventional complicated and low efficiency homologous recombination methods, or as a method applicable to gene therapy. . The RNA used for RNAi must be completely identical to the above-mentioned chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor protein, or gene encoding a sulfotransferase, or a partial region of the gene. None, but preferably has complete homology.

[0067] In designing siRNA, the target is not particularly limited as long as it is a gene encoding the above-mentioned chondroitin sulfate proteoglycan core protein, synthetic enzyme, desulfase inhibitor protein, or sulfate transferase. It is possible to make any arbitrary region as a target candidate. For example, the base sequence of Versican gene (SEQ ID NO: 3), the base sequence of C4ST-1 gene (SEQ ID NO: 45), the base sequence of C4ST-2 gene (SEQ ID NO: 47), the base sequence of C4ST-3 gene ( It can be created based on SEQ ID NO: 49). More specifically, a partial region of the sequence can be a target candidate. For example, a partial region of the base sequence of the Versican gene (SEQ ID NO: 57), the base of the C4ST-1 gene Partial region of sequence (SEQ ID NO: 58), partial region of base sequence of C4ST-2 gene (SEQ ID NO: 59), partial region of base sequence of C4ST-3 gene (SEQ ID NO: 60), C6ST -Partial region of the base sequence of 1 gene (SEQ ID NO: 61), partial region of the base sequence of C6ST-2 gene (SEQ ID NO: 62), partial region of the base sequence of GalNAc4ST-l gene (SEQ ID NO: 6 3), a partial region of the nucleotide sequence of the GalNAc4ST-2 gene (SEQ ID NO: 64), a partial region of the base sequence of GALNAC4S-6ST (SEQ ID NO: 65), and the like. More specifically, siRNA targeting the DNA sequence specifically shown by the present specification (SEQ ID NO: 7;! To 82) can be exemplified.

[0068] In order to introduce siRNA into a cell, a method in which siRNA synthesized in vitro is linked to plasmid DNA and introduced into the cell, a method of annealing two RNAs, or the like can be employed.

[0069] The two RNA molecules may be molecules having a structure in which one end is closed, for example, siRNA (shRNA) having a hairpin structure. shRNA is called short hairpin RNA, and part of a single strand forms a complementary strand with other regions. This is an RNA molecule having a stem-loop structure. That is, a molecule capable of forming a double-stranded RNA structure in the molecule is also included in the siRNA of the present invention.

[0070] Further, as a preferred embodiment of the present invention, RNA (siRNA) capable of suppressing the expression of Versican, C4ST_1, C4ST_2, C4ST-3, etc. by the RNAi effect, which is specifically shown in the present specification In siRNA targeting DNA ligated IJ (SEQ ID NO: 7;! -82), for example, even if it is a double-stranded RNA having a structure in which one or a few RNAs are added or deleted, the above-mentioned Any siRNA of the present invention may be used as long as it has a function of suppressing the expression of a gene encoding a chondroitin sulfate proteodarican core protein, a synthetic enzyme, a desulfase inhibitor protein, or a sulfotransferase. .

[0071] RNA used for RNAi (siRNA) need not be completely identical (homologous) to the gene encoding the protein or a partial region of the gene, but is completely identical (similar) ).

[0072] The details of the RNAi mechanism are still unclear. An enzyme called DICER (a member of the RNase III nuclease family) comes into contact with double-stranded RNA, and the double-stranded RNA becomes small interfering RNA or It is thought to be broken down into small fragments called siRNAs. The double-stranded RNA having the RNAi effect in the present invention includes double-stranded RNA before being digested by DICER as described above. That is, even if a long RNA that does not have the RNAi effect as it is is expected to be degraded into siRNA having the RNAi effect in the cell, the double-stranded RNA in the present invention The length of is not particularly limited.

[0073] For example, the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or two long-chains corresponding to the full-length or almost full-length region of mRNA of the gene encoding sulfate group transferase For example, the strand RNA can be decomposed in advance with DICER, and the degradation product can be used as the agent of the present invention. This degradation product is expected to contain double-stranded RNA molecules (siRNA) having the RNAi effect. According to this method, it is not necessary to particularly select a region on mRNA expected to have an RNAi effect. That is, the region on the mRNA of the above-mentioned gene of the present invention having an RNAi effect does not necessarily need to be accurately defined.

[0074] The above-mentioned "double-stranded RNA that can be suppressed by the RNAi effect" of the present invention is known to those skilled in the art. Produced as appropriate based on the base sequence of the gene encoding the above chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor protein, or sulfotransferase, which is the target of double-stranded RNA. Can do. For example, the double-stranded RNA of the present invention can be prepared based on the nucleotide sequence set forth in SEQ ID NO: 71. That is, based on the nucleotide sequence set forth in SEQ ID NO: 71, an arbitrary continuous RNA region of mRNA that is a transcription product of the sequence is selected, and a double-stranded RNA corresponding to this region is prepared. The person skilled in the art can appropriately carry out within the range of normal trials. Moreover, those skilled in the art can appropriately select a siRNA sequence having a stronger // RNAi effect from the mRNA sequence which is a transcription product of the sequence, by a known method. If one strand is known, those skilled in the art can easily know the base sequence of the other strand (complementary strand). A siRNA can be appropriately prepared by those skilled in the art using a commercially available nucleic acid synthesizer. In addition, for synthesis of desired RNA, a general synthetic contract service can be used.

[0075] In addition, the siRNA in the present invention may be a mixture of a plurality of sets of double-stranded RNAs for a region containing a target sequence, which need not necessarily be a set of double-stranded RNAs for the target sequence. Here, siRNA as a nucleic acid mixture corresponding to the target sequence can be appropriately prepared by a person skilled in the art using a commercially available nucleic acid synthesizer and a DICER enzyme. You can use the composite contract service. The siRNA of the present invention includes so-called “cocktail siRNA”.

[0076] In addition, in the siRNA of the present invention, not all nucleotides are necessarily ribonucleotides (RNA). That is, in the present invention, one or more ribonucleotides constituting siRNA may be a corresponding deoxyribonucleotide. This “corresponding” refers to the same base species (adenine, guanine, cytosine, thymine (uracil)) although the structures of the sugar moieties are different. For example, it corresponds to a ribonucleotide having an adenine. The “plurality” is not particularly limited, but preferably refers to a small number of about 2 to 5

Yes

[0077] Furthermore, a DNA (vector) capable of expressing the above RNA of the present invention is also the above-mentioned tag of the present invention. It is contained in the preferable aspect of the compound which can suppress the expression of the gene which codes a protein. For example, the DNA (vector) capable of expressing the double-stranded RNA of the present invention is a DNA encoding one strand of the double-stranded RNA and a DNA encoding the other strand of the double-stranded RNA, Each DNA has a structure linked to a promoter so that it can be expressed. Those skilled in the art can appropriately prepare the above DNA of the present invention by general genetic engineering techniques. More specifically, the expression vector of the present invention can be prepared by appropriately inserting DNA encoding the RNA of the present invention into various known expression vectors.

[0078] In addition, the expression inhibitory substance of the present invention includes the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or expression regulatory region of a gene encoding a sulfotransferase (for example, Specific examples include the base sequence represented by SEQ ID NO: 66, which is the promoter region of PG-Lb.) By binding to the above-mentioned core protein of chondroitin sulfate proteodarican A compound that inhibits the expression of a gene encoding a synthase, a desulfase inhibitor protein, or a sulfotransferase. The compound is, for example, a promoter DNA fragment of a gene encoding the above chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or sulfotransferase, and binding activity to the DNA fragment It can be obtained by a screening method using as an index. In addition, those skilled in the art will determine whether or not the desired compound inhibits the expression of the above-mentioned chondroitin sulfate-teododalican core protein, synthase, desulfase-inhibiting protein, or gene encoding sulfotransferase. The determination can be appropriately carried out by a known method such as a reporter assay method.

[0079] Furthermore, the DNA (vector) capable of expressing the RNA of the present invention is also the core protein, synthase, desulfase-inhibiting protein, or sulfate group of the above-described chondroitin sulfate proteodarican of the present invention. A preferred embodiment of the compound capable of inhibiting the expression of a gene encoding a transferase is included. For example, the DNA (beta) capable of expressing the double-stranded RNA of the present invention is a DNA that encodes one strand of the double-stranded RNA and a DNA force S that encodes the other strand of the double-stranded RNA. , The structure linked to the promoter so that each can be expressed It has DNA. Those skilled in the art can appropriately prepare the above DNA of the present invention by a general genetic technique. More specifically, the expression vector of the present invention can be prepared by appropriately inserting DNA encoding the RNA of the present invention into various known expression vectors.

[0080] A preferred embodiment of the vector of the present invention is a vector that expresses RNA (siRNA) capable of suppressing the expression of Versican, C4ST_1, C4ST_2, C4ST-3, and the like by the RNAi effect.

[0081] The above-described chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfating enzyme inhibitory compound, or antibody that binds to sulfotransferase can be prepared by methods known to those skilled in the art. For example, a polyclonal antibody can be obtained as follows. Serum is obtained by immunizing small animals such as rabbits with recombinant (recombinant) protein expressed in microorganisms as a fusion protein with the above-mentioned natural protein or GST, or a partial peptide thereof. For example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, core protein of the above chondroitin sulfate proteodarican, synthase, desulfase inhibitor compound, or sulfate transferase Or by purification using an affinity column coupled with a synthetic peptide. In the case of a monoclonal antibody, for example, the above-mentioned chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor compound, or sulfotransferase or its partial peptide is immunized to a small animal such as a mouse. The spleen is removed from the mouse and ground to separate the cells. The cells are fused with mouse myeloma cells using a reagent such as polyethylene glycol. From the above, a clone producing an antibody that binds to the above chondroitin sulfate proteodarican coprotein, synthase, desulfase inhibitor compound, or sulfotransferase is selected. Next, the obtained hyperidoma was transplanted into the abdominal cavity of the mouse, and ascites was collected from the mouse, and the resulting monoclonal antibody was purified using, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, Coupling of the chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor compound, or sulfotransferase protein or synthetic peptide described above It can be prepared by purification using an affinity column or the like.

[0082] The antibody of the present invention is not particularly limited as long as it binds to the above-described chondroitin sulfate proteodarican core protein of the present invention, a synthetic enzyme, a desulfase inhibitor compound, or a sulfotransferase. In addition to polyclonal antibodies and monoclonal antibodies, human antibodies, humanized antibodies obtained by genetic recombination, and antibody fragments or modified antibodies thereof may also be used.

[0083] The protein of the present invention used as a sensitizing antigen for obtaining an antibody is not limited with respect to the animal species from which it is derived, but is preferably a protein derived from a mammal such as a mouse, particularly a human-derived protein. . A human-derived protein can be appropriately obtained by those skilled in the art using the gene sequence or amino acid sequence disclosed in the present specification.

[0084] In the present invention, the protein used as the sensitizing antigen may be a complete protein or a partial peptide of the protein. Examples of the partial peptide of the protein include an amino group (N) terminal fragment and a carboxy (C) terminal fragment of the protein. As used herein, “antibody” means an antibody that reacts with the full length or fragment of a protein.

[0085] In addition to immunizing a non-human animal with an antigen to obtain the above hyperidoma, human lymphocytes such as human lymphocytes infected with EB virus are sensitized with proteins, protein-expressing cells or lysates thereof in vitro. And fusion of sensitized lymphocytes with human-derived permanent mitotic cells, such as U266, to produce a hyperidoma that produces the desired human antibody with protein-binding activity. .

[0086] The above-described chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor compound, or antibody to sulfate group transferase of the present invention binds to the protein, thereby causing expression or function of the protein. An inhibiting effect is expected. When the obtained antibody is used for the purpose of administering it to the human body (antibody treatment), a human antibody or a humanized antibody is preferable in order to reduce immunogenicity.

[0087] Further, the present invention provides a substance capable of inhibiting the function of the above-mentioned chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor compound, or sulfotransferase. In addition, it also contains a low molecular weight substance (low molecular weight compound) that binds to the core protein, synthetic enzyme, desulfurizing oxidase inhibiting compound, or sulfotransferase of the chondroitin sulfate proteodarican described above. The low molecular weight substance may be a natural or artificial compound. Usually, it is a compound that can be produced or obtained by using methods known to those skilled in the art. The compound of the present invention can also be obtained by the screening method described later.

[0088] Further, as a substance capable of inhibiting the expression or function of the above-mentioned chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor protein, or sulfotransferase of the present invention, the above-mentioned chondroitin sulfate proteodarican And a mutant having a dominant negative property (dominant negative protein) with respect to a core protein, a synthase, a desulfase inhibitor protein, or a sulfotransferase. “The chondroitin sulfate proteodarican core protein, synthase, desulfurase inhibitor protein, or the protein variant having a dominant negative property to sulfate group” refers to the core of chondroitin sulfate proteodarican. It refers to a protein having a function of eliminating or reducing the activity of an endogenous wild-type protein by expressing a gene encoding a protein, a synthase, a desulfase-inhibiting protein, or a sulfotransferase. Examples of such dominant negative proteins include Versican core protein mutants that competitively inhibit the binding to chondroitin sulfate with the wild-type Versican core protein.

[0089] In the present invention, the organ, tissue or cell that inhibits the production or accumulation of chondroitin sulfate proteodarican is not particularly limited, but is preferably an organ or tissue containing nerve cells, more preferably the brain or brain. A nerve cell in tissue or brain tissue.

[0090] A compound that inhibits the production or accumulation of chondroitin sulfate proteodarican is expected to be a drug for the treatment or prevention of neurofibrotic degenerative diseases. Here, “treatment or prevention” refers to a case where it has a partial effect that is not necessarily required to have a complete therapeutic or preventive effect on an organ, tissue, or cell that exhibits neurofibrotic degeneration. It may be.

[0091] In the present invention, a neurofibrotic degenerative disease is a special disease as long as it is a disease accompanied by neurofibrotic degeneration. Is preferably a cranial nerve fibrotic degenerative disease, more preferably a cerebrospinal nerve fibrotic degenerative disease or a peripheral nerve fibrotic degenerative disease, more preferably Parkinson's disease, Alzheimer's Disease, amyotrophic lateral sclerosis, polyglutamine disease, spinal muscular atrophy, Huntington's disease, or multiple sclerosis.

[0092] The neurofibrotic degeneration inhibitor of the present invention has an action of suppressing neurofibrotic degeneration by inhibiting the production or accumulation of chondroitin sulfate proteodarican which is the cause of neurofibrotic degeneration. Accordingly, preferred embodiments of the present invention include, for example, a therapeutic agent for cranial nerve fibrotic degenerative disease, a therapeutic agent for cerebrospinal neurofibrotic degenerative disease, a peripheral nerve fiber containing the neurofibrotic degeneration inhibitor of the present invention as an active ingredient. Sexual degenerative disease treatment agent, Parkinson's disease treatment agent, Alzheimer's disease treatment agent, amyotrophic lateral sclerosis treatment agent, polyglutamine disease treatment agent, spinal muscular atrophy treatment agent, Huntington's disease treatment agent, or multiple sclerosis Provide therapeutic agents.

In addition, the “nerve fibrotic degeneration inhibitor” of the present invention is expressed as a “nerve fibrotic degeneration therapeutic agent”, a “nerve fibrotic degeneration inhibitor”, a “nerve fibrotic degeneration improving agent” or the like. Is also possible. Further, in the present invention, the “suppressor” is expressed as “medicine”, “pharmaceutical composition”, “therapeutic drug” or the like.

It should be noted that “treatment” in the present invention includes a prophylactic effect capable of previously suppressing the occurrence of neurofibrotic degeneration. In addition, it is not necessarily limited to a case having a complete therapeutic effect on cells (tissues) expressing neurofibrotic degeneration, and may have a partial effect.

[0095] The drug of the present invention can be mixed with a physiologically acceptable carrier, excipient, certain! /, Diluent, etc. and administered orally or parenterally as a pharmaceutical composition. As oral preparations, dosage forms such as granules, powders, tablets, capsules, solvents, emulsions or suspensions can be used. As parenteral agents, dosage forms such as injections, infusions, drugs for external use, inhalants (nebulizers) or suppositories can be selected. Examples of the injection include intracranial injection, intranasal injection, subcutaneous injection, intramuscular injection, and intraperitoneal injection. Examples of the medicine for external use include a nasal administration agent or an ointment. The preparation technique for the above dosage form so as to include the drug of the present invention which is the main component is known. [0096] For example, a tablet for oral administration can be produced by adding an excipient, a disintegrant, a binder, a lubricant and the like to the drug of the present invention, mixing, and compressing and shaping. As the excipient, lactose, starch, mannitol or the like is generally used. As the disintegrant, calcium carbonate or carboxymethyl cellulose calcium is generally used. As the binder, gum arabic, carboxymethyl cellulose, or polybulur pyrrolidone is used. As the lubricant, talc magnesium stearate and the like are known.

[0097] The tablet containing the drug of the present invention can be subjected to a known coating for masking or enteric preparation. As the coating agent, ethyl cellulose, polyoxyethylene glycol or the like can be used.

[0098] The injection can be obtained by dissolving the agent of the present invention as a main component together with an appropriate dispersant, or dissolving or dispersing in a dispersion medium. Depending on the choice of the dispersion medium, either aqueous solvent or oil-based solvent can be used. In order to use an aqueous solvent, distilled water, physiological saline, Ringer's solution, or the like is used as a dispersion medium. For oil-based solvents, various vegetable oils such as propylene glycol are used as dispersion media. At this time, a preservative such as paraben can be added as necessary. In addition, known isotonic agents such as sodium chloride and glucose can be added to the injection. Furthermore, a soothing agent such as benzalkonium chloride pro-hydrochloride can be added.

[0099] Further, an external preparation can be obtained by making the agent of the present invention into a solid, liquid, or semi-solid composition. About a solid or liquid composition, it can be set as an external preparation by setting it as the composition similar to what was described previously. A semi-solid composition can be prepared by adding a thickener to an appropriate solvent as required. As the solvent, water, ethyl alcohol, polyethylene glycol, or the like can be used. As the thickener, bentonite, polybutyl alcohol, acrylic acid, methacrylic acid, or polyvinyl pyrrolidone is generally used. This composition can be added with a preservative such as benzalkonium chloride. A suppository can also be obtained by combining an oily base material such as cacao butter or an aqueous gel base material such as cellulose derivative as a carrier.

[0100] When the agent of the present invention is used as a gene therapy agent, in addition to the method of directly administering the agent of the present invention by injection, a method of administering a vector incorporating a nucleic acid can be mentioned. . Examples of the above-mentioned vectors include adenovirus vectors, adeno-associated virus vectors, herpes vinores vectors, vaccinia winores betaters, retro winores betaters, and lentivirus vectors. Throw well with the power S.

[0101] It is also possible to introduce the drug of the present invention into a phospholipid vesicle such as a ribosome and administer the vesicle. The endoplasmic reticulum retaining siRNA or shRNA is introduced into a predetermined cell by the ribofusion method. The obtained cells are then administered systemically, for example, intravenously or intraarterially. It can also be administered locally to neurofibrous degenerated tissue or the like. With respect to siRNA, it has a very excellent specific post-transcriptional inhibitory effect in vitro. In vivo, it is rapidly degraded by nuclease activity in serum. Therefore, the limited duration in vivo has become a problem, and the development of optimal and effective delivery systems has been demanded. As an example, Ochiya, T et al. (Ochiya, T et al. Nat. Med. (1999) 5 7 07-710; Ochiya, T et al. Curr. Gene Ther. (2001) 1 31-52) It has been reported that when atelocollagen, an affinity material, is mixed with nucleic acid to form a complex, it protects the nucleic acid from degrading enzymes in the living body and is a very suitable carrier for siRNA. Yes. As another example, a delivery system using ribosomes and viruses directly in the brain has been developed (Xia, H et al. Nat. Biotechnol. (2002) 20 1006- 1010; Brummelkamp, TR et al. Cancer Cell (2002) 2 243-247; Barton, GM and Medzhitov, R. Proc. Natl. Acad. Sci. USA, (2002) 99 14943-14945; Abbas- Terki, T • et al. Hum. Gene. Ther (2002) 13 2197-2201). Then, siRNA has been developed for gene therapy for neurofibrotic degenerative diseases by the above method! For example, BAC El (Beta-site APP Cleaving Enzyme: β-secretase) siRNA was developed to reduce amyloid formation using in vivo tofence nick mice. A delivery system has been reported in which the BACE1 siRNA is incorporated into a lentiviral vector and expressed in the brain (Singer et al. Nat. Neurosci. (2005) 8 (10) 1343-1349). These are only examples, and the delivery method in the present invention is not limited to these.

[0102] The necessary amount (effective amount) of the drug of the present invention is administered to mammals including humans within the safe dose range. The dosage of the drug of the present invention is the type of dosage form, In consideration of the administration method, the patient's age and weight, the patient's symptoms, etc., the final decision can be made as appropriate based on the judgment of a doctor or veterinarian. For example, the power varies depending on age, sex, symptoms, administration route, number of administrations, and dosage forms.For example, the dose in the case of adenovirus is about 10 ⁶ to 10 ¹³ per day, 1 week to 8 It is administered at weekly intervals.

[0103] In order to introduce siRNA or shRNA into a target tissue or organ, a commercially available gene introduction kit (for example, Adeno Express: Clontech) can also be used.

[0104] When the agent of the present invention is used, the application site or the type of the disease is not particularly limited as long as it is a disease that expresses neurofibrotic degeneration. For example, cerebrospinal nerve fibrotic degenerative disease, peripheral nerve fibrotic degeneration Applicable for diseases, Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, polyglutamine disease, spinal muscular atrophy, Huntington's disease, or multiple sclerosis. The above-mentioned diseases may be accompanied with other diseases.

[0105] The present invention also provides a screening method for a neurofibrotic degeneration inhibitor, which comprises selecting a substance having an action of inhibiting the production or accumulation of chondroitin sulfate proteodarican from a test sample. With the screening method of the present invention, it is possible to efficiently obtain a neurofibrous degeneration inhibitor or a candidate compound for a neurofibrous degeneration inhibitor.

[0106] A preferred embodiment of the screening method of the present invention includes screening a neurofibrotic degeneration inhibitor comprising the step of selecting a substance having the action described in any of the following (a) to (d): Is the method.

( _a ) Promoting the degradation of chondroitin sulfate proteodarican

(b) Inhibition of chondroitin sulfate proteodarican synthesis

(c) Desulfation effect of chondroitin sulfate proteodarican

(d) Inhibitory effect of chondroitin sulfate proteodarican on sulfation

[0107] As a basic principle of screening common to these, a typical example includes one including the following steps.

(1) Cells that synthesize (generate) chondroitin sulfate proteodarican (CSPG) itself / or glycosaminoglycan (GAG) chain / or CSPG or GAG chain

(2) Test compounds (for example, huge compound libraries owned by pharmaceutical companies) (3) Method for detecting cut cross section of chondroitin sulfate proteodarican (CSPG) / chondroitin sulfate proteodarican (CSPG) / free glycosaminodarlican (GAG) The above three tools are used. If (1) and (2) are mixed in a test tube or on a culture dish, and the effect is detected easily by (3)!

[0108] Hereinafter, embodiments of the screening method of the present invention will be exemplified. In the embodiment described below, the chondroitin sulfate proteodarican, synthase, desulfase inhibitor compound, sulfate transferase, degradation promoting enzyme, and desulfase used are derived from human, mouse, Forces derived from rats and the like are not particularly limited to those derived from these. The part of chondroitin sulfate proteodalycan is a component such as a glycosaminodarican chain, a core protein, or a part thereof, and is not particularly limited.

[0109] The test compound used in the embodiments described below is not particularly limited. For example, natural compounds, organic compounds, inorganic compounds, proteins, peptides and other single compounds, compound libraries, Examples include gene library expression products, cell extracts, cell culture supernatants, fermented microorganism products, marine organism extracts, plant extracts, and the like.

[0110] In addition, the "contact" to the test compound in the embodiment described below is usually chondroitin sulfate proteodarican, a part thereof, a synthetic enzyme, a desulfase inhibitor compound, a sulfotransferase, a degradation promoting enzyme. However, the method is not limited to this method, which is performed by mixing a desulfating enzyme with a test compound. For example, the above “contact” can be performed by contacting a cell expressing these proteins or a part thereof with a test compound.

[0111] The origin of the "cell" in the embodiments described below is not particularly limited to cells derived from humans, mice, rats, etc., and is used in each embodiment. It is also possible to use microbial cells such as Escherichia coli and yeast transformed to express the protein. For example, a cell expressing a chondroitin sulfate proteodarican can be expressed as a cell that expresses an endogenous chondroitin sulfate proteodarican gene or an exogenous chondroitin sulfate proteodarican gene, Cells in which the gene is expressed can be used. Cells expressing the exogenous chondroitin sulfate proteodarican gene are usually created by introducing an expression vector containing the chondroitin sulfate proteodarican gene into the host cell. The power to do S. The expression vector can be produced by general genetic engineering techniques.

[0112] In addition, in the following description, “chondroitin sulfate proteodarican core protein” (the matrix is chondroitin sulfate proteoglycan core, and the matrix type is chondroitin sulfate proteoglycan core protein such as aggrican, vers ican, neurocan, brevican, etc. In addition, membrane-type chondroitin sulfate proteoglycans are core proteins such as Decorin, Biglycan, Fibromodulin, and PG_Lb, and “synthetic enzymes” include, for example, GalNAc4ST_l, GalNAc4ST_2, GALNAC4S-6ST, UA20ST, GalT-I, GalT_H, GlcAT_I, XylosylT, etc. “Sulfyltransferase” includes, for example, C4ST-1 (Chondroitin D—N—acetylgalactosamine—4—0—sulfotransferase 1), 4S 丄 2 (Cnonaroitin DN-acetylgalactosamine) -4-0- sulfotransferase 2), C4ST-3 (Chondroitin D_N_acetylgalactosamine_4_0_sulfotransferase 3), D4ST, C6 ST-1, C6ST-2, etc. Also, "degradation promoting enzyme" Are, for example, ADAMTS-1, ADAM TS-4, ADAMTS-5, Chondroitinase ABC (ChABC), Chondroitinase AC, Chondroitinase B, Calpain I, etc. Also, “desulfating enzyme” is, for example, Chondroitin-4- sulfatase, Chondroitm_6_sulmtase (?

[0113] As an embodiment of the screening method of the present invention, there can be mentioned a method comprising a step of selecting a compound having an action of promoting the degradation of chondroitin sulfate proteodarican. The above method of the present invention includes the following steps, for example.

( _a ) The process of contacting the test compound with chondroitin sulfate proteodarican or a part thereof

(b) a step of measuring the abundance of chondroitin sulfate proteodarican or a part thereof

[0114] In the above method, first, a test compound is brought into contact with chondroitin sulfate proteodarican or a part thereof.

[0115] Next, in the present method, the amount of chondroitin sulfate proteodarican or a part thereof is measured. The measurement can be performed by methods known to those skilled in the art. For example, a labeled compound that binds to chondroitin sulfate proteodarican or a part thereof, or It can be detected by measuring the amount of label using an antibody. It can also be detected using a chromatographic method or mass spectrometry.

[0116] In this method, a compound that reduces the abundance of the chondroitin sulfate proteodarican or a part thereof is then selected as compared with the case where the test compound is not contacted (control). The compound that lowers becomes a drug for treating neurofibrotic degeneration.

[0117] A simple example of a method and a specific example that can be evaluated (measured) according to whether the test compound has the above activity (a) has the activity of promoting decomposition! Shown in

[0118] (a) Screening method for promoting the degradation of chondroitin sulfate proteodarican

Prepare CS-GAG such as chondroitin sulfate A (CS_A), CS_B, CS-C (Seikagaku Corporation, ICN, Sigma, etc.), human-derived proteodalycan (BGN, ISL, etc.), etc. The well plate is coated at a concentration of 10 g / mL (Kawashima H et al .; J. Biol. Chem. 277: 12921-12930, 2002. etc.). Add various test compounds to each well of this plate and detect CS-GAG change after 2 hours reaction at 37 ° C.

[0119] As a detection method, for example, a WFA lectin (Nodafuji lectin) binding method can be mentioned as a simple method. Since WFA lectin binds to the GalNAc residue of CS-GAG chain, CS-GAG can be easily detected. Chondroitinase ABC is used as a positive control for the test compound. When CS-GAG chain is degraded by chondroitinase ABC addition, WFA lectin cannot be bound, so use that principle. More specifically, FITC-labeled WFA lectin (such as EY) is added to the CS coating well before and after mixing the test compound, and the CS-GAG is decomposed to change the FITC fluorescence intensity in the well. Can be quantified and quantified very easily using a fluorescence plate reader or a fluorescence microscope. The compound with the lowest fluorescence value before and after mixing can be judged as a new treatment candidate compound that satisfies this concept.

[0120] Further, as another detection method, an anti-CS antibody (clone: CS56, manufactured by Seikagaku Corporation) that directly labels CS-GAG itself can be used. As with the WFA lectin, FITC-labeled anti-CS antibody can be added to CS-coated wells so that mass screening can be performed in a very short time and simply if changes in fluorescence values are observed. [0121] As a more detailed detection method, by using the plate before and after mixing the test compound as it is, and applying sGA G Assay Kit (manufactured by WIESLAB), Sulphanated Glycosaminoglycans, ELISA Kit (manufactured by FUNAK OSHI), etc. There is a method to accurately quantify and quantify the GAG content.

[0122] More specifically, free GAG is obtained by adding 2-AB (2-aminobenzamide) or 2-AP (2-aminopyridine; V, manufactured by LUD, etc.) to the plate before and after the test compound is mixed. More detailed analysis is possible by simply fluorescently labeling the reducing end of the chain and analyzing each type of sugar chain and the content of each type by HPLC, MALDI-MS, LC-MS, etc. . This is a method for the next stage of screening in which the properties of candidate compounds are examined in detail.

[0123] As another embodiment of the screening method of the present invention, there may be mentioned a method comprising a step of selecting a substance having an action of inhibiting chondroitin sulfate proteodarican synthesis. The above method of the present invention comprises, for example, the following steps.

(a) contacting a test compound with a substance group containing a cell expressing chondroitin sulfate proteodarican or a part thereof, the cell extract, or an enzyme and a substrate constituting the synthesis process of chondroitin sulfate proteodarican Process

(b) a step of measuring the amount of chondroitin sulfate proteoglycan or an intermediate in the synthesis process in the cell, cell extract or substance group.

(c) Do not contact a test compound! /, a step of selecting a compound that reduces the amount of synthesis compared to the case

[0124] In the above method, first, a cell that expresses chondroitin sulfate proteodarican or a part thereof, a cell extract, or a substance group containing an enzyme and a substrate constituting the synthesis process of chondroitin sulfate proteodarican, and the like. A test compound is brought into contact.

[0125] Next, the synthesis amount of chondroitin sulfate proteodarican or an intermediate in the synthesis process is measured. The measurement can be appropriately carried out by those skilled in the art by a known method, for example, a method using a labeled antibody, mass spectrometry, chromatography, or the like.

[0126] A compound that reduces (suppresses) the amount of synthesis is selected as compared with the case where the test compound is not contacted (control). Compounds that reduce (suppress) become agents for the treatment of neurofibrotic degeneration. [0127] A simple example of a method and a specific example that can be evaluated (measured) depending on whether the test compound has (b) the activity of inhibiting synthesis! Shown in

[0128] (b) Screening for the synthesis inhibitory action of chondroitin sulfate proteodarican Method aspect:

Cells and cell lines that synthesize chondroitin sulfate are known to the investigator. In humans, for example, chondroitin sulfate is produced in 16 hours of cell culture using the standard method of collecting and culturing mononuclear cells after collecting peripheral blood from healthy individuals (Uhlin-Hansen L et al , Blood 82: 2880, 1993, etc.). More simply, known cell lines such as fibroblast cell line MH3T3 (Phillip HA, et al. J. Biol. Chem. 279: 48640, 2004), renal tubular cancer cell line ACHN (Kawashima H et al., J. Biol. Chem. 277: 12921, 2002), distal renal tubular cell line MDCK (Borges FT et al., Kidney Int. 68: 1630, 2005., etc.), vascular endothelial cells Many strains such as HUVEC strains (Schick BP et al., Blood 97: 449, 2001, etc.) are mentioned. In the process of culturing such a cell line for a certain period of time, various test compounds are mixed, and the change in the CS-GAG amount before and after the culture can be easily quantified by the method (a). Compound power that suppresses the increase in CS-GAG amount after cell culture (ie, reflects the amount of CS-GAG synthesis) It can be easily determined as a therapeutic candidate compound that satisfies this concept.

[0129] Furthermore, more selectively, for example, a cell line in which CS-GAG synthase genes such as GalNAc4ST-1 and XylosylT are introduced into CHO cells and L cells in a well-known manner and expressed constantly is created. I can do it. By using such a cell line that constantly synthesizes CS-GAG, a therapeutic candidate compound can be determined more clearly.

[0130] As another embodiment of the screening method of the present invention, a method including a step of selecting a substance having a desulfating action of chondroitin sulfate proteodarican can be mentioned. The above method of the present invention comprises, for example, the following steps.

(b) a step of measuring the amount of chondroitin sulfate proteodarican or a part thereof that has undergone sulfation

(c) Compared with the measurement in the absence of the test compound, it was subjected to sulfation! /, The process of selecting substances that reduce the amount

[0131] In the above method, first, a test compound is contacted with chondroitin sulfate proteodarican or a part thereof.

[0132] Next, in this method, the amount of chondroitin sulfate proteodarican or a part thereof that has undergone sulfation is measured. The measurement can be performed by methods known to those skilled in the art. For example, it is possible to detect by measuring the amount of label using a labeled compound or antibody that binds to the structure of desulfurization oxidation remaining in chondroitin sulfate proteodarican or a part thereof. It can also be detected using chromatography or mass spectrometry.

[0133] In this method! /, The following! /, The test compound is not brought into contact with the test compound, compared to the case (control), the abundance of the chondroitin sulfate proteodarican or a part thereof Select a compound that lowers. The compound that lowers becomes a drug for treating neurofibrotic degeneration.

[0134] A simple example of a method and a specific example that can be evaluated (measured) according to whether the test compound has (c) the activity of desulfating action! Shown in

[0135] (c) Screening for desulfating action of chondroitin sulfate proteodarican Method aspect:

Basically, as in the method (a) above, human-derived proteodaricans (BGN, ISL, etc.) are prepared and coated on a 96-well plate at a concentration of 10 g / mL (Kawashima H et al.; J. Biol. Chem. 277: 12921-12930, 2002, etc.)). Add various test compounds to each well of this plate and detect CS-GAG change after 2 hours reaction at 37 ° C.

[0136] The detection method was carried out by desulfating the disaccharide structure of the desulfated fragment remaining on the core protein side of the proteodarican into anti-proteodarican A di4S antibody (clone; 2-B-6, 4 Or the anti-proteodarican Δdi6S (clone; 3-B-3, recognizes the part that was sulfated at position 6. The product that has been subjected to desulfation can be easily detected. Therefore, FITC-labeled 2-B-6 and 3-B-3 antibodies can be reacted on the plate before and after mixed culture, and changes in the fluorescence values can be easily detected. Compounds with increased fluorescence intensity before and after reaction are more desulfurized It can be determined that the substance promotes oxidation, and can be easily identified as a novel therapeutic candidate compound that satisfies this concept.

[0137] As another embodiment of the screening method of the present invention, a method including a step of selecting a substance having a sulfation inhibitory action of chondroitin sulfate proteodarican can be mentioned. The above method of the present invention comprises, for example, the following steps.

( _a ) A step in which a test compound is contacted with a substance or a cell extract expressing chondroitin sulfate proteodarican or a part thereof, or a substance group containing an enzyme, a substrate, or the like that constitutes the sulfation process of chondroitin sulfate proteodarican

(b) a step of measuring the sulfation activity of chondroitin sulfate proteoglycan in the cell, cell extract or substance group

(c) Do not contact a test compound! /, a step of selecting a compound that decreases the activity compared to the case

[0138] In the above method, first, a test substance is brought into contact with chondroitin sulfate proteodarican or a part thereof.

[0139] Next, in the present method, the amount of chondroitin sulfate proteodarican or a part thereof that has undergone sulfation is measured. The measurement can be performed by methods known to those skilled in the art. For example, it is possible to detect by measuring the amount of labeling using a labeled compound or antibody that binds to chondroitin sulfate proteodarican or a sulfated structure of a part thereof. Moreover, it can also detect using a chromatography method, a mass spectrometry, etc.

[0140] In this method! /, The following! /, When the test compound is not contacted, compared to the case (control), the abundance of the chondroitin sulfate proteodarican or a part thereof Select a compound that lowers. The compound that lowers becomes a drug for treating neurofibrotic degeneration.

[0141] The test compound has the above-mentioned (d) activity of inhibiting sulfation! /, Whether or not! /, And can be evaluated (measured). Show.

[0142] (d) Screening method relating to sulfation inhibitory action of chondroitin sulfate proteodarican:

The cells and cell lines that promote sulfation of chondroitin sulfate are the cells, cells described in (c) above. Consistent with cell lines. In the process of culturing such a cell line for a certain period of time, various test compounds are mixed, and the degree of sulfation before and after culturing is measured, for example, antibody (clone: LY111) for detecting sulfation at position 4 or position 6 An antibody that detects sulfation (clone; MC21C, 1 /, deviation is also available from Seikagaku Corporation) can be easily confirmed. Fluorescence-labeled antibodies may be used to compare fluorescence values before and after culture. Similarly to (c) above, detection methods using 2-B-6 and 3-B-3 antibodies may be performed before and after culture. Also good. Compounds that suppress the increase in sulfation after cell culture (LY111 and MC21C fluorescence P), or the progress of desulfation after cell culture (2-B-6 and 3-B-3 fluorescence increase calo) Can be easily determined as a candidate compound that satisfies this concept.

[0143] Furthermore, more selectively, for example, a cell line in which a gene of a sulfotransferase such as C4ST-1 or C6ST-1 is introduced into CHO cells or L cells by a well-known method and is expressed constantly. Can be created. By using such a cell line that constantly adds a sulfate group, a therapeutic candidate compound can be determined more clearly.

[0144] Another preferred embodiment of the present invention is a compound that decreases the expression level of the chondroitin sulfate proteodarican core protein, the synthase, the desulfase inhibitor protein, or the sulfotransferase gene of the present invention, Alternatively, by selecting a compound that increases the expression level of the chondroitin sulfate proteoglycan degradation-promoting enzyme or desulfating enzyme gene, the screening method for a neurofibrotic degeneration inhibitor comprising the following steps (a) to (d): is there.

( _a ) A test compound is brought into contact with a cell expressing a gene encoding a chondroitin sulfate proteodlican core protein, a synthetic enzyme, a desulfase inhibitor protein, a sulfotransferase, a degradation promoting enzyme, or a desulfase enzyme. Process

(b) measuring the gene expression level in the cell

(c) When the expression level is measured in the absence of the test compound and compared with the (control)

(d) If the gene is a chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, or sulfotransferase, the expression level of the gene is reduced compared to the control! /, The compound, the gene is chondroitin sulfate In the case of proteodarican degradation-promoting enzyme or desulfating enzyme, a step of selecting a compound in which the expression level of the gene is increased compared to the control

[0145] In the above method, first, a cell expressing a gene encoding a chondroitin sulfate proteodlican core protein, a synthetic enzyme, a desulfurase inhibitor protein, a sulfotransferase, a degradation promoting enzyme, or a desulfurase is expressed. The test compound is brought into contact.

[0146] In this method, chondroitin sulfate proteodarican core protein, synthetic enzyme, desulfase inhibitor protein, sulfate transferase, degradation promoting enzyme, or desulfase enzyme The expression level of the encoded gene is measured. Here, “gene expression” includes both transcription and translation. The gene expression level can be measured by methods known to those skilled in the art.

[0147] For example, mRNA is extracted from cells expressing any of the above proteins according to a standard method, and the Northern hybridization method, RT-PCR method, DNA array method, or the like using this mRNA as a cage is performed. Thus, the amount of transcription of the gene can be measured. In addition, a protein fraction is collected from a cell expressing a gene encoding any of the above proteins, and the expression of any of the above! / And any of the proteins is detected by electrophoresis such as SDS-PAGE. It is also possible to measure the translation amount. Furthermore, it is also possible to measure the amount of translation of a gene by detecting the expression of the protein by performing Western blotting using an antibody against any of the above proteins. . The antibody used for detecting the protein is not particularly limited as long as it is a detectable antibody. For example, both a monoclonal antibody and a polyclonal antibody can be used.

[0148] In this method, the expression level of the gene is compared with that in the case where the test compound is not brought into contact in the following manner!

[0149] In the case of this method! /, In the following! /, When the gene is a chondroitin sulfate proteodarican core protein, a synthase, a desulfase inhibitor protein, or a sulfotransferase Select a compound that decreases (suppresses) the expression level of the gene compared to the control! A compound that lowers (suppresses) becomes a drug for suppressing neurofibrotic degeneration or a candidate compound for treating neurofibrotic degeneration. [0150] In addition, when the gene is a chondroitin sulfate proteodarican degradation-promoting enzyme or desulfating enzyme, a compound in which the expression level of the gene is increased (enhanced) compared to the control is used. select. The compound to be increased (enhanced) is a drug for suppressing nerve fiber degeneration or a candidate compound for treating nerve fiber degeneration.

[0151] Further, as one aspect of the screening method of the present invention, the expression level of the core protein, synthase, desulfase inhibitor protein, or sulfotransferase gene of the chondroitin sulfate proteodarican of the present invention is reduced. Is a method of selecting a compound that increases the expression level of the chondroitin sulfate proteodarican degradation-promoting enzyme or desulfating enzyme gene using the expression of the reporter gene as an index. The method of the present invention includes, for example, the following steps (a) to (d).

( _a ) The transcriptional regulatory region of a gene encoding a chondroitin sulfate proteodarican core protein, a synthetic enzyme, a desulfase inhibitor protein, a sulfotransferase, a degradation-promoting enzyme, or a desulfase enzyme and the reporter gene are functional. A step of contacting a test compound with a cell or cell extract containing DNA having a bound structure

(b) measuring the expression level of the reporter gene

(c) Do not let the test compound come into contact!

(d) if the reporter gene is functionally linked to the core protein, synthase, desulfase inhibitor protein, or sulfotransferase of chondroitin sulfate proteodarican, the expression level of the reporter gene If the reporter gene is functionally linked to a chondroitin sulfate proteodalican degradation-promoting enzyme or desulfating enzyme, the expression level of the reporter gene Selecting a compound that is elevated relative to a control

[0152] In this method, first, the transcriptional regulatory region and reporter gene of a gene encoding chondroitin sulfate proteodlican core protein, synthase, desulfase inhibitor protein, sulfotransferase, degradation promoting enzyme, or desulfurase A test compound is brought into contact with a cell or cell extract containing DNA having a structure in which and are functionally bound.

[0153] Here, "functionally bound" refers to chondroitin sulfate proteodalycan core protein, synthase, desulfase inhibitor protein, sulfate transferase, degradation promoting enzyme, Chondroitin sulfate proteolycan core protein, synthase, desulfase inhibitor protein so that the transcription factor binds to the transcriptional regulatory region of the gene encoding desulfase to induce reporter gene expression. It means that a transcriptional regulatory region of a gene encoding a sulfotransferase, a degradation promoting enzyme, or a desulfating enzyme is linked to a reporter gene. Therefore, even when the reporter gene is linked to other genes and forms a fusion protein with other gene products, chondroitin sulfate proteodlican core protein, synthase, desulfase inhibitor protein, sulfate If the expression of the fusion protein is induced by binding of a transcription factor to the transcriptional regulatory region of a gene encoding a transferase, a degradation promoting enzyme, or a desulfating enzyme, the above-mentioned "functionally bound" Is included. Based on the cDNA base sequence of the gene encoding chondroitin sulfate proteodalican core protein, synthase, desulfase inhibitor protein, sulfate transferase, degradation promoting enzyme, or desulfase, Obtain the transcriptional regulatory region of the gene encoding chondroitin sulfate proteodalycan core protein, synthetic enzyme, desulfase inhibitor protein, sulfotransferase, degradation-promoting enzyme, or desulfase enzyme existing in It is possible.

The reporter gene used in this method is not particularly limited as long as its expression can be detected, for example, CAT gene, lacZ gene, luciferase gene, GFP gene and the like. “A structure in which a transcriptional regulatory region of a gene encoding a chondroitin sulfate proteodarican core protein, a synthetic enzyme, a desulfase inhibitor protein, a sulfotransferase, a degradation-promoting enzyme, or a desulfase enzyme and a reporter gene are functionally linked. Examples of the “cell containing a DNA having” include a cell into which a vector having such a structure inserted is introduced. Such vectors can be made by methods well known to those skilled in the art. The introduction of the vector into the cell can be carried out by a general method such as a calcium phosphate precipitation method, an electric pulse perforation method, a lipofussion method, or a microinjection method. “The transcriptional regulatory region of a gene encoding chondroitin sulfate proteodarican core protein, synthase, desulfase inhibitor protein, sulfate transferase, degradation promoting enzyme, or desulfase is functionally associated with the reporter gene. A “cell containing DNA having a linked structure” also includes cells in which the structure is inserted into a chromosome. The introduction of a DNA structure into a chromosome can be performed by a method generally used by those skilled in the art, for example, a gene introduction method using homologous recombination.

[0155] "Transcriptional regulatory region of a gene encoding chondroitin sulfate proteodlican core protein, synthetic enzyme, desulfase inhibitor protein, sulfotransferase, degradation promoting enzyme, or desulfase enzyme and reporter gene are functional. The cell extract containing DNA having a structure bonded to is, for example, a chondroitin sulfate proteodlican core protein, synthase, desulfated enzyme inhibitory protein added to a cell extract contained in a commercially available in vitro transcription translation kit. Or the addition of DNA having a structure in which a transcriptional regulatory region of a gene encoding a sulfotransferase and a reporter gene are functionally linked.

[0156] Here, "contact" means "chondroitin sulfate proteodalycan core protein, synthase, desulfase inhibitor protein, sulfotransferase, degradation-promoting enzyme, or transcriptional regulatory region of a gene encoding a desulfase enzyme. By adding a test compound to the culture solution of “cells containing DNA having a structure functionally linked to a reporter gene” or adding the test compound to the above-described commercially available cell extract containing the DNA It can be carried out. In the case where the test compound is a protein, for example, it can be carried out by introducing a DNA vector that expresses the protein into the cell.

[0157] In this method, the expression level of the reporter gene is measured by! /, And then! /. The expression level of the reporter gene can be measured by methods known to those skilled in the art depending on the type of the reporter gene. For example, when the reporter gene is a CAT gene, the expression level of the reporter gene can be measured by detecting acetylation of chloramphenicol by the gene product. When the reporter gene is the lac Z gene, by detecting the color development of the dye compound by the catalytic action of the gene expression product, and when it is a luciferase gene, the fluorescent compound by the catalytic action of the gene expression product In the case of the GFP gene, the expression level of the reporter gene can be measured by detecting the fluorescence of the GFP protein. [0158] In this method, compare the expression level of the reporter gene measured in the absence of the test compound (control) with the following! /.

[0159] In this method, the reporter gene is a gene encoding a chondroitin sulfate proteodalican core protein, a synthetic enzyme, a desulfase inhibitor protein, or a sulfotransferase. In the case of functional binding, a compound that reduces (suppresses) the expression level of the reporter gene compared to the control is selected. A compound that lowers (suppresses) becomes a drug for inhibiting neurofibrotic degeneration or a candidate compound for treating neurofibrotic degeneration.

[0160] In addition, when the reporter gene is functionally linked to a chondroitin sulfate proteodarican degradation-promoting enzyme or a desulfase enzyme, the expression level of the reporter gene is higher than that of the control. Increase (enhance) the compound! The compound to be increased (enhanced) is a drug for suppressing nerve fiber degeneration or a candidate compound for treating nerve fiber degeneration.

[0161] The neurofibrotic degeneration inhibitor found in the screening method of the present invention is preferably for treating or preventing a neurofibrotic degenerative disease.

[0162] The present invention also provides a kit containing various drugs, reagents and the like used for carrying out the screening method of the present invention.

[0163] The kit of the present invention can be appropriately selected from, for example, the above-mentioned various reagents of the present invention according to the screening method to be performed. For example, the kit of the present invention can comprise the chondroitin sulfate proteodarican of the present invention as a constituent element. The kit of the present invention can further contain various reagents, containers and the like used in the method of the present invention. For example, an anti-chondroitin sulfate proteodarican antibody, probe, various reaction reagents, cells, culture solution, control sample, buffer solution, instructions describing the method of use, etc. may be included as appropriate.

[0164] In a preferred embodiment of the present invention, there is provided a screening method for a neurofibrotic degeneration inhibitor comprising a step of detecting whether the production or accumulation of chondroitin sulfate proteodalycan is inhibited. Accordingly, in this screening method, for example, chondroitin sulfate proteolycan that can be used in the detection of chondroitin sulfate proteodarican. Oligonucleotides such as probes for the gene encoding the core protein of darlicans or primers for amplifying any region of the gene, or antibodies that recognize chondroitin sulfate proteodarican (anti-chondroitin sulfate proteodarican antibodies) , And can be included in the components of the screening kit for a neurofibrotic degeneration inhibitor of the present invention.

[0165] The oligonucleotide specifically hybridizes to, for example, the DNA of the Versican core protein gene of the present invention. Here, “specifically hybridize” means under normal hybridization conditions, preferably under stringent hybridization conditions (for example, Samb Norec et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New In the conditions described in York, USA, ^2nd edition, 1989), it means that cross-hybridization does not occur significantly with DNA encoding other proteins. If specific hybridization is possible, the oligonucleotide does not have to be completely complementary to the base sequence of the Versican core protein gene of the present invention.

[0166] In the present invention, hybridization conditions include, for example, "2XSSC, 0.1% SDS, 50 ° C", "2XSSC, 0.1% SDS, 42 ° C", "1XSSC, 0.1% SDS, 37 “C”, more stringent conditions such as “2XSSC, 0.1% SDS, 65.C”, “0.5XSSC, 0.1% SDS, 42 ° C” and “0.2XSSC, 0.1% SDS, 65 ° C” Can be mentioned. More specifically, as a method using Rapid-hy b buffer (Amersham Life Science), pre-hybridization is performed at 68 ° C for 30 minutes or more, then a probe is added, and hybridization is performed at 68 ° C for 1 hour or more. After that, wash twice in 2XSSC, 0.1% SDS at room temperature for 20 minutes, then wash in 1 XSSC, 0.1% SDS at 37 ° C for 20 minutes three times, and finally 1XSSC, It can be washed twice for 20 minutes at 50 ° C in 0.1% SDS. In addition, for example, in Expresshyb Hybridization Solution (CLONTECH), prehybridize at 55 ° C for 30 minutes or longer, add labeled probe, and incubate at 37-55 ° C for 1 hour or longer. It is also possible to perform 3 washes for 20 minutes at room temperature in 0.1% SDS and 1 wash for 20 minutes at 37 ° C in 1XSSC and 0.1% SDS. Here, for example, by setting the temperature at the time of pre-hybridization, hybridization, and the second washing higher, it is possible to make the conditions more stringent. For example, prehybridization and hybridisation The temperature of the chillon can be set to 60 ° C, and a stringent condition can be set to 68 ° C. Those skilled in the art will consider the conditions such as the salt concentration and temperature of the buffer, as well as other conditions such as the probe concentration, probe length, probe base sequence composition, and reaction time. Can be set.

[0167] The oligonucleotide can be used as a probe or primer in the above-described screening kit of the present invention. When the oligonucleotide is used as a primer, the length is usually 15 bp to 100 bp, preferably 17 bp to 30 bp. The primer is not particularly limited as long as it can amplify at least a part of the DNA of the gene of the present invention described above, for example, the force described in SEQ ID NO: 69 or 70.

[0168] The present invention also provides a method for treating or preventing a neurofibrotic degenerative disease, comprising the step of administering the agent of the present invention to an individual (eg, a patient).

[0169] The individual that is the subject of the prevention or treatment method of the present invention is not particularly limited as long as it is an organism capable of developing a neurofibrotic degenerative disease, but is preferably a human.

[0170] In general, administration to an individual can be performed by methods known to those skilled in the art, such as intraarterial injection, intravenous injection, and subcutaneous injection. The dose varies depending on the weight and age of the patient, the administration method, etc., but a person skilled in the art (such as a doctor, veterinarian, pharmacist, etc.) can appropriately select an appropriate dose.

[0171] Furthermore, the present invention relates to the use of the agent of the present invention in the production of a neurofibrotic degeneration inhibitor.

[0172] It should be noted that all prior art documents cited in the present specification are incorporated herein by reference.

Example

[0173] Hereinafter, the present invention will be described more specifically with reference to Examples. However, the technical scope of the present invention is not limited to these examples.

Example 1 MPTP Induction Case GalNAcST (siRNA) Treatment with C57BL / 6TcL Parkinson's Disease Model Mice GalNAc4ST-l GALNAC4S-6ST in Chondroitinase ABC Treatment

In this example, 1-methy 卜 4-pheny 卜 1,2,3,6 tetrahydropyridine (MPTP) Created a mouse model of Parkinson's disease that selectively denatured min neurons (Amende et al. (2005) Journal of NeuroEngineering and Rehabilitation 2 (20) 1-13) and developed GalNA cST siRNA drug and chondroitinase ABC drug. After administration, the gene expression after treatment and the state of the tissue were compared.

[0175] Day 14 of pregnancy C57BL / 6JcL mice (CLEA Japan, Inc.) were bred and born, 8 weeks old female C57B L / 6JcL mice (CLEA Japan), chondroitinase ABC (Sigma Aldrich Ja pan) ) 4 U / ml 100 1 and GalNAcST (GalNAc4ST-l, GalNAc4ST-2 and GALNAC4S-6ST cocktail sequence mixed) 1% A telocollagen (Kokensha) siRNA 1 g (GeneWorld) 200 L) was mixed intraperitoneally. Thereafter, MPTP (manufactured by Sigma Aldrich Japan), which selectively destroys only donomin neurons, was administered to the body at 30 mg / kg three times on the second, third and fourth days. On the 8th day of the experiment, BrdU 5 mg / mL (ZyMED Laboratory. Inc.) 100 1 was administered into the tail vein, and after 1 hour, dissection was performed, the brain was removed, immunostaining sample, gene expression analysis sample Got. From the above, per 1 mg of organ (brain) removed, 1 mL of RNA-Bee (TEL-TEST) is added, and after grinding with an electric homogenizer (DIGITAL HOMOGENIZER, ASONE), chloroform Add 200 ^ 1 (Sigma Aldrich Japan) and mix gently, then ice-cool for about 5 minutes and centrifuge using a centrifuge (Centrifbge 5417R, eppendorf) for 15 minutes at 12,000 rpm, 4 ° C. It was. Transfer 500 L of the supernatant after centrifugation to another Eppendorf tube, add isopropannol 500 L (manufactured by Sigma Aldrich Japan) in the same amount as the supernatant, mix, and add 1 glycogen dnvitrogen) for 15 minutes. Ice-cooled. 15 minutes after ice cooling, 12,000 rpm, 4. C. Centrifugation for 15 minutes, followed by 3 times washing with 75% Ethanol 1000 1 (Sigma Aldrich Japan), the RNA precipitate was air-dried for 30 minutes to 1 hour, and then Otsuka distilled water. 50 1 (manufactured by Otsuka Pharmaceutical Co., Ltd.), 100-fold diluted with Otsuka distilled water (manufactured by Otsuka Pharmaceutical Co., Ltd.), and plate reader (POWER Wave XS, BIO-TEK) on a UV plate (Corning Costar) Calculated the RNA concentration in the sample extracted by

Yes

[0176] Next, the following procedure was performed for RT reaction (cDNA synthesis). Adjust the calculated RNA sample to a concentration of 500 rig / 20 ^ 1 and set it to 68 ° C for 3 minutes with BLOCK INCUBATOR Heated (ASTEC) and ice-cooled for 10 minutes. RT Premix solution (composition: 25 mM MgCl 18.64 μ1 (Invitrogen)), 5 X Buffer 20 μ1 (Invitrogen), 0.1 M DTT 6.6 1 (Invitrogen) , 10 mM dNTP mix 10 1 (Invitrogen), RNase Inhibitor 2 μ 1 (Invitrogen), MMLV Reverse transcriptase 1.2 μ 1 (Invitroge η), Random primer 2 μ 1 (Invitrogen), sterilization Distilled water 19.56 μ 1 (Otsuka distilled water: Otsuka Pharmaceutical Co., Ltd.) 80 1 was added, BLOCK INCUBATOR (ASTEC Co., Ltd.) was used, and the reaction was heated at 42 ° C for 1 hour. After 1 hour, BLOCK INCUBATOR (ASTEC Co., Ltd. was produced) ) Was heated at 99 ° C for 5 minutes, and then ice-cooled to prepare cDNA 1001 to be obtained, and the synthesized cDNA was used to carry out PCR reaction with the following composition.

[0177] PCR Buffer 2 μ 1 [Composition: 166 mM (NH 2) SO (Sigma Aldrich Japan), 670 mM Tri

4 2 4

s-HC1 pH8.8 (Invitrogen), 67 mM MgCl-6H 2 O (Sigma Aldrich Japan), 100 mM 2-mercaptoethanol] (WAKO)), 25 mM dNTP mix 0.8 1 (Invitrogen) ), DMSO 0.6 1 (manufactured by Sigma Aldrich Japan), Primer Forward 0.2 l (manufactured by GeneWorld), Primer Reverse 0.2 l (manufactured by GeneWorld), 15.7 〃 1 (manufactured by Otsuka Pharmaceutical), Taq polymerase 0.1 ^ KPerkin Elmer) and 1 μ 1 of cDNA obtained as described above were mixed and reacted at 94 ° C for 45 seconds, 55 ° C for 45 seconds, 72 ° C for 60 seconds for 30 cycles using Authorized Themal Cycler (made by Pendorff Earth). . After completion of the reaction, prepare 21 1 Loading Dye (Invitrogen ^ D power!); ^, 1.5% UltraPure Agarose (Invitrogen † Sat) gnore, and use Mupid-2 plus (AD VANCE) ) For 100 minutes at 100 V. After swimming, 1 X LoTE [Composition: 3 mM Tris-HCl (pH7.5) (Invitrogen), 0.2 mM EDTA (pH 7.5) (Sigma Aldrich Japan) The product was shaken in Ethydium Bromide (Invitrogen) staining solution for 20 minutes and then geled with EX ILIM (CASIO) installed in I-Scope WD (ADVANCE). Photographs were taken to confirm gene expression.

[0178] Fig. 1 shows the results of gene expression of β_actin, GalNAc4ST-1 and GALNAC4S-6ST in the untreated group, GalNAcST siRNA-treated group and chondroitize ABC by RT-PCR. The following GalNAcST siRNA (GalNAc4ST-l siRNA cocktail, mixed siRNA of GalNAc4ST_2 siRNA cocktail and GALNAC4S-6ST siRNA cocktail; GeneWorld), Primer (Forward, Reverse) (Hokkaido System Science) Show. [0179] [Primer sequence]

* β -actin (Gene world)

Forward: 5,-GACCCAGATCATGTTTGAGAC -3, (SEQ ID NO: 67)

Reverse: 5,-ATGCCTGGGTACATGGTGGTA -3, (SEQ ID NO: 68)

[0180] * GalNAc4ST-l (Hokkaido System Science)

Forward: 5,-ACGTGCCTTTTACACCCAAG-3, (SEQ ID NO: 69)

Reverse: 5 '-GTGTGCCCTTTTCTGTGGAT-3' (酉己歹 IJ number: 70)

[0181] [GalNAc4ST-l siRNA cocktail IJ] (GenBank accession number NM.175140)

(Gene world)

5 '-ACCCCCAACTCGGAACGATGCGGCT-3' (酉番号 IJ number: 71)

5 '-TGCATGTTCTCGTCCATCCTGCTG-3' (SEQ ID NO: 72)

5 '-CGCCACCGTGTACTGTACTGTGAAGT-3' (SEQ ID NO: 73)

5,-AGGCT GCTCCAACTG GAAGAGGGTG-3 (SEQ ID NO: 74)

[0182] [GalNAc4ST-2 siRNA cocktail served IJ] (GenBank accession number NM—199055)

(Gene world)

5 '-ATATAGTATCTAGGATATATGTAG-3' (SEQ ID NO: 75)

5 '-GAAGTACCAAAAGCTGGCTGCTCTA-3' (SEQ ID NO: 76)

5 '-TTCTATCACTTGGACTATTTGATGTT-3' (IJ number: 77)

5 '-TACACAACTCCACATTTGTAATTTG-3' (SEQ ID NO: 78)

[0183] [GALNAC4S-6ST siRNA cocktail IJ] (GenBank accession number NM.029935)

(Gene world)

5 '-CCAGAAGCCAAGCTCATTGTTATG-3' (SEQ ID NO: 79)

5 '-CTGTGGAGAGGTTGTACTCAGACTA- 3' (SEQ ID NO: 80)

5 '-ATTTGCCTGGAAGACAACGTGAGAGC-3' (SEQ ID NO: 81)

5 '-GTCCCTTCTGCAGAAGCTGGGCCCACT-3' (酉歹 IJ number: 82)

[0184] Expression of endogenous control β-actin was observed at the same level in the untreated group, GalNA cST (siRNA), and chondroitinase ABC-treated group by RT-PCR in FIG. In contrast, GalNAc4ST-l and GALNAC4S-6ST compared with the untreated group In the (siRNA) treatment group, a decrease in expression was observed, and suppression of gene expression (reduction) was confirmed by administration of Atellocollagen medium GalNAcST siRNA.

[0185] Example 2 MPTP-induced C57BL / 6. TcL Parkinson's disease model mouse comparison test of chondroitinase ABC GalNAcST siRNA treatment to suppress the deposition of CSPG in the brain This example uses a brain tissue sample of Parkinson's disease model mouse Thus, a comparative study was conducted on the effect of CSPG deposition suppression. The brain tissue obtained in Example 1 was embedded in a freezing embedding agent OCT compound (manufactured by Miles), and a frozen block was prepared with liquid nitrogen. A 10 m thick section was prepared from the frozen block using a cryostat (Microm). The obtained sections were fixed with acetone (manufactured by Sigma Aldrich Japan) for 10 minutes, washed with a phosphate buffer, and further anti-chondroitin sulfate proteodarican (CSPG) antibody (clone CS56, mouse monoclonal antibody, lO as a primary antibody). g / ml (manufactured by Seikagaku Corporation) was added and allowed to react at room temperature for 1 hour. Subsequently, a secondary antibody reaction was performed using a histofine mouse stin kit (manufactured by Nichirei; used for mouse monoclonal antibody), and then DAB substrate (manufactured by Nichirei) was added to carry out an enzyme dye reaction. This specimen was observed with an optical microscope (manufactured by Leica). This tissue image is shown in Fig. 2 (the original image is in color). It can be seen that the positive signal in the untreated group is stronger than the CSPG accumulation in the control group near the dentate gyrus. It can be seen that the accumulation of CSPG in the GalNAcST siRNA and chondroitinase ABC treatment group is suppressed. In other words, considering the above results, it was found that CSPG deposition in the brain tissue of an MPTP-induced Parkinson's disease mouse model was suppressed by in vivo administration of Gal NAcST siRNA and chondroitinase ABC. .

[0186] Example 3 Comparison of the suppression of inflammation associated with macrophage infiltration in chondroitinase ABC GalNAcST siRNA treatment using MPTP-induced C57BL / 6.TcL Parkinson's disease model mice

The CSPG deposition shown in Example 2 is known to adsorb chemokines, which are in vivo substances that induce inflammatory cells such as macrophages. In addition, it was speculated that the deposition of CSPG would eventually lead to attracting inflammatory cells to induce destruction of brain tissue. Similarly, the effects of GalN AcST administration and chondroitinase ABC on brain macrophage accumulation kinetics were compared using brain tissue samples. Sections obtained in the same manner as in Example 2 were fixed with 4% PFA (Paraformaldehyde) phosphate buffer (Nacalai Testa) for 10 minutes, washed with deionized water, and rat-derived anti-mouse as the primary antibody. Macrophage antibody (clone F4 / 80; 1: 200 dilution; manufactured by BMA) was added, and the mixture was reacted at 4 ° C. Next, the secondary antibody Alexa488-labeled anti-rat IgG goat antibody (1: 200 dilution; Invitrogen) was added and allowed to react at room temperature for 30 minutes. The tissue image obtained by the above method is shown in Fig. 3 (the original image is a power error). The strong positive signal in the untreated group was a result of the accumulation of more macrophages in the tissue margin than in the control group. Furthermore, when comparing the staining results in the treatment group with GalNAcST siRNA and chondroitinase ABC, the results were almost the same as in the control group. From the above results, it was revealed that the accumulation of macaque phages in the brain tissue of a Parkinson's disease mouse model was significantly suppressed by in vivo administration of GalNAcST siRNA and chondroitinase ABC. (The macrophage accumulation is green, the nucleus is Sytox-Organge unvitrogen)

Example 4 MPTP induction C57BL / 6TcL Parkinson's disease model mouse chondroitinase ABOGalNAcST siRNA 几 i ratio of cellulose JMl force f meter CSPG deposition shown in Example 2 may further promote cell fibrosis In the same manner as in Examples 2 and 3, using tissue samples from brain tissue, we examined tissue findings obtained by in vivo administration of GalNAcST and chondroitinase ABC for fibrosis in neurons in the brain. Compared. Sections obtained in the same manner as in Examples 2 and 3 were fixed for 10 minutes with 4% PFA phosphate buffer lysate), washed with deionized water, and fibroblast antibody ( ER-TR7; 1: 100 dilution; manufactured by BMA) was added and allowed to react overnight at 4 ° C. Next, the secondary antibody Alexa488-labeled anti-rat IgG goat antibody (1: 200 dilution; Invitrogen) was added and allowed to react at room temperature for 30 minutes. The tissue image obtained by the above method is shown in Fig. 4 (the original image is in color). A strong positive signal in the untreated group was the result of fibroblast infiltration in the brain in the vicinity of the enlarged cortex of the posterior corpus callosum than in the control group. Furthermore, when compared with the findings in the GalNAcST siRNA and chondroitinase ABC treatment group, the positive findings of fibroblasts were unidentifiable as in the control group. From the above results, Parkinson The findings of ER-TR7 positive signal in brain tissue induced by a disease mouse model were found to be significantly suppressed by in vivo administration of Gal NAcST siRNA and chondroitinase ABC. In addition, considering the CSPG deposition revealed in this example and Examples 2 and 3, and macrophage infiltration induced by the deposition, the induction of inflammatory cells by suppressing the overexpression of CSPG And also prevented cell fibrosis. As a result, it can be concluded that it can lead to suppression of neurofibrotic degeneration. (Fibroblasts are displayed in green, nuclei are displayed in red using Sytox-Orange (invitrogen))

[0188] Example 5 Comparative study of the effect of astrocytes on treatment with GalNAcST (siRNA) chondroitinase ABC in MPTP-induced C57BL / 6.TcL Parkinson's disease model mice In addition to numerous neurons in the brain, glial cells There are cells that function to supply nutrients. In this example, anti-GFAP antibody was used to stain astrocytes in glial cells, and the tissue findings obtained by in vivo administration of GalNAcST and in vivo administration of chondroitinase ABC were compared. Sections obtained in the same manner as in Examples 2, 3 and 4 were fixed with 4% PFA phosphate buffer solution (manufactured by Leitesta) for 10 minutes, washed with deionized water, and anti-GFAP antibody as the primary antibody. (1:20 dilution; Santa Cruz Biotechnology) was added and allowed to react at 4 ° C. Next, Alexa488-labeled anti-goat IgG-donkey antibody (1: 200 dilution; Invitrogen), which is a secondary antibody, was added and reacted at room temperature for 30 minutes. FIG. 5 shows tissue images of the control group, the untreated group, the GalNAcST siRNA, and the chondroitinase ABC treatment group (the original figure is color). In the vicinity of the massive corpus callosum granule cortex, it was confirmed that astrocytes were normally present in the control group, but a negative signal appeared in the untreated group. This suggests that MP TP selectively destroyed glial astrocytes. On the other hand, it was confirmed that the signal in the treatment group treated with GalNAcST siRNA and chondroitinase ABC appeared stronger than that in the untreated group. It is known that the role of the first mouth site in glial cells is to play a role mainly in maintaining the function of nerve cells. This finding suggests that the inhibition of CSPG restored the function of astrocytes in glial cells, suggesting an improvement in function in neurons. (Astrocytes are green, nuclei are red using Sytox-Orange (invitrogen))

[0189] Example 6 GalNAcST (by live C57BL / gJgL Parkinson's mouse) Comparative study of the effect of dopamine neurons on siRNA treatment

In order to finally clarify the results shown in the above Examples, dopamine neurons were stained with an anti-tyrosine hydroxylase antibody using tissue sample sections obtained as markers of dopamine neurons, and the tissue findings were compared. . This tyrosine hydroxylase (TH) is an enzyme that converts dopamine precursors into dopamine. Sections obtained in the same manner as in Examples 2, 3, and 4 were fixed with 4% PFA phosphate buffer (manufactured by Nacalai Tester) for 10 minutes, washed with deionized water, and rabbit polyclonal as a primary antibody. Anti-tyrosine hydroxylase antibody (1:50 dilution; Calbiochem) was added and allowed to react at room temperature for 1 hour. Next, the secondary antibody Alexa488-labeled anti-rabbit-donkey antibody (1: 200 dilution; Invitrogen) was added and reacted at room temperature for 30 minutes. FIG. 6 shows tissue images of the control group, the untreated group, the GalN AcST siRNA, and the chondroitinase ABC treatment group (the original figure is the same). In the vicinity of the upper mesencephalon, it was confirmed that the tyrosine neuroxylase was normally expressed in the control group! /, But it appeared as a negative signal in the untreated group! This suggests that MPTP selectively destroyed dopamine neurons. On the other hand, it was confirmed that the signal in the treatment group treated with GalNAcST siRNA and chondroitinase ABC appeared stronger than that in the untreated group. That is, it was concluded that the functional recovery of dopamine neurons can be expected by in vivo administration of Gal NAcST siRNA and chondroitinase ABC with the activation of the first oral site shown in Example 5. (TH is displayed in green, nucleus is displayed in red using Sytox-Orange (invitrogen))

[0190] Furthermore, the present inventor examined the effect on actual CSPG expression by immunostaining using CS-56 antibody (Fig. 7). The photo shows the findings near the dentate gyrus. In the untreated group, a CSPG positive signal is strongly expressed. In contrast, C4-sulfata se treatment decreased the expression of positive signals. Next, in order to investigate the anti-inflammatory and anti-spring maintenance effects of C4-sulfatase, the expression of inflammation markers and fountain maintenance markers was examined. As shown in FIG. 8, compared to the untreated group, there was a significant effect of suppressing the difference in the expression of TNF-α and TGF- / 3 in the treated group!

[0191] In this experiment, we tried to examine the regeneration of DA neuron. We examined the effect of C4sulfatase using Nurrl, a gene involved in DA neuron expression, as a marker. Figure 9 shows the results. In the C4sul-treated group, Nurrl expression was significantly increased (p <0.001) compared to the untreated group. Further, as shown in FIG. 10, when the expression of DA neuron in brain tissue was examined, the same result was obtained. These results suggest that anti-CSPG therapy for PD model may promote DA neuron regeneration, combined with anti-inflammatory and anti-fibrotic effects.

[0192] Finally, we compared the survival rates of treated and untreated groups in Parkinson's disease model induced by MPDP administration. As a result, the survival rate at the end point was 16.7% in the untreated group, 50% in the C4sul treated group, and 71.4% in the GalNAc si treated group. The results suggest a protective effect against invasion such as infection, drug-induced encephalitis, and trauma. Hereinafter, the experimental method and results will be specifically described.

Example 7 MPTP induction C57BL6 TcL Parkinson's disease model mice in C4-sulfatas e 几 i CSPG ^^ ne JMI power ratio f meter

In this example, a mouse model of Parkinson's disease in which donomin neurons were selectively denatured with 1-methy 卜 4-pheny 卜 2,3-dihydropyridinium (MPDP) was administered and treated with C4-sulfatase drug. Later, gene expression and tissue appearance were compared.

[0194] Day 14 of pregnancy C57BL6J / JcL mice (CLEA Japan, Inc.) were bred and given birth, and C4-sulfatase (Seikagaku Corporation) 4 U for each 8 week-old female C57B L6J / JcL mouse (CLEA Japan) 100 ml / ml was administered intraperitoneally. Thereafter, MPDP (manufactured by Sigma Aldrich Japan) that selectively destroys only dopamine neuron at 30 mg / kg was reared for 3 times after 2 days, 3 days and 4 days. On the 8th day of the experiment, BrdU 5 mg / mL (manufactured by ZyMED Laboratory. Inc.) 100 1 was administered into the tail vein, dissected one hour later, the brain was removed, and a sample for immunostaining and a sample for gene expression analysis were prepared. Obtained.

[0195] Using a brain tissue sample of this Parkinson's disease model mouse, CSPG deposition suppression effect was compared! The obtained brain tissue was embedded in a freezing embedding agent OCT compound (manufactured by Miles), and a frozen block was prepared with liquid nitrogen. A section having a thickness of 10 μm was prepared from the frozen block using a cryostat (manufactured by Microm). The obtained sections were fixed with acetone (manufactured by Sigma Aldrich Japan) for 10 minutes, washed with a phosphate buffer, and further anti-chondroitin sulfate proteodarican (CSPG) antibody (clone CS56, as a primary antibody). Mouse monoclonal antibody (lO ^ g / ml; manufactured by Seikagaku Corporation) was added and reacted at room temperature for 1 hour. Subsequently, after performing a secondary antibody reaction using a histofine mouse stin kit (manufactured by Nichirei; used for mouse monoclonal antibody), DAB substrate (manufactured by Nichirei) was added to perform an enzyme dye reaction. It was. This specimen was observed with an optical microscope (Leica). This tissue image is shown in FIG. It was found that the positive signal in the untreated group was stronger than the control group's CSPG accumulation near the dentate gyrus. It was also found that CSPG accumulation was suppressed in the C4-sulfatase treatment group. In other words, considering the above results, it was found that the deposition of CSP G in the brain tissue of the MPDP-induced Parkinson's disease mouse model was suppressed by in vivo administration of C4-sulfatase.

Comparison of force ^ ffl tl force with WMH C4-sulfaase 几 i For each 50 mg of organ (brain) extracted from Example 7, force 1 mL of RNA-Bee (TEL-TEST) into electric power. After pulverization with a homogenizer (DIGITAL HOMOGENIZER, ASONE), add 200 μl of chloroform (Sigma Aldrich Japan) and mix gently, then ice-cool for about 5 minutes, 12,000 rpm, 4 ° C, Centrifugation was performed using a centrifuge (Centrifoge 5417R, eppendorf) for 15 minutes. Transfer 500 L of the supernatant after centrifugation to another Eppendorf tube, add 500 μL of isopropannol (Sigma Aldrich Japan) equivalent to the supernatant, mix, and then add l L of glycogen (Invitrogen). Ice-cooled for 15 minutes. After 15 minutes of ice cooling, centrifuge for 15 minutes at 12,000 rpm at 4 ° C, and then wash with 75% Ethanol 1000 l (manufactured by Sigma Aldrich Japan) three times for 30 minutes to 1 After natural drying for a period of time, dissolve in Otsuka distilled water 50 (Otsuka Pharmaceutical Co., Ltd.), further dilute 100 times with Otsuka distilled water (Otsuka Pharmaceutical Co., Ltd.), and plate reader on UV plate (Corning Costar Co., Ltd.) The RNA concentration in the sample extracted by (POWER Wave XS, manufactured by BIO-TEK) was calculated. Next, the following procedure was performed to perform RT reaction (cDNA synthesis). The calculated RNA sample was adjusted to a concentration of 500 rig / 20 ^ 1, heated at 68 ° C for 3 minutes with BLOCK INCUBATOR (ASTEC), and ice-cooled for 10 minutes. RT Pre Mix solution (composition: 25 mM MgCl 18.64 μ 1 (Invitrogen)), 5 X Buffer 20 μ 1 (Invitrogen), 0.1 M DTT 6.6 μ 1 (Invitrogen) ), 10 mM dNTP mix 10 μ1 (Invitrogen), RNase Inhibitor 2 μ1 (Invitrogen), MMLV Reverse transcriptase 1.2 μ1 (Invitrogen), Rando Add m primer 2 μ 1 (Invitrogen), sterile distilled water 19.56 μ 1 (Otsuka distilled water: Otsuka Pharmaceutical Co., Ltd.) 80 1 and heat reaction at 42 ° C for 1 hour using BLOCK INCUBATOR (ASTEC) 1 hour later, heat at 99 ° C for 5 minutes with BLOCK INCUBATOR (ASTEC), then cool on ice to prepare cDNA 1001 to be obtained, and use the cDNA obtained by synthesis to Red-time PCR reaction was performed with the composition. SYBR Premix EX taq 12.5 ^ 1 (TAKARA), sterile distilled water 11.3 1 (Otsuka distilled water), primer 0.1 1 (50 pmol / μ 1), cDNAl 1 were mixed, and Realtime PCR Dice (TAKARA) The reaction was carried out for 40 cycles at 95 ° C for 5 seconds and 60 ° C for 30 seconds. After completion of the reaction, gene expression of TNF-a and TGF-β, which are inflammation and fibrosis markers, was analyzed using β-actin as a correction gene.

[0197] Figure 8 shows that TNF-a and TGF-β gene expression was suppressed by C4_sulfatase treatment. The sequence information of β-actin, TNF-a, and TGF-β primer (Forward, Reverse) (TA KARA) used here is shown below.

[0198] β-actin: TAKARA

F: CATCCGTAAAGACCTCTATGCCAAC (SEQ ID NO: 84)

R: ATGGAGCCACCGATCCACA (IJ number: 85)

[0199] Tumor Necrosis Factor (TNF-a): manufactured by TAKARA

R: CCTGGTTGGCTGCTTGCTT (Distributed IJ number: 87)

[0200] Transforming growth factor-beta (TGF-β): TAKARA

F: GTGTGGAGCAACATGTGGAACTCTA (SEQ ID NO: 88)

R: TTGGTTCAGCCACTGCCGTA (SEQ ID NO: 89)

[0201] Example 9 Comparative study of the effect of dopamine neurons on C4-sulfatase treatment

In order to finally clarify the results shown in the above examples, first, expression analysis of Nurrl gene, which is an essential gene of dopamine neuron, was performed in the same manner as in Example 8. As a result, as shown in FIG. 9, there was a significant increase compared to the untreated group.

[0202] Furthermore, the obtained tissue sample sections were stained with an anti-tyrosine hydroxylase antibody using a dopamine neuron marker, and the tissue findings were compared. This tyrosine hydroxylase (TH) is a dopamine precursor It is an enzyme that converts to dolomine. The section obtained in the same manner as in Example 7 was fixed with 4% PFA phosphate buffer solution (manufactured by Leytester) for 10 minutes, washed with deionized water, and rabbit polyclonal anti-tyrosine hydroxylase as the primary antibody. Antibody (1:50 dilution; Calbiochem) was added and allowed to react for 1 hour at room temperature. Next, Alexa488-labeled anti-rabbit-donkey antibody (1: 200 dilution; Invitrogen), which is a secondary antibody, was added and reacted at room temperature for 30 minutes. Untreated group 10 showed tissue image for C4-sulfatas _e treatment group. A negative signal appeared near the substantia nigra of the untreated group. This suggests that MPDP selectively destroyed dopamine di eurone. On the other hand, it was confirmed that a strong signal appeared in the treatment group treated with C4-sulfatase. That is, it was concluded that the functional recovery of dopamine neuron can be expected with the activation of astrocytes shown in Example 5 by in vivo administration of C4-sulfatase. (TH is green)

[0203] The sequence of primers in Nurrl is shown below.

Nuclea receptor subfamily 4 GroupA member2 (Nurrl)

F: CTGCCCTGGCTATGGTCACA (Distributed IJ number: 90)

R: AGACAGGTAGTTGGGTCGGTTCA (SEQ ID NO: 91)

[0204] Example 10 Preservative If Effect from Foreign Factors in GalNAc4S-6ST siRNA

As in Examples 7, 8, and 9, the survival rate of C4-sulfatase and GalNAc4S_6ST siRNA treated group and untreated group in Parkinson's disease model induced by MPDP administration! /, Using the Kaplan Meier survival curve And compared. As shown in FIG. 11, the survival rate on day 7 was 16.7% in the untreated group, 50% in the C4-sufatase treated group, and 71.4% in the GalNAc4S-6ST siRNA treated group. In other words, treatment with C4-sulfatase or GalNAc4S_6ST siRNA prevents the overexpression and over-deposition of CSPG, thereby preventing the adsorption of chemokines related to the induction of inflammatory cells, and prevents the destruction of brain tissue in the inflammatory cells attracted by the deposition of CSPG. The results suggest that it can protect against invasion such as infection, drug-induced encephalitis, and trauma.

[0205] The sequence of GalNAc4S-6ST siRNA is shown below.

[GalNAc4S-6ST siRNA delivery IJ] iGene

5 '-GGAGCAGAGCAAGAUGAAUACAAUC—3' (酉己歹 IJ number: 92) 5 '-CCUCGUCUCGUUCUACUUAUGUUAG _3' (酉己歹 lj number: 93)

Industrial applicability

[0206] As an example of examining the effect of chondroitin sulfate proteodarican (CSPG) accumulation according to the present invention, the side chain of chondroitin sulfate proteodarican (acetilgalatatosamine stone) ¾ acid group was transferred. N-acetylgalactosamine- 4-0- sulfotransferase: N-acet ylgalactosamine- 4-0- sulrotransferase-l, N-acetylgalactosamine- 4-0- sulrotransfera se ~ 2, N-acetylgactosamine-4-sulfate 6-O Chondroitinase ABC, a degrading enzyme of chondroitin sulfate, which is a side chain of the siRNA of -sulfotransferase (GalNAc4ST-l, GalNAc4 ST-2, GALNAC4S-6ST), is a GAG chain associated with chondroitin sulfate proteodarican in the hypothalamus of the brain It is effective in treating or preventing Parkinson's disease by suppressing the sulfation and accumulation of and inhibiting the cell death of dopamine neurons. In addition, neurofibrotic degenerative diseases thought to be caused by the accumulation of abnormal proteins; Alzheimer's disease, polyglutamine disease, amyotrophic lateral sclerosis, spinal muscular atrophy, Huntington's disease and multiple sclerosis Therefore, it is considered that overexpression and accumulation of chondroitin sulfate proteodalycan in the present invention is a factor that reduces brain function. Since the neurofibrotic degeneration inhibitor according to the present invention can effectively improve lesions by an unprecedented mechanism of action and drug therapy, it can be an excellent therapy useful for further improvement of patient QOL and medical treatment.

[0207] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

Claims

The scope of the claims

[I] A neurofibrotic degeneration inhibitor comprising as an active ingredient a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican.

[2] The drug according to claim 1, wherein the substance is a substance having a chondroitin sulfate proteodarican degradation promoting action.

[3] The drug according to claim 1, wherein the substance is a substance having a chondroitin sulfate proteodarican synthesis inhibitory action.

[4] The drug according to claim 1, wherein the substance is a substance having a chondroitin sulfate proteodarican desulfation effect.

[5] The drug according to claim 1, wherein the substance is a substance having an inhibitory action on chondroitin sulfate proteodarican sulfation.

[6] The agent according to any one of [1] to [5], wherein production or accumulation of chondroitin sulfate proteodalycan is inhibited in the brain.

[7] The drug according to any one of claims;! To 6, which is used for treatment or prevention of neurofibrotic degenerative diseases.

8. The drug according to claim 7, wherein the neurofibrotic degenerative disease is cerebrospinal nerve or peripheral nerve fibrotic degenerative disease.

[9] The neurofibrotic degenerative disease is Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, polyglutamine disease, spinal muscular atrophy, Huntington's disease, or multiple sclerosis. The drug described in 1.

[10] An agent for promoting the regeneration of dopamine neurons in brain tissue, comprising as an active ingredient a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican.

[I I] An agent for preventing destruction of brain tissue in inflammatory cells, containing as an active ingredient a substance that inhibits the production or accumulation of chondroitin sulfate proteodarican.

[12] A screening method for a neurofibrotic degeneration inhibitor, which comprises selecting a substance having an action of inhibiting the production or accumulation of chondroitin sulfate proteodarican from a test sample.

[13] The following (a) to (d) are included, including a step of selecting a substance having the action described in any one of The screening method according to claim 12.

( _a ) Promoting the degradation of chondroitin sulfate proteodarican

(b) Inhibition of chondroitin sulfate proteodarican synthesis

(c) Desulfation effect of chondroitin sulfate proteodarican

(d) Inhibitory effect of chondroitin sulfate proteodarican on sulfation

[14] A screening method for a neurofibrotic degeneration inhibitor comprising the following steps (a) to (c).

[15] The screening method according to any one of [12] to [14], wherein the neurofibrotic degeneration inhibitor is used for treatment or prevention of a neurofibrotic degenerative disease.