WO2008024343A2

WO2008024343A2 - Micro rna arrays and methods of using the same

Info

Publication number: WO2008024343A2
Application number: PCT/US2007/018478
Authority: WO
Inventors: Dirk Dittmer; Wolfgang Vahrson
Original assignee: University of North Carolina at Chapel Hill
Current assignee: University of North Carolina at Chapel Hill
Priority date: 2006-08-21
Filing date: 2007-08-21
Publication date: 2008-02-28
Anticipated expiration: 2009-02-21
Also published as: WO2008024343A3

Abstract

Isolated polynucleic acids are disclosed. In some embodiments, the isolated polynucleic acids are selected from the group consisting of (a) a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; (b) a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2; and (c) a polynucleic acid capable of hybridizing under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4, wherein the polynucleic acid is 50 nucleotides or shorter. Also disclosed are libraries of isolated polynucleic acids; kits for determining the presence of miRNA expressed in a sample; methods for detecting, quantifying, or both at least one miRNA directed against at least one specific gene present in a sample; methods for designing a polynucleotide primer sequence for amplifying a precursor miRNA (pre-miRNA), a mature miRNA, or both of interest; methods for detecting at least one sequence variation in at least one miRNA in a sample; computer program products including computer-executable instructions embodied in a computer-readable medium for performing the disclosed methods; and computer systems that in some embodiments include relational databases.

Description

DESCRIPTION MICRO RNA ARRAYS AND METHODS OF USING THE SAME

RELATED APPLICATIONS

The presently disclosed subject matter claims the benefit of U.S. Provisional Patent Application Serial No. 60/823, 080 filed August 21 , 2006 and

U.S. Provisional Patent Application Serial No. 60/897,378 filed January 25,

2007, respectively; the disclosures of which are incorporated herein by reference in their entireties.

GOVERNMENT INTEREST

This presently disclosed subject matter was made with U.S. Government support under Grant No. R21 -CA97951 awarded by the United States National Institutes of Health. Thus, the U.S. Government has certain rights in the presently disclosed subject matter.

TECHNICAL FIELD

The presently disclosed subject matter pertains to the detection of miRNA.

BACKGROUND

MicroRNAs (miRNAs) are -22 nt long non-coding RNAs, which are found in all metazoan eukaryotes. At present 474 miRNAs have been identified in humans (http://microrna.sanger.ac.uk/). Many miRNAs are evolutionary conserved and homologs have been identified in Drosophila, humans, and plants. Each miRNA can regulate the expression of multiple target messenger RNAs (mRNA). MiRNAs regulate many processes including developmental stages, cellular responses such as inflammation, the differentiation of hematopoietic stem cells into lymphocytes and the transformation of normal cells into cancer cells (reviewed in 1 ). MiRNAs themselves are transcriptionally regulated and often show stringent tissue specificity.

Most miRNA gene loci are interspersed between coding regions or located within introns, though some can be embedded within an open reading frame. 37% of human miRNAs are organized in multi-miRNA clusters 2, many of which can be found around fragile sites 3,4. Clustered miRNAs are regulated by a common promoter and processed from a single primary transcript (pri- miR) that may contain several miRNAs, as well as coding exons. Hence, miRNAs are subject to (i) genomic alterations at the DNA level, (ii) transcriptional regulation at the pre-miRNA level and (iii) processing control at the mature miRNA level. Thus far few studies have evaluated these three modes of regulation simultaneously. In the nucleus, Drosha initiates miRNA processing (See Figure 1 and Figure 11 A) by cleaving the primary miRNA (pri- miRNA) to release the -60 nt long precursor miRNAs (pre-miRNA) (5). After export to the cytoplasm the pre-miRNAs are further processed by Dicer to yield a -22 bp miRNA duplex (6,7). One strand of this duplex is then incorporated into the RNA induced silencing complex (RISC), where it guides the RISC to mRNAs bearing complementary sequences (8,9). If the mRNA contains a perfectly complementary sequence, the RISC component Ago2, cleaves the target leading to mRNA degradation (10,11 ). In the case of an imperfect complementary target, RISC binding can induce translational inhibition (11). Translation inhibition is highly cooperative and requires several RISCs, potentially each with a different miRNA (12,13). miRNA profiling has emerged as a powerful new approach to stratify human cancer and to identify novel pathogenesis determinants (1). Some miRNAs are considered bona fide oncogenes based upon their strong transforming properties in animal models (29). Accordingly, there is a need for sensitive, accurate and reproducible procedures to compare miRNA expression patterns in disease states.

SUMMARY

It is an object of the presently disclosed subject matter to provide methods and compositions for the detection and or quantification of miRNA. In some embodiments, a database and computer program are provided for the design of primers useful for detecting miRNA. In some embodiments, the miRNA to be detected is mammalian miRNA. In some embodiments, the miRNA to be detected is human miRNA. In some embodiments, isolated polynucleic acid molecules are provided comprising nucleic acid sequences set forth in Tables 1 and 2, polynucleic acid molecules comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2; and polynucleic acid molecules capable of hybridizing under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4, wherein the polynucleic acid is 50 nucleotides or shorter.

In some embodiments, the isolated polynucleic acid molecules are provided as libraries where each molecule is attached to a support. In some embodiments, the support comprises a plurality of addresses, wherein each address is associated with at least one of the polynucleic acids.

In some embodiments, a kit is provided for determining the presence of miRNA expressed in a sample, comprising: a library comprising a substrate and a plurality of polynucleic acids arranged in pre-determined locations on the substrate, wherein each polynucleic acid is 30 nucleotides or shorter and hybridizes under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4; and an instruction set for utilizing the kit.

In some embodiments a method for detecting, quantifying, or both at least one miRNA directed against at least one specific gene present in a sample, comprising isolating RNA comprising at least one miRNA of interest from a sample; generating a cDNA of the miRNA; producing a polynucleic acid amplification product by polymerase chain reaction of the cDNA using at least one polynucleic acid primer pair having binding specificity for the cDNA under hybridization conditions; and detecting, quantifying or both detecting and quantifying the polynucleic acid amplification product. In some embodiments, the sample comprises one or more cells. In some embodiments, the sample comprises blood or tissue. In some embodiments, a plurality of miRNA is simultaneously detected. In some embodiments, the detecting, quantifying, or both the plurality of miRNAs in the sample is correlated with a pattern of expression of the genes in the same sample. In some embodiments, a plurality of miRNA is simultaneously detected.

In some embodiments, the detecting, quantifying, or both at least one miRNA in the sample is correlated with determining cellular transcriptional regulation by the at least one miRNA. In some embodiments, the cellular transcriptional regulation is related to the development of an organism. In some embodiments, the cellular transcriptional regulation is related to cell differentiation. In some embodiments, the cellular transcriptional regulation is related to cell proliferation. In some embodiments, the cellular transcriptional regulation is related to cell death. In some embodiments, the cellular transcriptional regulation is related to chromatin condensation. In some embodiments, the cellular transcriptional regulation is related to cell transformation. In some embodiments, the cellular transcriptional regulation is related to cancer cell detection, cancer cell characterization, or both.

An object of the presently disclosed subject matter having been stated hereinabove, and which is achieved in whole or in part by the presently disclosed subject matter, other objects will become evident as the description proceeds when taken in connection with the accompanying examples and drawings as best described herein below.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic showing the generally accepted mechanism of biogenesis of cellular and viral miRNAs. miRNAs are transcribed as parts of longer RNA molecules that are processed in the nucleus into hairpin RNAs of 70-100 nucleotides by the dsRNA-specific ribonuclease Drosha. The hairpin RNAs are transported to the cytoplasm and digested by a second, double- strand specific ribonuclease, Dicer. The resulting 19-23mer miRNA is bound by a complex that is similar to or identical to the RNA-lnduced Silencing Complex (RISC), which participates in RNA interference. The complex-bound, single-stranded miRNA binds mRNAs with sequences that are often significantly, though not completely, complementary to the mRNA. In animals, the bound mRNA typically remains intact but is not translated, resulting in reduced expression of the corresponding gene.

Figure 2 shows miRNAs as an additional layer of gene regulation in development and cancer. Initially (1958) the central dogma of molecular biology holds that DNA encodes a gene, which is transcribed into a messenger RNA₁ which is then translated into a protein. This fueled the recent developments in genomics, microarray profiling and proteomics or protein profiling. HIV is an exception, because this virus and other retroviruses are able to copy RNA back into DNA (dotted arrow) through the action of the reverse transcriptase enzyme. No similar activity is found in human cells. In 2002 miRNAs were discovered as a class of 400-4000 distinct, small RNA molecules encoded in the DNA. The miRNAs add another layer of gene regulation. The miRNAs are able to degrade messenger RNA thus preventing a protein from being made or to inhibit translation, which has the same net effect. Figure 3 depicts the small 22 nt miRNAs that are generated from larger

-60 nt pre miRNAs by miRNA directed real-time QPCR. A computer program is provided which can design all PCR primers that can be placed on a particular pre-miRNA. Moreover, given a collection of 400-4000 target pre-miRNAs, the program can find a set of primers such that all share a common melting temperature (tm).

Figure 4 depicts a relational database useful for the design of polynucleic acid primer pairs for the detection and/or quantification of miRNA.

Figure 5 depicts a more detailed schema for a relational database for the design of polynucleic acid primer pairs for the detection and/or quantification of miRNA.

Figure 6 illustrates an exemplary general purpose computing platform 100 upon which the methods and systems of the presently disclosed subject matter can be implemented.

Figure 7 demonstrates that primers designed using the disclosed computer program are specific for pre-miRNA. To validate the computer program designed primers, a set of primers specific for EBV virus pre-miRNAs and the small, abundant cellular RNA₁ U6 was tested. No RNA was detected with the primers in the cells lacking EBA and in the absence of reverse transcriptase. Figure 8 shows a validation experiment of the pre-miRNA Quantitative

PCR (QPCR) assay on clinical biopsies. One of the advantages of the presently disclosed assay is that it is equally well suited for the analysis of routine 2x2mm clinical biopsies as it is for analysis of cell lines. The assay is functional when less input RNA of a lower quality is used than in other assays. This is illustrated with an assay against EBV pre-miRNAs. Total RNA was isolated from either EBV positive cell lines or total RNA from two clinical lymphoma biopsies #291 and #274. Only biopsy #291 contained EBV. These RNAs were then reverse transcribed using random hexamer primers to yield cDNA and remaining RNA digested with RNAseH. Finally, the samples were subjected to real-time QPCR using the specific primer pairs indicated on the horizontal axis. Relative abundance was recorded as CT and relative levels (percent U6 RNA indicated on the vertical axis) calculated as 21\(CTprimerCTU6). The assay performance was similar for both the clinical biopsies and the experimental cell cultures.

Figure 9 shows an outline of the real-time QPCR pre-miRNA array. Most human miRNAs are clustered and co-regulated, such that mir34a is located in the vicinity of mir34b on the human genome. (A) Using PrimeTime we calculated forward (e.g. mir34a-1) and reverse (e.g. mir24a2) primers specific for each individual miRNA, which are combined in a singleplexQPCR reaction. (B) We also claim that our primers are suitable for multiplex QPCR such that all primers that detected a member of a miRNA family can be combined within a single well. Figure 10 shows the results of a profiling experiment for 158 pre- miRNAs (and controls) in two clinical biopsies (#JP, #06.001) and a non- template control (NTC) consisting of water. Primers described in Table 1 were used for this procedure. Each row corresponds to an individual primer from Table 1 . The raw data (CT) are shown for each reaction, with lower numbers indicating a higher abundance. CT=40 indicates the absence of a product.

Figure 11 shows genomic and transcript profiling of KSHV and EBV miRNAs. (A) Outline of miRNA maturation and the species that can be detected using pre-miRNA specific primers and SYBR™ -based real-time QPCR or miRNA specific primers and TaqMan™-based real-time QPCR. (B) Plot of normalized dCTU6 levels of viral miRNA gene loci. Variations in input DNA were first adjusted for using U6 normalization. This yielded dCTU6, which represents a relative logarithmic measure of copy number. Primers are indicated on the horizontal and relative levels on the vertical axis. Absence of miRNA loci are indicated by higher positive dCT values.

Figure 12 shows comparative genomic profiling for cellular miRNA loci in PEL. Variation in miRNA gene copy number. Plot of range of dCTU6 on the vertical vs 5% trimmed mean dCTU6 on the horizontal axis. Indicated are the signals for KSHV, EBV and hsa-miR-34a. A higher range indicates a larger variation in DNA copy number across this set of PEL and control cells.

Figure 13 shows mature miRNA profiles of PEL. PEL miRNA profile (A) Scatterplot analysis of two cell lines JSC-1 (vertical axis) and BC-1 (horizontal axis). Shown are mean CT data of technical triplicates. Lines indicate the SD. Dots correspond to individual miRNAs. CT=40 indicates absence of miRNA signal. (B) Variation of mature miRNA levels in PEL. Plotted is the SD on the vertical axis against the mean CT on the horizontal axis (n=10). Open circles indicate mature miRNAs as detected by TaqMan™ assay. Dark circles indicate that the corresponding pre-miRNA was also overexpressed. Crossed circles indicate miRNAs that were cloned from PEL (data from 16,17). Shaded area indicates the cut-off used to derive the PEL miRNA signature. (C) Fraction of total (165) probes on the vertical axis, with all CT lower than indicated on the horizontal axis. Arrow indicates all miRNAs with CT≤38, i.e. those uniformly detectable in all PEL lines. These are listed on the right. # indicates miRNAs, which were also cloned, ## indicates miRNAs, which were cloned independently by two groups (16,17).

DETAILED DESCRIPTION In accordance with the presently disclosed subject matter, methods and compositions are provided for the detection or quantification or both of miRNA. The presently disclosed subject matter is related to an isolated nucleic acid comprising a sequence of a pri-miRNA, pre-miRNA, miRNA, and/or a polynucleic acid primer sequence designed to hybridize to these miRNAs. The nucleic acid may comprise SEQ ID NO:s: 1-1609 present in Tables 1-4. miRNAs add an additional layer of gene regulation in development and cancer (Figure 2). Initially (1958) the central dogma of molecular biology held that DNA encodes a gene, which is transcribed into a messenger RNA, which is then translated into a protein. This fueled the recent developments in genomics, microarray profiling and proteomics or protein profiling. HIV is an exception, because this virus and other retroviruses are able to copy RNA back into DNA (dotted arrow of Figure 2) through the action of the reverse transcriptase enzyme. No similar activity is found in human cells. In 2002 miRNAs were discovered as a class of 400-4000 distinct, small RNA molecules encoded in the DNA. The miRNAs add another layer of gene regulation. The miRNAs are able to degrade messenger RNA thus preventing a protein from being made or to inhibit translation, which has the same net effect. The presently disclosed subject matter includes a computer program that can design all PCR primers that can be placed on a particular pre-miRNA. Moreover, given a collection of 400-4000 target pre-miRNAs, the program c find a set of primers such that all share a common melting temperature (tm). Figure 3 depicts the small 22 nt miRNAs that are generated from larger -60 nt pre miRNAs by miRNA directed real-time QPCR.

The presently disclosed subject matter is also related to a plurality of the polynucleic acid primer sequences. The plurality of primer sequences can comprise at least ten of the primer sequences. The plurality of probes can comprise at least 100 of the primer sequences. The plurality of probes can comprise at least 400 of the primer sequences. The presently disclosed subject matter is related to a biochip comprising a solid substrate, said substrate comprising a plurality of the primer sequences. Each of the primer sequences can be attached to the substrate at a spatially defined address. The biochip can comprise primer sequences that are complementary to a mammalian miRNA. The biochip can comprise primer sequences that are complementary to a human miRNA. The biochip can comprise primer sequences that are complementary to a human miRNA characterized by expression during viral infection.

The presently disclosed subject matter is also related to a method of detecting differential expression of miRNA in disease and/or of a disease- associated miRNA. In some embodiments a biological sample can be provided and the level of a nucleic acid measured that is a target sequence present in Table 3 or Table 4 or a variant thereof. A difference in the level of the nucleic acid compared to a control is indicative of differential expression.

In some embodiments miRNA profiling methods are provided. The presently disclosed miRNA profiling methods are useful for stratifying human cancer and identifying novel pathogenesis determinants. Some miRNAs are considered bona fide oncogenes based upon their strong transforming properties in animal models (29). To date cellular miRNAs have not been profiled in PEL. The presently disclosed subject matter includes a report of the miRNA profile of PEL (Figure 13). Multiple layers of regulation control miRNA abundance and the presently disclosed subject matter for the first time combined querying them all. miRNA gene locus deletions were evaluated using DNA QPCR. This identified cell-line specific deletions of individual miRNA loci, however few miRNA loci were lost in all PEL. Hsa-miR-218-1 , -

107, -153-1 , -188, and -125a were amplified in multiple PEL and await confirmation by genotyping.

The nascent transcript (pri-miRNA) is regulated at the level of promoter activity. Pri-miRNAs are processed into premiRNAs depending on Drosha levels and specificity. Upon nuclear export, Dicer generates mature miRNAs. A high concordance was found between pre-miRNAs and mature miRNAs (see Example 11 ). This result is in agreement with Schmittgen andcolleagues (30,31 ), who likewise profiled pre-miRNA levels and found them to be good predictors of mature miRNA abundance. This suggests that transcriptional control of miRNAs plays an important role in miRNA regulation.

There exists an additional justification to profile pre-miRNAs, because mature miRNAs of identical sequence can be derived from different pre- miRNAs, each located at a different genomic location and each under control of a different promoter. Thus, profiling pre-miRNA levels provides a stepping- stone towards the identification of miRNA regulatory elements.

The presently disclosed real-time QPCR assays (miRNA and pre- miRNA) revealed a remarkable robustness and sensitivity. On average replicates showed less than three-fold variation over a linear range of five orders of magnitude. This outperformed hybridization or radioactivity-based assays, for which we were not able to establish statistically significant differences of less than 10-fold (data not shown). Equally remarkable was the robustness of the miRNA profile between PEL cell lines. Even though each individual PEL had some pre-miRNAs and miRNAs (<5%) that were unique to a particular cell line, the signature miRNAs were highly upregulated in most PEL to almost the exact level (SD < 4 fold). This implies that the PEL signature miRNAs are important for and unique to this class of lymphomas.

Hsa-miR-181b, -15a, -16, -34a, -29b, -140, -28, -222, -129, -126 were identified by three independent methods (miRNA QPCR₁ pre-miRNA QPCR and cloning) in multiple PEL. The identification correlates well with the biology of PEL. Hsa-miR-181 b is B-ymphoid specific and can drive B lymphopoiesis upon ectopic expression in bone marrow progenitor cells (32). Hsa-miR-181 and Hsa-miR29b are also markers for B-CLL, although they are down regulated in the most aggressive forms. Recently it was shown that hsa-miR-181 and hsa-miR29b target the mRNA for TCL-1 (33). In contrast to PEL, hsa-miR-15a is dowregulated in B-CLL. Also in B-CLL, hsa -miR-15a expression was inversely correlated with its target, BCL-2, mRNA levels (3,34).

Since KSHV encodes a viral BCL-2 homolog (35), there is no selection pressure to induce human BCL-2. As a result, hsa-mir-15a was high and BCL-2 mRNA is low by comparison to others. Hsa-miR-34a has been ascribed tumor suppressor activity in neuroblastomas by targeting E2F3 mRNA (36), but no data have been reported with regard to human lymphoma. Hsa-miR-140 targets histone deacetylase in mouse cells (37), but no human data are available. Hsa-miR-222 was shown to target c-kit in endothelial cells and other cancers (38,39) and c-kit is induced in KS and KSH V-infected endothelial cells. However, c-kit is neither significantly up- or down regulated in PEL (15), suggesting that in lymphoid cancer, hsa-miR-222 has other targets. Interestingly, hsa-miR-222/221 are encoded in close proximity to each other on

Xp11.3, but while hsa-mir-222 was easily detectable by pre-miRNA or miRNA profiling and cloning, hsa-mir-221 was not detected by either method, demonstrating that these two adjacent miRNAs are differentially regulated.

Hsa-miR-28, hsa-miR-129 and hsa-miR-126 have not yet been ascribed a function. Hsa-miR-155 has been studied extensively in the context of human lymphoma, but was underrepresented in PEL. The miR-155 gene locus is embedded within exon 3 of the BIC mRNA, which was initially identified as a viral integration site in avian lymphoma.

BIC and miR-155 are highly expressed in HD, DLBCL and other lymphomas, but interestingly not in BL (40). While BIC mRNA was induced by phorbol ester in EBV- Ramos BL cells, neither the mature hsa-miR-155 miRNA nor the hsa-miR-155 pre-miRNA was detectable (41). This provides another example of discordant regulation between the nascent pri-RNAs comprising both protein and miRNA coding regions, and pre-miRNA/miRNA levels. These data show that combined pre-miRNA and miRNA profiling provides novel information for the classification of human tumors that is independent of messenger RNA profiling.

PEL express B cell lineage and B cell lymphoma-specific miRNAs, despite the absence of most B cell CD surface antigens. The presently disclosed subject matter thus contributes to the definition of common and differential miRNA markers for human B cell lymphoma. The presently disclosed subject matter shows that pre-miRNA profiling yields corroborative as well as novel, non-redundant information to mature miRNA profiling, which can be used for the stratification of human cancer. Novel, PEL-specific miRNAs were identified and for the first time an association was described for hsa-miR- 28, hsa-miR-129 and hsa-miR-126 with human cancer.

In some embodiments, an isolated polynucleic acid is provided, optionally selected from the group consisting of a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2; and a polynucleic acid capable of hybridizing under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4, wherein the polynucleic acid is 50 nucleotides or shorter.

In some embodiments, the isolated polynucleic acid is from about 15 to about 30 nucleotides in length. In some embodiments, a library of isolated polynucleic acids is provided, wherein each polynucleic acid is 30 nucleotides or shorter and hybridizes under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4. In some embodiments, each polynucleic acid of the library is selected from the group consisting of a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; and a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2. In some embodiments, each of the polynucleic acid molecules of the library is attached on a support. In some embodiments, the support comprises a plurality of addresses, wherein each address is associated with at least one of the polynucleic acids.

In some embodiments, a kit is provided for determining the presence of miRNA expressed in a sample, which comprises a library comprising a substrate and a plurality of polynucleic acids arranged in pre-determined locations on the substrate, wherein each polynucleic acid is 30 nucleotides or shorter and hybridizes under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4; and an instruction set for utilizing the kit. In some embodiments, each polynucleic acid of the kit is selected from the group consisting of a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; and a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2. In some embodiments a method is provided for detecting, quantifying, or both at least one miRNA directed against at least one specific gene present in a sample. The method comprises isolating RNA comprising at least one miRNA of interest from a sample; generating a cDNA of the miRNA; producing a polynucleic acid amplification product by polymerase chain reaction of the cDNA using a polynucleic acid primer pair having binding specificity for the cDNA under hybridization conditions; and detecting, quantifying or both detecting and quantifying the polynucleic acid amplification product.

In some embodiments, the at least one miRNA comprises at least one precursor miRNA (pre-miRNA). In some embodiments, the at least one pre- miRNA comprises a nucleic acid sequence set forth in Table 3. In some embodiments, the at least one miRNA comprises at least one mature miRNA. In some embodiments, the at least one mature miRNA comprises a nucleic acid sequence set forth in Table 4. In some embodiments, the sample comprises one or more cells. In some embodiments, the sample comprises blood or tissue. In some embodiments the sample is derived from a mammal. In some embodiments, the sample is derived from a human.

In some embodiments, each of the polynucleic acid primers in the primer pair is 30 nucleotides or shorter and each is a polynucleic acid selected from the group consisting of a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; and a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2. In some embodiments, the polynucleic acid primer pairs can have binding specificity for a precursor miRNA (pre-miRNA), a mature miRNA or both.

In some embodiments, a method is provided for detecting, quantifying, or both, at least one miRNA directed against at least one specific gene present in a sample. Optionally, the presence and/or amount of miRNA is correlated with determining cellular transcriptional regulation by the at least one miRNA. In some embodiments, the cellular transcriptional regulation is related to the development of an organism. In some embodiments, the cellular transcriptional regulation is related to cell differentiation. In some embodiments, the cellular transcriptional regulation is related to cell proliferation. In some embodiments, the cellular transcriptional regulation is related to cell death. In some embodiments, the cellular transcriptional regulation is related to chromatin condensation. In some embodiments, the cellular transcriptional regulation is related to cell transformation. In some embodiments, the cellular transcriptional regulation is related to cancer cell detection, cancer cell characterization, or both.

In some embodiments a method is provided for simultaneously detecting, quantifying, or both a plurality of miRNAs directed against specific genes present in a sample. The method comprises isolating RNA comprising the plurality of miRNAs of interest from the sample; generating a cDNA of each of the miRNAs; producing a polynucleic acid amplification product by polymerase chain reaction of each of the cDNAs using polynucleic acid primer pairs having binding specificity for each of the cDNAs under hybridization conditions; and detecting, quantifying or both detecting and quantifying the polynucleic acid amplification products. In some embodiments, at least 3, preferably 20, and more preferably 50 of the miRNAs set forth in Table 3 and Table 4 are simultaneously detected, quantified, or both. In some embodiments, the detecting, quantifying, or both the plurality of miRNAs in the sample is correlated with a pattern of expression of the genes in the same sample.

In some embodiments, the polynucleic acid primers in the primer pairs are compatible for use under the same reaction conditions. In some embodiments, the melting temperature (Tm) of a hybrid of the polynucleic acid primers is from about 45°C to about 65°C. In some embodiments, the melting temperature (Tm) of a hybrid of the polynucleic acid primers is from about 58°C to about 62°C.

In some embodiments, a method is provided for designing at least one pair of polynucleotide primer sequences for amplifying at least one precursor miRNA (pre-miRNA) or mature miRNA, or both of interest. The method comprises selecting a polynucleotide sequence template corresponding to at least a portion of a miRNA polynucleotide sequence; and designing at least one pair of primer polynucleotide sequences having binding specificity under hybridization conditions to at least a portion of the polynucleotide sequence template and having the characteristics of one or more of:

(i) about 15 to about 25 nucleotides in length;

(ii) a melting temperature (Tm) in a hybrid of from about 58°C to about 62°C;

(iii) a maximum difference in Tm between two primers within the same primer pair of about 2°C;

(iv) a maximum complementary overlap at the 3¹ ends of a primer pair of about four nucleotides; (v) a maximum self-complementarity in the primer polynucleotide sequence of about four nucleotides; (vi) a G/C content of the primer polynucleotide sequence of from about 20% to about 80%; and

(vii) a maximum length of a polynucleotide amplification product of less than about 110 nucleotides with a range of polynucleotide length of the amplification product of no more than +/- 10% of a predetermined optimal polynucleotide length of the amplification product.

In some embodiments, the designed polynucleotide sequence has the characteristics of two or more of the above listed characteristics. In some embodiments, the designed polynucleotide sequence has the characteristics of three or more of the above listed characteristics. In some embodiments, the designed polynucleotide sequence has the characteristics of four or more of the above listed characteristics. In some embodiments, the designed polynucleotide sequence has the characteristics of five or more of the above listed characteristics. In some embodiments, the designed polynucleotide sequence has the characteristics of six or more of the above listed characteristics. In some embodiments, the designed polynucleotide sequence has the characteristics of all seven of the above listed characteristics. In some embodiments, the polynucleotide sequences in the primer pair have the additional characteristics of: i) two or fewer complementarity mismatches with the polynucleotide sequence template (e.g. the target sequence); ii) a distance between the two polynucleotide sequence primers in the primer pair on the polynucleotide sequence template of less than 4,000 nucleotides; iii) each polynucleotide sequence primer in the primer pair having binding specificity on opposite strands of the polynucleotide sequence template; and iv) each polynucleotide sequence primer in the primer pair oriented upon binding to the polynucleotide sequence template with 3¹ ends pointed toward each other.

In some embodiments, a plurality of primer pair polynucleotide sequences is designed. In some embodiments, each of the plurality of primer pairs has binding specificity under hybridization conditions to a distinct portion of the miRNA polynucleotide sequence. In some embodiments, each of the plurality of primer pairs has binding specificity under hybridization conditions to a polynucleotide sequence from different miRNAs. In some embodiments, a computer program product is provided comprising computer-executable instructions embodied in a computer-readable medium for performing steps comprising: selecting a polynucleotide sequence template corresponding to at least a portion of a miRNA polynucleotide sequence; and designing at least one pair of_primer polynucleotide sequences having binding specificity under hybridization conditions to at least a portion of the polynucleotide sequence template and having one or more of the characteristics of: i) about 15 to about 25 nucleotides in length; ii) a melting temperature (Tm) in a hybrid of from about 58°C to about 62°C; Hi) a maximum difference in Tm between two primers within the same primer pairs of about 2°C; iv) a maximum complementary overlap at the 3' ends of a primer pair of about four nucleotides; v) a maximum self-complementarity in the primer polynucleotide sequence of about four nucleotides; vi) a G/C content of the primer polynucleotide sequence of from about 20% to about 80%; and vii) a maximum length of a polynucleotide amplification product of less than about 110 nucleotides with a range of polynucleotide length of the amplification product of no more than +/- 10% of a predetermined optimal polynucleotide length of the amplification product.

In some embodiments, a method is provided for detecting at least one sequence variation in at least one miRNA in a sample, comprising: a) isolating RNA comprising at least one miRNA of interest from a sample; b) generating a cDNA of the miRNA; c) producing a labeled polynucleic acid amplification product by polymerase chain reaction of the cDNA using a label and at least one polynucleic acid primer pair having binding specificity for the cDNA under hybridization conditions; and d) quantifying an amount of labeled polynucleic acid amplification product produced to thereby detect at least one sequence variation in the at least one miRNA.

In some embodiments, the at least one miRNA comprises at least one precursor miRNA (pre-miRNA). In some embodiments, the at least one pre- miRNA comprises a nucleic acid sequence set forth in Table 3. In some embodiments, the at least one miRNA comprises at least one mature miRNA. In some embodiments, the at least one mature miRNA comprises a nucleic acid sequence set forth in Table 4. In some embodiments, the sample comprises one or more cells. In some embodiments, the sample comprises blood and/or tissue. In some embodiments, the sample is derived from a mammal. In some embodiments, the sample is derived from a human. In some embodiments, the each of the polynucleic acid primers in the primer pair is 30 nucleotides or shorter and is a polynucleic acid selected from the group consisting of a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; and a poiynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2. In some embodiments, the polynucleic acid primer pairs can have binding specificity for a precursor miRNA (pre-miRNA), a mature miRNA or both. In some embodiments, the label comprises a fluorescent label.

In some embodiments, the sequence variation in the at least one miRNA in the sample is correlated with determining cellular transcriptional regulation by the at least one miRNA. In some embodiments, the the cellular transcriptional regulation is related to cancer cell detection, cancer cell characterization, or both. In some embodiments, the cellular transcriptional regulation is related to the development of an organism. In some embodiments, the cellular transcriptional regulation is related to cell differentiation. In some embodiments, the cellular transcriptional regulation is related to cell proliferation. In some embodiments, the cellular transcriptional regulation is related to cell death. In some embodiments, the cellular transcriptional regulation is related to chromatin condensation. In some embodiments, the ceilular transcriptional regulation is related to cell transformation.

In some embodiments, the at least one sequence variation is at least one single nucleotide polymorphism (SNP). In some embodiments, a plurality of sequence variations are simultaneously detected. In some embodiments, detecting the plurality of sequence variations is correlated with a pattern of expression of one or more genes in the sample. In some embodiments, the at least 3, preferably 20, and more preferably 50 sequence variations within the miRNAs set forth in Table 3 and Table 4 are simultaneously detected. In some embodiments each of the polynucleic acid primers in the primer pairs are compatible for use under the same reaction conditions. In some embodiments, the melting temperature (Tm) of a hybrid of each of the polynucleic acid primers is from about 45°C to about 65°C. In some embodiments, the melting temperature (Tm) of a hybrid of each of the polynucleic acid primers is from about 58°C to about 62°C.

In some embodiments, a computer system is provided comprising: (a) a relational database having records containing information related to at least one pair of.primer polynucleotide sequences having binding specificity under hybridization conditions to at least a portion of a polynucleotide sequence template and identifying one or more of the following characteristics: i) about 15 to about 25 nucleotides in length; ii) a melting temperature (Tm) in a hybrid of from about 58°C to about 62°C; iii) a maximum difference in Tm between two primers within the same primer pairs of about 2 ⁰C; iv) a maximum complementary overlap at the 3¹ ends of a primer pair of about four nucleotides; v) a maximum self-complementary in the primer polynucleotide sequence of about four nucleotides; vi) a G/C content of the primer polynucleotide sequence of from about 20% to about 80%; and vii) a maximum length of a polynucleotide amplification product of less than about 110 nucleotides with a range of polynucleotide length of the amplification product of no more than ±10% of a predetermined optimal polynucleotide length of the amplification product; and

(b) a sequence design function configured to design the at least one pair of primer polynucleotide sequences having binding specificity under hybridization conditions to at least a portion of the polynucleotide sequence template and having the one or more characteristics identified by the relational database.

An exemplary relational database for the computer sytem is shown in Figures 4 and 5. An exemplary source code for the sequence design function to design polynucleic acid primer sequences for the amplification of miRNA is disclosed in Example 1. With reference to Figure 6, an exemplary system for implementing the invention includes a general purpose computing device in the form of a conventional personal computer 100, including a processing unit 101 , a system memory 102, and a system bus 103 that couples various system components including the system memory to the processing unit 101. System bus 103 can be any of several types of bus structures including a memory bus or memory controller, a peripheral bus, and a local bus using any of a variety of bus architectures. The system memory includes read only memory (ROM) 104 and random access memory (RAM) 105. A basic input/output system (BIOS) 106, containing the basic routines that help to transfer information between elements within personal computer 100, such as during start-up, is stored in ROM 104. Personal computer 100 further includes a hard disk drive 107 for reading from and writing to a hard disk (not shown), a magnetic disk drive 108 for reading from or writing to a removable magnetic disk 109, and an optical disk drive 110 for reading from or writing to a removable optical disk 111 such as a CD ROM or other optical media.

Hard disk drive 107, magnetic disk drive 108, and optical disk drive 110 are connected to system bus 103 by a hard disk drive interface 112, a magnetic disk drive interface 113, and an optical disk drive interface 114, respectively. The drives and their associated computer-readable media provide nonvolatile storage of computer readable instructions, data structures, program modules, and other data for personal computer 100. Although the exemplary environment described herein employs a hard disk, a removable magnetic disk 109, and a removable optical disk 111 , it will be appreciated by those skilled in the art that other types of computer readable media which can store data that is accessible by a computer, such as magnetic cassettes, flash memory cards, digital video disks, Bernoulli cartridges, random access memories, read only memories, and the like may also be used in the exemplary operating environment.

A number of program modules can be stored on the hard disk, magnetic disk 109, optical disk 111 , ROM 104, or RAM 105, including an operating system 115, one or more applications programs 116, other program modules 117, and program data 118. System memory 104 and/or 105 can also include a search engine, a relational database, a database manager, and a comparator program having instructions for implementing the search, management, compilation (e.g. addition and deletion of data from the database or other aspects of memory), comparing data, assessing data, and displaying the primer sequence data. A user can enter commands and information into personal computer 100 through input devices such as a keyboard 120 and a pointing device 122. Other inputs include geneomic sequences and input devices (not shown) can include a microphone, touch panel, joystick, game pad, satellite dish, scanner, or the like. These and other input devices are often connected to processing unit 101 through a serial port interface 126 that is coupled to the system bus, but can be connected by other interfaces, such as a parallel port, game port or a universal serial bus (USB). A monitor 127 or other type of display device is also connected to system bus 103 via an interface, such as a video adapter 128. In addition to the monitor, personal computers typically include other peripheral output devices, not shown, such as speakers and printers. With regard to the presently disclosed subject matter, the user can use one of the input devices to input data indicating the user's preference between alternatives presented to the user via monitor 127. Personal computer 100 can operate in a networked environment using logical connections to one or more remote computers, such as a remote computer 129. Remote computer 129 can be another personal computer, a server, a router, a network PC, a peer device or other common network node, and typically includes many or all of the elements described above relative to personal computer 100, although only a memory storage device 130 has been illustrated in Figure 6. The logical connections depicted in Figure 6 include a local area network (LAN) 131 , a wide area network (WAN) 132, and a system area network (SAN) 133. Local- and wide-area networking environments are commonplace in offices, enterprise-wide computer networks, intranets and the Internet.

System area networking environments are used to interconnect nodes within a distributed computing system, such as a cluster. For example, in the illustrated embodiment, personal computer 100 can comprise a first node in a cluster and remote computer 129 can comprise a second node in the cluster. In such an environment, it is preferable that personal computer 100 and remote computer 129 be under a common administrative domain. Thus, although computer 129 is labeled "remote", computer 129 can be in close physical proximity to personal computer 100. When used in a LAN or SAN networking environment, personal computer 100 is connected to local network 131 or system network 133 through network interface adapters 134 and 134a. Network interface adapters 134 and 134a can include processing units 135 and 135a and one or more memory units 136 and 136a. When used in a WAN networking environment, personal computer 100 typically includes a modem 138 or other device for establishing communications over WAN 132. Modem 138, which can be internal or external, is connected to system bus 103 via serial port interface 126. In a networked environment, program modules depicted relative to personal computer 100, or portions thereof, can be stored in the remote memory storage device. It will be appreciated that the network connections shown are exemplary and other approaches to establishing a communications link between the computers can be used.

In some embodiments, the sequence design function of the computer system is configured to design a plurality of primer pair polynucleotide sequences. In some embodiments, the relational database of the computer system has records containing information identifying one or more of the following characteristics of the primer polynucleotide sequences in the primer pair: i) two or fewer complementary mismatches with the polynucleotide sequence template; ii) three or more complementary mismatches for each of the primer polynucleotide sequences in the primer pair to polynucleotide sequences of less than 4,000 nucleotides present in a genome of interest and other than the polynucleotide sequence template; iii) each polynucleotide sequence primer in the primer pair having binding specificity on opposite strands of the polynucleotide sequence template; and iv) each polynucleotide sequence primer in the primer pair oriented upon binding to the polynucleotide sequence template with 3' ends pointed toward each other.

In some embodiments of the computer system, each of the plurality of primer pairs has binding specificity under hybridization conditions to a distinct portion of the miRNA polynucleotide sequence. In some embodiments of the computer system, each of the plurality of primer pairs has binding specificity under hybridization conditions to a polynucleotide sequence from different miRNAs. Table 1

SEQ SEQ product id ID No forward primer seq len Tm id ID No reverse primer seq len Tm len hsa-let-7a-1-1 1 tgggatgaggtagtaggttgt 21 56.12 hsa-let-7a-1-2 539 aggaaagacagtagattgtatagtt 25 52.01 79 hsa-let-7a-1-3 2 tgggatgaggtagtaggttg 20 55.08 hsa-let-7a-1-4 540 aggaaagacagtagattgtatagtt 25 52.01 79 hsa-let-7a-1-5 ggttgtatagttttagggtcacacc 25 59.19 hsa-let-7a-1-6 541 agattgtatagttatctcccagtg 24 53.60 52 hsa-!et-7a-2-1 4 agtttagaattacatcaagggaga 24 55.50 hsa-let-7a-2-2 542 aggaaagctaggaggctgta 20 55.96 50 hsa-let-7a-2-3 5 aggttgaggtagtaggttgt 20 50.35 hsa-let-7a-2-4 543 aggaaagctaggaggctgta 20 55.96 72 hsa-let-7a-2-5 6 agtttagaattacatcaagggagat 25 55.94 hsa-let-7a-2-6 544 aggaaagctaggaggctgta 20 55.96 50 hsa-let-7a-3-1 7 gggtgaggtagtaggttgta 20 51.67 hsa-let-7a-3-2 545 tatcccatagcagggcaga 19 59.19 50 hsa-let-7a-3-3 8 gggtgaggtagtaggttgta 20 51.67 hsa-let-7a-3-4 546 tatcccatagcagggcagag 20 60.19 50 hsa-let-7a-3-5 9 gggtgaggtagtaggttgtatagttt 26 57.45 hsa-let-7a-3-6 547 tatcccatagcagggcaga 19 59.19 50 hsa-let-7b-1 10 cggggtgaggtagtaggttg 20 59.47 hsa-let-7b-2 548 cagggaaggcagtaggttgt 20 59.21 83 hsa-let-7b-3 ^' 11 gtttcagggcagtgatgttg 20 59.14 hsa-let-7b-4 549 cagggaaggcagtaggttgt 20 59.21 59 hsa-let-7b-5 12 cggggtgaggtagtaggttg 20 59.47 hsa-let-7b-6 550 cagggaaggcagtaggttgta 21 59.25 83 hsa-let-7c-1 13 tccgggttgaggtagtaggt 20 58.52 hsa-lst-7c-2 551 gctccaaggaaagctagaagg 21 59.62 81 hsa-let-7c-3 14 tccgggttgaggtagtaggt 20 58.52 hsa-let-7c-4 552 ccaaggaaagctagaaggttg 21 58.14 78 hsa-let-7c-5 15 atccgggttgaggtagtagg 20 58.00 hsa-let-7c-6 553 gctccaaggaaagctagaagg 21 59.62 82 hsa-let-7d-1 16 gttttagggcagggattttg 20 58.56 hsa-let-7d-2 554 agaaaggcagcaggtegtat 20 58.96 57 hsa-let-7d-3 17 gttttagggcagggattttg 20 58.56 hsa-let-7d-4 555 taagaaaggcagcaggtcgt 20 60.01 59 hsa-let-7d-5 18 gttttagggcagggattttg 20 58.56 hsa-let-7d-6 556 aagaaaggcagcaggtcgta 20 60.01 58 hsa-let-7e-1 19 gggctgaggtaggaggttgt 20 60.51 hsa-let-7e-2 557 ggaaagctaggaggccgtat 20 59.71 71 hsa-let-7e-3 20 gggctgaggtaggaggttg 19 59.66 hsa-let-7e-4 558 ggaaagctaggaggccgtat 20 59.71 71 hsa-let-7e-5 21 ggctgaggtaggaggttgta 20 56.86 hsa-let-7e-6 559 ggaaagctaggaggccgtat 20 59.71 70 hsa-let-71-1-1 22 ttgtggggtagtgattttacc 21 56.50 hsa-let-7f-1-2 560 tcagggaaggcaatagat 18 52.97 61 hsa-let-7f-1-3 23 agttgtggggtagtgattttacc 23 58.38 hsa-let-7f-1-4 561 tcagggaaggcaatagat 18 52.97 63 hsa-let-7f-1-5 24 gttgtggggtagtgattttacc 22 57.41 hsa-let-7f-1-6 562 tcagggaaggcaatagat 18 52.97 62 hsa-let-7f-2-1 25 tgtgggatgaggtagtagattg 22 56.70 hsa-let-7f-2-2 563 tctccaagatggggtatgac 20 57.36 54 hsa-let-7f-2-3 26 tgtgggatgaggtagtagattgt 23 57.62 hsa-let-7f-2-4 564 tctccaagatggggtatgac 20 57.36 54 hsa-let-7f-2-5 27 tgtgggatgaggtagtagattgta 24 57.72 hsa-let-7f-2-6 565 tctccaagatggggtatgac 20 57.36 54 hsa-let-7i-1 28 tggctgaggtagtagtttgtgc 22 59.45 hsa-let-7i-2 566 gcgcagttatctccacag 18 55.28 66 hsa-let-7i-3 29 tggctgaggtagtagtttgtgc 22 59.45 hsa-let-7i-4 567 cacagcgggcaatgtcac 18 62.40 53 hsa-let-7i-5 30 ggctgaggtagtagtttgtgct 22 57.72 fisa-let-7i-6 568 gcgcagttatctccacag 18 55.28 65 hsa-mir-1-1-1 31 tgggaaacatacttctttatatgc 24 56.61 hsa-mir-1-1-2 569 tgagatacatacttctttacattcca 26 56.33 71 hsa-mir-1-1-3 32 tgggaaacatacttctttatatgc 24 56.61 isa-mir-1-1-4 570 catacttctttacattccatagctt 25 55.34 64 hsa-mir-1-1-5 33 tgggaaacatacttctttatatgc 24 56.61 isa-mir-1-1-6 571 acatacttctttacattccatagctt 26 56.15 65 hsa-mir-101-1-1 34 ccctggctcagttatcacagt 21 59.22 hsa-mir-101-1-2 572 tgccatccttcagttatcaca 21 59.14 73

hsa-mir-101-1-3 35 gccctggctoagttatcaca 20 61.21 hsa-mιr-101-1-4 573 tgccatccttcagttatcaca 21 59.14 74 hsa-mir-101-1-5 36 tgccclggctcagttatca 19 60.36 hsa-mir-101 -1-6 574 tgccatccttcagttatcaca 21 59.14 75 isa-mir-103-1-1 37 tactgccctcggcttcttta 20 59.97 hsa-mir-103-1 -2 575 caatgccttcatagccctgt 20 60.10 78 hsa-mir-103-1-3 38 tactgccctcggcttcttta 20 59.97 hsa-mir-103-1 -4 576 aatgccttcatagccctgta 20 57.33 77 hsa-mir-103-1-5 39 actgccGtcggcttetttac 20 60.76 hsa-mir-103-1 -6 577 caatgccttcatagccctgt 20 60.10 77 hsa-mir-103-2-1 40 tgccttgtagcattcaggtc 20 58.88 hsa-mir-103-2-2 578 tggttctttcatagccctgt 20 57.27 52 hsa-mir-103-2-3 41 gccttgtagcattcaggtca 20 58.88 hsa-mir-103-2-4 579 tggttctttcatagccctgt 20 57.27 51 hsa-mir-103-2-5 42 ctgccttglagcattcaggt 20 57.98 hsa-mir-103-2-6 580 tggttctttcatagccctgt 20 57.27 53 hsa-mir-105-1-1 43 cgtggtcaaatgctcagact 20 58.88 hsa-mir-105-1 -2 581 atgctcaaacatccgtggt 19 58.95 59 hsa-mir-105-1 -3 44 atcgtggtcaaatgctcaga 20 59.24 hsa-mir-105-1 -4 582 atgctcaaacatccgtggt 19 58.95 61 hsa-mir-105-1-5 45 tggtcaaatgctcagactcc 20 58.80 hsa-mir-105-1-6 583 atgctcaaacatccgtggt 19 58.95 57 hsa-mir-105-2-1 46 cgtggtcaaatgctcagact 20 58.88 hsa-mir-105-2-2 584 aaacatccgtggtgcataag 20 58.50 53 hsa-mir-105-2-3 47 atcgtggtcaaatgctcaga 20 59.24 hsa-mir-105-2-4 585 aaacatccgtggtgcataag 20 58.50 55 hsa-mir-105-2-5 48 tggtcaaatgctcagactcc 20 58.80 hsa-mir-105-2-6 586 aaacatccgtggtgcataag 20 58.50 51 hsa-mir-106a-1 49 tgcttacagtgcaggtagctt 21 57.88 hsa-mir-106a-2 587 agaagtgcttacattgcagtaga 23 56.12 51 isa-mir-106a-3 50 gtgcttacagtgcaggtagctt 22 58.75 hsa-mir-106a-4 588 agaagtgcttacattgcagtaga 23 56.12 52 hsa-mir-106a-5 51 tgcttacagtgcaggtagcttt 22 59.25 hsa-mir-106a-6 589 agaagtgcttacattgcagtaga 23 56.12 51 isa-mir-106b-1 52 gacagtgcagatagtggtcctc 22 58.82 hsa-mir-106b-2 590 gagcagcaagtacccacagt 20 57.96 55 hsa-mir-106b-3 53 tgacagtgcagatagtggtcct 22 59.79 hsa-mir-106b-4 591 gagcagcaagtacccacagt 20 57.96 56 hsa-mir-106b-5 54 gacagtgcagatagtggtcctc 22 58.82 hsa-mir-106b-6 592 ggagcagcaagtacccaca 19 59.85 56 hsa-mir-107-1 55 tctctgctttcagcttctttaca 23 58.60 hsa-mir-107-2 593 cttgaactccatgccacaag 20 59.29 50 hsa-mir-107-3 56 ctctctgctttcagcttcttt 21 55.89 hsa-mir-107-4 594 cttgaactccatgccacaag 20 59.29 51 hsa-mir-107-5 57 tctctgctttcagcttcttt 20 54.70 hsa-mir-107-6 595 cttgaactccatgccacaag 20 59.29 50 hsa-mir-108-1 58 tgcaagaacaataaggattt 20 52.61 hsa-mir-108-2 596 aaaatgagggactttcagg 19 54.22 77 hsa-mir-108-3 59 tgcaagaacaataaggatttt 21 54.28 hsa-mir-108-4 597 aaatgagggactttcagg 18 52.37 76 hsa-mir-108-5 60 tgcaagaacaataaggatt 19 50.75 hsa-mir-108-6 598 aaaatgagggactttcagg 19 54.22 77 risa-mir-10a-1 61 ccctgtagatccgaatttgtg 21 59.44 hsa-mir-1 Oa-2 599 agagcggagtgtttatgtcaa 21 57.50 87 hsa-mir-10a-3 62 ccctgtagatccgaatttgtg 21 59.44 hsa-mir-1 Oa-4 600 gagcggagtgtttatgtcaact 22 58.40 86 hsa-mir-1 Oa-5 63 ccctgtagatccgaatttgtg 21 59.44 hsa-mir-10a-6 601 gagcggagtgrttatgtcaa 20 56.35 86 isa-mir-10b-1 64 accctgtagaaccgaatttgt 21 57.59 hsa-mir-1 Ob-2 602 aatcgaatctgtgactatacgg 22 55.94 50 hsa-mir-1 Ob-3 65 ccctgtagaaccgaatttgtg 21 59.48 hsa-mir-1 Ob-4 603 tatattcccctagaatcgaa 20 51.66 62 isa-mir-10b-5 66 taccctgtagaaccgaatttgt 22 57.69 hsa-mir-1 Ob-6 604 aatcgaatctgtgactatacgg 22 55.94 51 hsa-mir-122a-1 67 gtgacaatggtgtttgtgtct 21 55.85 hsa-mir-122a-2 605 tttagtgtgataatggcgtttg 22 57.80 50 hsa-mir-122a-3 68 gtgacaatggtgtttgtgtctaa 23 57.58 hsa-mir-122a-4 606 tttagtgtgataatggcgtttg 22 57.80 50 isa-mir-122a-5 69 gtgacaatggtgtttgtgtct 21 55.85 hsa-mir-122a-6 607 tttagtgtgataatggcgtttga 23 59.54 50 hsa-mir-124a-1-1 70 tctctctccgtgttcacagc 20 59.13 hsa-mir-124a-1 -2 608 gcgtgccttaattgtatgga 20 58.65 57 hsa-mir-124a-1 -3 71 tctctctccgtgttcacagc 20 59.13 rιsa-mir-124a-1 -4 609 accgcgtgccttaattgtat 20 59.50 60 rιsa-mir-124a-1-5 72 tctctctccgtgttcacagc 20 59.13 hsa-mir-124a-1 -6 610 accgcgtgccttaattgta 19 59.20 60

hsa-mir-124a-2-1 73 ggctctgctctccgtgtt 18 59.08 hsa-mir-124a-2-2 611 accgcgtgccttaattgtat 20 59.50 62 hsa-mir-124a-2-3 74 aggclctgctctccgtgtt 19 60.15 hsa-mir-124a-2-4 612 accgcgtgccttaattgtat 20 59.50 63 hsa-mir-124a-2-5 75 aggctctgctctccgtgt 18 58.64 hsa-mir-124a-2-6 613 accgcgtgccttaattgtat 20 59.50 63 hsa-mir-124a-3-1 76 ccctctgcgtgttcacag 18 58.90 hsa-mir-124a-3-2 614 accgcgtgccttaattgtat 20 59.50 58 hsa-mir-124a-3-3 77 tcacagcggaccttgattta 20 59.27 hsa-mir-124a-3-4 615 gcctctcttggcattcacc 19 60.76 62 hsa-mir-124a-3-5 78 ccctctgcgtgttcacag 18 58.90 hsa-mir-124a-3-6 616 accgcgtgccttaattgta 19 59.20 58 isa-mir-125a-1 79 ccctgagaccctttaacctg 20 58.64 hsa-mir-125a-2 617 ctcccaagaacctcacctgt 20 59.15 57 hsa-mir-125a-3 80 tccctgagaccctttaacct 20 57.71 hsa-mir-125a-4 618 ctcccaagaacctcacctgt 20 59.15 58 hsa-mir-125a-5 81 cctgagaccctttaacctgtg 21 58.71 hsa-mir-125a-6 619 ctcccaagaacctcacctgt 20 59.15 56 hsa-mir-125b-1-1 82 tccctgagaccctaacttgtg 21 59.19 hsa-mir-125b-1 -2 620 gagcctaacccgtggattta 20 59.04 53 hsa-mir-125b-1-3 83 ccctgagaccctaacttgtga 21 59.19 hsa-mir-125b-1 -4 621 gagcctaacccgtggattta 20 59.04 52 hsa-mir-125b-1-5 84 ccctgagaccctaacttgtg 20 57.23 hsa-mir-125b-1 -6 622 gagcctaacccgtggattta 20 59.04 52 hsa-mir-125b-2-1 85 tccctgagaccctaacttgtg 21 59.19 hsa-mir-125b-2-2 623 gtcccaagagcctgacttgt 20 59.31 59 hsa-mir-125b-2-3 86 ccctgagaccctaacttgtg 20 57.23 hsa-mir-125b-2-4 624 gtcccaagagcctgacttgt 20 59.31 58 hsa-mir-125b-2-5 87 tccctgagaccctaacttgtg 21 59.19 hsa-mir-125b-2-6 625 ccaagagcctgacttgtgat 20 57.87 56 hsa-mir-126-1 88 ggcgacgggacattattact 20 58.93 hsa-mir-126-2 626 gacggcgcattattactcac 20 58.27 74 hsa-mir-126-3 89 ggcgacgggacattattact 20 58.93 hsa-mir-126-4 627 gtggacggcgcattattact 20 59.99 77 hsa-mir-126-5 90 ggcgacgggacattattact 20 58.93 hsa-mir-126-6 628 gtggacggcgcattattac 19 59.01 77 hsa-mir-12θb-1 91 ctgtacgagagtgagtagcaggt 23 57.85 hsa-mir-128b-2 629 gacacagtagggaaagagacc 21 55.37 57 hsa-mir-128b-3 92 tgtacgagagtgagtagcaggt 22 56.77 hsa-mir-128b-4 630 gacacagtagggaaagagacc 21 55.37 56 hsa-mir-128b-5 93 ctgtacgagagtgagtagcaggt 23 57.85 hsa-mir-128b-6 631 acacagtagggaaagagacc 20 53.24 56 hsa-mir-129-1-1 94 ggtctgggcttgctgttc 18 59.35 hsa-mir-129-1 -2 632 ttggggtaagggcttcct 18 59.48 51 hsa-mir-129-1-3 95 gtctgggcttgctgttcc 18 59.35 hsa-mir-129-1 -4 633 ttggggtaagggcttcct 18 59.48 50 hsa-mir-129-1 -5 96 gtctgggcttgctgttcct 19 60.40 hsa-mir-129-1 -6 634 ttggggtaagggcttcct 18 59.48 50 hsa-mir-129-2-1 97 cggtctgggcttgctgta 18 60.98 hsa-mir-129-2-2 635 rtttggggtaagggcttc 18 57.58 52 hsa-mir-129-2-3 98 ttttgcggtctgggcttg 18 63.28 hsa-mir-129-2-4 636 gtaagggcttccggctatt 19 58.29 50 hsa-mir-129-2-5 99 ttttgcggtctgggcttg 18 63.28 hsa-mir-129-2-6 637 gtaagggcttccggctattg 20 60.94 50 hsa-mir-130a-1 100 tgctactgtctgcacctgtc 20 57.53 hsa-mir-130a-2 638 gccaatgcccttttaacatt 20 58.95 51 hsa-mir-130a-3 101 gctactgtctgcacctgtcac 21 58.53 hsa-mir-130a-4 639 gccaatgcccttttaacatt 20 58.95 50 hsa-mir-130a-5 102 gctactgtctgcacctgtca 20 57.53 hsa-mir-130a-6 640 gccaatgcccttttaacatt 20 58.95 50 hsa-mir-130b-1 103 cactctttccctgttgcact 20 57.93 hsa-mir-130b-2 641 gatgccctttcatcattgc 19 59.02 62 hsa-mir-130b-3 104 acactctttccctgttgcact 21 58.86 hsa-mir-130b-4 642 gatgccctttcatcattgc 19 59.02 63 hsa-mir-130b-5 105 acactctttccctgttgcac 20 57.77 hsa-mir-130b-6 643 galgccctttcatcattgc 19 59.02 63 hsa-mir-133a-1-1 106 gagctggtaaaatggaaccaa 21 59.08 hsa-mir-133a-1 -2 644 ggttgaaggggaccaaatc 19 59.18 55 hsa-mir-133a-1 -3 107 gagctggtaaaatggaaccaa 21 59.08 hsa-mir-133a-1 -4 645 gttgaaggggaccaaatcc 19 59.18 54 hsa-mir-133a-1 -5 108 agctggtaaaatggaaccaaa 21 58.62 hsa-mir-133a-1 -6 646 ggttgaaggggaccaaatc 19 59.18 54 hsa-mir-133a-2-1 109 aaaatggaaccaaatcgactg 21 58.94 hsa-mir-133a-2-2 647 ccatcaatgcacagctacag 20 57.87 69 hsa-mir-133a-2-3 110 gctggtaaaatggaaccaaa 20 57.61 hsa-mir-133a-2-4 648 ccatcaatgcacagctacag 20 57.87 75

hsa-mir-133a-2-5 111 tggtaaaatggaaccaaatcg 21 59.69 hsa-mir-133a-2-6 649 ccatcaatgcacagctacag 20 57.87 73 hsa-mir-133b-1 112 ctgctctggctggtcaaac 19 59.56 hsa-mir-133b-2 650 ctgctgtagctggttgaagg 20 58.67 73 hsa-mir-133b-3 113 ctggtcaaacggaaccaagt 20 60.01 hsa-mir-133b-4 651 ctccaaggactgggcatt 18 58.59 89 hsa-mir-133b-5 114 tggtcaaacggaaccaagt 19 58.97 hsa-mir-133b-6 652 ctccaaggactgggcatt 18 58.59 88 hsa-mir-134-1 115 agggtgtgtgactggltgac 20 58.40 hsa-mir-134-2 653 gagggttggtgactaggtg 19 55.39 72 hsa-mir-134-3 116 cagggtgtgtgactggttg 19 58.46 hsa-mir-134-4 654 gagggttggtgactaggtg 19 55.39 73 hsa-mir-134-5 117 cagggtgtgtgactggttga 20 60.63 hsa-mir-134-6 655 gagggttggtgactaggtg 19 55.39 73 tisa-mir-135a-1-1 118 tcgctgttctctatggctttt 21 59.12 hsa-mir-135a-1 -2 656 cggctccaatccctatatga 20 59.88 67 hsa-mir-135a-1-3 119 ctcgctgttctclatggcttt 21 58.76 hsa-mir-135a-1 -4 657 cggctccaatccctatatga 20 59.88 68 hsa-mir-135a-1-5 120 ggcctcgctgttctctatg 19 58.56 hsa-mir-135a-1 -6 658 eg gctccaatccctatatga 20 59.88 71 hsa-mir-135a-2-1 ^" 121 actctagtgctttatggctttt 22 54.43 hsa-mir-135a-2-2 659 gcttccatccctacatgaga 20 57.68 66 hsa-mir-135a-2-3 122 ctctagtgctttatggctttt 21 53.45 hsa-mir-135a-2-4 660 gcttccatccctacatgaga 20 57.68 65 hsa-mir-135a-2-5 123 actctagtgctttatggctttt 22 54.43 hsa-mir-135a-2-6 661 gcttccatccctacatgagac 21 58.61 66 hsa-mir-135b-1 124 gtggcctatggcttttcatt 20 59.05 hsa-mir-135b-2 662 ccctacatgagtttgggaca 20 58.41 53 hsa-mir-135b-3 125 gtggcctatggcttttcatt 20 59.05 hsa-mir-135b-4 663 agctcgcccctcactgta 18 59.53 86 hsa-mir-135b-5 126 gtggcctatggcttttcatt 20 59.05 hsa-mir-135b-6 664 agctcgcccctcactgtag 19 60.56 86 hsa-mir-136-1 127 ctccatttgttttgatgatgg 21 57.93 hsa-mir-136-2 665 agaaccctctgaagactcatttg 23 58.91 ^• 67 hsa-mir-136-3 128 ctccatttgttttgatgatgg 21 57.93 hsa-mir-136-4 666 gaaccctctgaagactcatttg 22 57.91 66 hsa-mir-136-5 129 actccatttgttttgatgatgg 22 58.81 hsa-mir-136-6 667 agaaccctctgaagactcatttg 23 58.91 68 hsa-mir-137-1 130 tctgactctcttcggtgacg 20 59.12 hsa-mir-137-2 668 cgctggtactctcctcgact 20 59.62 94 hsa-mir-137-3 131 ctctcttcggtgacgggtat 20 59.16 hsa-mir-137-4 669 cgctggtactctcctcgact 20 59.62 89 hsa-mir-137-5 132 crtcggtgacgggtattcH 20 59.05 hsa-mir-137-6 670 cgctggtactctcctcgact 20 59.62 85 hsa-mir-138-1-1 133 tgccaatcagagaacggcta 20 61.85 hsa-mir-138-1 -2 671 gtagtgtggtgtggccctggt 21 64.46 50 hsa-mir-138-1 -3 134 tgccaatcagagaacggctac 21 62.59 hsa-mir-138-1 -4 672 gtagtgtggtgtggccctggt 21 64.46 50 hsa-mir-138-1 -5 135 tgccaatcagagaacggctact 22 63.38 hsa-mir-138-1 -6 673 gtagtgtggtgtggccctggt 21 64.46 50 hsa-mir-138-2-1 136 gaatcaggccgacgagca 18 63.55 hsa-mir-138-2-2 674 aaccctggtgtcgtgaaatag 21 58.97 57 hsa-mir-138-2-3 137 gaatcaggccgacgagca 18 63.55 hsa-mir-138-2-4 675 aaccctggtgtcgtgaaata 20 57.92 57 hsa-mir-138-2-5 138 gaatcaggccgacgagca 18 63.55 hsa-mir-138-2-6 676 accctggtgtcgtgaaatag 20 57.51 56 hsa-mir-140-1 139 tgtgtctctctctgtgtcctg 21 56.40 hsa-mir-140-2 677 ggtatcctgtccgtggttct 20 58.87 92 hsa-mir-140-3 140 tgtgtctctctctgtgtcctg 21 56.40 hsa-mir-140-4 678 atcctgtccgtggttctacc 20 58.87 89 hsa-mir-140-5 141 tgtgtctctctctgtgtcctg 21 56.40 hsa-mir-140-6 679 ggtatcctgtccgtggttcta 21 58.92 92 hsa-mir-141-1 142 tgggtccatcttccagtaca 20 58.93 hsa-mir-141 -2 680 gagccatctttaccagacagtg 22 58.87 73 hsa-mir-141 -3 143 gggtccatcttccagtacagt 21 57.97 hsa-mir-141 -4 681 gggagccatctttaccagac 20 58.60 74 hsa-mir-141 -5 144 cctgggtccatcttccagta 20 59.92 hsa-mir-141 -6 682 gagccatctttaccagacagtg 22 58.87 75 hsa-mir-142-1 145 gacagtgcagtcacccataaa 21 58.64 hsa-mir-142-2 683 ctacaccctccagtgctgtt 20 57.80 56 hsa-mir-142-3 146 gacagtgcagtcacccataaa 21 58.64 hsa-mir-142-4 684 acaccctccagtgctgttag 20 57.80 54 isa-mir-142-5 147 gacagtgcagtcacccataaa 21 58.64 hsa-mir-142-6 685 caccctccagtgctgttagt 20 57.80 53 hsa-mir-143-1 148 gctgcatctctggtcagtt 19 56.38 isa-mir-143-2 686 gaacaacttctctcttcctgagc 23 58.80 66

hsa-mιr-143-3 149 gctgcatctctggtcagtt 19 56.38 hsa-mir-143-4 687 aacaacttctctcttcctgagc 22 hsa-mir-143-5 150 ctgcatctctggtcagttgg 20 59.42 hsa-mir-143-6 688 aacttctctcttcctgagctac 22 hsa-mir-145-1 151 gtcctcacggtccagttttc 20 59.56 hsa-mir-145-2 689 tgacctcaagaacagtatttcca 23 hsa-mir-145-3 152 gtcctcacggtccagttttc 20 59.56 hsa-mir-145-4 690 ccatgacctcaagaacagtatttc 24 hsa-mir-145-5 153 gtcctcacggtccagttttc 20 59.56 hsa-mir-145-6 691 catgacctcaagaacagtatttcc 24 hsa-mir-147-1 154 acatttctgcacacacacca 20 58.54 hsa-mir-147-2 692 gaagcatttccacacactgg 20 hsa-mir-147-3 155 gacaacatttctgcacacaca 21 58.16 hsa-mir-147-4 693 gaagcatttccacacactgg 20 hsa-mir-147-5 156 gacaacatttctgcacacaca 21 58.16 hsa-mir-147-6 694 catttccacacactggcttc 20 hsa-mir-148b-1 157 agcacgattagcatttgagg 20 58.00 hsa-mir-148b-2 695 agctttcgagacaaagttctg 21 hsa-mir-148b-3 158 agcacgattagcatttgaggt 21 58.87 hsa-mir-148b-4 696 agctttcgagacaaagttctg 21 hsa-mir-148b-5 159 gcacgattagcatttgaggt 20 57.85 hsa-mir-148b-6 697 agctttcgagacaaagttctg 21 hsa-mir-149-1 160 ctggctccgtgtcttcact 19 58.98 hsa-mir-149-2 698 gtccctccctccctcctc 18 hsa-mir-149-3 161 ctctggctccgtgtcttcac 20 61.01 hsa-mir-149-4 699 gtccctccctccctcctc 18 hsa-mir-149-5 162 tctggctccgtgtcttcac 19 59.97 hsa-mir-149-6 700 gtccctccctccctcctc 18 hsa-mir-151-1 163 cagtctagtatgtctcatccccta 24 56.62 hsa-mir-151 -2 701 tatgaccatccctgtcctca 20 hsa-mir-151 -3 164 cagtctagtatgtctcatcccctac 25 57.48 hsa-mir-151 -4 702 tatgaccatccctgtcctca 20 hsa-mir-151 -5 165 cagtctagtatgtctcatcccctact 26 58.41 hsa-mir-151 -6 ^• 703 tatgaccatccctgtcctca 20 hsa-mir-152-1 166 gcccaggttctgtgatacact 21 59.08 hsa-mir-152-2 704 gcccaagttctgtcatgc 18 hsa-mir-152-3 167 gcccaggttctgtgatacact 21 59.08 hsa-mir-152-4 705 ggcccaagttctgtcatgc 19 hsa-mir-152-5 168 ggcccaggttctgtgatac 19 57.92 hsa-mir-152-6 706 gcccaagttctgtcatgc 18 hsa-mir-153-1-1 169 gcagctagtattctcactccagtt 24 58.33 hsa-mir-153-1 -2 707 gccacacctgccaatgat 18 hsa-mir-153-1 -3 170 agctagtattctcactccagttgc 24 58.33 hsa-mir-153-1 -4 708 gccacacctgccaatgat 18 hsa-mir-153-1 -5 171 gctagtattctcactccagttgc 23 57.36 hsa-mir-153-1 -6 709 gccacacctgccaatgat 18 hsa-mir-154-1 172 aggttatccgtgttgccttc 20 59.06 hsa-mir-154-2 710 ggtcaaccgtgtatgattcg 20 hsa-mir-154-3 173 taggttatccgtgttgccttc 21 59.10 hsa-mir-154-4 711 ggtcaaccgtgtatgattcg 20 hsa-mir-154-5 174 aggttatccgtgttgccttc 20 59.06 hsa-mir-154-6 712 caaccgtgtatgattcgtca 20 hsa-mir-155-1 175 ctgttaatgctaatcgtgataggg ^• 24 59.13 hsa-mir-155-2 713 tgtaggagtcagttggaggcaaa 23 hsa-mir-155-3 176 tgttaatgctaatcgtgataggg 23 58.24 hsa-mir-155-4 714 aatatgtaggagtcagttggag 22 hsa-mir-155-5 177 tgttaatgctaatcgtgataggg 23 58.24 hsa-mir-155-6 715 atgtaggagtcagttggaggcaaa 24 hsa-mir-15a-1 178 ccttggagtaaagtagcagca 21 57.35 hsa-mir-15a-2 716 ttttgaggcagcacaatatg 20 hsa-mir-15a-3 179 ccttggagtaaagtagcagcac 22 58.22 hsa-mir-15a-4 717 ttttgaggcagcacaatatg 20 hsa-mir-15a-5 180 ccttggagtaaagtagcagca 21 57.35 hsa-mir-15a-6 718 cacaatatggcctgcacct 19 hsa-mir-16-1-1 181 gtgccttagcagcacgtaaa 20 59.14 hsa-mir-16-1 -2 719 caaccttacttcagcagcaca 21 hsa-mir-16-1 -3 182 agtgccttagcagcacgtaa 20 58.75 hsa-mir-16-1 -4 720 caaccttacttcagcagcaca 21 hsa-mir-16-1 -5 183 tgccttagcagcacgtaaat 20 58.61 hsa-mir-16-1 -6 721 caaccttacttcagcagcaca 21 hsa-mir-16-2-1 184 ttccactctagcagcacgtaa 21 58.74 hsa-mir-16-2-2 722 gtcacactaaagcagcacagt 21 hsa-mir-16-2-3 185 tccactctagcagcacgtaaa 21 58.74 hsa-mir-16-2-4 723 gtcacactaaagcagcacagt 21 hsa-mir-16-2-5 186 ttccactctagcagcacgtaa 21 58.74 hsa-mir-16-2-6 724 gtcacactaaagcagcacag 20

hsa-mir-17-1 187 tcagaataatgtcaaagtgctiaca 25 58.09 hsa-mir-17-2 725 gctacaagtgccttcactgc 20 58.68 72 hsa-mir-17-3 188 tcagaataatgtcaaagtgcttacag 26 58.99 hsa-mir-17-4 726 gctacaagtgccttcactgc 20 58.68 72 hsa-mir-17-5 189 gtcagaataatgtcaaagtgcttaca 26 58.87 hsa-mir-17-6 727 gctacaagtgccttcactgc 20 58.68 73 hsa-mir-18-1 190 tgcagatagtgaagtagattagcatc 26 58.29 hsa-mir-18-2 728 tgccagaaggagcacttagg 20 60.53 52 hsa-mir-18-3 191 tgcagatagtgaagtagatlagca 24 56.21 hsa-mir-18-4 729 tgccagaaggagcacttagg 20 60.53 52 hsa-mir-18-5 192 gtgcagatagtgaagtagattagca 25 57.07 hsa-mir-18-6 730 tgccagaaggagcacttagg 20 60.53 53 isa-mir-181 a-1 193 caaggaacattcaacgctgt 20 58.78 hsa-mir-181 a-2 731 aggaccccaaggtacagtca 20 59.42 75 hsa-mir-181 a-3 194 caaggaacattcaacgctgt 20 ^' 58.78 hsa-mir-181 a-A 732 ggaccccaaggtacagtcaa 20 59.82 74 hsa-mir-181 a-5 195 caaggaacattcaacgctgt 20 58.78 hsa-mir-181 a-6 733 aaggaccccaaggtacagtc 20 57.95 76 hsa-mir-181 b-1-1 196 attgctgtcggtgggttg 18 60.53 hsa-mir-181 b-1 -2 734 ccacagttgcattcattgttc 21 59.04 60 hsa-mir-181 b-1 -3 197 attgctgtcggtgggttg 18 60.53 hsa-mir-181 b-1 -4 735 cacagttgcattcattgttca 21 58.17 59 hsa-mir-181 b-1 -5 198 attgctgtcggtgggttg 18 60,53 hsa-mir-181 b-1 -6 736 ccacagttgcattcattgtt 20 57.02 60 hsa-mir-181 b-2-1 199 ggctgcactcaacattcatt 20 58.73 hsa-mir-181 b-2-2 737 gtccgcagtttgcattcat 19 59.67 78 hsa-mir-181 b-2-3 200 gatggctgcactcaacattc 20 59.25 hsa-mir-181 b-2-4 738 tgtttggtccgcagtttg 18 59.22 87 hsa-mir-181 b-2-5 201 ggctgcactcaacattcatt 20 58.73 hsa-mir-181 b-2-6 739 tgtttggtccgcagtttg 18 59.22 84 hsa-mir-181 c-1 202 gggaacattcaacctgtcg 19 58.92 hsa-mir-181 c-2 740 ctcagggtccactcaacg 18 57.62 69 hsa-mir-181 c-3 203 gggaacattcaacctgtcg 19 58.92 hsa-mir-181 c-4 741 gtcgatggtttgcctgag 18 57.65 51 hsa-mir-181 c-5 204 ggggaacattcaacctgtc 19 57.73 hsa-mir-181 c-6 742 ctcagggtccactcaacg 18 57.62 70 hsa-mir-182-1 205 tggcaatggtagaactcaca 20 57.67 hsa-mir-182-2 743 agtcctcgccccatagttg 19 60.08 76 hsa-mir-182-3 206 tggcaatggtagaactcaca 20 57.67 hsa-mir-182-4 744 gtcctcgccccatagttg 18 59.04 75 hsa-mir-182-5 207 tggcaatggtagaactcacac 21 58.64 hsa-mir-182-6 745 agtcctcgccccatagttg 19 60.08 76 hsa-mir-183-1 208 tgttctgtgtatggcactgg 20 58.11 hsa-mir-183-2 746 tcgtggatctgtctctgctc 20 59.08 93 hsa-mir-183-3 209 tgttctgtgtatggcactggt 21 59.08 hsa-mir-183-4 747 tcgtggatctgtctctgctc 20 59.08 93 hsa-mir-183-5 210 cctgttctgtgtatggcactg 21 59.22 hsa-mir-183-6 748 tcgtggatctgtctctgctc 20 59.08 95 hsaτmir- 184-1 211 cgtccccttatcacttttcc 20 58.50 hsa-mir-184-2 749 tcagttctccgtccaacact 20 58.28 60 hsa-mir-184-3 212 cagtcacgtccccttatcac 20 58.00 hsa-mir-184-4 750 tcagttctccgtccaacact 20 58.28 66 hsa-mir-184-5 213 cgtccccttatcacttttcc 20 58.50 hsa-mir-184-6 751 ccttatcagttctccgtccaa 21 59.18 65 hsa-mir-185-1 214 ttggagagaaaggcagttcc 20 59.40 hsa-mir-185-2 752 agggaaggaccagaggaaag 20 59.67 65 hsa-mir-185-3 215 ggattggagagaaaggcagt 20 58.32 hsa-mir-185-4 753 agggaaggaccagaggaaag 20 59.67 68 hsa-mir-185-5 216 ggattggagagaaaggcagt 20 58.32 hsa-mir-185-6 754 gagggaaggaccagaggaa 19 59.17 69 hsa-mir-186-1 217 aattctccttttgggctttc 20 57.41 hsa-mir-186-2 755 aaattcacctttgggcttaaaa 22 59.07 50 hsa-mir-186-3 218 aattctccttttgggctttct 21 58.40 hsa-mir-186-4 756 aaattcacctttgggcttaaaa 22 59.07 50 hsa-mir-186-5 219 aattctccttttgggctttc 20 57.41 hsa-mir-186-6 757 aaaattcacctttgggctta 20 56.42 51 hsa-mir-187-1 220 gggctcaccatgacacagt 19 59.52 hsa-mir-187-2 758 gctgcaacacaagacacga 19 59.58 85 hsa-mir-187-3 221 gggctcaccatgacacagt 19 59.52 hsa-mir-187-4 759 gctgcaacacaagacacgag 20 60.66 85 hsa-mir-187-5 222 gtgagacctcgggctacaac 20 59.73 hsa-mir-187-6 760 gctgcaacacaagacacga 19 59.58 66 hsa-mir-188-1 223 tgctccclctctcacatcc 19 58.85 hsa-mir-188-2 761 atcctgcaaaccctgcat 18 59.04 78 hsa-mir-188-3 224 tccctctctcacatcccttg 20 60.19 hsa-mir-188-4 762 atcctgcaaaccctgcat 18 59.04 75

hsa-mir-188-5 225 cctctctcacatcccttgc 19 58.31 hsa-mir-188-6 763 atcctgcaaaccctgcat 18 hsa-mir-191-1 226 tgHgtctccagagcattcc 20 58.80 hsa-mir-191 -2 764 gagagcaggggacgaaatc 19 hsa-mir-191-3 227 gctgttgtctcc^'agagcatt 20 58.03 hsa-mir-191 -4 765 gagagcaggggacgaaatc 19 hsa-mir-191-5 228 agctgttgtctccagagcatt 21 59.10 hsa-mir-191 -6 766 gagagcaggggacgaaatc 19 hsa-mir-192-1 229 atgaattgacagccagtgct 20 58.32 hsa-mir-192-2 767 cattgaggcgaacatacctg 20 isa-mir-192-3 230 tgaattgacagccagtgctc 20 59.99 hsa-mir-192-4 768 cattgaggcgaacatacctg 20 isa-mir-192-5 231 agggctctgacctatgaattg 21 58.28 hsa-mir-192-6 769 cattgaggcgaacatacctg 20 hsa-mir-193-1 232 ctgagggctgggtctttg 18 59.33 hsa-mir-193-2 770 ctgggactttgtaggccagt 20 hsa-mir-193-3 233 ctgagggctgggtctltg 18 59.33 hsa-mir-193-4 771 tgggactttgtaggccagtt 20 hsa-mir-193-5 234 ctgagggctgggtctttg 18 59.33 hsa-mir-193-6 772 gggactttgtaggccagttg 20 hsa-mir-194-1-1 235 gtaacagcaactccatgtg 19 52.21 hsa-mir-194-1 -2 773 caaaagtaacagcatctccactg 23 hsa-mir-194-1-3 236 gtaacagcaactccatgtg 19 52.21 hsa-mir-194-1 -4 774 catcaaaagtaacagcatctcca 23 hsa-mir-194-1 -5 237 gtaacagcaactccatgtg 19 52.21 hsa-mir-194-1 -6 775 ccatcaaaagtaacagcatctcc 23 hsa-mir-194-2-1 238 gtaacagcaactccatgtg 19 52.21 hsa-mir-194-2-2 776 cagataacagcagccccact 20 hsa-mir-194-2-3 239 gtaacagcaactccatgtg 19 52.21 hsa-mir-194-2-4 in agataacagcagccccactg 20 hsa-mir-194-2-5 240 gtaacagcaactccatgtg 19 52.21 hsa-mir-194-2-6 778 gataacagcagccccactg 19 hsa-mir-195-1 241 agcttccctggctctagca 19 60.25 hsa-mir-195-2 779 atattggcagactcgcttcc 20 hsa-mir-195-3 242 gcttccctggctctagca 18 59.22 hsa-mir-195-4 780 atattggcagactcgcttcc 20 hsa-mir-195-5 243 agcttccctggctctagca 19 60.25 hsa-mir-195-6 781 tattggcagactcgcttcc 19 hsa-mir-196a-1-1 244 gttgttgggcctgggttt 18 60.76 hsa-mir-196a-1 -2 782 gtgaatcgggtggtttaatg 20 hsa-mir-196a-1 -3 245 gttgttgggcctgggttt 18 60.76 hsa-mir-196a-1 -4 783 tgaatcgggtggtttaatgtt 21 hsa-mir-196a-1 -5 246 gttgttgggcctgggttt 18 60.76 hsa-mir-196a-1 -6 784 tgaatcgggtggtttaatgt 20 hsa-mir-196a-2-1 247 agctgatctgtggcttaggt 20 56.60 hsa-mir-196a-2-2 ^• 785 ctcaggcagtttcttgttgc 20 hsa-mir-196a-2-3 248 agctgatctgtggcttaggt 20 56.60 hsa-mir-196a-2-4 786 gtttcttgttgccg agttca 20 hsa-mir-196a-2-5 249 tttcatgttgttgggattgag 21 58.46 hsa-mir-196a-2-6 787 ctcaggcagtttcttgttgc 20 hsa-mir-196b-1 250 ctggtcggtgatttaggtagtU 23 58.64 hsa-mir-196b-2 788 atgaaggcagtgtcgtgct 19 hsa-mir-196b-3 251 tggtcggtgatttaggtagttt 22 57.69 hsa-mir-196b-4 789 atgaaggcagtgtcgtgct 19 hsa-mir-196b-5 252 cggtgatttaggtagtttcctg 22 57.83 hsa-mir-196b-6 790 atgaaggcagtgtcgtgct 19 hsa-mir-197-1 253 cgggtagagagggcagtg 18 59.36 hsa-mir-197-2 791 agaaggtggtgaagggtgaa 20 hsa-mir-197-3 254 cgggtagagagggcagtg 18 59.36 hsa-mir-197-4 792 gaaggtggtgaagggtgaag 20 hsa-mir-197-5 255 cgggtagagagggcagtg 18 59.36 hsa-mir-197-6 793 aaggtggtgaagggtgaaga 20 hsa-mir-199a-1-1 256 cccagtgttcagactacctgtt 22 58.24 hsa-mir-199a-1 -2 794 gcctaaccaatgtgcagacta 21 hsa-mir-199a-1 -3 257 cccagtgttcagactacctgtt 22 58.24 hsa-mir-199a-1 -4 795 gcctaaccaatgtgcagactac 22 isa-mir-199a-1 -5 258 acccagtgttcagactacctgtt 23 59.10 hsa-mir-199a-1 -6 796 gcctaaccaatgtgcagacta 21 hsa-mir-199a-2-1 259 agcttctggagatcctgctc 20 58.72 hsa-mir-199a-2-2 797 ccttgcccagtctaaccaat 20 hsa-mir-199a-2-3 260 agcttctggagatcctgctc 20 58.72 hsa-mir-199a-2-4 798 tgcccagtctaaccaatgtg 20 hsa-mir-199a-2-5 261 agcttctggagatcctgctc 20 58.72 hsa-mir-199a-2-6 799 cttgcccagtctaaccaatg 20 hsa-mir-199b-1 262 acacctccactccgtctacc 20 59.03 hsa-mir-199b-2 800 agcctaaccaatgtgcagac 20

hsa-mιϊ-199b-3 263 acacctccactccgtctacc 20 59.03 hsa-mir-199b-4 801 agcccagcctaaccaatgt 19 59.56 88 hsa-mir-199b-5 264 acacctccactccgtctacc 20 59.03 hsa-mir-199b-6 802 ctaacccagcccagcctaac 20 61.00 95 hsa-mir-19a-1 265 gcagtcctctgttagttttgc 21 56.77 hsarmir-19a-2 803 ccaccatcagttttgcataga 21 58.64 77 hsa-mir-19a-3 266 gcagtcctctgttagttttgc 21 56.77 hsa-mir-19a-4 804 gccaccatcagttttgcat 19 59.52 78 hsa-mir-19a-5 267 gcagtcctctgttagttttgc 21 56.77 hsa-mir-19a-6 805 caggccaccatcagttttg 19 60.10 81 hsa-mir-19b-1-1 268 agttttgcaggtttgcatcc 20 60.12 hsa-mir-19b-1 -2 806 agttttgcatggatttgcac 20 58.63 59 isa-mir-19b-1-3 269 gttttgcaggtttgcatcc 19 59.12 hsa-mir-19b-1 -4 807 agttttgcatggatttgcac 20 58.63 58 hsa-mir-19b-1 -5 270 agttttgcaggtttgcatcc 20 60.12 hsa-mir-19b-1 -6 808 tcagttttgcatggatttgc 20 59.67 61 hsa-mir-19b-2-1 271 gttttgcaggtttgcatttc 20 58.27 hsa-mir-19b-2-2 809 agttttgcatggatttgcac 20 58.63 63 hsa-mir-19b-2-3 272 gttttgcaggtttgcatttc 20 58.27 hsa-mir-19b-2-4 810 tcacaatcagttttgcatgg 20 58.10 71 hsa-mir-19b-2-5 273 gttttgcaggtttgcatttc 20 58.27 hsa-mir-19b-2-6 811 tcagttttgcatggatttgc 20 59.67 65 hsa-mir-200a-1 274 tgagcatcttaccggacagt 20 58.31 hsa-mir-200a-2 812 cacctttgaacatcgttacca 21 58.54 73 hsa-mir-200a-3 275 tgtgagcatcttaccggaca 20 60.26 hsa-mir-200a-4 813 cacctttgaacatcgttacca 21 58.54 75 hsa-mir-200a-5 276 gtgagcatcttaccggacagt 21 59.23 hsa-mir-200a-6 814 cacctttgaacatcgttacca 21 58.54 74 hsa-mir-200b-1 277 catcttactgggcagcattg 20 59.30 hsa-mir-200b-2 815 gctccgccgtcatcatta 18 60.75 67 hsa-mir-200b-3 278 ccatcttactgggcagcatt 20 60.10 hsa-mir-200b-4 816 gctccgccgtcatcatta 18 60.75 68 hsa-mir-200b-5 279 atcttactgggcagcattgg 20 60.10 hsa-mir-200b-6 817 gctccgccgtcatcatta 18 60.75 66 hsa-mir-200c-1 280 tcgtcttacccagcagtgtt 20 58.37 hsa-mir-200c-2 818 ccatcattacccggcagtat 20 59.67 62 hsa-mir-200c-3 281 cgtcttacccagcagtgttt 20 57.88 hsa-mir-200c-4 819 ccatcattacccggcagtat 20 59.67 61 hsa-mir-200c-5 282 tcgtcttacccagcagtgtt 20 58.37 hsa-mir-200c-6 820 ccatcattacccggcagta 19 59.36 62 hsa-mir-204-1 283 actcgtggacttccctttgt 20 58.64 hsa-mir-204-2 821 cttcccagcctccttcata 19 57.82 58 hsa-mir-204-3 284 actcgtggacttccctttgt 20 58.64 hsa-mir-204-4 822 aacgtccctttgccttcc 18 60.05 71 hsa-mir-204-5 285 actcgtggacttccctttgt 20 58.64 hsa-mir-204-6 823 ccttcccagcctccttcata 20 61.47 59 hsa-mir-205-1 286 cctcagacaatccatgtgct 20 58.67 hsa-mir-205-2 824 ctccactgaaatctggttgg 20 58.13 77 hsa-mir-205-3 287 cctcagacaatccatgtgct 20 58.67 hsa-mir-205-4 825 actccactgaaatctggttgg 21 59.05 78 hsa-mir-205-5 288 tcctcagacaatccatgtgc 20 59.64 hsa-mir-205-6 826 ctccactgaaatctggttgg 20 58.13 78 hsa-mir-206-1 289 gaggccacatgcttctttat 20 56.90 hsa-mir-206-2 827 ccgaaaccacacacttcctt 20 60.01 72 hsa-mir-206-3 290 cgaggccacatgcttcttta 20 61.29 hsa-mir-206-4 828 ccgaaaccacacacttcctt 20 60.01 73 hsa-mir-206-5 291 gaggccacatgcttctttat 20 56.90 hsa-mir-206-6 829 acttgccgaaaccacacac 19 59.59 77 isa-mir-21-1 292 tcgggtagcttatcagac 18 50.95 hsa-mir-21 -2 830 ctggtgttgccatgagattc 20 59.09 52 hsa-mir-21 -3 293 tcgggtagcttatcagac 18 50.95 hsa-mir-21 -4 831 gactggtgttgccatgagat 20 58.51 54 hsa-mir-21-5 294 tcgggtagcttatcagac 18 50.95 hsa-mir-21 -6 832 ggtgttgccatgagattcaa 20 59.50 50 isa-mir-211-1 295 gcttccctttgtcatccttc 20 58.72 hsa-mir-211 -2 833 acaactgagcacccctttg 19 58.71 68 hsa-mir-211-3 296 gacttgtgggcttcccttt 19 59.13 hsa-mir-211 -4 834 acaactgagcacccctttg 19 58.71 77 isa-mir-211-5 297 cttccctttgtcatccttcg 20 59.67 hsa-mir-211-6 835 acaactgagcacccctttg 19 58.71 67 hsa-mir-213-1 298 tgagttttgaggttgcttcag 21 58.15 hsa-mir-213-2 836 acggtcgatggttttgattt 20 59.29 75 hsa-mir-213-3 299 tgagttttgaggttgcttca 20 57.02 hsa-mir-213-4 837 acggtcgatggttttgattt 20 59.29 75 hsa-mir-213-5 300 tgagttttgaggttgcttcagt 22 59.03 hsa-mir-213-6 838 acggtcgatggttttgattt 20 59.29 75

hsa-mir-214-1 301 cctggctggacagagttgt 19 58.82 hsa-mir-214-2 839 tacaggtgagcggatgttct 20 58.31 69 hsa-mir-214-3 302 cctggctggacagagttgt 19 58.82 hsa-mir-214-4 840 gtacaggtgagcggatgttc 20 58.16 70 hsa-mir-214-5 303 ttgtcatgtgtctgcctgtc 20 58.17 hsa-mir-214-6 841 cctgtctgtgcctgctgta 19 58.52 71 hsa-mir-215-1 304 caggaaaatgacctatgaattgac 24 58.93 hsa-mir-215-2 842 ttggcctaaagaaatgacaga 21 57.50 65 hsa-mir-215-3 305 caggaaaatgacctatgaattgac 24 58.93 hsa-mir-215-4 843 ttggcctaaagaaatgacagac 22 58.38 65 ηsa-mir-215-5 306 caggaaaatgacctatgaattgac 24 58.93 hsa-mir-215-6 844 ggcctaaagaaatgacagacaa 22 58.38 63 hsa-mir-216-1 307 gctggcaactgtgagatgti 20 58.88 hsa-mir-216-2 845 tcgtgagggctaggaaattg 20 60.21 84 hsa-mir-216-3 308 tggcaactgtgagatgttca 20 58.78 hsa-mir-216-4 846 tcgtgagggctaggaaattg 20 60.21 82 hsa-mir-216-5 309 gctggcaactgtgagatgtt 20 58.88 hsa-mir-216-6 847 cgtgagggctaggaaattg 19 58.31 83 hsa-mir-217-1 310 gattggataagaatcagtcacca 23 58.06 hsa-mir-217-2 848 ttgtttagatgctgaaggcaat 22 58.90 59 hsa-mir-217-3 311 gattggataagaatcagtcacca 23 58.06 hsa-mir-217-4 849 tgtttagatgctgaaggcaat 21 57.53 58 hsa-mir-217-5 312 gattggataagaatcagtcacca 23 58.06 hsa-mir-217-6 850 tttagatgctgaaggcaatg 20 56.58 56 hsa-mir-218-1-1 313 agcgagattttctgrtgtgc 20 58.10 hsa-mir-218-1 -2 851 gtgcttgacggaaccatgt 19 59.54 74 hsa-mir-218-1-3 314 gcgagattttctgttgtgct 20 58.10 hsa-mir-218-1 -4 852 gtgcttgacggaaccatgt 19 59.54 73 hsa-mir-218-1 -5 315 agcgagattttctgttgtgct 21 59.14 hsa-mir-218-1 -6 853 gtgcttgacggaaccatgt 19 59.54 74 hsa-mir-218-2-1 316 ggctttcctttgtgcttgat 20 59.32 hsa-mir-218-2-2 854 aaccatgttccgtttccatc 20 59.65 58 hsa-mir-218-2-3 317 ggctttcctttgtgcttgat 20 59.32 hsa-mir-218-2-4 855 atgltccgtttccatcgttc 20 59.80 54 hsa-mir-218-2-5 318 ggctttcctttgtgcttga 19 58.99 hsa-mir-218-2-6 856 aaccatgtlccgtttccatc 20 59.65 58 hsa-mir-219-1-1 319 tgattgtccaaacgcaattc 20 59.52 hsa-mir-219-1 -2 857 acgtccagactcaactctc 19 52.37 59 hsa-mir-219-1 -3 320 gctcctgattgtccaaacg 19 59.23 hsa-mir-219-1 -4 858 acgtccagactcaactctc 19 52.37 64 hsa-mir-219-1 -5 321 gattgtccaaacgcaattct 20 57.67 hsa-mir-219-1 -6 859 acgtccagactcaactctc 19 52.37 58 hsa-mir-219-2-1 322 tgtccaaacgcaattcttgt 20 59.17 hsa-mir-219-2-2 860 cagatgtccagccacaattc 20 59.09 60 hsa-mir-219-2-3 323 ccaaacgcaattcttgtacg 20 59.23 hsa-mir-219-2-4 861 cagatgtccagccacaattc 20 59.09 57 hsa-mir-219-2-5 324 tgtccaaacgcaattcttgt 20 59.17 hsa-mir-219-2-6 862 cacagatgtccagccacaat 20 59.55 62 hsa-mir-22-1 325 gccgcagtagttcttcagtg 20 58.68 hsa-mir-22-2 863 gctttagctgggtcaggaca 20 60.40 50 hsa-mir-22-3 326 tgagccgcagtagttcttca 20 59.74 hsa-mir-22-4 864 gctttagctgggtcaggaca 20 60.40 53 hsa-mir-22-5 327 gagccgcagtagttcttcag 20 57.85 hsa-mir-22-6 865 gctttagctgggtcaggaca 20 60.40 52 hsa-mir-220-1 328 gtagggctccacaccgtatc 20 59.43 hsa-mir-220-2 866 catgaacaccttcagcatgg 20 60.11 60 hsa-mir-220-3 329 gtagggctccacaccgtatc 20 59.43 hsa-mir-220-4 867 gagttcccagaccgcatc 18 59.13 77 hsa-mir-220-5 330 tagggctccacaccgtatct 20 59.57 hsa-mir-220-6 868 catgaacaccttcagcatgg 20 60.11 59 hsa-mir-221-1 331 gcatgaacctggcatacaat 20 58.45 hsa-mir-221-2 869 ctgaaacccagcagacaatg 20 59.29 71 hsa-mir-221-3 332 gcatgaacctggcatacaat 20 58.45 hsa-mir-221 -4 870 cctgaaacccagcagacaat 20 60.11 72 hsa-mir-221 -5 333 gcatgaacctggcatacaat 20 58.45 hsa-mir-221 -6 871 gtagcctgaaacccagcaga 20 60.40 76 hsa-mir-222-1 334 accctcaatggctcagtagc 20 59.31 hsa-mir-222-2 872 ccatcagagacccagtagcc 20 59.68 79 hsa-mir-222-3 335 taccctcaatggctcagtagc 21 59.35 hsa-mir-222-4 873 ccatcagagacccagtagcc 20 59.68 80 hsa-mir-222-5 336 ccctcaatggctcagtagc 19 58.40 hsa-mir-222-6 874 ccatcagagacccagtagcc 20 59.68 78 hsa-mir-223-1 337 acgctccgtgtatttgaca 19 57.69 hsa-mir-223-2 875 cgcacttggggtatttgac 19 58.99 76 hsa-mir-223-3 338 acgctccgtgtatttgaca 19 57.69 hsa-mir-223-4 876 cgcacttggggtatttgaca 20 61.85 76

hsa-mir-223-5 339 acgctccgtgtatttgaca 19 57.69 hsa-mιr-223-6 877 ccgcacttggggtatttg 18 isa-mir-224-1 340 ggttccgtttagtagatgattgtg 24 58.99 hsa-mir-224-2 878 cactagggcaccattttgaa 20 hsa-mir-224-3 341 ggttccgtttagtagatgattgtg 24 58.99 hsa-mir-224-4 879 gtcactagggcaccattttg 20 isa-mir-224-5 342 ggttccgtttagtagatgalig 22 55.52 hsa-mir-224-6 880 cactagggcaccattttgaa 20 isa-mir-23a-1 343 ggticctggggatgggatt 19 63.15 hsa-mir-23a-2 881 tccctggcaatgtgatttgt 20 hsa-mir-23a-3 344 ggttcctggggatgggattt 20 64.27 hsa-mir-23a-4 882 tccctggcaatgtgatttgt 20 hsa-mir-23a-5 345 ggttcctggggatgggatt 19 63.15 hsa-mir-23a-6 883 tccctggcaatgtgatttg 19 tisa-mir-23b-1 346 ctctggclgcttgggttc 18 59.50 hsa-mir-23b-2 884 tccctggcaatgtgatttta 20 fisa-mir-23b-3 347 ctctggctgcttgggttc 18 59.50 hsa-mir-23b-4 885 atccctggcaatgtgatttt 20 hsa-mir-23b-5 348 ctctggctgcttgggttc 18 59.50 hsa-mir-23b-6 886 gtggtaatccctggcaatgt 20 hsa-mir-24-1-1 349 cggtgcctactgagctgat 19 59.00 hsa-mir-24-1-2 887 cctgttcctgctgaactgag 20 hsa-mir-24-1-3 350 cggtgcctactgagctgat 19 59.00 hsa-mir-24-1-4 888 tcctgttcctgctgaactga 20 hsa-mir-24-1-5 351 ctccggtgcctactgagc 18 59.53 hsa-mir-24-1-6 889 cctgttcctgctgaactgag 20 hsa-mir-24-2-1 352 ccgtgcctactgagctgaa 19 60.14 hsa-mir-24-2-2 890 cctgttcctgctgaactgag 20 hsa-mir-24-2-3 353 cctcccgtgcctactgag 18 59.36 hsa-mir-24-2-4 891 cctgttcctgctgaactgag 20 hsa-mir-24-2-5 354 cgtgcctactgagclgaaa 19 57.72 hsa-mir-24-2-6 892 cctgttcctgctgaactgag 20 hsa-mir-25-1 355 agtgttgagaggcggagact 20 59.05 hsa-mir-25-2 893 agaccgagacaagtgcaatg 20 isa-mir-25-3 356 gtgttgagaggcggagactt 20 59.46 hsa-mir-25-4 894 agaccgagacaagtgcaatg 20 isa-mir-25-5 357 agtgttgagaggcggagact 20 59.05 hsa-mir-25-6 895 cagaccgagacaagtgcaa 19 hsa-mir-26a-1-1 358 tggcctcgttcaagtaatcc 20 60.07 hsa-mir-26a-1-2 896 ccgtgcaagtaaccaagaat 20 hsa-mir-26a-1-3 359 ggcctcgttcaagtaatcca 20 60.07 hsa-mir-26a-1-4 897 ccgtgcaagtaaccaagaat 20 isa-mir-26a-1 -5 360 tggcctcgttcaagtaatcc 20 60.07 hsa-mir-26a-1 -6 898 cccgtgcaagtaaccaaga 19 hsa-mir-26b-1 361 ttcaggataggttgtgtgctg 21 58.79 hsa-mir-26b-2 899 ccgagccaagtaatggaga 19 hsa-mir-26b-3 362 ttcaggataggttgtgtgctg 21 58.79 hsa-mir-26b-4 900 ccgagccaagtaatggagaa 20 hsa-mir-26b-5 363 attcaggataggttgtgtgctg 22 59.12 hsa-mir-26b-6 901 ccgagccaagtaatggaga 19 hsa-mir-27a-1 364 cttgtgagcagggtccacac 20 61.76 hsa-mir-27a-2 902 ggcggaacttagccactgt 19 hsa-mir-27a-3 365 ttgtgagcagggtccacac 19 60.74 hsa-mir-27a-4 903 ggcggaacttagccactgt 19 hsa-mir-27a-5 366 cttgtgagcagggtccacac 20 61.76 hsa-mir-27a-6 904 ggcggaacttagccactg 18 nsa-mir-27b-1 367 tctctaacaaggtgcagagctt 22 58.42 hsa-mir-27b-2 905 ggtgcagaacttagccactg 20 hsa-mir-27b-3 368 tctctaacaaggtgcagagctt 22 58.42 hsa-mir-27b-4 906 ttcaggtgcagaacttagcc 20 hsa-mir-27b-5 369 tgattggtgaacagtgattgg 21 59.40 hsa-mir-27b-6 907 ttcaggtgcagaacttagcc 20 hsa-mir-299-1 370 ccgtcccacatacattttga 20 59.25 hsa-mir-299-2 908 aagaagcggtttaccatcc 19 hsa-mir-299-3 371 accgtcccacatacattttg 20 58.20 hsa-mir-299-4 909 aagaagcggtttaccatcc 19 hsa-mir-299-5 372 gtttaccgtcccacatacatttt 23 59.09 hsa-mir-299-6 910 gcggtttaccatcccacata 20 hsa-mir-29a-1 373 tttcttttggtgttcagagtcaa 23 58.91 hsa-mir-29a-2 911 ccgatttcagatggtgctaga 21 hsa-mir-29a-3 374 tgactgatttcttttggtgttca 23 59.64 hsa-mir-29a-4 912 ccgatttcagatggtgctaga 21 hsa-mir-29a-5 375 tttcttttggtgttcagagtcaa 23 58.91 hsa-mir-29a-6 913 cgatttcagatggtgctaga 20 hsa-mir-29b-1-1 376 ttcaggaagctggtttcata 20 55.97 hsa-mir-29b-1 -2 914 ccccaagaacactgatttcaa 21

hsa-mir-29b-1-3 377 ttcaggaagctggtttcata 20 55.97 hsa-mir-29b-1 -4 915 cccaagaacactgatttcaa 20 hsa-mir-29b-1-5 378 ttcaggaagctggtttcata 20 55.97 hsa-mir-29b-1-6 916 ccccaagaacactgatttc 19 hsa-mir-29b-2-1 379 ggaagctggtttcacatggt 20 59.97 hsa-mir-29b-2-2 917 tggtgctagatacaaagatggaa 23 hsa-mir-29b-2-3 380 ggaagctggtttcacalgg 19 59.07 hsa-mir-29b-2-4 918 tggtgctagatacaaagatggaa 23 hsa-mir-29b-2-5 381 ggaagctggtttcacatggt . 20 59.97 hsa-mir-29b-2-6 919 tggtgctagatacaaagatgga 22 hsa-mir-29c-1 382 gaccgatttctcctggtgtt 20 58.99 hsa-mir-29c-2 920 cccctacatcataaccgattt 21 hsa-mir-29c-3 383 gaccgatttotcctggtgtt 20 58.99 hsa-mir-29c-4 921 ccctacatcataaccgatttca 22 hsa-mir-29c-5 384 accgatttctcctggtgttc 20 58.99 hsa-mir-29c-6 922 cccctacatcataaccgattt 21 hsa-mir-301-1 385 actgctaacgaatgctct 18 50.75 hsa-mir-301-2 923 cctgctttcagatgctttgac 21 hsa-mir-301-3 386 actgctaacgaatgctct 18 50.75 hsa-mir-301-4 924 ctgctttcagatgctttgac 20 isa-mir-301-5 387 actgctaacgaatgctct 18 50.75 hsa-mir-301-6 925 cctgctttcagatgctttg 19 hsa-mir-302a-1 388 aaacgtggatgtacttgcttt 21 56.47 hsa-mir-302a-2 926 catcaccaaaacatggaagc 20 isa-mir-302a-3 389 aaacgtggatgtacttgcttt 21 56.47 hsa-mir-302a-4 927 ccatcaccaaaacatggaag 20 hsa-mir-302a-5 390 ttaaacgtggatgtacttgcttt 23 57.96 hsa-mir-302a-6 928 catcaccaaaacatggaagc 20 hsa-mir-302b-1 391 tcaactttaacatggaagtgc 21 55.47 hsa-mir-302b-2 929 ctcctactaaaacatggaagca 22 hsa-mir-302b-3 392 tcaactttaacatggaagtgc 21 55.47 hsa-mir-302b-4 930 actcctactaaaacatggaagca 23 hsa-mir-302b-5 393 tcaactttaacatggaagtgc 21 55.47 hsa-mir-302b-6 931 tcctactaaaacatggaagca 21 hsa-mir-302d-1 394 ttaacatggaggcacttgct 20 58.38 hsa-mir-302d-2 932 ccacactcaaacatggaagc 20 hsa-mir-302d-3 395 taacatggaggcacttgctg 20 59.86 hsa-mir-302d-4 933 ccacactcaaacatggaagc 20 hsa-mir-302d-5 396 acatggaggcacttgctgt 19 59.28 hsa-mir-302d-6 934 ccacactcaaacatggaagc 20 hsa-mir-30a-1 397 aaacatcctcgactggaagc 20 59.29 hsa-mir-30a-2 935 ctgcaaacatccgactgaaa 20 isa-mir-30a-3 398 aaacatcctcgactggaagc 20 59.29 hsa-mir-30a-4 936 tgcaaacatccgactgaaag 20 isa-mir-30a-5 399 ctcgactggaagctgtgaag 20 58.75 hsa-mir-30a-6 937 ctgcaaacatccgactgaaa 20 hsa-mir-30b-1 400 accaagtttcagttcatgtaaa 22 54.10 hsa-mir-30b-2 938 ctcccagccaatccatgt 18 hsa-mir-30b-3 401 ccaagtttcagttcatgtaaa 21 53.02 hsa-mir-30b-4 939 ctcccagccaatccatgt 18 hsa-mir-30b-5 402 accaagtttcagttcatgtaaa 22 54.10 hsa-mir-30b-6 940 atccacctcccagccaat 18 isa-mir-30c-1-1 403 accatgctgtagtgtgtgtaaa 22 55.80 hsa-mir-30c-1-2 941 tggcagaaggagtaaacaacc 21 isa-mir-30c-1-3 404 ccatgctgtagtgtgtgtaaa 21 54.74 hsa-mir-30c-1-4 942 tggcagaaggagtaaacaacc 21 isa-mir-30c-1-5 405 accatgctgtagtgtgtgtaa 21 54.10 hsa-mir-30c-1-6 943 tggcagaaggagtaaacaacc 21 isa-mir-30c-2-1 406 ctgtaaacatcctacactctcagc 24 57.29 hsa-mir-30c-2-2 944 gccttctcccagctttctta 20 hsa-mir-30c-2-3 407 tgtaaacatcctacactctcagc 23 56.23 hsa-mir-30c-2-4 945 gccttctcccagctttctta 20 hsa-mir-30c-2-5 408 actgtaaacatcctacactctcagc 25 58.13 hsa-mir-30c-2-6 946 gccttctcccagctttctta 20 hsa-mir-30d-1 409 gtaaacatccccgactggaa 20 59.79 hsa-mir-30d-2 947 gcagcaaacatctgactgaaa 21 hsa-mir-30d-3 410 gttgtaaacatccccgactg 20 57.92 hsa-mir-30d-4 948 gcagcaaacatctgactgaaa 21 hsa-mir-30d-5 411 taaacatccccgactggaag 20 59.93 hsa-mir-30d-6 949 gcagcaaacatctgactgaaa 21 hsa-mir-30e-1 412 acatccttgactggaagctg 20 57.87 hsa-mir-30e-2 950 acatccgactgaaagctcct 20 hsa-mir-30e-3 413 catccttgactggaagctgt 20 57.87 hsa-mir-30e-4 951 acatccgactgaaagctcct 20 hsa-mir-30e-5 414 acatccttgactggaagctgt 21 58.81 hsa-mir-30e-6 952 acatccgactgaaagctcct 20

hsa-mir-31-1 415 gagaggaggcaagatgctg 19 58.63 hsa-mir-31-2 953 atgttggcatagcaggttcc 20 59.96 56 hsa-mir-31-3 416 gagaggaggcaagatgctg 19 58.63 hsa-mir-31 -4 954 tgttggcatagcaggttcc 19 59.66 55 hsa-mir-31-5 417 ggagaggaggcaagatgc 18 58.40 hsa-mir-31 -6 955 catagcaggttcccagttca 20 58.72 50 hsa-mir-32-1 418 ctaagttgcalgttgtcacg 20 55.33 hsa-mir-32-2 956 aatatcacacacactaaattgcattg 26 59.31 50 hsa-mir-32-3 419 ctaagttgcatgttgtcacg 20 55.33 hsa-mir-32-4 957 aaaatatcacacacactaaattgcat 26 58.12 52 hsa-mir-32-5 420 ctaagttgcatgttgtcacg 20 55.33 hsa-mir-32-6 958 gaaaatatcacacacactaaattgc 25 56.98 53 hsa-mir-320-1 421 ccttctcttcccggttcttc 20 60.18 hsa-mir-320-2 959 ccctctcaacccagctttt 19 59.27 50 hsa-mir-320-3 422 ccttctcttcccggttctt 19 58.31 hsa-mir-320-4 960 ccctctcaacccagctttt 19 59.27 50 hsa-mir-320-5 423 ccttctcttcccggttcttc 20 60.18 hsa-mir-320-6 961 ccctctcaacccagcttttc 20 61.12 50 hsa-miι-323-1 424 tggtacttggagagaggtggt 21 58.66 hsa-mir-323-2 962 gcgccataaataaagcgaac 20 59.72 50 hsa-mir-323-3 425 ttggtacttggagagaggtggt 22 60.03 hsa-mir-323-4 963 gcgccataaataaagcgaac 20 59.72 51 hsa-mir-323-5 426 tggtacttggagagaggtggt 21 58.66 hsa-mir-323-6 964 tgtgcgccataaataaagc 19 57.43 53 hsa-mir-324-1 427 actatgcctccccgcatc 18 61.01 hsa-mir-324-2 965 gcagtgggtctccagcttta 20 60.40 54 hsa-mir-324-3 428 actatgcctccccgcatc 18 61.01 hsa-mir-324-4 966 cagtgggtctccagctttac 20 57.39 53 hsa-mir-324-5 429 actatgcctccccgcatc 18 61.01 hsa-mir-324-6 967 agtgggtctccagctttaca 20 57.39 52 hsa-mir-325-1 430 aggtgtccagtaagtgtttgtga 23 58.69 hsa-mir-325-2 968 cagtgcttgattgataggaggt 22 58,34 64 hsa-mir-325-3 431 ggtgtccagtaagtgtttgtga 22 57.63 hsa-mir-325-4 969 cagtgcttgattgataggaggt 22 58.34 63 hsa-mir-325-5 432 ggtgtccagtaagtgtttgtgac 23 58.55 hsa-mir-325-6 970 cagtgcttgattgataggaggt 22 58.34 63 hsa-mir-326-1 433 atctgtctgttgggctgga 19 59.20 hsa-mir-326-2 971 cagaggcgatctgagcac 18 58.08 62 hsa-mir-326-3 434 atctgtctgttgggctggag 20 60.26 hsa-mir-326-4 972 cagaggcgatctgagcac 18 58.08 62 hsa-mir-326-5 435 tctgtctgttgggctggag 19 59,96 hsa-mir-326-6 973 cagaggcgatctgagcac 18 58.08 61 hsa-mir-328-1 436 gctcagggagaaagtgcata 20 58.05 hsa-mir-328-2 974 ggacggaagggcagagag 18 60.91 50 hsa-mir-328-3 437 gctcagggagaaagtgcatac 21 58.95 hsa-mir-328-4 975 ggacggaagggcagagag 18 60.91 50 hsa-mir-328-5 438 aggggctcagggagaaagt 19 60.20 hsa-mir-328-6 976 ggacggaagggcagagag 18 60.91 54 hsa-mir-330-1 439 ctctctgggcctgtgtctta 20 58.03 hsa-mir-330-2 977 gtgtgctttgctcggttg 18 58.95 51 hsa-mir-330-3 440 tctctgggcctgtgtcttag 20 58.03 hsa-mir-330-4 978 gtgtgctttgctcggttg 18 58.95 50 hsa-mir-330-5 441 ctctctgggcctgtgtcttag 21 59.10 hsa-mir-330-6 979 gtgtgctttgctcggttg 18 58.95 51 hsa-mir-331-1 442 tttggttttgtttgggtttg 20 58.41 hsa-mir-331-2 980 aggggcctggtttgatct 18 59.46 63 hsa-mir-331-3 443 tttggttttgtttgggtttg 20 58.41 hsa-mir-331-4 981 aggttggttctaggataggc 20 55.00 85 hsa-mir-331-5 444 ttggttttgtttgggtttgt 20 57.88 hsa-mir-331-6 982 aggggcctggtttgatct 18 59.46 62 hsa-mir-335-1 445 ggggtcaagagcaataacga 20 60.07 hsa-mir-335-2 983 gcaaatgagaggaggtcagg 20 59.80 75 hsa-mir-335-3 446 ggggtcaagagcaataacga 20 60.07 hsa-mir-335-4 984 gagaggaggtcaggagcaat 20 58.41 69 hsa-mir-335-5 447 gggtcaagagcaataacgaa 20 57.82 hsa-mir-335-6 985 gcaaatgagaggaggtcagg 20 59.80 74 hsa-mir-337-1 448 tgatgcacagttatccagctc 21 58.89 hsa-mir-337-2 986 ttgaaggggatgaagaaagg 20 59.10 51 hsa-mir-337-3 449 tcatacaggagttgatgcacag 22 58.80 hsa-mir-337-4 987 ttgaaggggatgaagaaagg 20 59.10 63 hsa-mir-337-5 450 aggagttgatgcacagttatcc 22 58.20 hsa-mir-337-6 988 ttgaaggggatgaagaaagg 20 59.10 57 hsa-mir-342-1 451 caaggtgaggggtgctatct 20 59.16 hsa-mir-342-2 989 ggtgcgatttctgtgtgaga 20 59.84 69 hsa-mir-342-3 452 aaggtgaggggtgctatctg 20 59.16 hsa-mir-342-4 990 ggtgcgatttctgtgtgaga 20 59.84 68

hsa-mir-342-5 453 aggtgaggggtgctatctgt 20 58.62 hsa-mir-342-6 991 ggtgcgatttctgtgtgaga 20 59.84 67 hsa-mir-34a-1 454 ttggcagtgtcttagctggt 20 58.52 hsa-mir-34a-2 992 gcagcacttctagggcagta 20 58.28 76 hsa-mir-34a-3 455 tggcagtgtcttagctggtt 20 58.52 hsa-mir-34a-4 ^• 993 gcagcacttctagggcagta 20 58.28 75 hsa-mir-34a-5 456 ggcagtgtcttagctggttg 20 58.52 hsa-mir-34a-6 994 gcagcacttctagggcagta 20 58.28 74 hsa-mir-34b-1 457 ctcggtttgtaggcagtgtc 20 58.37 hsa-mir-34b-2 995 tgttttgatggcagtggagt 20 59.14 75 hsa-mir-34b-3 458 ctcgglttgtaggcagtgtc 20 58.37 hsa-mir-34b-4 996 cttgttttgatggcagtgga 20 59.69 77 hsa-mir-34b-5 459 ctcggtttgtaggcagtgtc 20 58.37 hsa-mir-34b-6 997 ttgttttgatggcagtggag 20 59.69 76 isa-mir-34c-1 460 ggcagtgtagttagctgattgct 23 59.99 hsa-mir-34c-2 998 tacctggccgtgtggttagt 20 60.43 56 hsa-mir-34c-3 461 aggcagtgtagttagctgattg 22 56.40 hsa-mir-34c-4 999 ccgtgtggttagtgattggt 20 58.34 50 hsa-mir-34c-5 462 ggcagtgtagttagctgattgct 23 59.99 hsa-mir-34c-6 1000 tacctggccgtgtggttag 19 59.58 56 hsa-mir-361-1 463 gaatctccaggggtacttta 20 53.38 hsa-mir-361-2 1001 gaagcaaatcagaatcacacct 22 58.32 61 hsa-mir-361-3 464 gaatctccaggggtacttta 20 53.38 hsa-mir-361 -4 1002 gaagcaaatcagaatcacacc 21 57.25 61 hsa-mir-361-5 465 gaatctccaggggtactttat 21 53.99 hsa-mir-361 -6 1003 gaagcaaatcagaatcacacc' 22 58.32 61 hsa-mir-367-1 466 ccattactgttgctaatatgc 21 52.79 hsa-mir-367-2 1004 ccatcaccattgctaaag 18 52.30 68 hsa-mir-369-1 467 aagggagatcgaccgtgtta 20 59.55 hsa-mir-369-2 1005 ctgagaaaagatcaaccatgt 21 54.33 67 hsa-mir-369-3 468 agggagatcgaccgtgttat 20 58.47 hsa-mir-369-4 1006 ctgagaaaagatcaaccatgt 21 54.33 66 hsa-mir-369-5 469 aagggagatcgaccgtgtta 20 59.55 hsa-mir-369-6 1007 tgagaaaagatcaaccatgt 20 52.98 66 hsa-mir-370-1 470 agagaagccaggtcacgtct 20 59.05 hsa-mir-370-2 1008 caggttccaccccagcag 18 62.72 63 hsa-mir-370-3 471 agaagccaggtcacgtctct 20 59.05 hsa-mir-370-4 1009 caggttccaccccagcag 18 62.72 61 isa-mir-370-5 472 acagagaagccaggtcacg 19 58.98 hsa-mir-370-6 1010 caggttccaccccagcag 18 62.72 65 hsa-mir-372-1 473 gcctcaaatgtggagcacta 20 58.88 hsa-mir-372-2 1011 gctcaaatgtcgcagcac 18 59.06 58 hsa-mir-372-3 474 gcctcaaatgtggagcacta 20 58.88 hsa-mir-372-4 1012 gctcaaatgtcgcagcact 19 60.16 58 hsa-mir-372-5 475 gcctcaaatgtggagcacta 20 58.88 hsa-mir-372-6 1013 atgtcgcagcactttcca 18 58.90 52 hsa-mir-376a-1 476 gattctccttctatgagtacatt 23 51.24 hsa-mir-376a-2 1014 aaaacgtggattttcctctatga 23 59.05 58 hsa-mir-376a-3 477 gattctccttctatgagtacattattt 27 55.01 hsa-mir-376a-4 1015 aaaacgtggattttcctctatga 23 59.05 58 hsa-mir-376a-5 478 gattctccttctatgagtacatt 23 51.24 hsa-mir-376a-6 1016 aaacgtggattttcctctatga 22 57.75 57 hsa-mir-377-1 479 agaggttgcccttggtga 18 59.18 hsa-mir-377-2 1017 aaaagttgcctttgtgtgattc 22 58.29 58 hsa-mir-377-3 480 gagcagaggttgcccttg 18 59.50 hsa-mir-377-4 1018 aaaagttgcctttgtgtgattc 22 58.29 62 hsa-mir-377-5 481 agaggttgcccttggtgaa 19 60.64 hsa-mir-377-6 1019 aaaagttgcctttgtgtgattc 22 58.29 58 hsa-mir-381-1 482 taaagcgaggttgcccttt 19 59.83 hsa-mir-381 -2 1020 cagagagcttgcccttgtat 20 57.17 65 hsa-mir-381-3 483 ttaaagcgaggttgcccttt 20 61.07 hsa-mir-381 -4 1021 cagagagcttgcccttgtat 20 57.17 66 hsa-mir-381-5 484 tgccctttgtatattcggttt 21 58.51 hsa-mir-381 -6 1022 cagagagcttgcccttgtat 20 57.17 54 hsa-mir-382-1 485 gagaagttgttcgtggtgga 20 58.70 hsa-mir-382-2 1023 aaaagtgttgtccgtgaatga 21 58.12 61 hsa-mir-382-3 486 gagaagttgttcgtggtgga 20 58.70 hsa-mir-382-4 1024 aaagtgttgtccgtgaatga 20 56.55 60 isa-mir-382-5 487 gagaagttgttcgtggtgga 20 58.70 hsa-mir-382-6 1025 aaaagtgttgtccgtgaatgat 22 58.49 61 hsa-mir-422a-1 488 agcactggacttagggtcaga 21 58.95 hsa-mir-422a-2 1026 cttggctcagggacagaga 19 59.06 69 hsa-mir-422a-3 489 agcactggacttagggtcaga 21 58.95 hsa-mir-422a-4 1027 ttggctcagggacagagag 19 59.06 68 hsa-mir-422a-5 490 agcactggacttagggtcaga 21 58.95 hsa-mir-422a-6 1028 cttggctcagggacagagag 20 60.13 69

hsa-mir-423-1 491 ggcagagagcgagactttic 20 59.31 hsa-mir-423-2 1029 cgggttaggaagcaagactg 20 59.87 70 hsa-mir-423-3 492 ggcagagagcgagacttttc 20 59.31 hsa-mir-423-4 1030 gcgggttaggaagcaagact 20 60.76 71 hsa-mir-423-5 493 ggcagagagcgagacttttc 20 59.31 hsa-mir-423-6 1031 gcgggttaggaagcaagac 19 59.83 71 hsa-mir-424-1 494 aggggatacagcagcaattc 20 59.15 hsa-mir-424-2 1032 gtatagcagcgcctcacgtt 20 60.44 68 hsa-mir-424-3 495 aggggatacagcagcaattc 20 59.15 hsa-mir-424-4 1033 gcctcacgttttgaaccatt 20 59.98 58 hsa-mir-424-5 496 aggggatacagcagcaattc 20 59.15 hsa-mir-424-6 1034 tatagcagcgcctcacgtt 19 59.60 67 hsa-mir-425-1 497 gacacgatcactcccgttg 19 60.10 hsa-mir-425-2 1035 gacattcccgatggcttct 19 60.03 50 hsa-mir-425-3 498 gacacgatcactcccgttg 19 60.10 hsa-mir-425-4 1036 gacattcccgatggcttc 18 58.96 50 hsa-mir-425-5 499 gacacgatcactcccgttg 19 60.10 hsa-mir-425-6 1037 gacacgacattcccgatg 18 58.33 55 hsa-mir-7-1-1 500 tggatgttggcctagttctg 20 58.72 hsa-mir-7-1-2 1038 agactgtgatttgttgtcgattt 23 57.79 80 hsa-mir-7-1-3 501 tggatgttggcctagttctg 20 58.72 hsa-mir-7-1-4 1039 gactgtgatttgttgtcgattt 22 56.72 79 hsa-mir-7-1-5 502 ttggcctagttctgtgtgga 20 59.29 hsa-mir-7-1-6 1040 agactgtgatttgttgtcgattt 23 57.79 74 hsa-mir-7-2-1 503 ggccccatctggaagacta 19 60.02 hsa-mir-7-2-2 1041 ggctggcaccattaggtaga 20 60.10 82 hsa-mir-7-2-3 504 ggccccatctggaagacta 19 60.02 hsa-mir-7-2-4 1042 gatttgttgttgagcgcagt 20 58.93 58 hsa-mir-7-2-5 505 tgttgtcttactgcgctcaa 20 58.22 hsa-mir-7-2-6 1043 ggctggcaccattaggtaga 20 60.10 53 hsa-mir-7-3-1 506 gagtggctgtggtctagtgc 20 58.47 hsa-mir-7-3-2 1044 aagggagtctgcgctatgag 20 59.60 100 hsa-mir-7-3-3 507 gtggctgtggtctagtgctg 20 59.49 hsa-mir-7-3-4 1045 aagggagtctgcgctatgag 20 59.60 98 hsa-mir-7-3-5 508 tggctgtggtctagtgctgt 20 59.49 hsa-mir-7-3-6 1046 aagggagtctgcgctatgag 20 59.60 97 hsa-mir-9-1-1 509 cggggttggttgttatcttt 20 58.81 hsa-mir-9-1-2 1047 actccacaccactcatacagc 21 57.65 50 hsa-mir-9-1-3 510 cggggttggttgttatcttt 20 58.81 hsa-mir-9-1-4 1048 gactccacaccacicatacagc 22 59.65 51 hsa-mir-9-1-5 511 cggggttggttgttatcttt 20 58.81 hsa-mir-9-1-6 1049 actccacaccactcatacagcta 23 58.81 50 hsa-mir-9-2-1 512 ggaagcgagttgttatctttgg 22 60.13 hsa-mir-9-2-2 1050 ttttactttcggttatctagc 21 51.15 78 hsa-mir-9-2-3 513 gaagcgagttgttatctttggtt 23 58.88 hsa-mir-9-2-4 1051 ttttactttcggttatctagc 21 51.15 Tl hsa-mir-9-2-5 514 ggaagcgagttgttatctttgg- 22 60.13 hsa-mir-9-2-6 1052 agaccaatacactcatacagctaga 25 56.44 50 hsa-mir-9-3-1 515 gcccgtttctctctttggt 19 59.27 hsa-mir-9-3-2 1053 agctttatgacggctctgtg 20 58.13 58 hsa-mir-9-3-3 516 aggcccgtttctctctttg 19 59.42 hsa-mir-9-3-4 1054 agctttatgacggctctgtg 20 58.13 60 hsa-mir-9-3-5 517 gaggcccgtttctctcttt 19 58.46 hsa-mir-9-3-6 1055 agctttatgacggctctgtg 20 58.13 61 hsa-mir-92-1 -1 518 ttctacacaggttgggatcg 20 58.57 hsa-mir-92-1-2 1056 cgggacaagtgcaataccat 20 60.78 61 hsa-mir-92-1-3 519 ttctacacaggttgggatcg 20 58.57 hsa-mir-92-1-4 1057 cgggacaagtgcaataccata 21 60.76 61 hsa-mir-92-1 -5 520 ttctacacaggttgggatcg 20 58.57 hsa-mir-92-1-6 1058 gggacaagtgcaataccataca 22 59.75 60 hsa-mir-92-2-1 521 ctgggtggggatttgttg 18 59.73 hsa-mir-92-2-2 1059 ccgggacaagtgcaatactt 20 59.99 58 hsa-mir-92-2-3 522 ctgggtggggatttgttg 18 59.73 hsa-mir-92-2-4 1060 cgggacaagtgcaatacttt 20 57.76 57 ^• hsa-mir-92-2-5 523 ctgggtggggatttgttg 18 59.73 hsa-mir-92-2-6 1061 ccgggacaagtgcaatact 19 58.58 58 hsa-mir-93-1 524 gtgctgttcgtgcaggtagt 20 58.96 hsa-mir-93-2 1062 ggggctcgggaagtgcta 18 63.60 63 hsa-mir-93-3 525 agtgctgttcgtgcaggtag 20 59.11 hsa-mir-93-4 1063 ggggctcgggaagtgcta 18 63.60 64 hsa-mir-93-5 526 gctgttcgtgcaggtagtgt 20 58.96 hsa-mir-93-6 1064 ggggctcgggaagtgcta 18 63.60 61 hsa-mir-95-1 527 tgggcactcaataaatgtctg 21 58.64 hsa-mir-95-2 1065 tgctcaataaatacccgttga 21 58.17 63 isa-mir-95-3 528 tgggcactcaataaatgtctg 21 58.64 hsa-mir-95-4 1066 tgctcaataaatacccgttgaa 22 59.49 63

hsa-mir-95-5 529 tgggcactcaataaatgtctg 21 58.64 hsa-mir-95-6 1067 tgctcaataaatacccgttg 20 56.28 63 hsa-mir-98-1 530 ltgtattgttgtggggtaggg 21 59.60 hsa-mir-98-2 1068 atagttatcttctaattggggccta 25 57.92 50 hsa-mir-98-3 531 tgtattgttgtggggtaggg 20 58.20 hsa-mir-98-4 1069 tatagttatcttctaattggggccta 26 57.99 50 hsa-mir-98-5 532 tgtattgttgtggggtaggg 20 58.20 hsa-mir-98-6 1070 gtatagttatcttctaattggggccta 27 58.67 51 hsa-mir-99a-1 533 cattggcataaacccgtaga 20 58.51 hsa-mir-99a-2 1071 cacactgacacagacccataga 22 58.65 79 hsa-mir-99a-3 534 tggcataaacccgtagatcc 20 59.78 hsa-mir-99a-4 1072 cacactgacacagacccataga 22 58.65 76 risa-mir-99a-5 535 cattggcataaacccgtaga 20 58.51 hsa-mir-99a-6 1073 ctgacacagacccatagaagc 21 57.40 75 hιsa-mir-99b-1 536 cacccgtagaaccgacctt 19 59.97 hsa-mir-99b-2 1074 gacccacagacacgagctt 19 58.82 58 hsa-mir-99b-3 537 acccgtagaaccgaccttg 19 59.97 hsa-mir-99b-4 1075 gacccacagacacgagctt 19 58.82 57 hsa-mir-99b-5 538 cccqtaqaaccqaccttg 18 59.08 hsa-mir-99b-6 1076 gacccacagacacgagctt 19 58.82 56

hsa-mir-373-3 1112 tttgtctgtactgggaagtgc 21 57.87 hsa-mir-373-4 1164 gggacaccccaaaatcgaag 20 63.76 40 hsa-mir-373-5 1113 tttgtctgtactgggaagtgct 22 58.91 hsa-mir-373-6 1165 gggacaccccaaaatcgaa 19 62.96 40 hsa-mir-375-1 1114 gagcccctcgcacaaacc 18 64.13 hsa-mir-375-2 1166 aacgaacaaaacgctcaggt 20 59.78 40 hsa-mir-375-3 1115 gagcccctcgcacaaacc 18 64.13 hsa-mir-375-4 1167 aacgaacaaaacgctcagg 19 58.91 40 hsa-mir-375-5 1116 gagcccctcgcacaaacc 18 64.13 hsa-mir-375-6 1168 gaacgaacaaaacgctcagg 20 60.81 41 hsa-mir-378-1 1117 ggtcctgtgtgttacctagaa 21 54.29 hsa-mir-378-2 1169 actccaagtccagtgctatttc 22 57.49 40 hsa-mir-378-3 1118 ggtcctgtgtgttacctagaaa 22 55.91 hsa-mir-378-4 1170 actccaagtccagtgctattt 21 55.57 40 hsa-mir-378-5 1119 ggtcctgtgtgttacctaga 20 52.48 hsa-mir-378-6 1171 actccaagtccagtgctatttc 22 57.49 40 hsa-mir-380-1 1120 ggttgaccatagaacatgc 19 53.72 hsa-mir-380-2 1172 ggaccatattacatacgacacaga 24 57.96 49 hsa-mir-380-3 1121 ggttgaccatagaacatgc 19 53.72 hsa-mir-380-4 1173 ggaccatattacatacgacacagag 25 58.90 49 hsa-mir-380-5 1122 ggttgaccatagaacatgc 19 53.72 hsa-mir-380-6 1174 ggaccatattacatacgacacag 23 56.14 49 hsa-mir-383-1 1123 cagaaggtgattgtggcttt 20 57.80 hsa-mir-383-2 1175 cagtgctgtggctgatta 18 53.98 48 hsa-mir-383-3 1124 agaaggtgattgtggctttg 20 57.80 hsa-mir-383-4 1176 cagtgctgtggctgatta 18 53.98 47 hsa-mir-383-5 1125 aaggtgattgtggctttgg 19 58.56 hsa-mir-383-6 1177 cagtgctgtggctgatta 18 53.98 45 hsa-mir-96-1 1126 cgattttggcactagcacat 20 58.80 hsa-mir-96-2 1178 tcagagcggagagacacaag 20 59.28 45 hsa-mir-96-3 1127 ccgattttggcactagcac 19 59.29 hsa-mir-96-4 1179 tcagagcggagagacacaag 20 59.28 46 hsa-mir-96-5 1128 cgattttggcactagcaca 19 58.43 hsa-mir-96-6 1180 tcagagcggagagacacaag 20 59.28 45

Table 3

Target miRNA precursor sequences Seq ID

No hsa-let- 1181

7a-l tgggatgaggtagtaggttgtatagttttagggtcacacccaccactgggagataact at acaatctactgtctttccta hsa-let- 1182

7a-2 aggttgaggtagtaggttgtatagtttagaattacatcaagggagataactgtacagc ct cctagcttt cct hsa-let- 1183

7a-3 gggtgaggtagtaggttgtatagtttggggctctgccctgctatgggataactataca at ctactgtct ttcct hsa-let- 1184

7b cggggtgaggtagtaggttgtgtggtttcagggcagtgatgttgcccctcggaagata ac tatacaacctactgccttccc tg hsa-let- 1185

7c gcatccgggttgaggtagtaggttgtatggtttagagttacaccctgggagttaactg ta caaccttctagctttccttgg age hsa-let- 1186

7d cctaggaagaggtagtaggttgcatagttttagggcagggattttgcccacaaggagg ta actatacgacctgctgccttt cttagg hsa-let- 1187

7e cccgggctgaggtaggaggttgtatagttgaggaggacacccaaggagatcactatac gg cctcctagctttccccagg hsa-let- 1188

7f-l tcagagtgaggtagtagattgtatagttgtggggtagtgattttaccctgttcaggag at aactatacaatctattgcctt ccctga hsa-let- 1189

7f-2 tgtgggatgaggtagtagattgtatagttttagggtcataccccatcttggagataac ta tacagtctactgtctttccca eg hsa-mir- 1190

15a ccttggagtaaagtagcagcacataatggtttgtggattttgaaaaggtgcaggccat at tgtgctgcctcaaaaatacaa gg hsa-mir- 1191 16-1 gtcagcagtgccttagcagcacgtaaatattggcgttaagattctaaaattatctcca gt attaactgtgctgctgaagtaaggttgac hsa-mir- 1192

17 gtcagaataatgtcaaagtgcttacagtgcaggtagtgatatgtgcatctactgcagt ga aggcacttgtagcattatggt gac hsa-mir- 1193

18 tgttctaaggtgcatctagtgcagatagtgaagtagattagcatctactgccctaagt gc tccttctgg ca hsa-mir- 1194

19a gcagtcctctgttagttttgcatagttgcactacaagaagaatgtagttgtgcaaatc ta tgcaaaactgatggtggcctg c hsa-mir- 1195

19b-l cactgttctatggttagttttgcaggtttgcatccagctgtgtgatattctgctgtgc aa atccatgcaaaactgactgtg gtagtg hsa-mir- 1196

19b-2 acattgctacttacaattagttttgcaggtttgcatttcagcgtatatatgtatatgt gg ctgtgcaaatccatgcaaaactgattgtgata atgt hsa-mir- 1197

20 gtagcactaaagtgcttatagtgcaggtagtgtttagttatctactgcattatgagca ct taaagtact gc hsa-mir- 1198

21 tgtcgggtagcttatcagactgatgttgactgttgaatctcatggcaacaccagtcga ' tg ggctgtctg aca hsa-mir- 1199

22 ggctgagccgcagtagttcttcagtggcaagctttatgtcctgacccagctaaagctg cc agttgaagaactgttgccctc tgcc hsa-mir- 1200

23a ggccggctggggttcctggggatgggatttgcttcctgtcacaaatcacattgccagg ga tttccaacc gacc hsa-mir- 1201

24-1 ctccggtgcctactgagctgatatcagttctcattttacacactggctcagttcagca gg aacaggag hsa-mir- 1202

24-2 ctctgcctcccgtgcctactgagctgaaacacagttggtttgtgtacactggctcagt tc agcaggaacaggg hsa-mir- 1203

25 ggccagtgttgagaggcggagacttgggcaattgctggacgctgccctgggcattgca ct tgtctcggtctgacagtgccg gcc hsa-mir- 1204

26a-l gtggcctcgttcaagtaatccaggataggctgtgcaggtcccaatgggcctattcttg gt tacttgcacggggacgc hsa-mir- 1205

26b ccgggacccagttcaagtaattcaggataggttgtgtgctgtccagcctgttctccat ta c11ggctcggggaccgg hsa-mir- 1206

27a ctgaggagcagggcttagctgcttgtgagcagggtccacaccaagtcgtgttcacagt gg ctaagttccgccccccag hsa-mir- 1207

28 ggtccttgccctcaaggagctcacagtctattgagttacctttctgactttcccacta ga ttgtgagctcctggagggcag gcact hsa-mir- 1208

29a atgactgatttcttttggtgttcagagtcaatataattttctagcaccatctgaaatc gg ttat hsa-mir- 1209

30a gcgactgtaaacatcctcgactggaagctgtgaagccacagatgggctttcagtcgga tg tttgcagct gc hsa-mir- 1210

31 ggagaggaggcaagatgctggcatagctgttgaactgggaacctgctatgccaacata tt gccatcttt cc hsa-mir- 1211

32 ggagatattgcacattactaagttgcatgttgtcacggcctcaatgcaatttagtgtg tg tgatatttt c hsa-mir- 1212

33 ctgtggtgcattgtagttgcattgcatgttctggtggtacccatgcaatgtttccaca gt gcatcacag hsa-mir- 1213

92-1 ctttctacacaggttgggatcggttgcaatgctgtgtttctgtatggtattgcacttg tc ccggcctgttgagtttgg hsa-mir- 1214

92-2 tcatccctgggtggggatttgttgcattacttgtgttctatataaagtattgcacttg tc ccggcctgtggaaga hsa-mir- 1215

93 ctgggggctccaaagtgctgttcgtgcaggtagtgtgattacccaacctactgetgag ct agcacttcccgagcccccgg hsa-mir- 1216

95 aacacagtgggcactcaataaatgtctgttgaattgaaatgcgttacattcaacgggt at ttattgagcacccactctgtg hsa-mir- 1217

96 tggccgattttggcactagcacatttttgcttgtgtctctccgctctgagcaatcatg tg cagtgccaatatgggaaa hsa-mir- 1218

98 gtgaggtagtaagttgtattgttgtggggtagggatattaggccccaattagaagata ac tatacaacttactactttcc hsa-mir- 1219

99a cccattggcataaacccgtagatccgatcttgtggtgaagtggaccgcacaagctcgc tt ctatgggtctgtgtcagtgtg hsa-mir- 1220

100 cctgttgccacaaacccgtagatccgaacttgtggtattagtccgcacaagcttgtat ct ataggtatgtgtctgttagg hsa-mir- 1221

101-1 tgccctggctcagttatcacagtgctgatgctgtctattctaaaggtacagtactgtg at aactgaaggatggca hsa-mir- 1222

29b-l cttcaggaagctggtttcatatggtggtttagatttaaatagtgattgtctagcacca tt tgaaatcagtgttcttggggg hsa-mir- 1223

29b-2 cttctggaagctggtttcacatggtggcttagatttttccatctttgtatctagcacc at ttgaaatcagtgttttaggag hsa-mir- 1224

103-2 ttgtgctttcagcttctttacagtgctgccttgtagcattcaggtcaagcagcattgt ac agggctatgaaagaacca hsa-mir- 1225

103-1 tactgccctcggcttctttacagtgctgccttgttgcatatggatcaagcagcattgt ac agggctatgaaggcattg hsa-mir- 1226

105-1 tgtgcatcgtggtcaaatgctcagactcctgtggtggctgctcatgcaccacggatgt tt gagcatgtgctacggtgtcta hsa-mir- 1227

105-2 tgtgcatcgtggtcaaatgctcagactcctgtggtggctgcttatgcaccacggatgt tt gagcatgtgctatggtgtcta hsa-mir- 1228

106a ccttggccatgtaaaagtgcttacagtgcaggtagctttttgagatctactgcaatgt aa gcacttcttacattaccatgg hsa-mir- 1229

107 ctctctgctttcagcttctttacagtgttgccttgtggcatggagttcaagcagcatt gt acagggctatcaaagcacaga hsa-mir- 1230

16-2 gttccactctagcagcacgtaaatattggcgtagtgaaatatatattaaacaccaata tt actgtgctgctttagtgtgac hsa-mir- 1231

192 gccgagaccgagtgcacagggctctgacctatgaattgacagccagtgctctcgtctc cc ctctggctgccaattccataggtcacaggtatgttcgcctcaa tgccagc hsa-mir- 1232

196a-l gtgaattaggtagtttcatgttgttgggcctgggtttctgaacacaacaacattaaac ca cccgattca c hsa-mir- 1233

197 ggctgtgccgggtagagagggcagtgggaggtaagagctcttcacccttcaccacctt ct ccacccagcatggcc hsa-mir- 1234

198 tcattggtccagaggggagataggttcctgtgatttttccttcttctctatagaataa at ga hsa-mir- 1235

199a-l gccaacccagtgttcagactacctgttcaggaggctctcaatgtgtacagtagtctgc ac attggttag gc hsa-mir- 1236

208 tgacgggcgagcttttggcccgggttatacctgatgctcacgtataagacgagcaaaa ag cttgttggt ca hsa-mir- 1237

129-1 ggatctttttgcggtctgggcttgctgttcctctcaacagtagtcaggaagcccttac cc caaaaagta tct hsa-mir- 1238

148a gaggcaaagttctgagacactccgactctgagtatgatagaagtcagtgcactacaga ac tttgtctc hsa-mir- 1239

30c-2 agatactgtaaacatcctacactctcagctgtggaaagtaagaaagctgggagaaggc tg tttactctt tct hsa-mir- 1240

3Od gttgttgtaaacatccccgactggaagctgtaagacacagctaagctttcagtcagat gt ttgctgcta c hsa-mir- 1241

139 gtgtattctacagtgcacgtgtctccagtgtggctcggaggctggagacgcggccctg tt ggagtaac hsa-mir- 1242

147 aatctaaagacaacatttctgcacacacaccagactatggaagccagtgtgtggaaat gc ttctgctag att hsa-mir- 1243

7-1 ttggatgttggcctagttctgtgtggaagactagtgattttgt tgtttttagataactaa atcgacaacaaatcacagtctgccatatggcacaggccatgcc tctacag hsa-mir- 1244

7-2 ctggatacagagtggaccggctggccccatctggaagactagtgattttgttgttgtc tt actgcgctcaacaacaaatcccagtctacctaatggtgccagc catcgca hsa-mir- 1245

7-3 agattagagtggctgtggtctagtgctgtgtggaagactagtgattttgttgttctga tg tactacgacaacaagtcacagccggcctcatagcgcagactcc cttcgac hsa-mir- 1246

10a gatctgtctgtcttctgtatataccctgtagatccgaatttgtgtaaggaattttgtg gt cacaaattcgtatctaggggaatatgtagttgacataaacact ccgctct hsa-mir- 1247 10b ccagaggttgtaacgttgtcCatatataccctgtagaaccgaatttgtgtggtatccg ta tagtcacagattcgattctaggggaatatatggtcgatgcaaa aacttca hsa-mir- 1248

34a ggccagctgtgagtgtttctttggcagtgtcttagctggttgttgtgagcaatagtaa gg aagcaatcagcaagtatactgccctagaagtgctgcacgttgt ggggccc hsa-mir- 1249

181a agaagggctatcaggccagccttcagaggactccaaggaacattcaacgctgtcggtg ag tttgggatttgaaaaaaccactgaccgttgactgtaccttggg gtcctta hsa-mir- 1250

18Ib-I cctgtgcagagattattttttaaaaggtcacaatcaacattcattgctgtcggtgggt tg aactgtgtggacaagctcactgaacaatgaatgcaactgtggc cccgctt hsa-mir- 1251

181c cggaaaatttgccaagggtttgggggaacattcaacctgtcggtgagtttgggcagct ca ggcaaaccatcgaccgttgagtggaccctgaggcctggaattg ccatcct hsa-mir- 1252

182 gagctgcttgcctccccccgtttttggcaatggtagaactcacactggtgaggtaaca gg atccggtggttctagacttgccaactatggggcgaggactcag ccggcac hsa-mir- 1253

183 ccgcagagtgtgactcctgttctgtgtatggcactggtagaattcactgtgaacagtc tc agtcagtgaattaccgaagggccataaacagagcagagacaga tccacga hsa-mir- 1254

187 ggtcgggctcaccatgacacagtgtgagacctcgggctacaacacaggacccgggcgc tg ctctgacccctcgtgtcttgtgttgcagccggagggacgcagg tccgca hsa-mir- 1255

196a-2 tgctcgctcagctgatctgtggcttaggtagtttcatgttgttgggattgagttttga ac tcggcaacaagaaactgcctgagttacatcagtcggttttcgt cgagggc hsa-mir- 1256

199a-2 aggaagcttctggagatcctgctccgtcgccccagtgttcagactacctgttcaggac aa tgccgttgtacagtagtctgcacattggttagactgggcaagg gagagca hsa-mir- 1257

199b ccagaggacacctccactccgtctacccagtgtttagactatctgttcaggactccca aa ttgtacagtagtctgcacattggttaggctgggctgggttaga ccctcgg hsa-mir- 1258

203 gtgttggggactcgcgcgctgggtccagtggttcttaacagttcaacagttctgtagc gc aattgtgaaatgtttaggaccactagacccggcgggcgcggcg acagcga hsa-mir- 1259

204 ggctacagtctttcttcatgtgactcgtggacttccctttgtcatcctatgcctgaga at atatgaaggaggctgggaaggcaaagggacgttcaattgtcat cactggc hsa-mir- • 1260

205 aaagatcctcagacaatccatgtgcttctcttgtccttcattccaccggagtctgtct ca tacccaaccagatttcagtggagtgaagttcaggaggcatgga gctgaca hsa-mir- 1261

210 acccggcagtgcctccaggcgcagggcagcccctgcccaccgcacactgcgctgcccc ag acccactgtgcgtgtgacagcggctgatctgtgcctgggcagc gcgaccc^' hsa-mir- 1262

211 tcacctggccatgtgacttgtgggcttccctttgtcatccttcgcctagggctctgag ca gggcagggacagcaaaggggtgctcagttgtcacttcccacag cacggag hsa-mir- 1263

212 cggggcaccccgcccggacagcgcgccggcaccttggctctagactgcttactgcccg gg ccgccctcagtaacagtctccagtcacggccaccgacgcctgg ccccgcc hsa-mir- 1264

213 tgagttttgaggttgcttcagtgaacattcaacgctgtcggtgagtttggaattaaaa tc aaaaccatcgaccgttgattgtaccctatggctaaccatcatc tactcca hsa-mir- 1265

214 ggcctggctggacagagttgtcatgtgtctgcctgtctacacttgctgtgcagaacat cc gctcacctgtacagcaggcacagacaggcagtcacatgacaac ccagcct hsa-mir- 1266

215 atcattcagaaatggtatacaggaaaatgacctatgaattgacagacaatatagctga gt ttgtctgtcatttctttaggccaatattctgtatgactgtgct acttcaa hsa-mir- 1267

216 gatggctgtgagttggcttaatctcagctggcaactgtgagatgttcatacaatccct ca cagtggtctctgggattatgctaaacagagcaatttcctagcc ctcacga hsa-mir- 1268 217 agtataattattacatagtfctttgatgtcgcagafcactgcatcaggaactgattggat aa gaatcagtcaccatcagttcctaatgcattgccttcagcatct aaacaag hsa-mir- 1269

218-1 gtgataatgtagcgagattttctgttgtgcttgatctaaccatgtggttgcgaggtat ga gtaaaacatggttccgtcaagcaccatggaacgtcacgcagct ttctaca hsa-mir- 1270

^■218-2 gaccagtcgctgcggggctttcctttgtgcttgatctaaccatgtggtggaacgatgg aa acggaacatggttctgtcaagcaccgcggaaagcaccgtgctc tcctgca hsa-mir- 1271

219-1 ccgccccgggccgcggctcctgattgtccaaacgcaattctcgagtctatggctccgg cc gagagttgagtctggacgtcccgagccgccgcccccaaacctc gagcggg hsa-mir- 1272

220 gacagtgtggcattgtagggctccacaccgtatctgacactttgggcgagggcaccat gc tgaaggtgttcatgatgcggtctgggaactcctcacggatctt actgatg hsa-mir- 1273

221 ' tgaacatccaggtctggggcatgaacctggcatacaatgtagatttctgtgttcgtta gg caacagctacattgtctgctgggtttcaggctacctggaaaca tgttctc hsa-mir- 1274

222 gctgctggaaggtgtaggtaccctcaatggctcagtagccagtgtagatcctgtcttt eg taatcagcagctacatctggctactgggtctctgatggcatct tetaget hsa-mir- 1275

223 cctggcctcctgcagtgccacgctccgtgtatttgacaagctgagttggacactccat gt ggtagagtgtcagtttgtcaaataccccaagtgcggcacatgc ttaccag hsa-mir- 1276

224 gggctttcaagtcactagtggttccgtttagtagatgattgtgcattgtttcaaaatg gt gccctagtgactacaaagccc hsa-mir- 1277

200b ccagctcgggcagccgtggccatcttactgggcagcattggatggagtcaggtctcta at actgcctggtaatgatgacggcggagccctgc acg hsa-let- ^' 1278

7g aggctgaggtagtagtttgtacagtttgagggtctatgataccacccggtacaggaga ta actgtacaggccactgccttg cca hsa-let- 1279

7i ctggctgaggtagtagtttgtgctgttggtcgggttgtgacattgcccgctgtggaga ta actgcgcaagctactgccttg eta hsa-mir- ^' 1280

1-2 acctactcagagtacatacttctttatgtacccatatgaacatacaatgctatggaat gt aaagaagtatgtatttttggt aggc hsa-mir- 1281

15b ttgaggccttaaagtactgtagcagcacatcatggtttacatgctacaghcaagatgc ga atcattatttgctgctctagaaatttaaggaa attcat hsa-mir- 1282

23b ctcaggtgctctggctgcttgggttcctggcatgctgatttgtgacttaagattaaaa tc acattgccagggattaccacgcaaccacgacc ttggc hsa-mir- 1283

27b acctctctaacaaggtgcagagcttagctgattggtgaacagtgattggtttccgctt tg ttcacagtggctaagttctgcacctgaagaga aggtg hsa-mir- 1284

30b accaagtttcagttcatgtaaacatcctacactcagctgtaatacatggattggctgg ga ggtggatgtttacttcagctg acttgga hsa-mir- ^• 1285

122a ccttagcagagctgtggagtgtgacaatggtgtttgtgtctaaactatcaaacgccat ta tcacactaaatagctactgct aggc hsa-mir- 1286

124a-l aggcctctctctccgtgttcacagcggaccttgatttaaatgtccatacaattaaggc ac gcggtgaatgccaagaatggg gctg hsa-mir- 1287

124a-2 atcaagattagaggctctgctctccgtgttcacagcggaccttgatttaatgtcatac aa ttaaggcacgcggtgaatgccaagagcggagcctacggctgca cttgaa hsa-mir- 1288

124a-3 tgagggcccctctgcgtgttcacagcggaccttgatttaatgtctatacaattaaggc ac gcggtgaatgccaagagaggcgcctcc hsa-mir- 1289

125b-l tgcgctcctctcagtccctgagaccctaacttgtgatgtttaccgtttaaatccacgg gt taggctcttgggagctgcgag tcgtgct hsa-mir- 1290

128a tgagctgttggattcggggccgtagcactgtctgagaggtttacatttctcacagtga ac cggtctctttttcagctgctt c hsa-mir- 1291

130a tgctgctggccagagctcttttcacattgtgctactgtctgcacctgtcactagcagt gc aatgttaaaagggcattggccgtgtagtg hsa-mir- 1292

132 ccgcccccgcgtctccagggcaaccgtggctttcgattgttactgtgggaactggagg ta acagtctacagccatggtcgccccgcagcacgcccacgcgc hsa-mir- 1293

133a-l acaatgctttgctagagctggtaaaatggaaccaaatcgcctcttcaatggatttggt cc ccttcaaccagctgtagctat gcattga hsa-mir- 1294

133a-2 gggagccaaatgctttgctagagctggtaaaatggaaccaaatcgactgtccaatgga tt tggtccccttcaaccagctgtagctgtgcattgatggcgccg hsa-mir- 1295

135a-l aggcctcgctgttctctatggctttttattcctatgtgattctactgctcactcatat ag ggattggagccgtggcgcacggcggggaca hsa-mir- . 1296

135a-2 agataaattcactctagtgctttatggctttttattcctatgtgatagtaataaagtc tc atgtagggatggaagccatgaaatacattgtg aaaaatca hsa-mir- 1297

137 ggtcctctgactctcttcggtgacgggtattcttgggtggataatacggattacgttg tt attgcttaagaatacgcgtagtcgaggagagtaccagcggca hsa-mir- 1298

138-2 cgttgctgcagctggtgttgtgaatcaggccgacgagcagcgcatcctcttacccggc ta tttcacgacaccagggttgca tea hsa-mir- 1299

140 tgtgtctctctctgtgtcctgccagtggttttaccctatggtaggttacgtcatgctg tt ctaccacagggtagaaccacggacaggataccggggcacc hsa-mir- 1300

141 cggccggccctgggtccatcttccagtacagtgttggatggtctaattgtgaagctcc ta acactgtctggtaaagatggctcccgggtggg ttc hsa-mir- 1301

142 gacagtgcagtcacccataaagtagaaagcactactaacagcactggagggtgtagtg tt tcctactttatggatgagtgt actgtg hsa-mir- 1302

143 gcgcagcgccctgtctcccagcctgaggtgcagtgctgcatctctggtcagttgggag tc tgagatgaagcactgtagctcaggaagagagaagttgttctgc age hsa-mir- 1303

144 tggggccctggctgggatatcatcatatactgtaagtttgcgatgagacactacagta ta gatgatgtactagtccgggca ccccc hsa-mir- 1304

145 caccttgtcctcacggtccagttttcccaggaatcccttagatgctaagatggggatt cc tggaaatactgttcttgaggt catggtt hsa-mir- 1305

152 tgtcccccccggcccaggttctgtgatacactccgactcgggctctggagcagtcagt gc atgacagaacttgggcccggaaggacc hsa-mir- 1306

153-1 ctcacagctgccagtgtcatttttgtgatcCgcagctagtattctcactccagttgca ta gtcacaaaagtgatcattggcaggtgtggc hsa-mir- 1307

153-2 agcggtggccagtgtcatttttgtgatgttgcagctagtaatatgagcccagttgcat ag tcacaaaagtgatcattggaa actgtg hsa-mir- 1308

191 cggctggacagcgggcaacggaatcccaaaagcagctgttgtctccagagcattccag ct gcgcttggatttcgtcccctgctctcctgcct hsa-mir- 1309

9-1 cggggttggttgttatctttggttatctagctgtatgagtggtgtggagtcttcataa ag ctagataaccgaaagtaaaaataacccca hsa-mir- 1310

9-2 ggaagcgagttgttatctttggttatctagctgtatgagtgtattggtcttcataaag ct agataaccgaaagtaaaaactccttca hsa-mir- 1311

9-3 ggaggcccgtttctctctttggttatctagctgtatgagtgccacagagccgtcataa ag ctagataaccgaaagtagaaatgattctca hsa-mir- 1312

125a tgccagtctctaggtccctgagaccctttaacctgtgaggacatccagggtcacaggt ga ggttcttgggagcctggcgtc tggcc hsa-mir- 1313

125b-2 accagacttttcctagtccctgagaccctaacttgtgaggtattttagtaacatcaca ag tcaggctcttgggacctaggcggagggga hsa-mir- 1314

126 cgctggcgacgggacattattacttttggtacgcgctgtgacacttcaaactcgtacc gt gagtaataatgcgccgtccac ggca hsa-mir- 1315

127 tgtgatcactgtctccagcctgctgaagctcagagggctctgattcagaaagatcatc gg atccgtctgagcttggctggtcggaagtctca tcatc hsa-mir- 1316

129-2 tgcccttcgcgaatctttttgcggtctgggcttgctgtacataactcaatagccggaa gc ccttaccccaaaaagcatttgcggagggcg hsa-mir- 1317

134 cagggtgtgtgactggttgaccagaggggcatgcactgtgttcaccctgtgggccacc ta gtcaccaac cctc hsa-mir- 1318

136 tgagccctcggaggactccatttgttttgatgatggattcttatgctccatcatcgtc tc aaatgagtcttcagagggttc t hsa-mir- 1319

138-1 ccctggcatggtgtggtggggcagctggtgttgtgaatcaggccgttgccaatcagag aa cggctacttcacaacaccagggccacaccacactacagg hsa-mir- ^" 1320

146 ccgatgtgtatcctcagctttgagaactgaattccatgggttgtgtcagtgtcagacc tc tgaaattcagttcttcagctgggatatctctg tcatcgt hsa-mir- 1321

149 gccggcgcccgagctctggctccgtgtcttcactcccgtgcttgtccgaggagggagg ga gggacgggggctgtgctggggcagctgga hsa-mir- 1322

150 ctccccatggccctgtctcccaacccttgtaccagtgctgggctcagaccctggtaca gg cctgggggacagggacctggg gac hsa-mir- 1323

154 gtggtacttgaagataggttatccgtgttgccttcgctttatttgtgacgaatcatac ac ggttgacctatttttcagtac caa hsa-mir- 1324

184 ccagtcacgtccccttatcacttttccagcccagctttgtgactgtaagtgttggacg ga gaactgataagggtaggtgat ₍ tga hsa-mir- 1325

185 agggggcgagggattggagagaaaggcagttcctgatggtcccctccccaggggctgg ct ttcctctggtccttccctccc a hsa-mir- 1326

186 tgcttgtaactttccaaagaattctccttttgggctttctggt tttattttaagcccaaa ggtgaattttttgggaagttt gagct hsa-mir- 1327

188 tgctccctctctcacatcccttgcatggtggagggtgagctttctgaaaacccctccc ac atgcagggtttgcaggatggc gagcc hsa-mir- 1328

190 tgcaggcctctgtgtgatatgtttgatatattaggttgttatt taatccaactatatatc aaacatattcctacagtgtct tgcc hsa-mir- 1-329

193 cgaggatgggagctgagggctgggtctttgcgggcgagatgagggtgtcggatcaact gg cctacaaagtcccagttctcggcccccg hsa-mir- 1330

194-1 atggtgttatcaagtgtaacagcaactccatgtggactgtgtaccaatttccagtgga ga tgctgttacttttgatggtta ccaa hsa-mir- 1331

195 agcttccctggctctagcagcacagaaatattggcacagggaagcgagtctgccaata tt ggctgtgctgctccaggcagg gtggtg hsa-mir- 1332

206 tgcttcccgaggccacatgcttctttatatccccatatggattactttgctatggaat gt aaggaagtgtgtggtttcggc aagtg hsa-mir- 1333

320 gcttcgctcccctccgccttctcttcccggttcttcccggagtcgggaaaagctgggt tg agagggcgaaaaaggatgagg t ϊisa-mir- 1334

200c ccctcgtcttacccagcagtgtttgggtgcggttgggagtctctaatactgccgggta at gatggagg hsa-mir- 1335

1-1 tgggaaacatacttctttatatgcccatatggacctgctaagctatggaatgtaaaga ag tatgtatct ca hsa-mir- 1336

155 ctgttaatgctaatcgtgataggggtttttgcctccaactgactcctacatattagca tt aacag hsa-mir- 1337

181b-2 ctgatggctgcactcaacattcattgctgtcggtgggtttgagtctgaatcaactcac tg atcaatgaatgcaaactgcggaccaaaca hsa-mir- 1338

128b tgtgcagtgggaaggggggccgatacactgtacgagagtgagtagcaggtctcacagt ga accggtctctttccctactgt gtc hsa-mir- ^' 1339

194-2 tggttcccgccccctgtaacagcaactccatgtggaagtgcccactggttccagtggg gc tgctgttatctggggcgaggg ccag hsa-mir- 1340

106b cctgccggggctaaagtgctgacagtgcagatagtggtcctctccgtgctaccgcact gt gggtacttgctgctccagcag g hsa-mir- 1341

29c atctcttacacaggctgaccgatttctcctggtgttcagagtctgtttttgtctagca cc atttgaaatcggttatgatgt aggggga hsa-mir- 1342

3Oc-I accatgctgtagtgtgtgtaaacatcctacactctcagctgtgagctcaaggtggctg gg agagggttgtttactccttctgccatgga hsa-mir- 1343

200a ccgggcccctgtgagcatcttaccggacagtgctggatttcccagcttgactctaaca ct gtctggtaacgatgttcaaaggtgacccgc hsa-mir- 1344

302a ccaccacttaaacgtggatgtacttgctttgaaactaaagaagtaagtgcttccatgt tt tggtgatgg hsa-mir- . 1345

101-2 actgtcctttttcggttatcatggtaccgatgctgtatatctgaaaggtacagtactg tg ataactgaagaatggtggt hsa-mir- 1346

219-2 actcaggggcttcgccactgattgtccaaacgcaattcttgtacgagtctgcggccaa cc gagaattgtggctggacatctgtggctgagct ccggg hsa-mir- 1347

34b gtgctcggtttgtaggcagtgtcattagctgattgtactgtggtggttacaatcacta ac tccactgccatcaaaacaagg cac hsa-mir- 1348

34c agtctagttactaggcagtgtagttagctgattgctaatagtaccaatcactaaccac ac ggccaggtaaaaagatt hsa-mir- 1349

299 aagaaatggtttaccgtcccacatacattttgaatatgtatgtgggatggtaaaccgc tt ctt hsa-mir- 1350

301 actgctaacgaatgctctgactttattgcactactgtactttacagctagcagtgcaa ta gtattgtcaaagcatctgaaa gcagg hsa-mir- 1351

99b ggcacccacccgtagaaccgaccttgcggggccttcgccgcacacaagctcgtgtctg tg ggtccgtgt c hsa-mir- 1352

296 aggacccttccagagggccccccctcaatcctgttgtgcctaattcagagggttgggt gg aggctctcctgaagggctct hsa-mir- 1353

130b ggcctgcccgacactctttccctgttgcactactataggccgctgggaagcagtgcaa tg atgaaagggcatcggtcaggt c hsa-mir- 1354

3Oe gggcagtctttgctactgtaaacatccttgactggaagctgtaaggtgttcagaggag ct ttcagtcggatgtttacagcggcaggctgcca hsa-mir- 1355

26a-2 ggctgtggctggattcaagtaatccaggataggctgtttccatctgtgaggcctattc tt gattacttgtttctggaggca get hsa-mir- ■ 1356 361 ggagcttatcagaatctccaggggtactttataatttcaaaaagtcccccaggtgtga . tt ctgatttgc ttc hsa-mir- 1357

302b gctcccttcaactttaacatggaagtgctttctgtgactttaaaagtaagtgcttcca tg ttttagtag gagt hsa-mir- 1358

302c cctttgctttaacatgggggtacctgctgtgtgaaacaaaagtaagtgcttccatgtt tc agtggagg hsa-mir- 1359

302d cctctactttaacatggaggcacttgctgtgacatgacaaaaataagtgcttccatgt tt gagtgtgg hsa-mir- 1360

367 ccattactgttgctaatatgcaactctgttgaatataaattggaattgcactttagca at ggtgatgg hsa-mir- 1361

368 aaaaggtggatattccttctatgtttatgttatttatggttaaacatagaggaaattc ca cgtttt hsa-mir- 1362

369 ttgaagggagatcgaccgtgttatattcgctttattgacttcgaataatacatggttg at cttttctca g hsa-mir- 1363

370 agacagagaagccaggtcacgtctctgcagttacacagctcacgagtgcctgctgggg tg gaacctggtctgtct hsa-mir- 1364

371 gtggcactcaaactgtgggggcactttctgctctctggtgaaagtgccgccatctttt ga gtgttac hsa-mir- ^' 1365

372 gtgggcctcaaatgtggagcactattctgatgtccaagtggaaagtgctgcgacattt ga gcgtcac hsa-mir- 1366

373 gggatactcaaaatgggggcgctttcctttttgtctgtactgggaagtgcttcgattt tg gggtgtccc hsa-mir- 1367

374 tacatcggccattataatacaacctgataagtgttatagcacttatcagattgtattg ta attgtctgt gta hsa-mir- 1368

375 ccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcg tg aggc hsa-mir- 1369

376a taaaaggtagattctccttctatgagtacattatttatgattaatcatagaggaaaat cc acgttttc hsa-mir- 1370

377 ttgagcagaggttgcccttggtgaattcgctttatttatgttgaatcacacaaaggca ac ttttgtttg hsa-mir- 1371

378 agggctcctgactccaggtcctgtgtgttacctagaaatagcactggacttggagtca ga aggcct hsa-mir- 1372

379 agagatggtagactatggaacgtaggcgttatgatttctgacctatgtaacatggtcc ac taactct hsa-mir- 1373

380 aagatggttgaccatagaacatgcgctatctctgtgtcgtatgtaatatggtccacat ct t hsa-mir- 1374

381 tacttaaagcgaggttgccctttgtatattcggtttattgacatggaatatacaaggg ca agctctctgtgagta hsa-mir- 1375

382 tacttgaagagaagttgttcgtggtggattcgctttacttatgacgaatcattcacgg ac aacacttttttcagta hsa-mir- 1376

383 ctcctcagatcagaaggtgattgtggctttgggtggatattaatcagccacagcactg cc tggtcagaa agag hsa-mir- 1377

340 ttgtacctggtgtgattataaagcaatgagactgattgtcatatgtcgtttgtgggat cc gtctcagttactttatagccatacctggtatc tta hsa-mir- 1378

330 ctttggcgatcactgcctctctgggcctgtgtcttaggctctgcaagatcaaccgagc aa agcacacggcctgcagagaggcagcgctctgc cc hsa-mir- 1379 328 tggagtgggggggcaggaggggctcagggagaaagtgcatacagcccctggccctctc tg cccttccgtcccctg hsa-mir- 1380

342 gaaactgggctcaaggtgaggggtgctatctgtgattgagggacatggttaatggaat tg tctcacacagaaatcgcacccgtcaccttggc ctactta hsa-mir- 1381

337 gtagtcagtagttggggggtgggaacggcttcatacaggagttgatgcacagttatcc ag ctcctatatgatgcctttcttcatccccttca a hsa-mir- 1382

323 ttggtacttggagagaggtggtccgtggcgcgttcgctttatttatggcgcacattac ac ggtcgacctctttgcagtatc taatc hsa-mir- 1383

326 ctcatctgtctgttgggctggaggcagggcctttgtgaaggcgggtggtgctcagatc gc ctctgggcccttcctccagccccgaggcggat tea hsa-mir- 1384

151 tttcctgccctcgaggagctcacagtctagtatgtctcatcccctactagactgaagc tc cttgaggacagggatggtcatactcacctc hsa-mir- 1385

135b cactctgctgtggcctatggcttttcattcctatgtgattgctgtcccaaactcatgt ag ggctaaaagccatgggctacagtgaggggcga gctcc hsa-mir- 1386

148b caagcacgattagcatttgaggtgaagttctgttatacactcaggctgtggctctctg aa agtcagtgcatcacagaactttgtctcgaaag ctttcta hsa-mir- 1387

331 gagtttggttttgtttgggtttgttctaggtatggtcccagggatcccagatcaaacc ag gcccctgggcctatcctagaaccaacctaagc tc hsa-mir- 1388

324 ctgactatgcctccccgcatcccctagggcattggtgtaaagctggagacccactgcc cc aggtgctgctgggggttgtag tc hsa-mir- 1389

338 tctccaacaatatcctggtgctgagtgatgactcaggcgactccagcatcagtgattt tg ttgaaga hsa-mir- 1390

339 cggggcggccgctctccctgtcctccaggagctcacgtgtgcctgcctgtgagcgcct eg acgacagagccggcgcctgccccagtgtctgc gc hsa-mir- 1391

335 tgttttgagcgggggtcaagagcaataacgaaaaatgtttgtcataaaccgtttttca tt attgctcctgacctcctctcatttgctatatt ca hsa-mir- 1392

133b cctcagaagaaagatgccccctgctctggctggtcaaacggaaccaagtccgtcttcc tg agaggtttggtccccttcaaccagctacagcagggctggcaatgcccagtccttggag a hsa-mir- 1393

325 atacagtgcttggttcctagtaggtgtccagtaagtgtttgtgacataatttgtttat tg aggacctcctatcaatcaagcactgtgctagg ctctgg hsa-mir- 1394

345 acccaaaccctaggtctgctgactcctagtccagggctcgtgatggctggtgggccct ga acgaggggtctggaggcctgggtttgaatatc gacage hsa-mir- 1395

346 gtctgtctgcccgcatgcctgcctctctgttgctctgaaggaggcaggggctgggcct gc agctgcctgggcagagcggct cctgc hsa-mir- 1396

384 tgttaaatcaggaattttaaacaattcctagacaatatgtataatgttcataagtcat tc ctagaaattgttcataatgcc tgtaaca hsa-mir- 1397

196b actggtcggtgatttaggtagtttcctgttgttgggatccacctttctctcgacagca eg acactgccttcattacttcag ttg hsa-mir- 1398

108 acactgcaagaacaataaggatttttaggggcattatgactgagtcagaaaacacagc tg cccctgaaagtcecteatttttcttgctgtec hsa-mir- 1399

422a gagagaagcactggacttagggtcagaaggcctgagtctctctgctgcagatgggctc tc tgtccctgagccaagctttgtcctccctgg hsa-mir- 1400

423 ataaaggaagttaggctgaggggcagagagcgagacttttctattttccaaaagctcg gt ctgaggcccctcagtcttgcttcctaacccgc gc hsa-mir- 1401

424 cgaggggatacagcagcaattcatgttttgaagtgttctaaatggttcaaaacgtgag gc gctgctataccccctcgtggggaaggtagaag gtgggg hsa-mir- 1402

425 gaaagcgctttggaatgacacgatcactcccgttgagtgggcacccgagaagccatcg gg aatgtcgtgtccgcccagtgc tctt tc

Table 4 mature iuiRNA Seg ID No sequences hsa-let-7a(2) 1403 tgaggtagtaggttgta tagtt hsa-let-7b(2) 1404 tgaggtagtaggttgtg tggtt hsa-let-7c(2) 1405 tgaggtagtaggttgta tggtt hsa-let-7d<2) 1406 agaggtagtaggttgca tagt hsa-let-7e<2) 1407 tgaggtaggaggttgta tagt hsa-let-7f (2) 1408 tgaggtagtagattgta tagtt hsa-miR-15a(2) 1409 tagcagcacataatggt ttgtg hsa-miR-16 (2) 1410 tagcagcacgtaaatat tggcg hsa-miR-17-3p (2 ) 1411 actgcagtgaaggcact tgt hsa-miR-17 -5p ( 2 ) 1412 caaagtgcttacagtgcaggtagt hsa-miR-18(2) 1413 taaggtgcatctagtgc agata hsa-miR-19a(2)^' 1414 gtgcaaatctatgcaa

tgtgcaaatccatgcaa aactga hsa-miR-20 (2) 1416 taaagtgcttatagtgc aggtag hsa-miR-21(2) 1417 tagcttatcagactgat gttga hsa-miR-22 (2) 1418 aagctgccagttgaaga actgt hsa-miR-23a<2) 1419 atcacattgccagggat ttcc hsa-miR-189 <2) 1420 gtgcctactgagctgat atcagt hsa-miR-24(2) 1421 hggctcagttcagcagg aacag hsa-miR-25(2) 1422 cattgcacttgtctcgg tctga hsa-miR-26a<2) 1423 ttcaagtaatccaggat aggc hsa-miR-26b(2) 1424 ttcaagtaattcaggat aggtt hsa-miR-27a(2) 1425 ttcacagtggctaagtt ccgc hsa-miR-28 (2) 1426 aaggagctcacagtcta ttgag hsa-miR-29a (2) 1427 tagcaccatctgaaatc ggtt hsa-miR-30a-3p(2) 1428 ctttcagtcggatgttt gcagc hsa-miR-30a-5p (2 ) 1429 tgtaaacatcctcgact ggaag hsa-miR-31 (2) 1430 ggcaagatgctggcata gctg hsa-miR-32(2) 1431 tattgcacattactaag ttgc hsa-miR-33 (2) 1432 gtgcattgtagttgcat tg hsa-miR-92 (2) 1433 tattgcacttgtcccgg cctg hsa-miR-93 ( 2 ) 1434 aaagtgctgttcgtgca ggtag hsa-miR-95 ( 2 ) 1435 ttcaacgggtatttatt gag c a hsa-miR-96 ( 2 ) 1436 tttggcactagcacatt cttgc hsa-miR-98 ( 2 ) 1437 tgaggtagtaagttgta ttgtt hsa-miR-99a ( 2 ) 1438 aacccgtagatccgatc ttgtg hsa-miR-100 ( 2 ) 1439 aacccgtagatccgaac ttgtg hsa-miR-101 ( 2 ) 1440 tacagtactgtgataac tgaag hsa-miR-29b ( 2 ) 1441 tagcaccatttgaaatc agtgtt hsa-miR-103 (2) 1442 agcagcattgtacaggg ctatga hsa-miR-105 (2) 1443 tcaaatgctcagactcc tgt hsa-miR-106a(2) 1444 aaaagtgcttacagtgcaggtagc hsa-miR-107 (2) 1445 agcagcattgtacaggg ctatca hsa-miR-192(2) 1446 ctgacctatgaattgac agec hsa-miR-196a (2) 1447 taggtagtttcatgttg ttgg hsa-miR-197 (2) 1448 ttcaccaccttctccac ccage hsa-miR-198 (2) 1449 ggtccagaggggagata gg hsa-miR-199a (2) 1450 cccagtgttcagactac ctgttc hsa-miR-199a* (2) 1451 tacagtagtctgcacat tggtt hsa-miR-208 (2) 1452 ataagacgagcaaaaag cttgt hsa-miR-129 (2) 1453 ctttttgcggtctgggc ttgc hsa-miR-148a(2) 1454 tcagtgcactacagaac tttgt hsa-miR-30c (2) 1455 tgtaaacatcctacact ctcagc hsa-miR-30d(2) 1456 tgtaaacatccccgact ggaag hsa-miR-139(2) 1457 tctacagtgcacgtgtc t hsa-miR-147(2> 1458 gtgtgtggaaatgcttc tgc hsa-miR-7(2) 1459 tggaagactagtgattt tgttg hsa-miR-10a(2) 1460 taccctgtagatccgaa tttgtg hsa-miR-10b(2) 1461 taccctgtagaaccgaa tttgt hsa-miR-34a(2) 1462 tggcagtgtcttagctg gttgtt hsa-miR-181a(2) 1463 aacattcaacgctgtcg gtgagt hsa-miR-181b(2) 1464 aacattcattgctgtcg gtggg hsa-miR-181c(2) 1465 aacattcaacctgtcgg tgagt hsa-miR-182 ( 2 ) 1466 tttggcaatggtagaac tcaca hsa-miR-182* (2) 1467 tggttctagacttgcca acta hsa-miR-183(2) 1468 tatggcactggtagaat tcactg hsa-miR-187(2) 1469 tcgtgtcttgtgttgca gccg hsa-miR-199b(2) 1470 cccagtgtttagactat ctgttc hsa-miR-203{2) 1471 gtgaaatgtttaggacc actag hsa-πιiR-204(2) 1472 ttccctttgtcatccta tgcct hsa-miR-205(2) 1473 tccttcattccaccgga gtctg hsa-miR-210 (2) 1474 ctgtgcgtgtgacagcg gctga hsa-miR-211 (2) 1475 ttccctttgtcatcctt cgcct hsa-miR-212<2) 1476 taacagtctccagtcac ggcc hsa-miR-213(2) 1477 accatcgaccgttgatt gtacc hsa-miR-214<2) 1478 acagcaggcacagacag gcag hsa-miR-215 (2) 1479 atgacctatgaattgac agac hsa-miR-216 (2) 1480 taatctcagctggcaac tgtg hsa-miR-217 (2) 1481 tactgcatcaggaactg attggat hsa-miR-218 (2) 1482 ttgtgcttgatctaacc atgt hsa-miR-219 (2) 1483 tgattgtccaaacgcaa ttct hsa-miR-220 (2) 1484 ccacaccgtatctgaca cttt hsa-miR-221(2) 1485 agctacattgtctgctg ggtttc hsa-miR-222 (2) 1486 agctacatctggctact gggtctc hsa-miR-223 (2) 1487 tgtcagtttgtcaaata cccc hsa-miR-224 (2) 1488 caagtcactagtggttc cgttta hsa-miR-200b(2) 1489 taatactgcctggtaat gatgac hsa-let-7g(2) 1490 tgaggtagtagtttgta cagt hsa-let-7i(2) 1491 tgaggtagtagtttgtg ctgt hsa-miR-1 (2) 1492 tggaatgtaaagaagta tgta hsa-miR-15b < 2 ) 1493 tagcagcacatcatggt ttaca hsa-miR-23b<2) 1494 atcacattgccagggat tacc hsa-miR-27b<2) 1495 ttcacagtggctaagtt ctgc hsa-miR-30b<2) 1496 tgtaaacatccCacact cagct hsa-miR-122a (2 ) 1497 tggagtgtgacaatggt gtttgt hsa-miR-124a (2) 1498 ttaaggcacgcggtgaa tgcca hsa-miR-125b(2) 1499 tccctgagaccctaact tgtga hsa-miR-128a{2) 1500 tcacagtgaaccggtct ctttt hsa-miR-130a(2) 1501 cagtgcaatgttaaaag ggcat hsa-miR-132 (2) 1502 taacagtctacagccat ggtcg hsa-miR-133a(2) 1503 ttggtccccttcaacca gctgt hsa-miR-135a (2) 1504 tatggctttttattcct atgtga hsa-miR-137<2) 1505 tattgcttaagaatacg cgtag hsa-miR-138(2) 1506 agctggtgttgtgaatc hsa-miR-140 (2) 1507 agtggttttaccctatg gtag hsa-miR-141(2) 1508 taacactgtctggtaaa gatgg hsa-miR-142-3p(2) 1509 tgtagtgtttcctactt tatgga hsa-miR-142-5p(2) 1510 cataaagtagaaagcac tac hsa-miR-143 (2) 1511 tgagatgaagcactgta gctca hsa-miR-144(2) 1512 tacagtatagatgatgt actag hsa-miR-145(2) 1513 gtccagttttcccagga atccctt hsa-miR-152(2) 1514 tcagtgcatgacagaac ttggg hsa-miR-153{2) 1515 ttgcatagtcacaaaag tga hsa-miR-191(2) 1516 caacggaatcccaaaag cagct hsa-miR-9(2) 1517 tctttggttatctagct gtatga hsa-miR-9*(2) 1518 taaagctagataaccga aagt hsa-miR-125a(2) 1519 tccctgagaccctttaa cctgtg hsa-miR-126(2) 1520 tcgtaccgtgagtaata atgc hsa-miR-126*(2) 1521 cattattacttttggta cgcg hsa-miR-127(2) 1522 tcggatccgtctgagct tggct hsa-miR-134(2) 1523 tgtgactggttgaccag aggg hsa-miR-136(2) 1524 actccatttgttttgat gatgga hsa-miR-146(2) 1525 tgagaactgaattccat gggtt hsa-miR-149(2) 1526 hctggctccgtgtcttc actcc hsa-miR~150(2) 1527 tctcccaacccttgtac cagtg hsa-miR-154{2) 1528 taggttatccgtgttgc cttcg hsa-miR-154* (2) 1529 aatcatacacggttgac ctatt hsa-miR-184(2) 1530 tggacggagaactgata agggt hsa-miR-185{2) 1531 tggagagaaaggcagtt c hsa-miR-186 ( 2 ) 1532 caaagaattctcctttt gggctt hsa-miR-188 (2) 1533 catcccttgcatggtgg agggt hsa-miR-190 (2) 1534 tgatatgtttgatatac taggt hsa-miR-193 (2) 1535 aactggcctacaaagtc ccag hsa-miR-194(2) 1536 tgtaacagcaactccat

Stgga hsa-miR-195(2) 1537 tagcagcacagaaatat tggc hsa-miR-206 (2) 1538 tggaatgtaaggaagtg tgtgg hsa-miR-320 (2) 1539 aaaagctgggttgagagggcgaa hsa-miR-200c (2) 1540 taatactgccgggtaat gatgg hsa-miR-155 (2) 1541 ttaatgctaatcgtgat agggg hsa-miR-128b(2) 1542 tcacagtgaaccggtct ctttc hsa-miR-106b(2) 1543 taaagtgctgacagtgc agat hsa-miR-29c (2) 1544 tagcaccatttgaaatc ggt hsa-miR-200a(2) 1545 taacactgtctggtaac gatgt hsa-miR-302a(2) 1546 taagtgcttccatgttt tggtga hsa-miR-302a* (2) 1547 taaacgtggatgtactt gcttt hsa-miR-34b(2) 1548 taggcagtgtcattagc tgattg hsa-miR-34c (2) 1549 aggcagtgtagttagct gattgc hsa-miR-299(2) 1550 tggtttaccgtcccaca tacat hsa-miR-301(2) 1551 cagtgcaatagtattgt caaagc hsa-miR-99b(2) 1552 cacccgtagaaccgacc ttgcg hsa-miR-296(2) 1553 agggccccccctcaatc ctgt hsa-miR-130b(2) 1554 cagtgcaatgatgaaag ggcat hsa-miR-30e-3p(2) 1555 ctttcagtcggatgttt acagc hsa-miR-30e-5p(2) 1556 tgtaaacatccttgact gga hsa-miR-361(2) 1557 ttatcagaatctccagg ggtac hsa-miR-302b(2) 1558 taagtgcttccatgttt tagtag hsa-miR-302b*(2) 1559 ac11taacatggaagtg ctttct hsa-miR-302c(2) 1560 taagtgcttccatgttt cagtgg hsa-miR-302c*(2) 1561 tttaacatgggggtacc tgctg hsa-miR-302d{2) 1562 taagtgcttccatgttt gagtgt hsa-miR-367(2) 1563 aattgcactttagcaat ggtga hsa-miR-368(2) 1564 acatagaggaaattcca cgttt hsa-miR-369(2) 1565 aataatacatggttgat cttt hsa-miR-370(2) . 1566 gcctgctggggtggaac ctgg hsa-miR-371(2) 1567 gtgccgccatcttttga gtgt hsa-miR-372(2) 1568 aaagtgctgcgacattt gagcgt hsa-miR-373(2) 1569 gaagtgcttcgattttg gggtgt hsa-miR-373*(2> 1570 actcaaaatgggggcgc tttcc hsa-miR-374 ( 2 ) 1571 ttataatacaacctgat aagtg hsa-miR-375 ( 2 ) 1572 tttgttcgttcggctcg cgtga hsa-miR-376a ( 2 ) 1573 atcatagaggaaaatcc acgt hsa-miR-377(2) 1574 atcacacaaaggcaact tttgt hsa-miR-378 (2) 1575 ctcctgactccaggtcc tgtgt hsa-miR-422b(2) 1576 ctggacttggagtcaga aggcc hsa-miR-379(2) 1577 tggtagactatggaacg ta hsa-miR-380-3p(2) 1578 tatgtaatatggtccac atctt hsa-miR-380-5p(2) ■ 1579 tggttgaccatagaaca tgcgc hsa-miR-381<2) 1580 tatacaagggcaagctc tctgt hsa-miR-382 (2) 1581 gaagttgttcgtggtgg attcg hsa-miR-383(2) 1582 agatcagaaggtgattg tggct hsa-miR-340 (2) 1583 tccgtctcagttacttt atagcc

.hsa-miR-330(2) 1584 gcaaagcacacggcctgcagaga hsa-miR-328 (2) 1585 ctggccctctctgccct tccgt hsa-miR-342 (2) 1586 tctcacacagaaatcgcacccgtc hsa-miR-337(2) 1587 tccagctcctatatgat gccttt hsa-miR-323(2) 1588 gcacattacacggtcga cctct hsa-miR-326(2) 1589 cctctgggcccttcctc cag hsa-miR-151(2) 1590 actagactgaagctcct tgagg hsa-miR-135b ( 2 ) 1591 tatggctttteattect atgtg hsa-miR-148b(2) 1592 tcagtgcatcacagaac tttgt hsa-miR-331(2) 1593 gcccctgggcctatcct agaa hsa-miR-324-3p (2 ) 1594 ccactgccccaggtgct gctgg hsa-miR-324-5p (2 ) 1595 cgcatcccctagggcat tggtgt hsa-miR-338 (2) 1596 tccagcatcagtgattt tgttga hsa-miR-339 (2) 1597 tccctgtcctccaggag ctca hsa-miR-335(2) 1598 tcaagagcaataacgaa aaatgt hsa-miR-133b(2) 1599 ttggtccccttcaacca gcta hsa-miR-325 (2) 1600 cctagtaggtgtccagt aagtgt hsa-miR-345 (2) 1601 tgctgactcctagtcca gggc hsa-miR-346 (2) 1602 tgtctgcccgcatgcct gcctct hsa-miR-384 (2) 1603 attcctagaaattgttc ata hsa-miR-196b(2) 1604 taggtagtttcctgttg ttgg hsa-miR-108{2) 1605 ataaggatttttagggg catt hsa-miR-422a (2 ) 1606 ctggacttagggtcaga aggcc hsa-miR-423 (2) 1607 agctcggtctgaggccc ctcag hsa-miR-424(2) 1608 cagcagcaattcatgtt ttgaa hsa-miR-425(2) 1609 atcgggaatgtcgtgtc cgcc EXAMPLES Example 1. Primer design.

Primers were designed using the following computer program and source code.

PrimeTime.rb

#! /usr/bin/env/ruby

# $Header. /Userslwova/laufend/cvslPrimeTime/lib/PπmeTime.rb.v l. l . l . l 2003/05/20

10.50.16 wova Exp $ # COPYRIGHT 2002-2003 Dr. Wolfgang Vahrson (mail® vahrson.de). ALL RIGHTS RESERVED. require I!log4r" include Log4r require "Iog4r/formattcr!formattcr" require lIPrimcrFindcrn class PrimcTitnc

# Thc main program a ttr_reader : subj ect i_:extractedSequencesFile • seqlnfos, :pπmerPairs def initialize(subject)

@subject= sUbject initLogging

@cxtractcdScqucnccsFile= ©subject + n cds. fasta »

@prιmerFile= ©subject + n .pπnietimel!

@primerpairs= [) end def initLogging

@logfilename= ©subject + ' primetime log '

@109'" Logger new IiPπmeTime n oul= FileOulputler new (tPrimeTimeOutputtei i i :πiename",,>@logfilename }) out.foπnattei "" PatternFoi matter.new .patlern=>tl%l\t%d\t%c\t%m" @log.outpulters= out end def run

©log.info tpπmeTime started

@log. info (l subject: t + eval ( tl%x (infoseq -auto -noheading If { ©subject}) tl) ) sanityCheck prepareSequences generatePπmers report

©log.info 'PrimeTime finished, i puts ιι-= = - = = « "- = = = '" =• = = = = puts tllnspect files #{ @logfilename} and lf{ @primerFile } I t end def sanityCheck # check prerequisites:

#^• EMBOSS version

#. subject in EMBL format end def prepareSequences fpe= FeaturePosιtionExtractor.new( ©subject! fpe.run se= SequenceExtractor.new( ©subject, fpe.extractedPosilions,

©extractedSequencesFile ) se.run @seqlnfos= se. seqlnfos end def generatePπmers

©log.info "Starting search for primersi

©seqlnfos each do linfol p P= PπmeiFinder.new (info.id.to_s, π fasta: : tl+@extractedSequencesFile+" : ll+info. id. to_s, 1 , info : length, info. revCompl) pf .run pf.primerPaiis.each do lpairl

@primerPairs « remap ( pair, info) end end end def report begin OUtFiIe= File, new ( @primerFile, -win

@primerPairs.each do Ipair] outFile.puts pair.to_s end

@log.info "Results have been written to file: #{outFile.path.to_s }ll ensure ouiFile.close if outFile end

# report warnings, error. Fatal errors !ogfile= File.new( @logfilename ) while line=logfile.gets if line =- /AWARNIAERROR1AFATAL/ puts line end end logfile.close if logfile end def remap ( primerpair, seqinfo)

# primers are searched in sequences extracted from the original sequence. Raw primer pair positions thus refer to the extracted sequence. They are here remapped to positions in the original sequence

# Answer new primer pair answer= primerpair.cloπe #puts seqinfo.to_s if seqinfα.revCompl fwd= answer.fwdPos.to_i + answer.fwdPrimer.seq.lenglh-l rev= answer.revPos.to_i + answer.revPrimer.seq.length-l else fwd= answer. I^'wdPos rav- answer.revPos end fwdPos= PrimeTime.reMapPosition( fwd, seqinfo. segments, seqinfo. revCompl) revFos= PrimeTime.reMapPosition( rev, seqinfo. segments, seqinfo. revCompl) answer.remap( ©subject, fwdPos, revPos) return answer end def PrimeTime.reMapPosition( pos, segments, revCompl) i= 0 len= segments [i) . length pos"" pos.to_i while pos > len i+=l len+= segments [i) .length end

# we now know that pos is in the i-th segment # sum the lengths of all previous segments sum= 0 segments (0 ... ij .each {I segmentj sum+= segment . length )

# calculate the offset of pos into the i-th segment offset= pos-sum-l #puts ( [pos, len, sum, offset, i, segments [ij ,revComplJ . join (" \t ii) )

# the true remapped pos is if revCompl answer= segments [i) .end-offset else answer= segments [i) .begin+offset end return answer end end # PrimcTimc class Scqlnfo

# holds info about single ORFs attr_reader :id, : length, :revCompl, :description, :segments def initialize ( id, length, revCompl=false, descript ion= mi. segments=[l .. length,))

@id= id

@length= length

@revCompl= revCompl

@description= description @segments= segments end def to s

[@id-to_s, @length.to_s, @revCompl.to_s, ©description, @segmcnts).join(ll\t . end end #SeqInfo class FeaturePosition Extractor

# extract and prepare sequences as needed for PrimeTime

# expects EMBL format attr_reader :subject, : input, :extractFeature , :extractedPositions def initialize (subject)

@log= Logger.new i FeaturePositionExtractorl @log.outputters= Outputter[lprimeTimeOutputter , "@log.leve!= INFO

@subject= subject

@line= nil

@key=nil

@input= File.new{ ©subject @log.debug( ©subject)

@log.debug( ©input)

@extractFeature=HCDS 11

@extractedPositions=[) end def run

@log.debug{ "extractFeaturePositions ■

> while (nextLine) if @line=_jAFT / and @key = @extractFeaturc #@log.debug( @Iine) positions= extractPositions nextLine while ©line and (©key == I i II) and (@line=- jAFT *W) positions= positions + extractPositions nextLine end

@log.debug( positions)

©extractedPositions « positions end end end def nextLine

@ltne= ©input. gets

#@log.debug ©line if ©line

@key= ©line [5 .. 20) if ©key

©key.stripl end end return ©line end de r extractPosi tions pos= @line(21.256) if pos pos.strip end end end # FeaturePositionExtractor # class SequenceExtractor # extract sequences according to FeaturePositionExtractor attr_reader : subj ect, :seqlnfos def initialize( subject, featPositions, extractedSequencesFile)

@subject= subject

@FeatPositions= featpos"itions @seq InFoS= Il

@log= Logger.new 'SequenceExtractor'

@log.outputters= Outputter['PrimeTimeOutputter']

@log.level= INFO

@outfile= File, new (exlractedSequencesFile, llW") end def run begin item=O record= nil @featPositions.each do idescriptor λ itcm+=I record= ">" + item.to_s + "\t" + descriptor + "\n" seq"" u segments"" [] revCompl"" isRevCompl? descriptor regions""splitPositions(descriptor) regions.each do lregion I segments •• region cmd= createSeqretcmd( region.begin,region.end, revCompl) @Iog.debug( cmd) seq"" seq + eval("%x(#{cmd ))Il) end record= record + seq

@log.debug( descriptor) @seqlnfos« Seqlnrb.new( item.to_s, seq. count (llA-z ll ) , revCompl, descriptor, segments)

@outfile.puts( record) end

@log. info ("Extracted #{seqlnfos. size} ORFs for further analysis into file: #{ ©outfile .path. to_s}") ensure

©outfile.close if @outfile end end def isRevCompl?( descriptor) if descriptor",,- /complement/ true else false end end def splitPositions descriptor

# answer a list of ranges of positions regions=- descriptor.split(ll,U) answer=-U regions.each do jregionj positions=- region.spKK'^ O #the parameter to split is interpreted as re! positions (OJ .gsub! ( AD/, nil) positions [ U .gsub! ( ΛD/, till) answer « ((positionslOJ .to_i) .. (positions [1] .toj) end return answer end def createseqretCrnd ( from, to, revCompl) rc=- o if revCompl rc="-sreverse" end return "seqret -aulo -os format plain -stdout #{rc} -sbegin #( from} -send #( to)

+ ©subject end end # SequenceExtractor

##### "main" ! Tests ##### if _FILE_ $0 if ARGV. size >0 #called as main pt= PrimeTime.new ARGV[O] pt.run else # tests require "runiUlestcase" require Yuπit/cuUlestrunner i require trunit/testsuite i class TestPrimeTime < RUNIT: :TestCase

TESTDATA=- "/Users ! wo va/pri meTi me/I i b/eb v" def test_geneiatePrimers pt= PrimeTime.new TESTDATA pt.run

# ppl= pt.primerPairsfOJ puts pp 1.to_s assert_equals ( 5573.to_s, ρpl .fwdPos.to_s) assert_equals { 5654.Lo s, ppl .revPos.to s) assert_equals ( "TTTTGGCAATGGGAGCAC!I, PPl . fwdPrimer. seq) assert_equals ( IITGCCTGAGTG ACC ATAGGTGl I. ppl. revPrimer. seq) pp 17=- pt.primerPairs[481 puts PP17.to_s assert_equals ( 58500.to_s. ppl 7.FwdPos.to_s) assert_equals ( 58423.to_s, ppl7.revPos.to_s) assert_equals ( UACAAAGTCACGAGCGCAAAu, ppl 7. fwdPrimer .seq) assert_equals ( HTCTGTGCCACCTCTGTTACG". pp 17. revPrimer. seq) end def test_remap puts I! .1 puts ( %w(pos len sum offset i segments[ϋ).join("\t ■> segments=- [ 1. .10. 21..40, 51. .60] assert_equals ( 1. PrimeTime.reMapPosition( 1 , segments, false) assert_equals ( 10, PrimeTime.reMapPosition( 10, segmenls, false) assert_equals ( 21. PrimeTime.reMapPosition{ 1 1 , segments, false») assert_equals j 51 , primeTime.reMapPosition( 31 , segments, false)) asscrt_equals ( 60, PrimeTime.reMapPosition( 40, segments, false))

# i.e.: 10,20, 10 segmcnts= [51 .. 60, 21 .. 40, 1 .. I0J # note order of ranges! assert_equals ( 60. PrimeTime.reMapPosition( 1 , segments, true)) assert_cquals ( 51 , PrimeTime.reMapPosition( 10, segments, true)) assert equals( 40, PrimcTimc,reMapPosition( 1 1 , segments, true» assert:equals{ 21 , PrimcTime.reMapPosition( 30, segments, true)) assert equal s( 10, PrimcTime.reMapPosition( 31, segments, true) assert=equals( 1, PrimeTime.rcMapPosition( 40, segments, true) end end # TestPri meTime class TestFeaturePositionExtractor < RUNlT::TestCase

TESTDATA= Il/Users/wova/PrimeTime/lib/ebvu def test init se= FeaturePositionExtractor. new (TESTDATA) assert j se.input) 7 018478

assert ( se. subject) assert ( se.extractFeature) end def test extractFeaturePositions se= FeaturePositionExtractor.new(TESTDATA) se.run assert} sc.cxtractcdPositions.size == 86,se.extractedPositions.size.to s ) assert ( sc.cxtractcdPositions[41J = -

"join{complement( l 0265S .. 103 lSS),complcmcnt( 102423 .. 102S30) .complement «102210 .. 102 338) )" ) end end #TestFeaturePositionExtractor class TestSequenceExtractor < RUNlT::TestCase

TESTDATA= "/Users/wova/PrimeTime/lib/ebv! def setup

# cds 36-41 from ebv

@featPos=%w(92243 .. 92602

<92663..92767 join 195353 .. 95709.95788 .. 98247) join(9837 1 .. 98730.9880S .. 101423 ) complement { 10144S .. 1021 16) join(complement(102655 .. 1031 SS) .complement 102423 .. 102530),complement«102210.. 1023

38) 1

1 end def test_split . se= SequenceExtractor.new( TESTDATA, ©featPos,

TESTD ATA+" . test split, cds. fasta") regtons= se.splitPositions( ..join {complement ( 10265S .. 10315S),complement{ 102423 .. 102530) .complement «102210 .. 102

338)" ) assert_equal { 3. regions.size) assert equal ( 11103 ISS", regions [0] .end.to s) assert=equal (1 1 102210 1 1 , regions[2J .begin.to_s) end def test_ruπ se= SequenceExtractor.new( TESTDATA, @featPos,

TESTDAT A+". test_run. cds. fasta,,

) se.run

St= se.seqlnfos[S] assert equal( 6.to s, si.id.to s) assert=equal( 738,-si. length) assert_equal ( true, si.revCompl} regions si.segments(O] asseιt_equals ( IU31SS.to_s, rcgion.cιid.to_s) rcgion= si.segnicnts[l) assert_equals ( I02423.to_s, region.bcgin.to_s} region= si. segments^] assert_equals ( I02338.to_s, region.cnd.to_s) end end # TestSequenceExtractor

RUNIT: :CUI: :TestRunner.runlTestPrimeTiιne.suUe) end end

PrimerFinder.rb

# $Header: /Users!wova/laufena7cvs/PrimeTime/libjPrimerFinder.rb,v 1.2 2003/05/28 21 :05:24 wo va Exp $

# Primer collects data for a single primer, but does not know about its intended application. Hence no position info and no reference to a template attr_reader : id, :seq attr_accessor : tiD, :9c deF initialize! id, seq, tm=ni]. gc=nil)

@gc=gc end def to s

[@id~ @seq, @tm. @gc).join("\U) end end class PrimerPair

# PrimerPair bundles two primers for a particular application (i.e., amplifying a region oF seqRef) attr_reader -.fwdPrimer, :revPrimer, :productLen, :seqRef , :fwdPos. :revPos def initialize ( seqRef, fwdPrimer, fwdPos, revPrimer, revPos, productLen)

@seqRef= seqRef

@fwdPrimer= FwdPrimer

@FwdPos= fwdPos @revPrimer= revPrimer

@revPos= revPos

@productLen= productLen end deF remapj seqRef, fwdPos, revPos) # map the pair to another sequence and positions

# caution! @segRef= seqRef @fwdPos= fwdPos @revPos= revPos end def header

!l#ll + [ %w( sequence fwd-id fwd-seq fwd-tm fwd-gc fwd-pos fwd-len rev-id revseq rev-tm rev-gc rev-pos rev-len product-len)) . join (tt\t n) end def to s

[@seqRef, @fwdPrimer.id, @fwdPrimer.seq, @ fwdPrimer. tm, @fwdPrimer.gc, @fwdpos,

@fwdPrimer.seq. length, ©revPrimer.id, ©revPrimer.seq, OrevPrimer.tm, @revPrimer.gc,

OrevPos, ©revPrimer.seq.length, @productLen).join(U\t U) end def PrimerP air. parse j line)

# parse a line produced by self.to_s

# answer a new instance of PrimerPair fields= line.sρlit(lt\ttl) if fields. size != 14 raise "Cannot parse line: II + line end scqRef= fields[O] fwdPrimer= Primer.new( fieldsll], fields[2j , fields[3] , fields[4]) fwdPos= fields[S] rcvPrimer= Primer.new( fields f7] , FieldsfS], fields[9], fields [1O] ) rcvPos= ficlds[ll] productLen= fields[ I 3J answer= PrimerPair.new( seqRef, fwdPrimer, fwdPos. revPrimer, revpos, productLen) end end class PrimerFinder

# Pr±merFinder is the class driving eprimer3

# Additionally it repeats searches with modified settings iF a given search yields no primers

EXT¹¹Il .primer3" attr_reader :primerPairs def initialize ( id, seqFile, from, to, isRevCompl) @id= id @seqFile= seqFile @outFilc= @ id + EXT

@from= From

@to= to

@isRcvCompl= isRcvCompl @numreturn= 1

@target= 0

@eprimer3= initepritner3

©primerpairs"" (1

@idCount= 0 @log=Logger.new "PrimerFiπdern

@log.outputters"" Outputter[lprimeTimeOutputter u

@log.level=INFO end def initeprimer3 answer"" EmbossApp.new ucprimcr3 « answer. setOpt ion ( u-taskl I , "Oi l) answer. setOpt ion ( "-numreturn", @numrcturn. to_s) answer. setOption ( ll-includcdregion", @from.to_s + 1 1,1 1 + @to.to_s) answer. setOption ( Il-otm", "59.0 m answer. setOption { 11-mintm", "57.0") answer. setOpt ion ( n -maxtmu."61.0 n, answer. setOption ( n -maxdiFftmn. H2") answer.setθption{ ll-mingc", H20.0 in answer. setOption ( n-maxgc »."80.0 Il ) answer , setOption ( n-maxpolyx", no answer.setθption( "-selfanyi, "4") answer.setθption( II-productosize", U500") answer. setOption ( ll-productsizcrangc", "200-800") answer. setOption ( "-outfile", nstdout m answer.addArgumentC @seqFile) return answer end def run trials= 0 while goOn? trials+=l

@target= ncxtTargct if inRangc?

@log.debug( Ii trying " + @id.to s + ": u + @target.to s+ll,u+(@target+l).to s) @eprimer3 . setOption ( n - target u. -©target .to_s + n.-+(@target+l) .to_s) - rcsult= eval( l!%x(#{ @eprimer3.to_s ))") n= countPrimerPairs( result) if (n>O) extractPrimcrs(rcsult).each do ]pairl @primerPairs « pair end end end end summarize trials end def extractPrimers(result)

# answer a list of PrimerPairs extracted from result answer= [] fwdPrimer= revPrimer= fwdPos= revPos= productLen= nil result.each do ]linel- fields= line.split if line=- 'PRODUCT SIZE,! productLen= fields[3] end if line=- ! PRIMER ! primer= primer.new( nextPrimerlD , fields (6) , fields (4] , fields[5)) pos= Fields [2] if line=- /FORWARD PRIMER/ fwdPrimer= primer FwdPos= pas elsif line=- IREVERSE PRIMER/ answer « PrimerPair.new{ ©seqFile, fwdPrimer, fwdPos, primer, pas, productLen) fwdPrimer=FwdPos=primer=pos=productLen= nil end end end return answer end def nextTarget

# target refers to the -target option of eprimer3 (www.hgrnp.mrc.ac.ukiSoftware/EMBOSS)

# it is used here to find primers at the 3' end preferentially # isRevCompl is commented out, because sequences are rev-compl'd during extraction, avoid doing it a second time

# @target= @from + 50 # else

#primers have their own unique id

@idCounl+= 1 @id + 11_" + @idCounl.to_s end def countPrimerPairs( result)

# count the primer pairs in a result of eprimer3 answer= 0 result.each do llinel then answer+= 1 end end return answer end del^' goOn?

# do we need more iterations to obtain the requested number of primer pairs? (@target==O) or (@primerPairs.size < Onumreturn and inRange?) end def inRange?

# is target within the bounds of from and to? ©From < ©target and @target+l < @to end def summarize trials if ©primerPairs.size < @numreturn if ©primerPairs.size == 0

@log.warn( "No primers found For ,+ @seqFile + Gave up after searching whole sequence. [Tried * (trials) times.)") else

@log.warn( nOnly n+ @primerPairs _size. to_s + "primer pairs found for " +

@seqFile + u.") end end end 78

end if $0"" FILE

# not rc;l primers ... p l= Primer, new (I! fwd-Il!, nacgtacgtacgtacgt u.60.1 , 55.2) p2= Primer, new {iι rcv-I", 'Igcgcgcgagagatgtgt II, 59.5, 60.3) puts pi. to s pp'" PrimcrPair.new( nebvu

.pi. 12345, p2, 12456, 111) puts pp.header puts pp. to_s pf= primcrFindcr.new( u20 «

.uebv.cds.joined", 24292, 24822, FALSE) pf.run pf.primcrPairs.cach do lpairl puts pair.to_s end end

EmbossApp.rb

# wrapper to run Emboss Applications from ruby # $Header: /Users/wova/laufend/cvs!PrimeTime/lib/EmbossApp.rb,v 1.1.1.1 2003/05/20 10:50:16 wova EXp $

@name"" name

@Options= { )

@arguments= (] # default options setOption (U-autall , Il 11) end def setθption(key.value)

@options(key]"" value end def getθption(key) return @optionsfkey] end def addArgument( value) @argumcntsL@arguments.size]= value end def getArgument(index) return @arguments[index] end def to_s answer""¹ ©name

@options.each do Ikey, valuel answer"" answer. to_s + «»+ key. to_s + »«+ value. to_s end @arguments.each do lvalue I answer= answer.to_s + " n+ valuc.to_s end return answer end end if $0 FILE then app= EmbossAp~πew nembossversion" app.setθption( II-outfile", llstdout") puts app. to_s system( app.to_s) app= EmbossApp.new "banana.. app. setOption ( ll-graphϋ, "XU") app.addArgumentC'asistacgtaaaaatatatatatataaacgt «> puts app.to_s system ( app. to_s } end

PrimerMapper.rb

# $Header: /UsersIwova/laufend/cvs/PrirneTirne/lib/PrimerMapper.rb.v 1.1.1.1 2003/05/20 10:50: 16 Wo Va Exp $ # COPYRIGHT 2002-2003 Dr. Wolfgang Vahrson (mail@vahrson.de). ALL RIGHTS RESERVED, require Hlog4r" include Log4r require llPrimerFinder u require "EmbossApp" class PrimerMapper

# map a list of primers produced by PrimerFinder to the original sequence attr_reader :outFilename, :mappedPrimerPairs def initialize { subject, primerPairs, Qutfilename

@subject= subject @primerPairs= primerPairs

@ mappedprimerPairs=[]

@primeφairs.each do lpairl

@log= Logger.new nprimerMapper ■

@ log.Qutputtcrs= Outputtcr.stdout end def run prcparcPrimerList ©subject results= search map results report end def preparePrimerList

# create a list suitable as input to EMBOSS primersearch / stssearch

# answer as multi-line string begin

OUtFiIc= File.new(@outFilename,"w») count= 0

@primcrpairs.each do lpairl count+= 1 outFile.puts [pair.fwdprimer.id.to_s, pair. fwdPrimer. seq, pair. revPrimer. seq) . join (Ii \t n) end ensure outFile.closc if outfile end end def search

# invoke the EMBOSS stssearch program to Find the primers in subject

# answer the programts stdout ps= EmbossApp.new ltstssearch α ps. setOption (11-stdout π,-,,> ps.addArgument( ©subject) ps.addArgumcnt( ©outFilename

#@log.dcbug( ps.to_s) rcsult= cval( lt%x(#{ps.to_s )) II) return result end def map results lines: results. split(lt\nn> if lines.size != @mappedPrimerPairs.sizc*2

@log.fatal ( HFormat error. There must be 2 lines of results per primer pair! ") raise "Format error. « end i=O

@mappedPrimerPairs.each do lpairl fwdPos. revPos= extractPrimerPositions (lines[i] ,lines[i+U) i+= 2 pair.remap{ ©subject, fwdpos, revPos) end end def extractPrimerPositions stsl, sts2 if stsl =-/PrimerA/ fwd= stsl rev= sts2 elsif stsl =- /PrimerB/ fwd= sts2 rcv= stsl else

@log.faial ( HUnknown Format for stssearch result; It + stsl) raise "Unknown Format « end posPat= Regexp. new ( r.+: . +Primer. matched al (\d+)') fwdPos= posPat.match(Fwd) [ 1] revPos= pospat .match(rev) [1 ] return [fwdPos. revPos] end def report end end ##### llmain" / Tests ##### if FlLE_ "" $0 require nr unit/testcase" require Irunit/cui/testrunner i require 'runit/testsuite i class TestPrimerMapper < RUNIT::TestCase

TESTDATA= 11/users/wova/PrimeTime/lib/ebv. def setup ppl_l= PrimerPair .parse ( ltfasta:: /Users/wova/PrimeTime/lib/ebv. cds. fasta: 1

I-I TTTTGGCAATGGGAGCAC 60.61 50.003838 1 -2 TGCCTGAGTGA CCATA GGTG 59.70 55.00 3919 101 ") pp l7_l= PrimerPair. parse ( ,,fasta: : /Users/wova/PrimeTime/lib/ebv. cds. fasta: 17

17-1 ACAAAGTCACGAGCGCAAA 60.59 47.37 8 17-2 TCTGTGCCACCTCTGTTACG

59.90 55.00 84 96") #rev-compl

@testPrimerPairs= [ppl_I , ppl 7_l l end def test-pri merList pm= PrimerMapper. new ( TESTDATA, @testPrimerPairs.

TESTDATA+" .test.primerlist n, pm.preparePri merList refList= "1- 1 UTTTTGGCA ATGGGAGCACUTGCCTGAGTG ACCATAGGTGNn 171\ tACAAAGTCACGAGCGCAAA\tTCTGTGCCACCTCTGTTACG\n" pfile= File.new(pm.outfilename) primerList= pfile. readlines. join (Ii H) pfile.close assert_equals( refList, primerList) end def test_scarch pm- PrimerMapper.new( TESTDATA, ©testPrimerPairs,

TESTDAT A+" . test .primerlist H) pm.preparePrimεrList result- pm. search lines- result.split{ H\n") assert equals ( HEBV: l-i PrimerA matched at 5572", lines [O]) asser(~equals{"EBV: (rev) 17-1 PrimerA matched at 58518", lincs[3]) end def test_map pm= PrimerMapper.new( TESTDATA ,@testPrimerPairs.

TESTDAT A+" . test .primerlist II) pm.preparePrimerList results^ pm. search pm. map results assert_equals ( 585 I 8.to_s, prή.mappedPrimerPairs[l] .fwdPos ) assert_equals { 58422. to srpm.mappedPrimerPairs[l] .revPos) assert_equals ( TESTDATA~ pm.mappedPrimerPairsø] .seqRef) end end

RUNIT: :CUI: :TestRunner,ruπ(TestPrimerMapper,suite) end

Example 2. Cell lines and tissue Samples.

All cells were cultured in RPMI containing 25mM HEPES, 10% fetal bovine serum, 0.05 mM 2-mercaptoethanol, 1 mM sodium pyruvate, 2 mM L- glutamine, 0.05ug penicillin/ml and 5OU streptomycin/ml at 37°C and in 5% CO2. Five de-identified frozen tonsil tissue biopsies were obtained from the cooperative human tissue network (CHTN). Use of human cell lines and tissue was approved by IRB.

Example 3. RNA isolation and reverse transcription.

Total RNA was isolated using Triazol™-reagent (Sigma Inc.) as per manufacturers procedures. Triazol has been shown to isolate RNA from all known agents in a single step extraction. This method, as opposed to columns, also isolates small, pre-miRNA and miRNAs. Total RNA was reverse- transcribed using Mo-MuLV reverse transcriptase and 120-pmol random hexanucleotide primers according to manufacturers procedures (Taqman™RT, Applied Biosystems, Inc.). The reactions were stopped by heating to 95°C for 5 min, subjected to RNAseH (New England Biolabs Inc.) treatment and subsequently, the cDNA pools stored at -80⁰C. DNA was isolated using WizardSV kit (Promega Inc.). RNA was quantitated on a Nanodrop™ and equal amounts of RNA were subjected to DNase treatment (Ambion Inc.). RNA was reverse transcribed using cDNA archive kit (Applied Biosystems Inc.). RNA integrity was evaluated using a 2100 bioanalyzer (Agilent Inc.).

Example 4. Real-time QPCR

Real-time QPCR was carried out using primers specific for each target (Table 1 ) and 2xSYBR Amplitaq Gold™ mix (Applied Biosystems, Inc.) according to manufacturer recommendation in a final volume of 20 microliter using 20OnM of each primer. Amplitaq-polymerase is inactive until hot start, which minimizes spurious amplification of nonspecific targets. Real-time quantitative PCR was carried out using universal cycle conditions (2 min @ 50⁰C, 10 min @ 95⁰C then 40 cycles of 15 sec @ 95°C and 1 min at 60⁰C). All PCR reactions were assembled in a designated room in which no PCR product or sample is handled. The reactions were set up using a CAS-2000 pipetting robot (Corbett Research Inc.). Carryover of the amplification product was avoided using filtered pipettes and UNGglycosylase (Applied Biosystems inc.) in the amplification reaction. It was determined that the combined pipetting and instrument error was less than 6% (data not shown). Real-time QPCR was conducted on a MJR Opticon2 machine (Biorad Inc.)

Analysis: The real-time QPCR assay yields a single numeric value CT for each well following the manufactures automated procedures (Biorad Inc.). This result was exported into Microsoft Excel and relative levels determined as outlined in the individual figures. CT output represents a logarithmic transformation of the target levels. First all data were normalized to a single, common reference gene U6 (dCT method) which removed variances due to differing input RNA amounts and differing RT efficiencies. These were either plotted directly as % U6 in each sample or the same analytical methods were applied to real-time QPCR data as are used for conventional microarray data sets, namely hierarchical clustering. This yielded a representation in which the RNAs of highest abundance were at one end of the scale and the RNAs of lowest abundance at the other end of the scale. We used a correlation metric, which first normalizes all profiles to length one and calculates the distance as the arccosine of the scalar product. Genes with all measurements as zero (i.e. the normalizing gene for dCT normalization) were excluded.

Example 5. Primers designed using the disclosed computer program are specific for pre-miRNA

To validate the computer program designed primers, a set of primers specific for EBV virus pre-miRNAs and the small, abundant cellular RNA, U6 was tested. Human BC-1 lymphoma cells (from ATCC) that were EBV positive and human BCBL- 1 lymphoma cells (from ATCC) that were EBV negative were used. Either total RNA or polyA RNA was isolated from the EBV positive BC-1 cells or total RNA from the EBV-negtive BCBL-1 cells. These RNAs were then reverse transcribed using random hexamer primers to yield cDNA and remaining RNA digested with RNAseH. The exception was the "RTneg" set, in which the reverse transcriptase was left out. The four pools {total, polyA, RTneg and EBVneg) were subjected to real-time QPCR using the specific primer pairs indicated on the horizontal axis). Relative abundance was recorded as CT and relative levels (percent U6 RNA indicated on the vertical axis) calculated as 2"(CTprimer-CTU6). The results are shown in Figure 7.

For the total RNA sample from EBV positive BC-1 cells, specific targets were detected using the designed PCR primers and the level of the target pre- miRNA was quantified (see Figure 7). For the polyA enriched RNA from EBV positive BC-1 cells, 10-100 fold less pre-miRNA was detected with the PCR primers. This is a result of the pre-miRNA not being polyadenylated. An exception was observed for primer BHRF1 because this primer detects the overlapping identical messenger RNA in addition to the pre-miRNA. Omitting the reverse transcriptase step (RTneg) yielded no products, showing that the method results in purification of RNA only and not DNA. Use of total RNA from EBV negative BCBL-1 cells resulted in detection of only the U6 specific target. This result is attributable to none of the other pre-miRNAs being present in this cell line.

Example 6. Validation experiment of the pre-miRNA Quantitative PCR (QPCR) assay on clinical biopsies.

One of the advantages of the presently disclosed assay is that it is equally well suited for the analysis of routine 2x2mm clinical biopsies as it is for analysis of cell lines. The assay is functional when less input RNA of a lower quality is used than in other assays. This is illustrated with an assay against EBV pre-miRNAs. Total RNA was isolated from either EBV positive cell lines or total RNA from two clinical lymphoma biopsies #291 and #274. Only biopsy #291 contained EBV. These RNAs were then reverse transcribed using random hexamer primers to yield cDNA and remaining RNA digested with RNAseH. Finally, the samples were subjected to real-time QPCR using the specific primer pairs indicated on the horizontal axis. Relative abundance was recorded as CT and relative levels (percent U6 RNA indicated on the vertical axis) calculated as 21\(CTprimerCTU6) (see Figure 8). The assay performance was similar for both the clinical biopsies and the experimental cell cultures.

Example 7. Combined pre-miRNA and mRNA profiling.

One of the advantages of the presently disclosed assay is that it is useful for profiling pre-miRNAs and mRNAs from the same sample using the same procedure. This was illustrated with an assay against human herpesvirus 8 pre-miRNAs (miK1 , miK2, miK5, miK6, miK7, miK8, miK9, micrOI) or human herpesvirus 8 messenger RNAs (LANA, Kaposin, orf69, K14, vFLIP, actin). A map was generated showing the final output using five different cell lines (BC3, BCBL1 , JSC1 , L1 TIVE, E1 TIVE) and E1 -2 (biopsy) as input (data not shown). The map is useful to illustrate the increase or decrease in the RNA relative to the mean for each primer.

Example 8. Pre-miRNA profiling of two clinical biopsies using 158 primers.

The presently disclosed assay is sensitive enough to allow profiling of at least 158 individual pre-miRNAs from a clinical biopsy. Primers described in Table 1 were used for this procedure. Figure 10 shows the results of a profiling experiment for 158 pre-miRNAs (and controls) in two clinical biopsies (#JP, #06.001) a non-template control (NTC) consisting of water. Each row corresponds to an individual primer from Table 1. The raw data (CT) are shown for each reaction, with lower numbers indicating a higher abundance. CT=40 indicates the absence of a product.

Example 9. Viral miRNA gene profile in PEL.

Micro RNAs are regulated by gene alteration, transcription and processing. Thus far few studies have.simultaneously assessed all three levels of regulation. Using real-time QPCR-based arrays we determined changes in gene copy number, pre-miRNA and mature miRNAs levels for the largest set of primary effusion lymphomas (PEL) to date. We detected PEL-specific miRNA gene amplifications, and concordant changes in pre- and mature miRNAs. We identified 68 PEL specific miRNAs. This defines the miRNA signature of PEL and shows that transcriptional regulation of pre-miRNAs as well as mature miRNA levels contribute non-redundant information that can be used for the classification of human tumors. We hypothesized (i) that cancer- specific miRNA profiles are selected for by the combined action of genome, transcriptional and miRNA processing mutations. Hence, comprehensive miRNA profiling should query genomic loci, precursor miRNAs as well as mature miRNAs and this information can be used for the differential diagnosis of lymphomas, specifically of primary effusion lymphoma (PEL). PEL are a unique type of post germinal center diffuse large B cell lymphoma (DLBCL) 14,15. Clinically PEL are well defined by their effusion phenotype as well as a near perfect association with Kaposi sarcoma associated herpesvirus (KSHV) infection. KSHV also encodes miRNAs (16,17), which are highly conserved among KSHV isolates 18. We assembled the largest group of PEL to date, which allowed us to generate the first miRNA signature for PEL. Using a novel real-time QPCR based assay, we identified miRNAs, which are concordantly transcribed in most PEL and are present at the premiRNA and mature miRNA level. The more abundant of these miRNAs were previously cloned, which independently confirms our data. However, high throughput profiling uncovered twice as many PEL-specific miRNAs as found by cloning methods. We found a second group of miRNAs, which are uniformly present in non-transformed tonsil tissue, but down regulated in PEL as well as a third group of miRNAs that were uniquely up- or downregulated in individual PEL. This data PEL miRNA profile can be used to molecularly classify PEL. Based on the known and predicted targets of PEL specific miRNAs we propose that PEL-specific miRNAs define the biological phenotype of PEL.

We used two 96 well plates containing a combined total of 372 different primers representing 168 cellular and 12 viral pre-miRNA targets, 6 cellular and viral control mRNA targets. All primers conform to universal real-time PCR conditions 19-21 with a predicted Tm of 60±1⁰C and < 100 bp amplicon length.

Real-time QPCR was conducted under universal cycling conditions (40 cycles) with SYBR as the method of detection following our previously validated methods (19). A 36 μl reaction mix was made and distributed in triplicate into a 384 well plate using a CAS-1200 robot that uses filtered carbon-graphite pipette tips (Tecan Inc., Durham, NC) for liquid level sensing, allowing for a pipetting accuracy of 0.1 μl. The final primer concentration was 250 nM in total of 9.0 μl (Roche LC420 unit, Roche Inc.) reaction volume. The combined pipetting and instrument error was less than 6% (data not shown). All reactions were done in technical as well as experimental triplicates. For DNA QPCR each reaction contained 2.85 ng DNA/μl. For RNA QPCR, 40 μl of the 100 μl RT reaction (Applied Biosystems Inc.) was used for each 384 well plate yielding a final amount of 0.1 μl cDNA per each 9 μl reaction. Real-time QPCR primers against 165 mature miRNAs from Applied Biosystems Inc. were used according to manufacturers protocol. Of note we were able to quantify miR-K5 from BC-1 cells and miR-K4 from VG-1 cells, even though the pre-miRNA contains a single nucleotide polymorphism (SNP) (22) and unpublished, which is located within the primer binding site. This underscores the robustness of a SYBR- based pre-miRNA PCR assay, which tolerates up to 2 SNPs in the primer binding site and any number of SNPs within the amplicons as opposed to TaqMan™-based mature miRNA assays, which do not tolerate SNPs (23).

Calculations. CT represents a logarithmic measure of the underlying target concentration. CT values of technical replicates were averaged to yield a single CT for each primer pair. In case of triplicates, if one and only one replicate yielded CT=40, the average of the remaining two CTs was used. Each experiment was repeated an additional two times. Next, CT values PEL miRNA profile were normalized to CT of U6 as reference to yield dCTUδ. For DNA copy number determination and miRNA profiling, dCTU6 were standardized (Z- transformation (24)) to the median of each array. The SD of U6 was less than 1 CT unit, evidencing that we can discern two-fold changes in gene copy number (data not shown). Unsupervised clustering was conducted using ArrayMiner™ (Optimal Design Inc., Belgium) and a simple correlation metric. Additional statistical tests were conducted using SPSS v11.0 (SPSS science, Chicago, IL).

PEL contain two classes of miRNAs: those encoded by cellular gehes and those encoded by either KSHV or EBV. Whereas nothing is known about the cellular miRNAs in PEL, the viral miRNAs have been intensely studied (16,17,22,25). This afforded us an internal positive control. As pre-miRNA- specific primers also detect the corresponding genomic DNA (Figure 1 1 B) we first determined relative miRNA gene copy numbers. Total DNA was isolated and subjected to real-time QPCR. All PEL encode the gene for 10 KSHV miRNAs ((16,17) and below), whereas only EBV coinfected PEL contain the genes for the EBV miRNAs (Figure 1 B). Except for VG-1 cells, the pre-miRNA specific primers detected all KSHV miRNA genome loci at equivalent levels in all PEL (95%CI: 0.45 - 1.15 dCTU6 units, n=5). dCT U6 represents the Iog2 difference between the U6 and the target miRNA levels. One CT unit represents a two-fold difference.

This experiment established the limit of our assay based on combined technical and biological variation. Using triplicates we were able to distinguish 5-fold (2 x 95%CI) differences in miRNA levels. The reason for the decreased signal for miR-K4 in VG-1 cells is due to a single nucleotide polymorphism in the miRNA (unpublished observation). The EBV miRNA loci could only be detected in the two EBV genome positive cell lines BC-1 and JSC-1. The relative abundance of the EBV miRNA genes was less than those compared to the KSHV miRNA genes, evidencing that on average, fewer EBV genomes than KSHV genomes are present PEL.

Example 10. Genomic miRNA gene profile in PEL.

We used the same design parameters as for viral miRNAs to design primers for cellular pre-miRNAs. As our pre-miRNA specific primers also recognize the genomic loci, we first conducted comparative genomic profiling for 168 miRNA loci in PEL. DNA was isolated, adjusted for DNA concentration based on A260 absorption and real-time QPCR was performed in triplicate. Figure 12 shows a plot of the range of the normalized triplicate dCTU6 over the 5% trimmed mean for each miRNA gene. Most miRNA genes showed little variation across cell lines with dCTUδ 95%CI: 6.15-6.80. Genomic profiling of miRNAs in PEL is not trivial, since PEL exhibit severe aneuploidy (26,27) and genome coverage based on 168 miRNAs loci was sparse. Nevertheless, we gained important insights. KSHV miRNA loci were easily detected since they were present in >20_vcoptes in all but two virus negative lymphoma cell lines (Figure 12, open circles). EBV miRNA gene loci likewise stood out, since they were absent in all but three EBV positive cell lines (Figure 12, closed circles). A large range (dCTU6 of >8 units) in copy number variation represent rπiRNAs that were deleted in at least one PEL. For instance, miR-34a was deleted in JSC-1 cells (Figure 12, arrow indicates triplicate measurements). Additional miRNAs genes that had sustained deletions or amplifications were identified by pair wise scatter plots (supplemental Figure 1): hsa-miR-153-1 (Chr. 2), 218-1 (Chr. 4), 107 (Chr. 10), 188 (Chr. X), 125a (Chr. 19) were amplified in >50% of PEL. In sum, while miRNA genome loci typing clearly identified miRNA genes that were missing in individual cell lines, no one miRNA locus in our collection was consistently lost or amplified in all PEL. This suggests that the PEL specific miRNA signature is derived primarily from transcriptional reprogramming rather than mutations in miRNA gene loci.

Example 11. Pre-miRNA profile of PEL.

We used our array to identify pre-miRNAs that were transcribed in PEL. Total RNA was isolated, DNAse I -treated, reverse transcribed and subjected to real-time QPCR. Overall the KSHV miRNAs were present at higher levels than the cellular miRNAs, probably due to the high genome copy number (20- 30) of KSHV in PEL (28). In contrast, in EBV+ PEL the EBV miRNAs were present at approximately equal level of cellular miRNAs. To gain a complete picture, we performed unsupervised clustering. This representation preserves the relative levels of all miRNAs in the array, such that miRNAs that were not detectable are coded in one color and the most highly abundant miRNAs in the entire array are coded in another color.

The KSHV miRNAs were abundant in PEL and absent in tonsil or the two virus negative lymphoma lines BJAB and DG75. Of the cellular mRNAs Hsa-miR-126 co-clustered with the KSHV pre-miRNAs, which establishes it as the first PELassociated cellular miRNA. Hsa-miR-122a, -361 , -346, -326, -423, -27b . also clustered with the KSHV miRNAs, though their degree of overexpression in PEL was less than for hsa-miR-126. The mature hsa-miR- 27b was also highly abundant in PEL as it could be detected by TaqMan QPCR (see below); hsa-miR-361 , -346, -423 were not present in the mature miRNA array and the mature hsa-miR-122a and -326 were not detectable. Hsa-miR- 181b and -106b also were highly abundant in PEL, but not in tonsil. Unlike hsa- miR-126, however, hsa-miR-181 b and -106b were also highly abundant in the virus negative DG-75 cells, suggesting that they signify a broader range of B cell lymphomas not just PEL. Of note, the mature hsa-miR-181b was also highly abundant in PEL as it could be detected by TaqMan QPCR (see below) as well as cloning.

A large group of pre-miRNAs was highly expressed in B cell-rich tonsil as well as PEL. For many of those abundant pre-miRNAs we were also able to detect the corresponding mature miRNAs. Many of those were lymphoid- lineage specific miRNAs, suggesting that the PEL tumor miRNA profile reflects the tissue of origin. The pre-miRNAs for hsa-miR-130a, -125e, -29b-2, -221 , - 133a-2, -138-1 , -103-2, -216, -218-2, -7-1 and -323 were down regulated in PEL, as well as the two virus-negative B cell lymphomas compared to tonsil tissue. Furthermore, we identified pre-miRNAs that were uniquely upregulated in only the virus-negative DG-75 (hsa-miR-19a, -302b, -328, -331) or BJAB (hsa-133a-1 , -154, -7b, -195, -16-1) Burkitt lymphoma cell lines. As expected, the EBV premiRNAs were only detected in the EBV-positive BC1 , BC5 and JSC-1 PEL cell lines.

Example 12. miRNA profile of PEL.

We used a TaqMan™-based miRNA array to profile mature miRNAs in PEL. This yielded very good reproducibility for technical replicates as well as biological replicates comparing two PEL cell lines (Figure 13A). We considered all miRNAs that were detectable in fewer than 38 cycles and which exhibited limited variation (SD≤ 4 fold) among multiple PEL cell lines to constitute the miRNA signature for PEL (Figure 13B, shaded box). This yielded 68 miRNAs, which are listed in supplemental table 2. A stricter cut-off required all miRNAs to be uniformly present in every PEL cell line tested. This yielded 31 miRNAs or 19% of all miRNAs in the array (Figure 13C). By eliminating SD as an independent selection criterion this cut-off proved susceptible to outliers. It yielded the minimal PEL signature miRNA set listed in Figure4C, namely hsa- miR-9, -16, -17-3p, -17-5p, -19a, -20, -23b, -26a, -29b, -3Oe, -34a, -103, -106a, -140, -142-3p, -148a, -152, -181b, -182, -186, -191 , -194, -210, -301 , -320, - 331108 (61%) of the mature miRNA arrays were also represented in our pre- miRNA array. In addition, real-time QPCR for mature miRNA detected 11 (10%) of miRNAs, which were not detected at the pre-miRNA level, and pre- miRNA profiling detected 45 (42%) of pre-miRNAs for which we could not detect the corresponding miRNA. Hence, both consensus information as well as non-redundant information can be gained from combined mature miRNA and pre-miRNA profiling.

Non-saturating miRNA cloning previously reported a few cellular miRNAs for the BCBL-1 and BC-1 cell lines during the identification of the KSHV viral miRNAs (16,17). Cloning preferentially identified abundant miRNAs such as hsa-miR-16 (Figure 13C, miRNAs marked with an *), but not all that were detected by real-time QPCR-based mature miRNA profiling. Cloning also identified some miRNAs for which we could detect the pre-miRNA, but not the mature miRNA by real-time QPCR. Approximately half of the miRNAs uncovered herein by realtime QPCR were novel and not identified in prior cloning attempts.

It will be understood that various details of the presently disclosed subject matter may be changed without departing from the scope of the presently disclosed subject matter. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.

7 018478

LIST OF REFERENCES

1. Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev

Cancer. 2006;6:857-866. 2. Altuvia Y, Landgraf P, Lithwick G, et al. Clustering and conservation patterns of human microRNAs. Nucleic Acids Res. 2005;33:2697-2706. 3. Calin GA, Sevignani C, Dumitru CD, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A. 2004;101 .2999-3004. 4. Zhang L, Huang J, Yang N, et al. microRNAs exhibit high frequency genomic alterations in human cancer. Proc Natl Acad Sci U S A.

2006; 103:9136-9141. 5. Lee Y, Ann C, Han J, et al. The nuclear RNase III Drosha initiates microRNA processing Nature. 2003;425:415-419. 6. Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl T, Zamore

PD. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 2001 ;293:834-838.

7. Grishok A, Pasquinelli AE, Conte D, et al. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 2001 ; 106:23-

34.

8. Hammond SM, Bernstein E₁ Beach D, Hannon GJ. An RNA-directed nuclease mediates posttranscriptional gene silencing in Drosophila cells. Nature. 2000;404:293-296. 9. Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded

RNA. Nature 2004,431 :343-349. 10. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G₁ Tuschl T.

Human Argonaute2 mediates RNA cleavage targeted by miRNAs and

SiRNAs. MoI Cell. 2004; 15:185-197. 1 1. Zeng Y, Yi R, Cullen BR. MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci U

S A. 2003; 100:9779-9784. 12. Doench JG, Sharp PA. Specificity of microRNA target selection in translational repression. Genes Dev. 2004; 18:504-511.

13. Doench JG, Petersen CP, Sharp PA. siRNAs can function as miRNAs. Genes Dev. 2003; 17:438-442. 14. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. Kaposi's sarcoma-associatedherpesvirus-like DNA sequences in AIDS- related body-cavity-based lymphomas [see comments]. N. Engl J Med. 1995;332:1186-1191.

15. Klein U, Gloghini A, Gaidano G, et al. Gene expression profile analysis of AIDS-related primary effusion lymphoma (PEL) suggests a plasmablastic derivation and identifies PEL-specific transcripts. Blood. 2003:101 :4115-4121.

16. Cai X₁ Lu S, Zhang 2, Gonzalez CM, Damania B, Cullen BR. Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proc Natl Acad Sci LJ S A.2005;102:5570-5575.

17. Samols MA, Hu J, Skalsky RL, Renne R. Cloning and identification of a microRNA cluster within the latency-associated region of Kaposi's sarcoma-associated herpesvirus. J Virol. 2005;79:9301 -9305.

18. Marshall V₁ Parks T, Bagni R, et al. Conservation of Virally Encoded MicroRNAs in Kaposi Sarcoma-Associated Herpesvirus in Primary

Effusion Lymphoma Cell Lines and in Patients with Kaposi Sarcoma or Multicentric Castleman Disease. J Infect Dis. 2007;195:645-659.

19. Papin J, Vahrson W, Hines-Boykin R, Dittmer DP. Real-time quantitative PCR analysis of viral transcription. Methods MoI Biol. 2004;292:449- 480.

20. Fakhari FD, Dittmer DP. Charting Latency Transcripts in Kaposi's Sarcoma-Associated Herpesvirus by Whole-Genome Real-Time Quantitative PCR. J Virol. 2002:76:6213-6223.

21. Hilscher C, Vahrson W, Dittmer DP. Faster quantitative real-time PCR protocols may lose sensitivity and show increased variability. Nucleic

Acids Res. 2005;in press. 22. Gottwein E, Cai X, Cullen BR. A novel assay for viral microRNA function identifies a single nucleotide polymorphism that affects Drosha processing. J Virol. 2006;80:5321-5326.

23. Papin JF, Vahrson W, Dittmer DP. SYBR green-based real-time quantitative PCR assay for detection of West Nile Virus circumvents false-negative results due to strain variability. J Clin. Microbiol. 2004;42:1511 -1518.

24. Troyanskaya OG, Garber ME, Brown PO, Botstein D, Altman RB. Nonparametric methods for identifying differentially expressed genes in microarray data. Bioinformatics. 2002;18:1454-1461.

25. Pfeffer S, Sewer A, Lagos-Quintana M, et al. Identification of microRNAs of the herpesvirus family. Nat Methods. 2005;2:269-276.

26. Nair P, Pan H, Stallings RL, Gao SJ. Recurrent genomic imbalances in primary effusion lymphomas. Cancer Genet Cytogenet. 2006;171 :119- 121.

27. Mullaney BP₁ Ng VL₁ Hemdier BG, McGrath MS, Pallavicini MG. Comparative genomic analyses of primary effusion lymphoma. Arch Pathol Lab Med. 2000; 124:824-826.

28. Staudt MR, Kanan Y, Jeoηg JH, Papin JF, Hines-Boykin R, Dittmer DP. The tumor microenvironment controls primary effusion lymphoma growth in vivo. Cancer Res. 2004;64:4790-4799.

29. He L, Thomson JM, Hemann MT₁ et al. A microRNA polycistron as a potential human oncogene. Nature. 2005;435:828-833.

30. Jiang J₁ Lee EJ₁ Gusev Y₁ Schmittgen TD. Real-time expression profiling of microRNA precursors in human cancer cell lines. Nucleic Acids Res.

2005;33:5394-5403.

31. Schmittgen TD, Jiang J₁ Liu Q₁ Yang L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 2004;32:e43. 32. Chen CZ₁ Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004;303:83-86. 33. Pekarsky Y, Santanam U, Cimmino A, et al. TcH expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res. 2006;66:11590-1 1593.

34. Cimmino A, Calin GA, Fabbri M, et al. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A.

2005;102:13944-13949.

35. Sarid R, Sato T, Bohenzky RA₅ Russo JJ, Chang Y. Kaposi's sarcoma- associated herpesvirus encodes a functional bcl-2 homologue. Nat Med. 1997;3:293-298. 36. Welch C, Chen Y, Stallings RL. MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene. 2007.

37. Tuddenham L, Wheeler G, Ntounia-Fousara S, et al. The cartilage specific microRNA-140 targets histone deacetylase 4 in mouse cells. FEBS Lett. 2006:580:4214-4217.

38. Poliseno L, Tuccoli A, Mariani L, et al. MicroRNAs modulate the angiogenic properties of HUVECs. Blood. 2006; 108:3068-3071.

39. Lee EJ₅ Gusev Y, Jiang J, et al. Expression profiling identifies microRNA signature in pancreatic cancer, lnt J Cancer. 2007;120:1046-1054. 40. Eis PS, Tarn W, Sun L, et al. Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci U S A. 2005; 102:3627- 3632.

41. Kluiver J, van den Berg A, de Jong D, et al. Regulation of pri-microRNA BIC transcription and processing in Burkitt lymphoma. Oncogene.2006.

Claims

CLAIMSWhat is claimed is:

1. An isolated polynucleic acid selected from the group consisting of: a) a polynucleic acid comprising a nucleic acid sequence set forth in

Table 1 or Table 2; b) a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2; and c) a polynucleic acid capable of hybridizing under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4, wherein the polynucleic acid is 50 nucleotides or shorter.

2. The isolated polynucleic acid of claim 1 , wherein the oligonucleotide is from about 15 to about 30 nucleotides.

3. A library of isolated polynucleic acids, wherein each polynucleic acid is 30 nucleotides or shorter and hybridizes under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4.

4. The library of claim 3, wherein each polynucleic acid is selected from the group consisting of: a) a polynucleic acid comprising a nucleic acid sequence set forth in

Table 1 or Table 2; and b) a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2.

5. The library of claim 3, wherein each polynucleic acid is attached on a support.

6. The library of claim 5, wherein the support comprises a plurality of addresses, wherein each address is associated with at least one of the polynucleic acids.

7. A kit for determining the presence of miRNA expressed in a sample, comprising: a) a library comprising a substrate and a plurality of polynucleic acids arranged in pre-determined locations on the substrate, wherein each polynucleic acid is 30 nucleotides or shorter and hybridizes under stringent conditions to a nucleic acid sequence set forth in Table 3 or Table 4; and b) an instruction set for utilizing the kit.

8. The kit of claim 7, wherein each polynucleic acid is selected from the group consisting of: a) a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; and b) a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to. a nucleic acid sequence set forth in

Table 1 or Table 2.

9. A method for detecting, quantifying, or both at least one miRNA directed against at least one specific gene present in a sample, comprising: a) isolating RNA comprising at least one miRNA of interest from a sample; b) generating a cDNA of the miRNA; c) producing a polynucleic acid amplification product by polymerase chain reaction of the cDNA using polynucleic acid primer pairs having binding specificity for the cDNA under hybridization conditions; and d) detecting, quantifying or both detecting and quantifying the polynucleic acid amplification product.

10. The method of claim 9, wherein the at least one miRNA comprises at least one precursor miRNA (pre-miRNA).

11. The method of claim 9, wherein the at least one pre-miRNA comprises a nucleic acid sequence set forth in Table 3.

12. The method of claim 9, wherein the at least one miRNA comprises at least one mature miRNA.

13. The method of claim 9, wherein the at least one mature miRNA comprises a nucleic acid sequence set forth in Table 4.

14. The method of claim 9, wherein the sample comprises one or more cells.

15. The method of claim 14, wherein sample comprises blood or tissue.

16. The method of claim 9, wherein each of the polynucleic acid primers in the primer pair is 30 nucleotides or shorter and is a polynucleic acid selected from the group consisting of: a) a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; and b) a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in

Table 1 or Table 2.

17. The method of claim 9, wherein the polynucleic acid primer pairs can have binding specificity for a precursor miRNA (pre-miRNA), a mature miRNA or both.

18. The method of claim 9, wherein detecting, quantifying, or both at least one miRNA in the sample is correlated with determining cellular transcriptional regulation by the at least one miRNA.

19. The method of claim 18, wherein the cellular transcriptional regulation is related to the development of an organism.

20. The method of claim 18, wherein the cellular transcriptional regulation is related to cell differentiation.

21. The method of claim 18, wherein the cellular transcriptional regulation is related to cell proliferation.

22. The method of claim 18, wherein the cellular transcriptional regulation is related to cell death.

23. The method of claim 18, wherein the cellular transcriptional regulation is related to chromatin condensation.

24. The method of claim 18, wherein the cellular transcriptional regulation is related to cell transformation.

25. The method of claim 18, wherein the cellular transcriptional regulation is related to cancer cell detection, cancer cell characterization, or both.

26. The method of claim 9, wherein a plurality of miRNAs are simultaneously detected.

27. The method of claim 26, wherein detecting, quantifying, or both the plurality of miRNAs in the sample is correlated with a pattern of expression of the genes in the same sample.

28. The method of claim 26, wherein at least 3, preferably 20, and more preferably 50 of the miRNAs set forth in Table 3 and Table 4 are simultaneously detected, quantitated, or both.

29. The method of claim 26, wherein each of the polynucleic acid primers in the primer pairs are compatible for use under the same reaction conditions.

30. The method of claim 29, wherein the melting temperature (Tm) of a hybrid of each of the polynucleic acid primers is from about 45⁰C to about 65°C.

31. The method of claim 30, wherein the melting temperature (Tm) of a hybrid of each of the polynucleic acid primers is from about 58°C to about 62°C.

32. A method for designing a polynucleotide primer sequence for amplifying a precursor miRNA (pre-miRNA), a mature miRNA, or both of interest, comprising: a) selecting a polynucleotide sequence template corresponding to at least a portion of a miRNA polynucleotide sequence; and b) designing at least one pair of primer polynucleotide sequences having binding specificity under hybridization conditions to at least a portion of the polynucleotide sequence template and having the characteristics of one or more of: i. about 15 to about 25 nucleotides in length; ii. a melting temperature (Tm) in a hybrid of from about 58°C to about 62⁰C; iii. a maximum difference in Tm between two primers within the same primer pairs of about 2°C; iv. a maximum complementary overlap at the 3^l ends of a primer pair of about four nucleotides; v. a maximum self-complementarity in the primer polynucleotide sequence of about four nucleotides; vi. a G/C content of the primer polynucleotide sequence of from about 20% to about 80%; and vii. a maximum length of a polynucleotide amplification product of less than about 110 nucleotides with a range of polynucleotide length of the amplification product of no more than +/- 10% of a predetermined optimal polynucleotide length of the amplification product.

33. The method of claim 32, wherein at least one pair of primer polynucleotide sequences is designed.

34. The method of claim 33, wherein the polynucleotide sequences in the primer pair have the characteristics of: i. two or fewer complementarity mismatches with the polynucleotide sequence template; ii. a distance between the polynucleotide sequence templates for each polynucleotide sequence primer in the primer pair of less than 4,000 nucleotides; iii. each polynucleotide sequence primer in the primer pair having binding specificity on opposite strands of the polynucleotide sequence template; and iv. each polynucleotide sequence primer in the primer pair oriented upon binding to the polynucleotide sequence template with 3¹ ends pointed toward each other.

35. The method of claim 33 wherein a plurality of primer pair polynucleotide sequences is designed.

36. The method of claim 34, wherein each of the plurality of primer pairs has binding specificity under hybridization conditions to a distinct portion of the miRNA polynucleotide sequence.

37. The method of claim 34, wherein each of the plurality of primer pairs has binding specificity under hybridization conditions to a polynucleotide sequence from different miRNAs.

38. A computer program, product comprising computer-executable instructions embodied in a computer-readable medium for performing steps comprising: a) selecting a polynucleotide sequence template corresponding to at least a portion of a miRNA polynucleotide sequence; and b) designing at least one pair of primer polynucleotide sequences having binding specificity under hybridization conditions to at least a portion of the polynucleotide sequence template and having one or more of the characteristics of: i. about 15 to about 25 nucleotides in length; ii. a melting temperature (Tm) in a hybrid of from about 58^CC to about 62°C; iii. a maximum difference in Tm between two primers within the same primer pairs of about 2°C; iv. a maximum complementary overlap at the 3' ends of a primer pair of about four nucleotides; v. a maximum self-complementarity in the primer polynucleotide sequence of about four nucleotides; vi. a G/C content of the primer polynucleotide sequence of from about 20% to about 80%; and vii. a maximum length of a polynucleotide amplification product of less than about 110 nucleotides with a range of polynucleotide length of the amplification product of no more than +/- 10% of a predetermined optimal polynucleotide length of the amplification product.

39. A method for detecting at least one sequence variation in at least one miRNA in a sample, comprising: a) isolating RNA comprising at least one miRNA of interest from a sample; b) generating a cDNA of the miRNA; c) producing a labeled polynucleic acid amplification product by polymerase chain reaction of the cDNA using a label and polynucleic acid primer pairs having binding specificity for the cDNA under hybridization conditions; and d) quantifying an amount of labeled polynucleic acid amplification product produced to thereby detect at least one sequence variation in the at least one miRNA.

40. The method of claim 39, wherein the at least one miRNA comprises at least one precursor miRNA (pre-miRNA).

41. The method of claim 40, wherein the at least one pre-miRNA comprises a nucleic acid sequence set forth in Table 3.

42. The method of claim 39, wherein the at least one miRNA comprises at least one mature miRNA.

43. The method of claim 40, wherein the at least one mature miRNA comprises a nucleic acid sequence set forth in Table 4.

44. The method of claim 39, wherein the sample comprises one or more cells.

45. The method of claim 44, wherein the sample comprises blood and/or tissue.

46. The method of claim 39, wherein each of the polynucleic acid primers in the primer pair is 30 nucleotides or shorter and is a polynucleic acid selected from the group consisting of: a) a polynucleic acid comprising a nucleic acid sequence set forth in Table 1 or Table 2; and b) a polynucleic acid comprising a nucleic acid sequence having at least about 90% identity to a nucleic acid sequence set forth in Table 1 or Table 2.

47. The method of claim 39, wherein the polynucleic acid primer pairs can have binding specificity for a precursor miRNA (pre-miRNA), a mature miRNA or both.

48. The method of claim 39, wherein the label comprises a fluorescent label.

49. The method of claim 39, wherein detecting the at least one sequence variation in the at least one miRNA in the sample is correlated with determining cellular transcriptional regulation by the at least one miRNA.

50. The method of claim 49, wherein the cellular transcriptional regulation is related to cancer cell detection, cancer cell characterization, or both.

51. The method of claim 49, wherein the cellular transcriptional regulation is related to the development of an organism.

52. The method of claim 49, wherein the cellular transcriptional regulation is related to cell differentiation.

53. The method of claim 49, wherein the cellular transcriptional regulation is related to cell proliferation.

54. The method of claim 49, wherein the cellular transcriptional regulation is related to cell death.

55. The method of claim 49, wherein the cellular transcriptional regulation is related to chromatin condensation.

56. The method of claim 49, wherein the cellular transcriptional regulation is related to cell transformation.

57. The method of claim 39, wherein the at least one sequence variation is at least one single nucleotide polymorphism (SNP).

58. The method of claim 39, wherein a plurality of sequence variations are simultaneously detected.

59. The method of claim 58, wherein detecting the plurality of sequence variations is correlated with a pattern of expression of one or more genes in the sample.

60. The method of claim 58, wherein at least 3, preferably 20, and more preferably 50 sequence variations within the miRNAs set forth in Table 3 and Table 4 are simultaneously detected.

61. The method of claim 58, wherein each of the polynucleic acid primers in the primer pairs are compatible for use under the same reaction conditions.

62. The method of claim 61 , wherein the melting temperature (Tm) of a hybrid of each of the polynucleic acid primers is from about 45°C to about 65°C.

63. The method of claim 62, wherein the melting temperature (Tm) of a hybrid of each of the polynucleic acid primers is from about 58°C to about 62°C.

64. A computer system comprising: a) a relational database having records containing information related to at least one pair of_primer polynucleotide sequences having binding specificity under hybridization conditions to at least a portion of a polynucleotide sequence template and identifying one or more of the following characteristics: i. about 15 to about 25 nucleotides in length; ii. a melting temperature (Tm) in a hybrid of from about 58°C to about 62°C; iii. a maximum difference in Tm between two primers within the same primer pairs of about 2 ⁰C; iv. a maximum complementary overlap at the 3¹ ends of a primer pair of about four nucleotides; v. a maximum self-complementary in the primer polynucleotide sequence of about four nucleotides; vi. a G/C content of the primer polynucleotide sequence of from about 20% to about 80%; and vii. a maximum length of a polynucleotide amplification product of less than about 110 nucleotides with a range of polynucleotide length of the amplification product of no more than ±10% of a predetermined optimal polynucleotide length of the amplification product; and b) a sequence design function configured to design the at least one primer polynucleotide sequence having binding specificity under hybridization conditions to at least a portion of the polynucleotide sequence template and having the one or more characteristics identified by the relational database.

65. The computer system of claim 64, wherein the sequence design function is configured to design a plurality of primer pair polynucleotide sequences.

66. The computer system of claim 65, wherein the relational database has records containing information identifying one or more of the following characteristics of the primer polynucleotide sequences in the primer pair. i. two or fewer complementary mismatches with the polynucleotide sequence template; ii. three or more complementary mismatches for each of the primer polynucleotide sequences in the primer pair to polynucleotide sequences of less than 4,000 nucleotides present in a genome of interest and other than the polynucleotide sequence template; iii. each polynucleotide sequence primer in the primer pair having binding specificity on opposite strands of the polynucleotide sequence template; and iv. each polynucleotide sequence primer in the primer pair oriented upon binding to the polynucleotide sequence template with 3¹ ends pointed toward each other.

67. The computer system of claim 64, wherein the sequence design function is configured to design a plurality of primer pair polynucleotide sequences.

68. The computer system of claim 67, wherein each of the plurality of primer pairs has binding specificity under hybridization conditions to a distinct portion of the miRNA polynucleotide sequence.

69. The computer system of claim 67, wherein each of the plurality of primer pairs has binding specificity under hybridization conditions to a polynucleotide sequence from different miRNAs.