WO2008009179A1

WO2008009179A1 - A novel human gene-loc344967 related with nasopharyngeal carcinoma and the protein it encodes

Info

Publication number: WO2008009179A1
Application number: PCT/CN2006/002212
Authority: WO
Inventors: Yixin Zeng
Original assignee: Sun Yat-Sen University Cancer Center
Priority date: 2006-07-10
Filing date: 2006-08-28
Publication date: 2008-01-24
Also published as: CN101104852A

Abstract

A novel human gene -LOC344967, which is closely related with nasopharyngeal carcinoma's occurring and development and it is widely expressed in many human tissues, NPC biopsy specimen and NPC cell lines. When it is highly expressed in nasopharyngeal carcinoma cell lines, such as NP69, C666-1, CNE-2 tissues, it can lead to apoptosis's occurring, showing that it has important biological function. LOC344967 can be used as a new target to diagnose and treat nasopharyngeal carcinoma and other types of tumors.

Description

Human new gene LOC344967 associated with nasopharyngeal carcinoma and its encoded protein product

[Technical field]

The present invention is in the field of biotechnology, and in particular, the present invention describes the discovery, preparation and validation of a novel human gene LOC344967.

[Background technique]

Nasopharyngeal Carcinoma (NPC) is highly prevalent in Guangdong Province and is known as Canton Tumor. Guangdong is not only a high-risk area for nasopharyngeal cancer in China, but also has morbidity and mortality worldwide. It is also the highest. This remarkable regional and ethnic distribution of nasopharyngeal carcinoma has attracted a lot of interest from scholars at home and abroad, and what is the reason for the high incidence of nasopharyngeal cancer in the region. Researchers at home and abroad have tried to explain this phenomenon with newly developed technologies and new theories.

In 2002, the research team located the PC susceptibility gene on the 4pl5.1-ql2 region, and then further fine-positioned the region to D4S2950 to D4S3347. The genetic map distance was 8.29cM, corresponding to 4pl5.1-4pll. The results were published in Nature Genetics.

Recently, based on the accumulated genetic basis, the applicants used bioinformatics and molecular biology methods. Based on the positioning results of pre-NPC susceptibility genes, the applicant adopted the location ^ candidate cloning strategy to select the 4pl5.1-ql2 region. The gene, using a PCR-sequencing method, screens the detection gene into the promoter region of LOC344967 for sequence variation linked to familial nasopharyngeal carcinoma patients. This mutation results in the production of AP-1 transcription factor binding sites,

Confirmation The expression of LOC344967 is elevated and is inherited with the nasopharyngeal cancer susceptible haplotype.

LOC344967 is located on the human chromosome 4pl4 (NCBI Human Genome Project database, Build 35) and was once considered a pseudogene. It was later reported as a predictive gene by the NEDO human cDNA sequencing project in Japan and named as AK125299. In the NCBI database, its sequence has been updated and changed. LOC344967 was identified in NCBI build 35.1. Its mR A is 1613 bp in length and has 3 exons. It is predicted to be transcribed to encode 252 amino acids. This protein contains 2 acyl-CoA. Hydrogenase (Acyl-CoA hydrolase) The conserved domain of 4HBTD may be involved in lipid metabolism.

According to the amino acid sequence alignment between LOC344967 and acyl-CoA thioesterase 7 isoform hBACHa (NM-007274, NP-009205), LOC344967 and acetyl-CoA hydrolase (hBACH, EC 3.1.2.2, The gene is located at 1ρ36.31-ρ36.11) with a homology of 88.4 «1⁄2. Acetyl-CoA hydrolase is highly conserved and has a wide range of thioesterase activities. It can be localized on the membrane of the organelle, or it can exist in soluble form in the mitochondria and cytosol, and can also be transferred to the nucleus under certain conditions. The catalytic activity of acetyl-CoA hydrolase is an intrinsic component of animal fatty acid synthase, which catalyzes the elongation of fatty acid chains. Other thioesterases may interact non-covalently with fatty acid synthase in a certain organization. The length of the fatty acid product is modified. Although the role of these fatty acid synthase-associated thioesterases in cellular metabolism is not well defined, their most prominent role is in the action of peroxisomes and mitochondrial organs (participating in fatty acid Beta oxidation).

The function of many acetyl-CoA hydrolases is not yet clear, and the regulation of acyl-CoA aggregation by thioesterase in cells provides a mechanism for regulation of fat metabolism. Thioesterase It regulates some acylation states, such as: signal transduction proteins and their intracellular localization. Acyl coenzyme

A and acyl-CoA thioesterase are also involved in the transport of intracellular substances, which are involved in cell endocytosis. Current research indicates that HIV 1 Nef protein interacts with acyl-CoA to form human thioesterase, which is required for Nef-induced downstream regulation of CD4; as well as fatty acid synthase (FAS) compared to normal epithelial cells Increased expression in prostate cancer cells, Orlistat, an inhibitor of FAS, induces apoptosis in prostate cancer cells. Related reports indicate that acetyl-CoA hydrolase plays an important role in organisms, and abnormal expression usually leads to abnormal contraction and proliferation of cells and tissues, inflammation, immune system diseases and various tumors.

For LOC344967, although its biological function is not fully understood, its mRNA was detected by RT-PCR in many normal human tissues, NPC biopsy specimens and NPC cell lines. Its extensive tissue distribution illustrates the important biology of the gene. It can be considered that the mutation can lead to an increase in the activity of the enzyme, resulting in an abnormal metabolism of the fatty acid, which plays an auxiliary role in the transformation of the epithelial cells.

[Summary of the Invention]

The present invention provides an isolated novel human nucleic acid molecule LOC344967 comprising a polynucleotide encoding a protein involved in cell cycle regulation, and the LOC344967 of the present invention is expressed by human acyl-CoA hydrolase (ACOT7 I hBACH) Highly homologous.

The invention also relates to the correlation, expression and antibody preparation of the nucleic acid molecule LOC344967 with nasopharyngeal carcinoma, and a recombinant expression vector comprising the nucleic acid molecule of LOC344967 pCIneo-LOC344967 and pEGFP-Nl-LOC344967. The fusion expression product of LOC344967 and EGFP localizes to the cytoplasm and can promote apoptosis of host cells. The cells include nasopharyngeal carcinoma cell lines such as NP69, C666-1, CNE-1, CNE-2 and other cell lines.

[Description of the Drawings]

Figure ί: RT-PCR was used to detect the expression of LOC344967 in various tissues and cell lines.

Figure 2: Western Blotting detects the expression of LOC344967 in cell lines.

Figure 3: Western Blotting detects the transient expression of LOC344967 in 293T cells.

Figure 4: Intracellular localization of EGFP-LOC344967 fusion protein under fluoroscopy. Figure 5: pEGFP-Nl and Peg-Nl-LOC344967 transfected with C666-1, 1640 medium (containing 10% FCS, 400 ug/mL G418). Screening after 2 weeks (A, B were transfected with pEGFP-N1 cells, respectively) Photographs under light microscope and fluoroscopy; C, D are transfected Peg-Nl-LOC344967 cells under light microscope and fluoroscopy).

Figure 6: Apoptosis was detected by DAPI staining of NP69 cells after pCIneo-LOC344967 and pCIneo (A was transfected with pCIneo-LOC344967; B was transfected with pCIneo control. Arrows showed apoptotic nuclei).

[detailed description]

Example 1: Genetic analysis and screening of LOC344967 related to nasopharyngeal carcinoma Based on the accumulated genetic basis, using bioinformatics and molecular biology methods, based on the location of pre-NPC susceptibility genes, the location candidate cloning strategy was adopted. , choose The gene in the 4pl5.lq.12 region was screened by PCR-sequencing to screen for the sequence variation in the promoter region of LOC344967 in association with familial nasopharyngeal carcinoma patients. This mutation results in the production of the AP-1 transcription factor binding site, and the expression of LOC344967 is elevated, which is inherited with the nasopharyngeal cancer susceptible haplotype. Example 2: RT-PCR method for cloning the LOC344967 gene

Total RNA was extracted from nasopharyngeal carcinoma tissue as a template, cDNA was synthesized by reverse transcription reaction using oligo-dT as a primer, and PCR amplification was carried out using the following primers-

Primer 1 : 5, ATCAAAGAGGCGGGCGCCATCATC3, (SEQ ID NO. 4)

Primer 2: 5'GGTGAAGACACTGGCGGCCC3' (SEQ ID NO. 5) Primer 1 is the forward sequence at base 501 of the 5' end of SEQ ID NO. 1; Primer 2 is located at the 5' end of SEQ ID NO. Reverse complementary sequence

Amplification conditions: 50 mmol/L KC1, 10 mmol/L Tris-Cl (pH 8.5), 1.5 mmol/L MgCl ₂ , 200 umol/L dNTP, 10 pmol primer, 1 U Teq in a 50 uL reaction system DNA polymerase (product of Promega). The reaction was carried out for 25 cycles on a PE9600 DNA Thermal 'Circulator (Perkin-Elmer) under the following conditions: 94 °C 30 Sec; 58 °C 30 Sec; 72 °C 1 min. The amplified product was purified and ligated into the pMD18-T vector (product of Takara Co., Ltd.) using a TA cloning kit. The DNA sequence analysis revealed that the DNA sequence of the PCR product was identical to that of 501 - 1251 bp shown in SEQ ID NO. . Example 3: RT-PCR analysis of the expression of LOC344967 in human tissues and cell lines

Total RNA from normal biopsy tissue samples and cells was amplified by RT-PCR. The tissues included liver, lung, kidney, brain, intestine and 2 cases of nasopharyngeal carcinoma. The cells included NP69, C666-1, CNEK CNE2, SU El. o PCR primers are SEQ ID NO. 4 and SEQ ID N0.5. The result is shown in Figure 1. Example 4: Antibody against LOC344967 protein

According to the sequence SEQ ID N0.2, amino acids 102-118 (such as SEQ ID NO. 3) were selected for analysis, and the short peptide N'-CYFRQEQEEEGQKRYKT-C' was synthesized, and a cysteine was added at the N-terminus for coupling to the KLH vector. The protein, the conjugated product, was immunized to New Zealand rabbits to obtain a polyclonal antibody against the SEQ ID NO. Example 5: Western Blotting analysis of LOC344967 expression in cell lines

P69, C666, CNE1 and CNE2 cell lysates were selected, and the protein concentration (Pierce product) was detected by BCA method. Each 15 ug was loaded on a 12% SDS-PAGE gel and transferred to a PVDF membrane. Membranes were blocked with 5% skim milk powder in TBST (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween 20) overnight, incubated with 1:200 diluted polyclonal antibody S1107 for 1 hour, and washed twice with TBST. HRP-labeled secondary antibody was added for 1.5 hours. Finally, TBST was washed 3 times to remove unbound antibody, ECL The chemiluminescence strip was detected (Cell Signaling Technology) and developed on Kodak X-ray film. The result is shown in Figure 2. Example 6: Construction of expression 'plasmid pEGFP-Nl-LOC344967 and pIRESneo3-FLAG-LOC344967

The following pair of primers PCR method amplified the expression framework of LOC344967, and both ends were Bglll and EcoRI restriction sites, and were cloned into pEGFP-Nl plasmid (for Clontech).

Primer 3: 5' GCAGATCTACCATGGATTACAAGGATGACG 3' (SEQ ID NO. 6)

Primer 4: 5' GCGAATTCCCAGATCCTCTTCTGAGATGA 3 ( SEQ ID N0.7)

The DNA sequence of the constructed expression plasmid pEGFP-Nl-LOC344967 was completely sequenced and did not interfere with the reading frame of EGFP protein.

The expression framework of LOC344967 was amplified by the following pair of primers, and the two ends were Bamffl and BstXI restriction sites, which were cloned into pIRESneo3 plasmid (for Clontech), and added to the N-terminus of LOC344967 by primers. Label (Order 歹lj is Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys)

Primer 5:

CGGGATCCACCATGGATTACAAGGATGACGACGATAAGATC

AAAGAGGCGGGCG 3' (SEQ ID 0.8) Primer 6:

,

CCAGCACACTGGTTACAGATCCTCTTCTGAGATGAGTTTTTGT TCGGTGAAGACACTGGCGG 3' (SEQ ID N0.9)

The DNA sequence of the constructed expression plasmid pIRESneo3-FLAG-LOC344967 was completely confirmed by sequencing. Example 7: Expression plasmid pIRESneo3-FLAG-LOC344967 transfection 293T fine 'cell transient expression and Western Blotting detection

Qiagen Mini Pre granule extraction reagent cartridge granules pIRESneo3-FLAG-LOC344967, once precipitated with ethanol, washed twice with 70% ethanol, dissolved in sterile water.

Transfected 293T cells according to Roche's Fugene 6. Transfection Reagent Instructions. Forty-eight hours after transfection, the cell lysate was used for Western Blotting detection. The antibody was an HRP-labeled anti-FLAG mAb, ECL chemiluminescence detection band (Cell Signaling Technology), and developed on Kodak X-ray film. The result is shown in Figure 3. Example 7: pEGFP-Nl-LOC344967 localization in cells

Plasmid pEGFP-Nl-LOC344967 was transfected into 293T cells and photographed at high magnification after fluoroscope 16 hours later. The result is cytoplasmic expression, as shown in Figure 4. Example 7: High expression of LOC344967 in cell lines leads to the occurrence of apoptosis Plasmids pEGFP-Nl and pEGFP-Nl-LOC344967 were transfected into NP69, C666-1, and CNE-2 cell lines, respectively, and the procedures were followed according to Roche's Fugene 6 transfection reagent instructions. Fluorescent cell status was observed under a fluorescence microscope at 24, 48, and 72 hours after cell transfection. It was observed that the fluorescent positive cells transfected with pEGFP-Nl-LOC344967 gradually condensed and died, while the control positive cells transfected with pEG P-Nl grew well.

After 48 hours of C666-1 transfection, trypsin digested 1 : 10 dilution passage, add 10% FCS 1640 (including 400 13⁄4/11^ 0418) for screening, and change the solution every other day. After 2 weeks of screening, the microscope was observed. The result is shown in Figure 5.

After transfecting the plasmids pEGFP-Nl and pEGFP-Nl-LOC344967, the cells were stained with DAPI, and the nuclear morphology was observed under a fluorescence microscope to determine the apoptotic condition. The result is shown in Figure 6.

Claims

Claim

An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of:

a) a nucleotide sequence encoding a full-length polypeptide having the amino acid sequence set forth in SEQ ID NO: 2; b) a nucleotide sequence complementary to the nucleotide sequence of (a) above;

c) a nucleotide sequence that hybridizes to the nucleotide sequence of (a).

The nucleic acid molecule according to claim 1, wherein the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO.

3. An expression vector comprising the nucleic acid molecule of claim 1 or 2.

4. A polypeptide which is a full length, LOC344967 protein or a biologically active fragment having the complete amino acid sequence set forth in SEQ ID NO.

5. An antibody to the polypeptide of claim 4.

6. Use of the nucleic acid molecule of claim 1 or 2 as a medicament for the treatment of a nasopharyngeal carcinoma tumor.

7. The nucleic acid molecule of claim 1 or 2 for use as a medicament for the diagnosis of a nasopharyngeal carcinoma tumor.

8. Use of the nucleic acid molecule of claim 1 or 2 as a diagnostic and therapeutic agent for nasopharyngeal carcinoma.