WO2008002849A2 - Aryl sulfones - Google Patents

Abstract

Aryl sulfones of Formula (I) are provided, in which the variables are as described herein. Such compounds may be used to modulate bradykinin receptor activity in vivo or in vitro, and are particularly useful in the treatment of conditions responsive to B1 modulation in humans, domesticated companion animals and livestock animals, including inflammation and pain. Pharmaceutical compositions and methods for using them to treat such disorders are provided, as are methods for using such ligands for receptor localization studies and various in vitro assays.

Description

ARYL SULFONES

FIELD OF THE INVENTION

This invention relates generally to aryl sulfones, and to the use of such compounds to treat conditions responsive to bradykinin receptor- 1 (B ι) modulation. The invention further relates to the use of such compounds as reagents for the identification of other agents that bind to B₅, and as probes for the detection and localization Of B₁.

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application 60/805,781, filed June 26, 2006, which is hereby incorporated by reference in its entirety.

DESCRIPTION OF THE SEQUENCE LISTING

SEQ ID NO: 1 B , PCR primer number 1

SEQ ID NO:2 Bi PCR primer number 2

SEQ ID NO:3 B₁ PCR primer number 3 SEQ ID NO:4 B₁ PCR primer number 4

BACKGROUND OF THE INVENTION

Millions of people throughout the world suffer debilitating and incapacitating pain. Current treatments for pain can be beneficial, but such treatments are not completely effective, and typically have undesirable side effects. For example, non-steroidal anti-inflammatory drugs are commonly used, but are only moderately effective against pain, and have serious renal and gastrointestinal side effects at high doses. Opiates, such as morphine, are potent analgesics, but their usefulness is limited because of adverse side effects, such as physical addictivertess and withdrawal properties, as well as respiratory depression, mood changes, and decreased intestinal motility with concomitant constipation, nausea, vomiting, and alterations in the endocrine and autonomic nervous systems. There is thus a need for effective agents for the treatment of pain.

Bradykinin (BK) is a nonapeptide (Arg-Pro-Pro-GIy-Phe-Ser-Pro-Phe-Arg) that functions in cardiovascular homeostasis, contraction and relaxation of smooth muscles, inflammation and pain. The effects of BK are mediated by specific G protein-coupled BK receptors, of which there are at least two distinct subtypes termed B₁ and B₂. The B₂ receptor is expressed constitutive Iy in a variety of tissues. In contrast, the B₁ receptor is inducibly expressed in response to pathophysiological conditions such as inflammation, pain, trauma, bacterial infection, burns and shock.

Accordingly, B₁ is a particularly attractive drug target for these and other conditions, and agents that act at this receptor may be targeted specifically to injured tissues, with minimal effects in normal tissues. In addition, compounds that bind to Bj and/or modulate the activity of Eh also find use as research tools.

There is thus a need in the art for small molecule modulators of Bj activity. The present invention fulfills this need and provides further related advantages,

SUMMARY OF THE INVENTION

The present invention provides aryl sulfones that satisfy Formula I:

Formula I

or are a pharmaceutically acceptable salt, solvate (e.g., hydrate) or ester of such a compound.

Within Formula I:

== represents a single or double bond; B is N or CH;

Ar is phenyl or a 5- or 6-membered heteroaryl, each of which is optionally substituted, and each of which is preferably unsubstituted or substituted on one or more ring carbon atoms with a substituent independently chosen from Ri;

Y is a group of the formula (CH₂)_F-W-(CH₂)_P, which is optionally substituted and is preferably substituted with from 0 to 4 substituents independently chosen from: (i) amino, hydroxy, cyano,

Ci-Qalky], C₂-C₆a!kenyl, C₂-C₆alkynyl and C₁-C₆IIaSo alky 1; (ii) substituents of the same carbon atom or adjacent carbon atoms that are taken together to form C₃-C_fiCycloalkyl, and (iii) substituents that are taken together with R₂ or R₃ to form a 4- to 7-membered carbocycle or heterocycle, wherein: W is absent, CH₂, O, S or NR_!3, wherein R_]3 is hydrogen or CpCgalkyl; and r and p are independently chosen integers ranging from 0 to 6, such that the sum of r and p ranges from 1 to 6; each Ri is independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosulfonyl and -COOH; (ii) CrQalky], C₂-C₆alkenyl, C₂-C₆alkynyl, C ,-C₆haloalkyl, C_rC₆aikyl ether, (C₃-

C₈cycloalkyl)C₀-C₄alkyl, C,-C₆alkoxy, C,-C₆alkylthio, C,-C₆alkylsulfinyl, C]- Cβalkoxycarbonyl,

mono- or di-(C]-C_<5alkyi)amiπoCo-Gsalkyl, mono- or di-(C_rC₆alkyl)aminosu!fonylCo-C₄alkyl, and (4- to 8-membered heterocycloalkyl)Co-C₄aikyl; each of which is optionally substituted and each of which is preferably substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; and (iii) groups that are taken together with an Ri attached to an adjacent ring carbon atom to form a fused 5- to 10-membered carbocycle or heterocycle that is optionally substituted and is preferably substituted with from 0 to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, oxo, Ci-QalkyL Cj-Cehaloalkyi, C₁-C₆aikoxy, Cj- Qhaloalkoxy, and mono- or di-(Ci-C₆a]kyl)aminoCo-C₄alkyl;

R₂ and R₃ are:

(i) independently chosen from:

(a) hydrogen; and

(b) CrQalkyl, C₂-C₆alkenyl, C₂-C₆alkynyl, Q-Qhaloalkyl, and (C₃-Cscycioalkyl)Co-C₄alky], each of which is optionally substituted and each of which is preferably substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, amino and C_rC₄alkyl; or

(ii) taken together to foπn a 4- to 10-membered carbocycie or heterocycle that is optionally substituted; preferably the carbocycfe or heterocycle so formed is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, halogen, amino and CpCjalkyl;

R₄ and R₅ are:

(i) independently chosen from:

(a) hydrogen; and

(b) C_rC₆alkyI, C₂-C₆alkenyl, C₂-C₆alkynyl, C,-C₆haloalkyl, C₂-C₆alkyl ether, mono- or di- (C_rC₆alkyl)aminoCi-C₄afkyl, (3- to 10-membered carbocycle)C₀-C₄alkyl or (4- to 10- membered heterocyc]e)Co-C₄aikyl_; each of which is optionally substituted and each of which is preferably substituted with from 0 to 6 substituents independently chosen from (1) oxo, hydroxy, cyano, halogen, amino, aminocarbonyl, aminosulfonyl, and -COOH; and (2) C_rC₄alkyl, C_rC₆alkyl, (C₃-C₈cycloalkyl)C₀-C₄alkyl, d-Qalkoxy, phenylC₀- C₄alky! and (5- or 6-membered heterocycIe)C₀-C₄alkyl, each of which is further substituted with from 0 to 4 substituents independently chosen from amino, cyano, halogen, hydroxy, Cj-C₅alkyl, (C₃-C₈cycloaikyl)Co-C₄alkyi, Ci-Qhaloalkyl, C_rC₆alkoxy, Ci-Cgalkoxycarbonyl, mono- or di-(C_rC₆alkyl)amino, phenylCo-Qalkyl and phenylCV C₄alkoxy; or (ii) taken together to foπn a 4- to 10-membered heterocycle that is optionally substituted; and is preferably substituted with from 0 to 4 substituents independently chosen from:

(a) hydroxy, oxo, cyano and amino;

(b) CrCgalkyl, C]-C₆alkoxy, mono- or di-(Ci-C_<5alkyl)aminoCo-C₄alkyl, (C₃-C_!0carbocyc]e)Co- C₄alkyl and (4- to 10-membered heterocycle)C₀-C₄alkyl; each of which is optionally substituted and each of which is preferably substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, CpCgalkyl, C_rC₆alkoxy, (C₃- C₁₀carbocycle)Co-C₄alkyl and (4- to 10-membered heterocycle)Co-C₄alkyl. Within further aspects, aryl sulfones provided herein satisfy Formula II:

Formula Iϊ

or are a pharmaceutically acceptable salt or hydrate thereof, wherein:

Y is a group of the formula (CH₂)_r-W-(CH₂)_p, which is optionally substituted and is preferably substituted with from 0 to 4 substituents independently chosen from: (i) amino, hydroxy, cyano, Cj-C₆alkyl, C₂-C₆alkenyl, C₂-C₆alkynyl and Ci-C₆haloalkyl; (ii) substituents of the same carbon atom or adjacent carbon atoms that are taken together to form Cj-Cecycloalkyl, and (iii) substituents that are taken together with R₂ or R₃ to form a 4- to 7-membered carbocycle or heterocycle, wherein:

W is CH₂, O, S or NR_]3; and r and p are independently chosen integers ranging from 0 to 6, such that the sum of r and p ranges from 1 to 6: and the remaining variables are as described for Formula I.

Within other aspects, aryl sulfones provided herein satisfy Formula III:

Formula III

or are a pharmaceutically acceptable salt or hydrate thereof, wherein:

represents a 4- to 10-membered carbocycie or heterocycle that is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, halogen, amino and CpCgalkyl; and the remaining variables are as described for Formula I.

Within certain aspects, aryl sulfones of Formula I. and other Formulas provided herein, are B₁ modulators and exhibit a K, of no greater than 5 micromolar, 2 micromolar, 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar in a Bi binding assay and/or have an EC₅₀ or IC₅₀ value of no greater than 5 micromolar, 2 micromolar, 1 micromolar, 500 nanomolar, 100 nanomolar, 50 nanomolar or 10 nanomolar in an assay for determination of B; agonist or antagonist activity.

In certain embodiments, B] modulators provided herein are B₁ antagonists; preferably such antagonists exhibit no detectable Bi agonist activity.

Within certain aspects, aryl sulfones of Formula I, II or III are labeled with a detectable marker (e.g., radiolabeled or fluorescein conjugated). The present invention further provides, within other aspects, pharmaceutical compositions comprising at least one aryl sulfone of Formula I, II or III in combination with a physiologically acceptable carrier or excipient.

Methods are further provided for inhibiting agonist-induced B] activity. Within certain such aspects, the inhibition takes place in vitro. Such methods comprise contacting a Bi receptor with at least one Bj antagonist as described herein, under conditions and in an amount or concentration sufficient to detectably inhibit agonist-induced B] activity. Within other such aspects, the Bj receptor is in a patient. Such methods comprise contacting cells expressing a Bj receptor in a patient with at least one B] antagonist as described herein in an amount or concentration that would be sufficient to detectably inhibit agonist-induced Bi activity in cells expressing a cloned Bi receptor in vitro.

The present invention further provides methods for treating a condition responsive to B, receptor modulation in a patient, comprising administering to the patient a therapeutically effective amount of at least one aryl sulfone of Formula I, II or III.

Within other aspects, methods are provided for treating pain in a patient, comprising administering to a patient suffering from (or at risk for) pain a therapeutically effective amount of at least one aryl sulfone of Formula I, II or III. Pain conditions that may be treated include, but are not limited to, inflammatory pain, acute pain, dental pain, back pain, surgical pain, headache, neuropathic pain, and pain associated with osteoarthritis or trauma.

Within further aspects, the present invention provides methods for determining the presence or absence of Bi in a sample, comprising: (a) contacting a sample with an aryl sulfone of Formula I, II or III under conditions that permit binding of the compound to Bj; and (b) detecting a signal indicative of a level of the compound bound to B].

In yet another aspect, the present invention provides methods of preparing the compounds disclosed herein, including the intermediates. These and other aspects of the present invention will become apparent upon reference to the following detailed description.

DETAILED DESCRIPTION

As noted above, the present invention provides aryl sulfones, which may be used in vitro or in vivo in a variety of contexts, as described herein. TERMINOLOGY

Compounds are generally described herein using standard nomenclature. For compounds having asymmetric centers, it should be understood that (unless otherwise specified) all of the optical isomers and mixtures thereof are encompassed. In addition, compounds with carbon-carbon double bonds may occur in Z- and E- forms, with all isomeric forms of the compounds being included in the present invention unless otherwise specified. If a compound exists in various tautomeric forms, a recited compound is not limited to any one specific tautomer, but rather is intended to encompass all tautomeric forms. Certain compounds are described herein using a general formula that includes variables (e.g., Y, Ar, Ri). Unless otherwise specified, each variable within such a formula is defined independently of any other variable, and any variable that occurs more than one time in a formula is defined independently at each occurrence. The term "aryl sulfone" encompasses all compounds that satisfy the criteria for Formula I, including compounds in which the Ar moiety is heteroaryl and compounds in which the Ar moiety is aryl. This term further includes pharmaceutically acceptable salts, solvates (e.g., hydrates) and esters of such compounds, as well as the various crystal forms and polymorphs.

A "pharmaceutical Iy acceptable salt" of a compound recited herein is an acid or base salt that is suitable for use in contact with the tissues of human beings or animals without excessive toxicity or carcinogenicity, and preferably without irritation, allergic response, or other problem or complication. Such salts include mineral and organic acid salts of basic residues such as amines, as well as alkali or organic salts of acidic residues such as carboxylic acids. Specific pharmaceutically acceptable anions for use in salt formation include, but are not limited to, acetate, 2-acetoxybenzoate, ascorbate, benzoate, bicarbonate, bitartrate, bromide, calcium edetate, carbonate, chloride, citrate, dihydrochloride, diphosphate, edetate, estolate (ethylsuccinate), formate, fumarate, gluceptate, gluconate, glutamate, glycolate, glycollylarsatiilate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroiodide, hydroxymaleate, hydroxynaphthoate, iodide, isethionate, lactate, lactobionate, malate, maleate, mandelate, methyl bromide, methylnitrate, methylsulfate, rnucate, napsylate, nitrate, pamoate, pantothenate, phenylacetate, phosphate, polygalacturonate, propionate, salicylate, stearate, subacetate, succinate, sulfamate, sulfanilate, sulfate, sulfonates including besylate (benzenes u Ifonate), camsylate (camphorsulfonate), edisyfate (ethane- 1,2-disulfonate), esylate (ethanesulfonate) 2-hydroxyethylsulfonate, mesylate (methanesulfonate), trifiate (trifiuoromethanesuifonate) and tosylate (p-toluenesulfonate), tannate, tartrate, teoclate and triethiodide. Similarly, pharmaceutically acceptable cations for use in salt formation include, but are not limited to ammonium, benzathine, chloroprocaine, choline, diethanol amine, ethylenediamine, meglumine, procaine, and metals such as aluminum, calcium, lithium, magnesium, potassium, sodium and zinc. Those of ordinary skill in the art will recognize further pharmaceutically acceptable salts for the compounds provided herein. In general, a pharmaceutically acceptable acid or base salt can be synthesized from a parent compound that contains a basic or acidic moiety by any conventional chemical method. Briefly, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, the use of nonaqueous media, such as ether, ethyl acetate, ethanol, methanol, isopropanol or acetonitrile, is preferred. It will be apparent that each compound provided herein may, but need not, be formulated as a solvate (e.g., a hydrate) or non-covalent complex. Also provided herein are prodrugs of the compounds provided herein. A "prodrug" is a compound that may not fully satisfy the structural requirements of a formula provided herein, but is modified in vivo, following administration to a patient, to produce a compound within the scope of such formula. For example, a prodrug may be an acylated derivative of a compound as provided herein. Prodrugs include compounds wherein hydroxy, amine or sulfhydryl groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxy, amino, or suifhydryi group, respectively.

Examples of prodrugs include, but are not limited to, acetate, formate, phosphate and benzoate derivatives of alcohol and amine functional groups within the compounds provided herein. Prodrugs of the compounds provided herein may be prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved in vivo to yield the parent compounds. As used herein, the term "alkyl" refers to a straight or branched chain saturated aliphatic hydrocarbon. Alkyl groups include groups having from 1 to 8 carbon atoms (CrQalkyl), from 1 to 6 carbon atoms (Q-Cβalkyl) and from 1 to 4 carbon atoms (C_rC₄alkyI), such as methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyi, tert-buty], pentyl, 2-pentyl, isoperttyl, neopentyl, hexyl, 2-hexyl, 3-hexyl or 3-methylpentyl. "C₀-Qalkyl" refers to a single covaient bond (Co) or an alkylene group having I, 2, 3 or 4 carbon atoms; "Co-C^alkyl" refers to a single covaient bond or a methylene or ethylene group.

"Alkylene" refers to a divalent alkyl group, as defined above. C[-C₄alkylene is an alkylene group having 1, 2, 3 or 4 carbon atoms.

"Alkenyi" refers to straight or branched chain alkene groups, which comprise at least one unsaturated carbon-carbon double bond. Alkenyi groups include C₂-Cgalkenyl, C₂-Cgalkenyl and C?-

C₄alkenyl groups, which have from 2 to 8, 2 to 6 or 2 to 4 carbon atoms, respectively, such as ethenyl, ally! or isopropenyl. "Alkynyl" refers to straight or branched chain alkyne groups, which have one or more unsaturated carbon-carbon bonds, at least one of which is a triple bond. Alkynyl groups include

Ci-Cgalkynyl, C₂-C₆alkynyi and C₂-C₄alkynyi groups, which have from 2 to 8, 2 to 6 or 2 to 4 carbon atoms, respectively.

A "cycloalkyl" is a saturated or partially saturated cyclic group in which all ring members are carbon, such as cyclopropyl, cycJobutyl, cyciopentyl, cyclohexyl and partially saturated variants thereof. Certain cycloalkyl groups are C₃-C₃cycloalkyL in which the ring contains from 3 to 8 ring members, all of which are carbon. A "(C;,-Cscyc!oaIkyl)C₀-C₄alkyl" is a C₃-Cscycloalkyl group linked via a single covaient bond or a CrC₄alkylene group.

By "alkoxy," as used herein, is meant an alkyl group attached via an oxygen bridge (i.e., -O- alkyl). Alkoxy groups include CrC₆aIkoxy and C_rC₄alkoxy groups, which have from 1 to 6 or from

1 to 4 carbon atoms, respectively. Methoxy, ethσxy, propoxy. isopropoxy, n-butoxy, jrec-butoxy, tert- butoxy, n-ρentoxy, 2-pentoxy, 3-pentoxy, isopentoxy, neopentoxy, hexoxy, 2-hexoxy, 3-hexoxy, and 3-methyipentoxy are representative alkoxy groups. Similarly, "alkylthio" refers to an alky! group as attached via a sulfur bridge (i.e., -S-alkyi). Alkylthio groups include Cj-C₆alkylthio and Ci-C₄alkylthio groups, which have from 1 to 6 or from 1 to 4 carbon atoms, respectively. nAlkylsulfinyl" refers to groups of the formula -(SO)-alkyl, in which the sulfur atom is the point of attachment. Alkylsulfinyl groups include CrC₆alkylsulfiny] and Ci-C₄alkylsulfϊnyl groups, which have from 1 to 6 or from 1 to 4 carbon atoms, respectively.

"Alkyisulfonyl" refers to groups of the formula ~{SG₂)-alkyl, in which the sulfur atom is the point of attachment. Alkyisulfonyl groups include Cj-Qalkylsulfonyl and C[-C₄aikylsulfonyl groups, which have from 1 to 6 or from 1 to 4 carbon atoms, respectively. The term "Ci-C₆alkylsu!fonylCo- C₄alkyl refers to a C_rC₆alkylsulfonyl that is linked via a single covalent bond or a C_rC₄alkylene group (i.e., -(C₀-C₄alkyl)-(SO₂HCrC₆alkyl)).

The term "alkanoyi" refers to an acyl group (e.g., -(C=O)-alkyl), where attachment is through the carbon of the keto group. Alkanoyi groups include Ci-Cgalkanoyl, C₂-Qalkanoyl and C₂-

C₄alkanoyl groups, which have from 2 to 8, 2 to 6 or 2 to 4 carbon atoms, respectively. "Ci alkanoyi" refers to -(C=O)H, which (along with C₂-Cgalkanoyl) is encompassed by the term "Ci-Cgaikanoyl."

Ethanoy] is C₂alkanoy1.

Similarly, "alkyi ether" refers to a linear or branched ether substituent. Alkyl ether groups include C₂-C₃alkyl ether, Ci-Qalkyl ether and C₂-C₄alkyl ether groups, which have 2 to 8, 6 or 4 carbon atoms, respectively. A C₂ alkyl ether is -CH₂-O-CH₃. The teπn "aikoxycarbonyl" refers to an alkoxy group linked via a carbonyl (i.e., a group having the general structure -C(=O)-O-alkyl). Aikoxycarbonyl groups include Cj-Cs, CpCe and Q- C₄alkoxy carbonyl groups, which have from 1 to 8, 6 or 4 carbon atoms, respectively, in the alkyl portion of the group. "Cj aikoxycarbonyl" refers to — C(=O)-O-CH₃.

"Alkylamino" refers to a secondary or tertiary amine that has the general structure -NH-alkyl or ~-N(alkyl)(alky1), wherein each alkyl is selected independently from alkyl, cycloalkyl and

(cycloalkyi)alkyl groups. Such groups include, for example, mono- and di-(Ci-Cgalky!)amino groups, in which each C]-C₃alkyl may be the same or different, as weii as mono- and di-(CrQalkyi)amino groups and mono- and di-(Ci-C.(alkyl)amino groups.

"Alkylaminoalkyl" refers to an alkylamino group linked via an alkylene moiety (i.e., a group having the general structure -alkylene-NH-alkyl or -alkylene-N(alkyl)(alkyl)) in which each alkyl is selected independently from alkyi, cycloalkyl and (cycloalkyl)alkyl groups. Alkylaminoalkyi groups include, for example, mono- and di-(C]-C₈alkyl)aminoC_rC₆a]kyl, and mono- and di-(C|-

C₆alkyl)aminoCi-C₄aIkyI. "Mono- or di-(Ci-C₆aIkyl)aminoCo-C₄alkyF' refers to a mono- or di-(C_r

C₆alkyl)amino group linked via a single covalent bond or a Ci-C₄alkylene group. The following are representative alkylaminoalkyl groups:

It will be apparent that the definition of "alkyl" as used in the terms "alkylamino" and "alkyiaminoalkyl" differs from the definition of "alkyl" used for ail other alkyl-containing groups, in the inclusion of cycloalkyl and (cycloalkyl)alkyl groups (e.g., (C₃-C₇cycloalkyl)Co-C₂alkyl). The term "aminocarbonyl" refers to an amide group (i.e., -CX=O)NH₂). "Mono- or di-(Ci-

C₆alkyI)aminocarbonyICo-C₄alkyI" refers to an aminocarbonyl group in which one or both hydrogens are replaced with an independently selected CpQalkyl group, and which is linked via a single covalent bond or a CVC^alkylene group.

The term "aminosulfonyl" refers to a sulfonamide group (i.e., -SO₂NH₂). "Mono- or di-(Cr C₆alkyl)aminosulfonylCo-C₄alkyl" refers to an aminosulfonyl group in which one or both hydrogens are replaced with an independently selected Ci-Qalkyl group, and which is linked via a single covalent bond or a Ci-C₄alkylene group.

The term "halogen" refers to fluorine, chlorine, bromine or iodine.

The term "oxo," as used herein refers to an oxygen substituent of a carbon atom that results in the formation of a carbonyl group (C=O). An oxo group that is a substituent of a nonaromatic carbon atom results in a conversion of -CH₂— to -C(=O)~. An oxo group that is a substituent of an aromatic carbon atom results in a conversion of -CH- to -C(=O)- and may result in a loss of aromaticity.

A "haloalkyl" is an alkyl group that is substituted with 1 or more independently chosen halogens (e.g., "CrCghaloalkyl" groups have from 1 to 8 carbon atoms; ^MCi-C₆haloalkyl" groups have from 1 to 6 carbon atoms). Examples of haloalkyl groups include, but are not limited to, mono-, di- or tri-fluoromethyl; mono-, di- or tri-chloromethyl; mono-, di-, tri-, tetra- or penta-fluoroethyl; mono-, di-, tri-, tetra- or penta-chloroethyl; and 1,2,2,2-tetrafluoro-l-trifluoromethyl-ethyl. Typical haloalkyl groups are trifluoromethyl and difluoromethyl.

A dash ("-") that is not between two letters or numbers is used to indicate a point of attachment for a substituent. For example, -C(=O)NH₂ is attached through the carbon atom.

A "carbocycle" has from 3 to 3 fused, pendant or spiro rings, each of which has only carbon ring members and each of which may, but need not, be bridged by an alkylene moiety. Typically, a carbocycle that has a single ring contains from 3 to 8 ring members (i.e., C₃-C₃carbocycles); rings having from 4 or 5 to 7 ring members (i.e., C₄-C₇carbocycles or C₅-C₇carbocycles) are recited in certain embodiments. Carbocycles comprising fused, pendant or spiro rings typically contain from 9 to 14 ring members. Carbocycles may be optionally substituted with a variety of substituents, as indicated. Unless otherwise specified, a carbocycle may be a cycloalkyl group (i.e., each ring is saturated or partially saturated as described above) or an aryl group (i.e., at least one ring within the group is aromatic). Representative aromatic carbocycles are phenyl, naphthyl, tetrahydronaphthyl and biphenyl. In certain embodiments preferred carbocycfes have a single ring, such as phenyl and C₃- Cgcycloalkyl groups.

Certain carbocycles recited herein are (C₃-C]ocarbocycle)Co-C₄alkyl groups (i.e., groups in which a 3- to 10-membered carfaocyclic group (which may be cycloalky! or aryl) is linked via a single covaSent bond or a Cj-C₄alkylene group). Phenyl groups linked via a single covaleπt bond or Q- C₂alkylene group are designated phenylCo-C₄alkyl (e.g., ben2yl, 1 -phenyl-ethyl, 1 -phenyl-propyl and 2-phenyl-ethyl). When substituted, it will be apparent that such groups may be substituted on the ring portion and/or on the alkylene portion of the group. A "pheπylCo^alkoxy" group is a phenyl ring that is linked via an oxygen atom (i.e., phenoxy) or via a CpQalkoxy group (e.g., benzyloxy). A "heterocycle" (also referred to herein as a "heterocyclic group") has from 1 to 3 fused, pendant or spiro rings, at least one of which is a heterocyclic ring (i.e., one or more ring atoms is a heteroatom independently chosen from oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon). Typically, a heterocyclic ring comprises 1 , 2, 3 or 4 heteroatoms: within certain embodiments each heterocyclic ring has 1 or 2 heteroatoms per ring. Each heterocyclic ring generally contains from 3 to 8 ring members (rings having from 4 or 5 to 7 ring members are recited in certain embodiments) and heterocycles comprising fused, pendant or spiro rings typically contain from 9 to 14 ring members. Certain heterocycles comprise a sulfur atom as a ring member; in certain embodiments, the sulfur atom is oxidized to SO or SCK Heterocycles may be optionally substituted with a variety of substituents, as indicated. Certain heterocycles are 4- to 10-membered and comprise one or two rings: in certain embodiments, such heterocycles are monocyclic (e.g., 4- to 8-membered, 5- to 8-membered, 4- to 7-membered, or 5- or 6-membered).

Certain heterocycles are heteroaryl groups (i.e., at least one heterocyclic ring within the group is aromatic), such as a 5- to 10-membered heteroaryl (which may be monocyclic or bicyclic) or a 5- or 6-membered heteroaiyl (e.g., thienyl, imidazolyl, pyridyl or pyrimidyl). Other heterocycles are heterocycloalkyl groups (i.e., do not comprise an aromatic heterocyclic ring). Certain heterocycles may be linked by a single covalent bond or via an alkylene group, as indicated, for example, by the terms "(4- to 10-membered heterocycfoalkyOCo-Cjalkyl," "(4- to 8-membered heterocycIoalky!)C₀- C₄alkyl," and "(5- or 6-membered heteiOcycloalkyl)Co-C₄alkyI." An "N-linked heterocycloalkyl" is heterocycloalkyl moiety wherein attachment is via a single covalent bond to a ring nitrogen atom

(e.g., ^{? \}-/ ).

A "substituent," as used herein, refers to a molecular moiety that is covalently bonded to an atom within a molecule of interest. For example, a "ring substituent" may be a moiety such as a halogen, alkyl group, haloalkyl group or other group discussed herein that is covalentiy bonded to an atom (such as a carbon or nitrogen atom) that is a ring member. The term "substitution" refers to replacing a hydrogen atom in a molecular structure with a substituent as described above, such that the valence on the designated atom is not exceeded, and such that a chemically stable compound (i.e., a compound that can be isolated, characterized, and tested for biological activity) results from the substitution.

Groups that are "optionally substituted" are unsubstituted or are substituted by other than hydrogen at one or more available positions, typically 1, 2, 3, 4 or 5 positions, by one or more suitable groups (which may be the same or different). Optional substitution is also indicated by the phrase "substituted with from 0 to X substituents," where X is the maximum number of possible substituents. Certain optionally substituted groups are substituted with from 0 to 2, 3 or 4 independently selected substituents (i.e., are unsubstituted or substituted with up to the recited maximum number of substituents). "Bi," as used herein, refers to the human Bi bradykinin receptor reported by Menke et al.

(1994) J. Biol. Chem. 269:21583-21586, as well as allelic variants thereof and homologues thereof found in other species (e.g., GenBank Accession Number AAX14712 (Macaca fascicular is)).

The term "Bj agonist" refers to a compound that binds Bj and induces signal transduction mediated by B]. B] agonists include, for example, bradykinin and kallidin (lysy I- bradykinin), as well as peptide portions or variants of bradykinin or kallidin that bind Bj and retain activity. Representative B] agonists include, but are not limited to, desArg⁹bradykinin and desArg'°kaliidin.

A "B] antagonist" is a compound that detectably inhibits signal transduction mediated by Bj. Such inhibition may be determined using the representative calcium mobilization assay provided in Example 7. Preferred Bj antagonists have an iCso of 5 μM or less in this assay, more preferably 2 μM or less, and still more preferably 1 μM or less, 500 iiM or less, 100 nM or less or 10 nM or less. In certain embodiments, the Bi antagonist is specific for Bi (i.e., the IC₅₀ value in a similar assay perfoπned using the B₂ receptor is greater than 2 μM and/or the IC_SQ ratio (BiZB₁) is at least 10, preferably 100, and more preferably at least 1000). B; antagonists preferably have minimal agonist activity (i.e., induce an increase in the basal activity of Bi that is less than 5% of the increase that would be induced by one EC₅₀ of the peptide agonist desArg^!Okallidin, and more preferably have no detectable agonist activity within the assay described in Example 7). Bi antagonists for use as described herein are generally non-toxic. Bi antagonists include neutral antagonists and inverse agonists.

A "neutral antagonist" of Bj is a compound that inhibits the activity of B] agonist (e.g., desArg^I0kallidin) at Bi, but does not significantly change the basal activity of the receptor (i.e., within a calcium mobilization assay as described in Example 7 performed in the absence of agonist, Bi activity is reduced by no more than 10%, more preferably by no more than 5%, and even more preferably by no more than 2%; most preferably, there is no detectable reduction in activity). Neutral antagonists may, but need not, also inhibit the binding of agonist to Bi. An "inverse agonist" of Bi is a compound that reduces the activity of B] below its basal activity level in the absence of activating concentrations of agonist. Inverse agonists may also inhibit the activity of agonist at B₁, and/or may inhibit binding of Bj agonist to B_;. The reduction in basal activity of Bj produced by an inverse agonist may be determined from a calcium mobilization assay, such as the assay of Example 7.

A "therapeutically effective amount" (or dose) is an amount that, upon administration to a patient, results in a discernible patient benefit (e.g., provides detectable relief from a condition being treated). Such relief may be detected using any appropriate criteria. A therapeutically effective amount or dose generally results in a concentration of compound in a body fluid (such as blood, plasma, serum. CSF, synovial fluid, lymph, cellular interstitial fluid, tears or urine) that is sufficient to result in detectable alteration in B_rmediated signal transduction (using an assay provided herein). The discernible patient benefit may be apparent after administration of a single dose, or may become apparent following repeated administration of the therapeutically effective dose according to a predetermined regimen, depending upon the indication for which the compound is administered. For the treatment of pain, a discernible patient benefit is generally apparent after administration of a single therapeutically effective dose, although further benefit may become apparent following repeated administrations. A "patient" is any individual treated with an aryl sulfone as provided herein. Patients include humans, as well as other animals such as companion animals (e.g., dogs and cats) and livestock. Patients may be experiencing one or more symptoms of a condition responsive to Bi modulation or may be free of such symptom(s) (i.e., treatment may be prophylactic in a patient considered to be at risk for the development of such symptoms). ARYL SULFONES

As noted above, the present invention provides aryl sulfones of Foπnula I that may be used in a variety of contexts, including in the treatment of conditions responsive to Bj modulation, as described herein.

Formula 1

Such compounds may also be used within in vitro assays (e.g., assays for Bi activity), as probes for detection and localization Of B₁ and within assays to identify other Bj antagonists.

Certain such aryl sulfones further satisfy one or both of Formulas II and III, as described above.

Within certain aryl sulfones of Formulas I, II and III, Y is a group of the formula (CH₂X-O-

(CH₂)_p that is substituted with from 0 to 4 substituents independently chosen from amino, hydroxy, cyano, Ci-C₆alkyl, C₂-C₆alkenyl, C₂-C₆alkynyl, Ci-C₆haloalkyl and substituents of the same carbon atom or adjacent carbon atoms that are taken together to foπn C₃-Qcycloalkyl. Representative such Y groups include, for example, groups in which p is not zero, such as -CH₂-O-CH₂-, -O-CH₂-CH₂-, "CH₂-O-CH₂-CH₂- or -CH₂-CH₂-O-CH₂-.

Within other aryl suifones of Formulas I and III, Y is a group of the formula (CH₂)_r-(CH₂)_p that is substituted with from 0 to 4 substituents independently chosen from amino, hydroxy, cyano. Ci-Qalkyi, C₂-C₆alkenyl, C₂-C₆alkynyl, Cj-Cehaloaikyi and substituents of the same carbon atom or adjacent carbon atoms that are taken together to form Ca-Cβcycloaikyl. Representative such Y groups include, for example,~-CH₂-, -CH₂-CH₂-, and -CH₂-CH₂-CH₂-, each of which is optionally substituted as indicated above.

The variable "B" is, within certain embodiments, CH. Within other embodiments, the variable "B" is N.

Within certain aryi suifones of Formulas I, II and 111, Ar is phenyl, naphthyl, pyridyl or pyrimidinyl, each of which is substituted with from 0 to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro,

C_rC₆haloalkyl, C|-C₆alkoxy, and mono- or di-(C_r

C₆a!kyl)amtnoCo-C₄alkyl. Within other aryl suifones of Formulas I₃ II and III, Ar is phenyl that is substituted with from 0 to 4 substituents independently chosen from R₁ (e.g., substituted with 1. 2 or 3 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro. CrQ,alkyL C₁-

C_ύhaloalkyl, C|-C₆alkoxy, and mono- or di-(CrC₆alky])aminoC₀-C₄alkyl). Within further aiyl suifones of Formulas I, Il and III, each substituent represented by R₁ is independently chosen from halogen, hydroxy, Cj-C₆alkyl, Cj-C₆haloalkyl, Cj-C_δalkoxy and d-Cβhaloalkoxy. Within certain aryl suifones, Ar is a group of the formula:

wherein Rio, Rn and Ri₂ are independently chosen from hydrogen, halogen, hydroxy, CpCealkyl, C_r C_fihaloalkyl, Cj-Qalkoxy and Ci-C₆haloalkoxy. Within certain such compounds, at least one of R]₀, R_n and R₁₂ is not hydrogen; within further such compounds, no more than one Of R₁₀, R_n and R₎₂ is hydrogen.

The variables R₂ and R₁ of Formulas I and II are, within certain embodiments, independently chosen from hydrogen and CpCealkyl. Within other embodiments of Formulas I and II, R₂ and R₃ are taken together to form an aromatic group. Similarly, within certain embodiments of Formula III,

is an aromatic group. Representative such aromatic groups include, for example, naphthyl. quinolinyl, phenyl or pyridyl, optionally substituted as described above. Within further embodiments of Formulas I and II. R₂ and R3 are taken together to form an optionally substituted partially or fully saturated ring. Similarly, within certain embodiments of Formula III,

is an optionally substituted partially or fully saturated ring. Representative such rings include, for example, piperazine, morpholine, thiomorpholine, piperidine or pyrrolidine. Certain such compounds of Formulas ϊ, lϊ and ϊϊl further satisfy Formula IV or V:

Formula IV Formula V wherein:

X is CH₂, NR₇, O, S, SO or SO₂; m and q are independently 0, 1 or 2, such that the sum of m and q is 1, 2 or 3; R₆ represents from 0 to 4 substituents independently chosen from oxo, hydroxy and Cj-Csalkyl; and R₇ is hydrogen or C]-C₆alkyl. Within certain such compounds, R^ represents from 0 to 4 substituents independently chosen from C_r C₃aikyl (e.g., R₆ represents gem-dimethyl).

Certain aryl sulfones of Formulas I and II further satisfy Formula VI:

Formula Vl

wherein

represents a 4- to 7-membered, N-linked heterocycioalkyl that is substituted with from 0 to 4 substituents independently chosen from: (i) hydroxy, oxo, cyano and amino; and (ii) Ci- C^alkyl. Ci-Cealkoxy, mono- or di-(Ci-C₆alkyl)aminoCo-C₄alkyl. (C₆-Ciocarbocycle)Co-C₄alkyl and (4- to 10-membered heteiOcycle)C₀-C₄alkyl; each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, CrC₆alkyl, Ci-C₆a!koxy, (C₃- C]₀carbocycle)Co-C₄aIkyl and (4- to 10-membered heteiOcycle)C₀-C₄alkyl.

Representative ^"" — groups include, for example, piperidine, piperazine, moφholine, thiomorpholine, imidazolidine and pyn'olidine, each of which is optionally substituted as described

above. Further representative ~" — groups include groups of the formula ""^■-' , in which 1, 2 or 3; Z is CR₇Rg or NR₉; R₇ and Rg are independently chosen from: (i) hydrogen, hydroxy and cyano; and (ii) CrQalkyl, C₂-C₆alkenyl, C₂-C₆alkynyl. CrQalkoxy, mono- or di-(C_r C₆alkyl)arninoCo-C₄afkyL (C₃-C₈cycioa!kyl)Co-C₄alkyl, phenyIC₀-C₄alkyl, (4- to 8-membered heterocycloalky])Co-C₄alky] and (5- or 6-membered heteiOaryl)C₀-C₄aikyI, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, cyano, oxo and CrC₆alkyl; and R₉ is: (i) hydrogen; or (ii) CrQalkyl, C₂-C₆alkenyl, C₂-C₆aikynyl, mono- or di-(C,- C₆alkyl)aminoC]-C₄alkyi, (C₃-C₈cycloalkyl)Co-C₄aikyI, phenyiCo-C₄alkyϊ, (4- to 8-membered heterocycioalkyOCo-Qalky! and (5- or 6-membered heteroaryl)C₀-C₄a]kyl, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, cyarto, oxo and Cj-QalkyL Representative such aryi sulfones of Formulas I and 11 further satisfy one or more of Formulas VIl - IX, in which variables are as described above.

Formula VIl Formula VIII Fonnula IX

Representative compounds of Formula VII further satisfy Formula X:

Formula X

wherein Rio, Rn and R_]2 are independently chosen from hydrogen, halogen, hydroxy, CrC_fcalkyl, Ci- C₆haloalkyl, CrC₆aIkoxy and C_rC_fihaloalkoxy, such that at least one of R_]0, Rn and R₁₂ is not hydrogen. In certain such compounds, no more than one of R[_0; Rn and R]₂ is hydrogen; in further such compounds, none of Ri₀, Rn and R₁₂ is hydrogen.

Certain aryl sulfones of Formula III further satisfy Formula XIl:

Formula XII

wherein ¹^ — represents an optionally substituted 4- to 7-membered, N-iinked heterocycloalkyl as described above. Certain such aryl sulfones further satisfy Formula XIII:

Formula XlII

wherein n, Z, R₇, Rg and R₉ are as described above. Representative aryi sulfones of Formula XIIl further satisfy one or both of Formulas XIV - XV, in which variables are as described above.

Formula XV

Representative compounds of Formula XIlI further satisfy Formula XVI:

Formula XVI

wherein R₁₀, R₁₁ and R₁₂ are indepen dently chosen from hydrogen, halogen, hydroxy, C₁-C₆alkyI C₁ C₆haloaikyl, C₁-C₆alkoxy and C₁-C₆haloalkoxy, such that at least one of R₁₀, R₁₁ and R₁₂ is not hydrogen. In certain such compounds, no more than one of R₁₀, R₁₁ and R₁₂ is hydrogen; in further such compounds, none of R₁₀, R₁₁ and R₁₂ is hydrogen. Within certain aryl sulfones of Formulas I, II and III, R₄ is hydrogen, C₁C₆alkyl, C₂-

C₆alkenyl, C₂-C₆alkynyl, (C₃-C₈cycioalkyI)C₀-C₄alky!, C₂-C₆alkyl ether, or mono- or di-(C₁ C₆alkyl)aminoC₁C₄alkyl; and R₅ is C₁-C₆alkyL C₂-C₆alkenyl, C₂-C₆alkyny], C₂-C₆alkyl ether, mono- or di-(C₁-C₆aIkyl)aminoC₁C₄alkyL (C₃-C₃cycloalkyl)Co-C.falky{, phenylC₀-C₄alkyl, (4- to 7- membered heterocycloalkyI)C₀-C₄alkyl or (5- or 6-membered heteroaryl)C₀-C₄alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from: (i) amino, halogen, hydroxy, cyano and oxo; and (ii) Cj-C^alkyl, (C₃-C₈cycloalkyl)C₀-C₄aIkyl, C₁-C₆alkoxy, phenylC₀-C₄alkyl and (5- or 6-membered heterocyc]e)C₀-C₄alkyi, each of which is substituted with from 0 to 4 substituents independently chosen from amino, cyano, halogen, hydroxy, C_rC₆aIkyl, (C₃-C₈cycloalkyi)C₀-C₄alkyi,

CpCehaloalkyl, C_rQa!koxy, Cj-Qalkoxycarboπyi, mono- or di-(C,-C₆alkyl)amino, phenylC₀-

C₄alkyl and phenylC₀-C₄aikoxy. Representative R₄ groups include hydrogen and Q-Qalkyl; representative R₅ groups include mono- and di-(Ci-C_<;aIkyl)aminoC_!-C₄alkyi, phenylCo-C₄alkyl. (4- to

7-membered heterocycloalkyl)C₀-C₄alkyl or (5- or 6-membered heteroaryl)C₀-C₄alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from: (a) amino, haiogen, hydroxy, cyano and oxo; and (b) C_rC₆alkyl, (C₃-C₃cycloa]kyl)Co--C₄alkyl, Q-Qalkoxy, phenylCo-C₄aIkyl and

(5- or 6-membered heterocycle)Co-C₄alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from amino, cyano, haiogen, hydroxy, Q -Q alky], CrQhaloalkyl, C₁-

C₄alkoxy, C]-C₄alkoxycarbonyl, and mono- or di-(Ci-QaIkyl)aminoCo-C₂aikyl.

Certain aryl sulfones of Formulas 1 and II further satisfy Formula XI:

Formula XI

in which variables are as described above. Within certain such compounds. R₂ and R₃ are independently chosen from:(a) hydrogen; and (b) Cj-Qalkyl, C₂-C₆alkenyl,

Q- Qhaϊoaikyl, and (C₃-Cgcycloalkyl)Co-C₄alkyI, each of which is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, amino and C]-C₄aikyl. Within further such compounds, Ar is phenyl that is substituted with from 1 to 3 substituents independently chosen from haiogen, hydroxy, Ci-Cgalkyl, Ci-Qhaloalkyl, Q-Cealkoxy and d-C_δhaloalkoxy. Within still further such compounds, (i) R₄ is hydrogen or C]-C₄alkyl; and (ii) R₅ is mono- or di-(C]-C₆alky!)aminoC_r C₄alkyl, phenylC₀-C₄alkyl, (4- to 7-membered heterocycloa!kyl)Co-C₄alkyl or (5- or 6-membered heteroaryl)C₀-C₄alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from: (a) amino, halogen, hydroxy, cyano and oxo; and (b) CrC₆alkyl, (C_.rC_gcycloalkyl)Co~C₄alkyl, Cj-Qafkoxy, phenylCo-C₄alkyl and (5- or 6-membered heterocycle)C₀-C₄alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from amino, cyano. halogen, hydroxy, CrC₄alkyl, CrQhaloalkyl, C]-C₄alkoxy, Cj-C4alkoxycarbonyl, and mono- or di-(C_r

Within other such compounds, R₄ and R₅ are taken together to form piperidine, piperazine. morpholine, thiomorpholine, imidazolidine or pyrrolidine, each of which is substituted with from 0 to 4 substituents independently chosen from: (i) hydroxy, oxo, cyano and amino; and (ii) Ci-Cealkyl, Ci-C₆alkoxy, mono- or di-(C]-C₆alkyl)aminoCo-C₄alkyl, (C_.r Ciocarbocycle)Co-C₄alkyi and (4- to 10-membered heterocycle)C₀-C₄alkyl;each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, C_ϊ-Cgalkyf, Cj-Qalkoxy, (C₃-Ciocarbocycle)Co-C₄alkyl and (4- to ] O-membered heterocycle)C₀- C₄alkyl.

Representative aryl sulfones provided herein include, but are not limited to, those specifically described in the Examples below. It will be apparent that the specific compounds recited herein are representative only, and are not intended to limit the scope of the present invention. Further, as noted above, all compounds of the present invention may be present as a free acid or base or as a pharmaceutically acceptable salt, hydrate or ester.

As noted above, within certain aspects, compounds provided herein are B] modulators. Jn addition, certain compounds provided herein are specific for Bj. B] modulator activity may be confirmed using a calcium mobilization assay, such as the assay described in Example 7, herein.

If desired, binding activity of the compounds provided herein to B] may be confirmed using the representative assay described in Example 6, herein, or using an assay described by Fox et al.

(2005) Br. J. Pharmacol. 144:889-99. Preferred B] modulators exhibit a K, within such an assay of 5 micromolar or less, more preferably 2 micromolar or less, 1 micromoiar or less, 500 nanomolar or less, 100 nanomolar or less or 10 nanomolar or less.

In vivo activity of B] modulators provided herein may be confirmed using any of a variety of animal models including, but not limited to, those described in the following documents (each of which is hereby incorporated by reference for its disclosure of the recited animal model): Wood et al. (2003) J. Med. Chem. -^(5: 1803-06 - carrageenan-induced mechanical pressure hyperalgesia;

Conley et al. (2005) Eur. J. Pharmacol. 527:44-51 - thermal antinociception and carrageenan-induced mechanical pressure hypersensitivity;

Gougat et al. (2004) J. Pharmacol. Exper. Therap. 309: 661-669 - UV irradiation-induced thermal hyperalgesia and chronic constriction of the sciatic nerve-induced neuropathy and in ischemia- induced injury;

Fox et al. (2005) Br. J. Pharmacol. 144:889-99 - complete Freund's adjuvant- induced mechanical pressure hypersensitivity; Gabra et al. (2005) J. Neuropathol. Exp. Neurol. 64:782-89 - diabetes-induced peripheral neuropathic pain; Pesquero et al. (2000) Proc. Natl. Acad. ScL USA 97:8140-45 - carrageenan-induced pleurisy

(inflammation around the lung);

Lawson et al. (2005) Eur. J. Pharmacol. 514:69-78 - diabetes-induced vascular disease; Hirata et a (2003) Eur. J. Pharmacol. 474:255-60 - ACE inhibitor-induced cough; Mazzuferi et al. (2005) Neiiroscience. 7_?J:979-86 - neuronal hyperexcitability in epilepsy. If desired, compounds provided herein may be evaluated for certain pharmacological properties including, but not limited to, oral bioavailability (preferred compounds are orally bioavailable to an extent allowing for therapeutically effective doses of less than 140 mg/kg, preferably less than 50 mg/kg, more preferably less than 30 mg/kg. even more preferably less than 10 mg/kg, still more preferably less than 1 mg/kg and most preferably less than 0.1 mg/kg), toxicity (a preferred compound is nontoxic when a therapeutically effective amount is administered to a subject), side effects (a preferred compound produces side effects comparable to placebo when a therapeutically effective amount of the compound is administered to a subject), serum protein binding and in vitro and in vivo half-life (a preferred compound exhibits an in vivo half-life allowing for Q. I. D. dosing, preferably T.I.D. dosing, more preferably B. I. D. dosing, and most preferably once-a- day dosing). In addition, differential penetration of the biood brain barrier may be desirable. Routine assays that are well known in the art may be used to assess these properties, and identify superior compounds for a particular use. For example, assays used to predict bioavailability include transport across human intestinal cell monolayers, including Caco-2 cell monolayers. Penetration of the blood brain barrier of a compound in humans may be predicted from the brain levels of the compound in laboratory animals given the compound (e.g., intravenously). Serum protein binding may be predicted from albumin binding assays. Compound half-life is inversely proportional to the frequency of dosage of a compound. In vitro half-lives of compounds may be predicted from assays of microsomal half-life as described herein.

As noted above, preferred compounds provided herein are nontoxic. In general, the term

"nontoxic" as used herein shall be understood in a relative sense and is intended to refer to any substance that has been approved by the United States Food and Drug Administration ("FDA") for administration to mammals (preferably humans) or, in keeping with established criteria, is susceptible to approval by the FDA for administration to mammals (preferably humans). In addition, a highly preferred nontoxic compound generally satisfies one or more of the following criteria: (1) does not substantially inhibit cellular ATP production; (2) does not significantly prolong heart QT intervals; (3) does not cause substantial liver enlargement, or (4) does not cause substantial release of liver enzymes.

As used herein, a compound that does not substantially inhibit cellular ATP production is a compound that satisfies the criteria set forth in Example 8, herein. In other words, cells treated as described in Example 8 with 100 μM of such a compound exhibit ATP levels that are at least 50% of the ATP levels detected in untreated cells. In more highly preferred embodiments, such cells exhibit ATP levels that are at least 80% of the ATP levels detected in untreated cells.

A compound that does not significantly prolong heart QT intervals is a compound that does not result in a statistically significant prolongation of heart QT intervals (as determined by electrocardiography) in guinea pigs, minipigs or dogs upon administration of a dose that yields a serum concentration equal to the EC₅₀ or IC₅₀ for the compound. In certain preferred embodiments, a dose of 0.01. 0.05, 0.1, 0.5, 1, 5, 10. 40 or 50 mg/kg administered parenterally or orally does not result in a statistically significant prolongation of heart QT intervals. By "statistically significant" is meant results varying from control at the p<0.1 level or more preferably at the p<0.05 level of significance as measured using a standard parametric assay of statistical significance such as a student's T test.

A compound does not cause substantia! liver enlargement if daily treatment of laboratory rodents (e.g., mice or rats) for 5-10 days with a dose that yields a serum concentration equal to the EQo or IC₅₀ for the compound results in an increase in liver to body weight ratio that is no more than

100% over matched controls. In more highly preferred embodiments, such doses do not cause liver enlargement of more than 75% or 50% over matched controls. If non-rodent mammals (e.g., dogs) are used, such doses should not result in an increase of liver to body weight ratio of more than 50%, preferably not more than 25%, and more preferably not more than 10% over matched untreated controls. Preferred doses within such assays include 0.01, 0.05. 0.1, 0.5, 1 , 5, 10, 40 or 50 mg/kg administered parenterally or orally.

Similarly, a compound does not promote substantial release of liver enzymes if administration of twice the minimum dose that yields a serum concentration equal to the EC₅₀ or IC₅₀ for the compound does not elevate serum levels of ALT, LDH or AST in laboratory rodents by more than 100% over matched mock-treated controls. In more highly preferred embodiments, such doses do not elevate such serum levels by more than 75% or 50% over matched controls. Alternatively, a compound does not promote substantial release of liver enzymes if, in an in vitro hepatocyte assay, concentrations (in culture media or other such solutions that are contacted and incubated with hepatocytes in vitro) that are equal to the EC₅₀ or IC₅₀ for the compound do not cause detectable release of any of such liver enzymes into culture medium above baseline levels seen in media from matched mock-treated control cells. In more highly preferred embodiments, there is no detectable release of any of such liver enzymes into culture medium above baseline levels when such compound concentrations are five-fold, and preferably ten-fold the EC₅₀ or IC₅₀ for the compound.

In other embodiments, certain preferred compounds do not inhibit or induce microsomal cytochrome P450 enzyme activities, such as CYP 1A2 activity, CYP2A6 activity, CYP2C9 activity, CYP2C19 activity, CYP2D6 activity, CYP2E1 activity or CYP3A4 activity at a concentration equal to the EC₅₀ or IC₅₀ for the compound.

Certain preferred compounds are not clastogenic (e.g., as determined using a mouse erythrocyte precursor cell micronucleus assay, an Ames micronucleus assay, a spiral micronucleus assay or the like) at a concentration equal the EQo or IC₅₀ for the compound. In other embodiments, certain preferred compounds do not induce sister chromatid exchange (e.g., in Chinese hamster ovary cells) at such concentrations.

For detection purposes, as discussed in more detail below, compounds provided herein may be isotopically-labeled or radiolabeled. For example, such compounds may have one or more atoms replaced by an atom of the same element having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be present in the compounds provided herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as Η, Η, ⁿC, ^IJC, ¹⁴C, ¹N, 1¹8O,- , IV_/ O- , 3 ^J 1¹P, 3 ^J2T_n, 3 "5_£S, 1 ⁱ8^SτF and 3 ^" 6T,- l. In addition, substitution with heavy isotopes such as deuterium (i.e., ²H) can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances. PREPARATION OF ARYL SULFONES

Compounds provided herein may generally be prepared using standard synthetic methods, In general, starting materials are commercially available from suppliers such as Sigma-Aldrich Corp. (St. Louis, MO), or may be synthesized from commercially available precursors using established protocols. By way of example, a synthetic route similar to that shown in any of the following Schemes may be used, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon appreciated by those skilled in the art. It will be apparent that the reagents and synthetic transformations in the following Schemes and in the art can be readily modified to produce additional compounds of Formula I. Each variable in the following Schemes refers to any group consistent with the description of the compounds provided herein. When a protecting group is required, an optional deprotection step may be employed.

Suitable protecting groups and methodology for protection and deprotection, such as those described in Protecting Groups in Organic Synthesis by T. Greene, are well known. Compounds and intermediates requiring protection/deprotection will be readily apparent.

Certain definitions used in the following Schemes and in the Examples include: DIBAL diisobutylaluminium hydride

DMA N,N-dimethy!acetamide

DMC 2-chloro-l,3-dimethylimidazolidinium chloride

DMF dimethylformamide

DMSO dimethylsulfoxide Eq. equivalent(s)

Et ethyl

EtOH ethanol

EtOAc ethyl acetate h hour(s) 1H NMR proton nuclear magnetic resonance

LAH lithium aluminum hydride

LC-MS liquid chromatography/mass spectrometry mCPBA m-chloroperoxybenzoic acid Me methyl MeOH methanol

MHz megahertz

M+l mass + 1 min minute(s)

MS mass spectrometry n-BuLi n-butyl lithium

NMO N-methylmorpholiπe N-oxide δ chemical shift rt room temperature

Ph phenyl

SCX strong cation exchange

TBAF letrabutyl ammonium fluoride

TBS tert- butyl d im ethy lsi Jy i

TEA triethylamine

TFA triftuoroacetic acid

THF tetrahydrofuran

TPAP tetra-n -propyl am mon i urn perruth enate

Scheme 1

Scheme 4

In certain embodiments, a compound provided herein may contain one or more asymmetric carbon atoms, so that the compound can exist in different stereoisomeric forms. Such forms can be, for example, racemates or optically active forms. As noted above, ail stereoisomers are encompassed by the present invention. Nonetheless, it may be desirable to obtain single enantiomers (i.e., optically active forms). Standard methods for preparing single enantiomers include asymmetric synthesis and resolution of the racemates. Resolution of the racemates can be accomplished, for example, by conventional methods such as crystallization in the presence of a resolving agent, or chromatography using, for example a chiral HPLC column.

Compounds may be radiolabeled by carrying out their synthesis using precursors comprising at least one atom that is a radioisotope. Each radioisotope is preferably carbon (e.g., ^!4C), hydrogen (e.g., Η), sulfur (e.g., ³⁵S) or iodine (e.g., ¹²⁵I). Tritium labeled compounds may also be prepared catalytically via platinum-catalyzed exchange in tritiated acetic acid, acid-catalyzed exchange in tritiated trifluoroacetic acid, or heterogeneous-catalyzed exchange with tritium gas using the compound as substrate. In addition, certain precursors may be subjected to tritium-halogen exchange with tritium gas, tritium gas reduction of unsaturated bonds, or reduction using sodium borotritide, as appropriate. Preparation of radiolabeled compounds may be conveniently performed by a radioisotope supplier specializing in custom synthesis of radiolabeled probe compounds.

PHARMACEUTICAL COMPOSITIONS

The present invention also provides pharmaceutical compositions comprising one or more aryl sulfones provided herein, together with at least one physiologically acceptable carrier or excipient. Pharmaceutical compositions may comprise, for example, one or more of water, buffers (e.g., neutral buffered saline or phosphate buffered saline), ethanol, mineral oil, vegetable oil, dimethylsulfoxide, carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, adjuvants, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione and/or preservatives. In addition, other active ingredients may (but need not) be included in the pharmaceutical compositions provided herein. Pharmaceutical compositions may be formulated for any appropriate manner of administration, including, for example, topical, oral (including, but not limited to. sublingual), nasal, rectal or parenteral administration. The term parenteral as used herein includes subcutaneous, intradermal, intravascular (e.g., intravenous), intramuscular, spinal, intracranial, intrathecal and intraperitoneal injection, as well as any similar injection or infusion technique. In certain embodiments, compositions suitable for oral use are preferred. Such compositions include, for example, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs. Within yet other embodiments, compositions of the present invention may be formulated as a iyophilizate.

Compositions intended for oral use may further comprise one or more components such as sweetening agents, flavoring agents, coloring agents and/or preserving agents in order to provide appealing and palatable preparations. Tablets contain the active ingredient in admixture with physiologically acceptable excipients that are suitable for the manufacture of tablets. Such excipients include, for example, inert diluents (e.g., calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate), granulating and disintegrating agents (e.g., corn starch or alginic acid), binding agents (e.g., starch, gelatin or acacia) and lubricating agents (e.g., magnesium stearate. stearic acid or talc). The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monosterate or glyceryl di stearate may be employed. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g., calcium carbonate, calcium phosphate or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin or olive oil).

Aqueous suspensions contain the active material(s) in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients include suspending agents (e.g., sodium carboxymethylcellulose, methylcellulose, hydropropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia); and dispersing or wetting agents (e.g., naturally-occurring phosphatides such as lecithin, condensation products of an alkyiene oxide with fatty acids such as polyoxy ethylene stearate, condensation products of ethylene oxide with long chain aliphatic alcohols such as heptadecaethyleneoxycetanol, condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides such as polyethylene sorbitan monooleate). Aqueous suspensions may also comprise one or more preservatives, such as ethyi or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin. Oily suspensions may be formulated by suspending the active ingredient(s) in a vegetable oil

(e.g., arachis oil, olive oil, sesame oil or coconut oil) or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and/or flavoring agents may be added to provide palatable oral preparations. Such suspensions may be preserved by the addition of an anti-oxidant such as ascorbic acid.

Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, such as sweetening, flavoring and coloring agents, may also be present.

Pharmaceutical compositions may also be formulated as oil-in-water emulsions. The oily phase may be a vegetable oil (e.g., olive oil or arachis oil), a mineral oil (e.g., liquid paraffin) or a mixture thereof. Suitable emulsifying agents include naturally-occurring gums (e.g., gum acacia or gum tragacanth). natural Iy- occurring phosphatides (e.g., soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol). anhydrides (e.g., sorbitan monoleate) and condensation products of partial esters derived from fatty acids and hexitol with ethylene oxide (e.g., polyoxyethylene sorbitan monoleate). An emulsion may also comprise one or more sweetening and/or flavoring agents.

Syrups and elixirs may be formulated with sweetening agents, such as glycerol, propylene glycol, sorbitol or sucrose. Such foπnulations may also comprise one or more demulcents, preservatives, flavoring agents and/or coloring agents. Formulations for topical administration typically comprise a topical vehicle combined with active agent(s), with or without additional optional components. Suitable topical vehicles and additional components are well known in the art, and it will be apparent that the choice of a vehicle will depend on the particular physical form and mode of delivery. Topical vehicles include water: organic solvents such as alcohols (e.g., ethanol or isopropyl alcohol) or glycerin; glycols (e.g., butylene, isoprene or propylene glycol); aliphatic alcohols (e.g., lanolin); mixtures of water and organic solvents and mixtures of organic solvents such as alcohoi and glycerin; lipid-based materials such as fatty acids, acylglycerols (including oils, such as mineral oil, and fats of natural or synthetic origin), phosphoglycerides, sphingolipids and waxes; protein-based materials such as collagen and gelatin; silicone-based materials (both non-volatile and volatile); and hydrocarbon-based materials such as microsponges and polymer matrices. A composition may further include one or more components adapted to improve the stability or effectiveness of the applied formulation, such as stabilizing agents, suspending agents, emulsifying agents, viscosity adjusters, gelling agents, preservatives, antioxidants, skin penetration enhancers, moisturizers and sustained release materials. Examples of such components are described in Martin dale— The Extra Pharmacopoeia (Pharmaceutical Press. London 1993) and Martin (ed.)_s Remington's Pharmaceutical Sciences. Formulations may comprise microcapsules, such as hydroxymethylcellulose or gelatin-microcapsules, liposomes, albumin microspheres, micrσemuisions, nanoparticles or nanocapsules.

A topical formulation may be prepared in a variety of physical forms including, for example, solids, pastes, creams, foams, lotions, gels, powders, aqueous liquids and emulsions. Typical modes of delivery for topical compositions include application using the fingers; application using a physical applicator such as a cloth, tissue, swab, stick or brush; spraying (including mist, aerosol or foam spraying); dropper application; sprinkling; soaking; and rinsing. Controlled release vehicles can also be used. A pharmaceutical composition may be prepared as a sterile injectible aqueous or oleaginous suspension. The compound(s) provided herein, depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Such a composition may be formulated according to the known art using suitable dispersing, wetting and/or suspending agents such as those mentioned above. Among the acceptable vehicles and solvents that may be employed are water, 1 ,3-butanedioi, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectible compositions, and adjuvants such as local anesthetics, preservatives and/or buffering agents can be dissolved in the vehicle. Compounds may also be formulated as suppositories (e.g., for rectal administration). Such compositions can be prepared by mixing the drug with a suitable non- irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Suitable excipients include, for example, cocoa butter and polyethylene glycols.

Pharmaceutical compositions may be formulated for release at a pre-determined rate. Instantaneous release may be achieved, for example, via sublingual administration (i.e., administration by mouth in such a way that the active ingredient(s) are rapidly absorbed via the blood vessels under the tongue rather than via the digestive tract). Controlled release formulations (i.e., formulations such as a capsule, tablet or coated tablet that slows and/or delays release of active ingredient(s) following administration) may be administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at a target site. In general, a controlled release formulation comprises a matrix and/or coating that delays disintegration and absorption in the gastrointestinal tract (or implantation site) and thereby provides a delayed action or a sustained action over a longer period. One type of control led-release formulation is a sustained-release formulation, in which at least one active ingredient is continuously released over a period of time at a constant rate. Preferably, the therapeutic agent is released at such a rate that blood (e.g., plasma) concentrations are maintained within the therapeutic range, but below toxic levels, over a period of time that is at least 4 hours, preferably at least 8 hours, and more preferably at least 12 hours. Such formulations may generally be prepared using well known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site. Carriers for use within such formulations are biocompatible, and may also be biodegradable; preferably the formulation provides a relatively constant level of modulator release. The amount of modulator contained within a sustained release formulation depends upon, for example, the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented.

Controlled release may be achieved by combining the active ingredient(s) with a matrix material that itself alters release rate and/or through the use of a control led-release coating. The release rate can be varied using methods well known in the art, including (a) varying the thickness or composition of coating, (b) altering the amount or manner of addition of piasticizer in a coating, (c) including additional ingredients, such as release-modifying agents, (d) altering the composition, particle size or particle shape of the matrix, and (e) providing one or more passageways through the coating. The amount of modulator contained within a sustained release formulation depends upon, for example, the method of administration (e.g., the site of implantation), the rate and expected duration of release and the nature of the condition to be treated or prevented.

The matrix material, which itself may or may not serve a controlled-release function, is generally any material that supports the active ingredient(s). For example, a time delay material such as glyceryl monosterate or glyceryl distearate may be employed. Active ingredient(s) may be combined with matrix material prior to formation of the dosage form (e.g., a tablet). Alternatively, or in addition, active ingredient(s) may be coated on the surface of a particle, granule, sphere, microsphere, bead or pellet that comprises the matrix material. Such coating may be achieved by conventional means, such as by dissolving the active ingredient(s) in water or other suitable solvent and spraying. Optionally, additional ingredients are added prior to coating (e.g., to assist binding of the active ingredient(s) to the matrix material or to color the solution). The matrix may then be coated with a barrier agent prior to application of controlled-release coating. Multiple coated matrix units may. if desired, be encapsulated to generate the final dosage form.

In certain embodiments, a controlled release is achieved through the use of a controlled release coating (i.e., a coating that permits release of active ingredient(s) at a controlled rate in aqueous medium). The controlled release coating should be a strong, continuous film that is smooth, capable of supporting pigments and other additives, non-toxic, inert and tack-free. Coatings that regulate release of the modulator include pH-independent coatings, pH-dependent coatings (which may be used to release modulator in the stomach) and enteric coatings (which allow the formulation to pass intact through the stomach and into the small intestine, where the coating dissolves and the contents are absorbed by the body). It will be apparent that multiple coatings may be employed (e.g., to allow release of a portion of the dose in the stomach and a portion further along the gastrointestinal tract). For example, a portion of active ingredient(s) may be coated over an enteric coating, and thereby released in the stomach, while the remainder of active ingredient(s) in the matrix core is protected by the enteric coating and released further down the GI tract. pH dependent coatings include, for example, shellac, cellulose acetate phthalate. polyvinyl acetate phthalate, hydroxypropylmethylcellulose phthalate, methacrylic acid ester copolymers and zeiri. In certain embodiments, the coating is a hydrophobic material, preferably used in an amount effective to slow the hydration of the geliing agent following administration. Suitable hydrophobic materials include alkyl celluloses (e.g., ethylcellulose or carboxymethylcellulose), cellulose ethers, cellulose esters, acrylic polymers (e.g., poly(acrylic acid), poiy(methacrylic acid), acrylic acid and methacrylic acid copolymers, methyl methacrylate copolymers, ethoxy ethyl methacrylates, cyanoethyl methacrylate, methacrylic acid alkamide copolymer, poly(methyl methacrylate), polyacryiamide, ammonio methacrylate copolymers, aminoalkyl methacrylate copolymer, poly(methacrylic acid anhydride) and glycidyl methacrylate copolymers) and mixtures of the foregoing. Representative aqueous dispersions of ethylcellulose include, for example, AQUACOAT® (FMC Corp., Philadelphia. PA) and SURELEASE® (Colorcon, Inc.. West Point, PA), both of which can be applied to the substrate according to the manufacturer's instructions. Representative acrylic polymers include, for example, the various EUDRAGIT® (Rohm America, Piscataway, NJ) polymers, which may be used singly or in combination depending on the desired release profile, according to the manufacturer's instructions.

The physical properties of coatings that comprise an aqueous dispersion of a hydrophobic material may be improved by the addition or one or more plasticizers. Suitable plasticizers for alkyl celluloses include, for example, dibutyl sebacate, diethyl phthalate, triethyl citrate, tributyl citrate and triacetin. Suitable plasticizers for acrylic polymers include, for example, citric acid esters such as triethyl citrate and tributyl citrate, dibutyl phthalate, polyethylene glycols, propylene glycol, diethyl phthalate, castor oil and triacetin.

Control led-re lease coatings are generally applied using conventional techniques, such as by spraying in the form of an aqueous dispersion. If desired, the coating may comprise pores or channels to facilitate release of active ingredient. Pores and channels may be generated by well known methods, including the addition of organic or inorganic material that is dissolved, extracted or leached from the coating in the environment of use. Certain such pore-forming materials include hydrophilic polymers, such as hydroxyalky! celluloses (e.g., hydroxypropylmethylcellulose), cellulose ethers, synthetic water-soluble polymers (e.g., polyvinylpyrrolidone, cross-linked polyvinylpyrrolidone and polyethylene oxide), water-soluble polydextrose, saccharides and polysaccharides and alkali metal salts. Alternatively, or in addition, a controlled release coating may include one or more orifices, which may be formed my methods such as those described in US Patent Nos. 3,845,770; 4,034,758; 4,077,407; 4,088,864; 4,783,337 and 5,071 ,607. Control led-re lease may also be achieved through the use of transdeπnal patches, using conventional technology (see, e.g., US Patent No. 4,668,232). Further examples of controlled release formulations, and components thereof, may be found, for example, in US Patent Nos. 4,572,833; 4,587,1 17; 4,606,909; 4,610,870: 4,684,516; 4,777,049; 4,994,276; 4,996,058; 5,128,143; 5,202,128; 5,376,384; 5,384,333; 5,445,829; 5,510, 1 19; 5,618,560; 5,643,604; 5,891,474; 5,958,456; 6,039,980; 6, 143,353; 6,126,969; 6,156,342; 6,197,347; 6,387,394; 6,399,096; 6,437,000; 6,447,796; 6,475,493; 6,491,950; 6,524,615; 6,838,094; 6,905,709; 6,923,984; 6.923,988; and 6.91 1,217; each of which is hereby incorporated by reference for its teaching of the preparation of controlled release dosage forms.

In addition to or together with the above modes of administration, a compound provided herein may be conveniently added to food or drinking water (e.g., for administration to non-human animals including companion animals (such as dogs and cats) and livestock). Animal feed and drinking water compositions may be formulated so that the animal takes in an appropriate quantity of the composition along with its diet. It may also be convenient to present the composition as a premix for addition to feed or drinking water.

Aryl sulfones provided herein are generally administered in a therapeutically effective amount. Preferred systemic doses are no higher than 50 mg per kilogram of body weight per day (e.g., ranging from about 0.001 mg to about 50 mg per kilogram of body weight per day), with oral doses generally being about 5-20 fold higher than intravenous doses (e.g., ranging from 0.01 to 40 mg per kilogram of body weight per day). The amount of active ingredient that may be combined with the earner materials to produce a single dosage unit will vary depending, for example, upon the patient being treated and the particular mode of administration. Dosage units will generally contain from about 10 μg to about 500 mg of an active ingredient. Optimal dosages may be established using routine testing, and procedures that are well known in the art. Pharmaceutical compositions provided herein may, but need not, further comprise one or more additional pharmaceutical agents, such as an anti-inflammatory agent or analgesic.

Anti-inflammatory agents include, for example, non-steroidal anti-inflammatory drugs

(NSAIDs), non-specific and cyclooxygenase-2 (COX-2) specific cyciooxgenase enzyme inhibitors, gold compounds, corticosteroids, methotrexate, leflunomide, cyclosporine A, IM gold, minocycline, azathioprine, tumor necrosis factor (TNF) receptor antagonists, soluble TNF alpha receptor

(etanercept), aiiti-TNF alpha antibodies (e.g., infliximab and adalimumab), anti-C5 antibodies, interleukin- 3 (IL-I ) receptor antagonists (e.g., anakinra or IL-] trap), IL- 18 binding protein, CTLA4-

Ig {e.g., abatacept), anti-human IL-6 receptor monoclonal antibody (e.g., tocilizumab), LFA-3-Ig fusion proteins (e.g., alefacept), LFA-I antagonists, anti-VLA4 monoantibody (e.g., nataϋzumab), anti-CDl la monoclonal antibody, anti-CD20 monoclonal antibody (e.g., rituximab), anti-IL-12 monoclonal antibody, anti-IL-15 monoclonal antibody, CDP 484, CDP 870, chemokine receptor antagonists, selective iNOS inhibitors, p38 kinase inhibitors, integrin antagonists, angiogenesis inhibitors, and TMl-I dual inhibitors. Further anti-inflammatory agents include nieloxicam, rofecoxib, celecoxib, etoricoxib, parecoxib, valdecoxib and tilicoxib.

NSAlDs include, but are not limited to, ibuprofen, flurbiprofen, naproxen or naproxen sodium, diclofenac, combinations of diclofenac sodium and misoprostol, sulindac, oxaprozin, difiunisal, piroxicam, indσmethacin, etodolac, fenoprofen calcium, ketoprofen, sodium nabumetone, sulfasalazine, tolmetin sodium, and hydroxychloroquine. One class of NSAIDs consists of compounds that inhibit cyclooxygenase (COX) enzymes; such compounds include celecoxib and rofecoxib. NSAΪDs further include salicylates such as acetylsalicylic acid or aspirin, sodium salicylate, choline and magnesium salicylates, and salsalate, as well as corticosteroids such as cortisone, dexamethasone, methylprednisolone, prednisolone, prednisolone sodium phosphate, and prednisone. Certain analgesics for use in combination with B; modulators provided herein are also anti- inflammatory agents, and are listed above. Other such medications are analgesic agents, including narcotic agents which typically act at one or more opioid receptor subtypes (e.g., μ, K and/or δ), preferably as agonists or partial agonists. Such agents include opiates, opiate derivatives and opioids, as well as pharmaceutically acceptable salts and hydrates thereof. Specific examples of narcotic analgesics include, within preferred embodiments, alfentanil, alphaprodine, anileridine, bezitramide, buprenorphine, butorphanol, codeine, diacetyldihydromorphine, diacetylmorphine, dihydrocodeine, diphenoxylate, ethyimorphine, fentanyl, heroin, hydrocodone, hydromorphone, isomethadone, levomethorphan, levorphane, levorphanol, meperidine, metazocine, methadone, methorphan, metopon, morphine, nalbuphine, opium extracts, opium fluid extracts, powdered opium, granulated opium, raw opium, tincture of opium, oxycodone, oxymorphone, paregoric, pentazocine, pethidine, phenazocine, piminodine, propoxyphene, racemethorphan, racemorphan, sulfentanyl, thebaine and pharmaceutically acceptable salts and hydrates of the foregoing agents. Other examples of narcotic analgesic agents include acetorphϊne, acetyidihydrocodeine, acetylmethadol, ailylprodme, alphracetylmethadol, alphameprodine, alphamethadol, benzethidine, benzyl morphine, betacetylmethadoi, betameprodine, betamethadol, betaprodine, clonitazene, codeine methylbromide, codeine-N-oxide. cyprenoφhine, desomoφhine, dextromoramide, diampromide, diethylthiambutene, dihydromorphine, dimenoxadol, dimepheptanol, dimethylthiamubutene, dioxaphetyl butyrate, dipipanone, drotebanol, ethanol, etliylmethylthiambutene, etonitazene, etoφhine, etoxeridine, furethidine, hydromoφhinol, hydroxypethidine, ketobernidone, levomoramide, levophenacylmorphan, methyldesoφhine, methyJdihydromorphine, moφheridine, moφhine, methylpromide, morphine methylsulfonate, morphine-N-oxide, myrophin, naloxone, naltyhexone, nicocodeine, nicomoφhiπe, noracymethadol, norlevoφhanol, normethadone, normorphine, noφipanone, pentazocaine, phenadoxone, phenampromide, phenomorphan, phenoperidine, piritramide, pholcodine, proheptazoine, properidine, propiran, racemoramide, thebacon, trimeperidine and the pharmaceutically acceptable salts and hydrates thereof.

Further specific representative analgesic agents include, for example acetaminophen (paracetamol); aspirin and other NSAIDs described above; NR2B antagonists; capsaicin receptor antagonists; anti-migraine agents; anticonvulsants such as oxcarbazepine and carbamazepine; antidepressants (such as TCAs, SSRIs, SNRIs, substance P antagonists, etc.); spinal blocks; pentazocine/naloxone; meperidine; levorphanol; buprenorphine; hydromorphone; fentanyl; sufentanyl; oxycodone; oxycodone/acetaminophen, nalbuphine and oxymorphone. Still further analgesic agents include CB2-receptor agonists, such as AM 1241, capsaicin receptor antagonists and compounds that bind to the α2δ subunit of voltage-gated calcium channels, such as gabapentin and pregabalin.

Representative anti-migraine agents for use in combination with a B| modulator provided herein include CGRP antagonists, capsaicin receptor antagonists, ergotamines and 5-HTi agonists, such as sumatripan, naratriptan, zolmatriptan and rizati"iptan.

Pharmaceutical compositions may be packaged for treating conditions responsive to B] modulation (e.g., treatment of pain, inflammation or other disorder(s) recited herein). Packaged pharmaceutical preparations generally comprise a container holding a therapeutically effective amount of a pharmaceutical composition as described above and instructions (e.g., labeling) indicating that the composition is to be used for treating a condition responsive to B] modulation in a patient (e.g., pain or other disorder as indicated herein). In certain embodiments, a packaged pharmaceutical preparation comprises one or more aryl sulfones provided herein and one or more additional agents in the same package, either in separate containers within the package or in the same container (i.e., as a mixture). Preferred mixtures are formulated for oral administration (e.g., as pills, capsules, tablets or the like). In certain embodiments, the package comprises a label bearing indicia indicating that the components are to be taken together for the treatment of pain. METHODS OF USE

Within certain aspects, the present invention provides methods for treating a condition responsive to B] modulation in a patient. The patient may be afflicted with such a condition, or may be free of symptoms but considered at risk for developing such a condition. A condition is "responsive to B₁ modulation" if the condition or symptom(s) thereof are alleviated, attenuated, delayed or otherwise improved by modulation of B| activity. In general, such methods comprise administering to the patient a therapeutically effective amount of at ieast one aryl sulfone as provided herein.

Conditions responsive to Bi modulation include_,, for example pain; inflammation including neuroinfiammation (such as atherosclerosis), inflammation associated with airway diseases (e.g., asthma, including allergic asthma, exercise-induced bronchoconstriction, occupational asthma, and other non-allergic asthmas), and inflammatory skin disorders (e.g., psoriasis and eczema)); respiratory disorders including bronchoconstriction, asthma, chronic obstructive pulmonary disease (e.g., emphysema), chronic cough (including ACE-inhibitor cough), adult respiratory distress syndrome, bronchitis, pneumonia, allergic rhinitis and vasomotor rhinitis; vascular edema (including diabetes- related vascular disease); and epilepsy.

Other conditions responsive to B] modulation include diabetes (e.g., type II or non insulin dependent as well as diabetic vasculopathy, diabetic neuropathy, diabetic retinopathy, post capillary resistance and symptoms associated with insulitis), seizure disorders (e.g., epilepsy), multiple sclerosis, liver disease, cardiovascular disorders (e.g., atherosclerosis, congestive heart failure and myocardial infarction), neurodegenerative diseases (e.g., Alzheimer's disease and Parkinson's disease) rheumatoid arthritis, infection, cancer, cranial trauma, rhinitis, septic shock, endotoxic and pancreatic shock, anaphylaxis, inflammatory bowel disease, irritable bowel syndrome, pancreatitis, cystitis, uveitis, vascular perme ability, gingivitis, osteoporosis, benign prostatic hyperplasia, hyperactive bladder, cerebral edema, vasodilation, hypotension associated with sepsis, edema resulting from trauma associated with burns, sprains or fracture, cerebral edema, angiodema, Crohn's disease and ulcerative colitis. B₁ modulators may also be used as smooth muscle relaxants for treating spasms of the gastrointestinal tract of uterus, In certain embodiments, the condition responsive to B₁ modulation is pain or inflammation. Pain that may be treated using the B] modulators provided herein includes, for example, acute, chronic, inflammatory, and neuropathic pain. Specific pain indications that may be treated as described herein include, but are not limited to, bone and joint pain (e.g., pain associated with osteoarthritis or rheumatoid arthritis; various neuropathic pain syndromes (such as post-herpetic neuralgia, trigeminal neuralgia, refiex sympathetic dystrophy, diabetic neuropathy, Guillian Barre syndrome, fibromyalgia, oral neuropathic pain, phantom limb pain, post-mastectomy pain, peripheral neuropathy, traumatic neuropathy, painful polyneuropathy, myofascial pain syndromes, MS-related neuropathy, HIV or AIDS-related neuropathy, and chemotherapy-induced and other iatrogenic neuropathies); visceral pain, (such as that associated with gastroesophageal reflux disease (GERD), irritable bowe! syndrome, inflammatory bowel disease, pancreatitis, renal colic, interstitial cystitis, intestinal gas, gynecological disorders (e.g., menstrual pain, dysmenorrhoea, pain associated with cystitis, labor pain, chronic pelvic pain, vulvodynia, chronic prostitis, and endometriosis), heart pain and abdominal pain, and urologica] disorders); dental pain (e.g., toothache, denture pain, nerve root pain, pain resulting from periodontal disease, and pain due to dental surgery including operative and post-operative pain); stump pain; meralgia paresthetica; burning-mouth syndrome; pain associated with nerve and root damage, including as pain associated with peripheral nerve disorders (e.g., nerve entrapment and brachial plexus avulsions, amputation, peripheral neuropathies including bilateral peripheral neuropathy, tic douloureux, atypical facial pain, nerve root damage, and arachnoiditis), causalgia, neuritis (including, for example, sciatic neuritis, peripheral neuritis, polyneuritis, optic neuritis, postfebrile neuritis, migrating neuritis, segmental neuritis and Gombault's neuritis), neuronitis, neuralgias (e.g., those mentioned above, cervicobrachial neuralgia, cranial neuralgia, geniculate neuralgia, glossopharyngia! neuralgia, migranous neuralgia, idiopathic neuralgia, intercostals neuralgia, mammary neuralgia, mandibular joint neuralgia, Morton's neuralgia, nasociliary neuralgia, occipital neuralgia, red neuralgia, Sluder's neuralgia, splenopalatine neuralgia, supraorbital neuralgia and vidian neuralgia); surgery-related pain; musculoskeletal pain; central nervous system pain (e.g., pain due to brain stem damage, sciatica, and ankylosing spondylitis); and spinal pain, including spinal cord injury-related pain. Headache, including headaches involving peripheral nerve activity may also be treated as described herein. Such headache pain includes, for example, sinus, cluster (i.e., migranous neuralgia) and tension headaches, migraine, temporomandibular pain and maxillary sinus pain. For example, migraine headaches may be prevented by administration of a compound provided herein as soon as a pre-migrainous aura is experienced by the patient. Further pain conditions that can be treated as described herein include Charcot's pains, ear pain, muscle pain, eye pain, orofacial pain (e.g., odontalgia), repetitive motion pain, carpel tunnel syndrome, acute and chronic back pain (e.g., lower back pain), gout, scar pain, hemorrhoidal pain, dyspeptic pains, angina, nerve root pain, "non-painful" neuropathies, complex regional pain syndrome, nomotopic pain and heterotopic pain — including pain associated with carcinoma, often referred to as cancer-associated pain (e.g., in patients with bone cancer), pain (and inflammation) associated with venom exposure (e.g., due to snake bite, spider bite, or insect sting) and trauma- associated pain (e.g., post-surgical pain, episiotomy pain, pain from cuts, musculoskeletal pain, bruises and broken bones, and burn pain, especially primaiy hyperalgesia associated therewith). Additional pain conditions that may be treated as described herein include pain associated with autoimmune diseases or immunodeficiency disorders, hot flashes, burns, sunburn, and pain that results from exposure to heat, cold or external chemical stimuli. In certain embodiments, pain treated with B] modulators provided herein is inflammatory pain, acute pain, dental pain, back pain, surgical pain, headache, neuropathic pain or pain from osteoarthritis or trauma.

It will be apparent that compounds provided herein may be administered alone or in combination with one or more additional agents that are suitable for treating the disorder of interest. Within such combination therapy, the compound(s) and additional agent(s) may be present in the same pharmaceutical composition, or may be administered separately in either order. Representative anti-inflammatory agents and analgesics for use in combination therapy include those indicated above. Within other aspects, B, modulators provided herein may be used within combination therapy for the treatment of conditions involving pain and/or inflammatory components. Such conditions include, for example, autoimmune disorders and pathologic autoimmune responses known to have an inflammatory component including, but not limited to, arthritis (especially rheumatoid arthritis), psoriasis, Crohn's disease, lupus erythematosus, irritable bowel syndrome, tissue graft rejection, and hyperacute rejection of transplanted organs. Other such conditions include trauma (e.g., injury to the head or spinal cord), cardio- and cerebrovascular disease and certain infectious diseases. Within such combination therapy, a Bi modulator is administered to a patient along with an additional analgesic and/or anti- inflammatory agent. The Bi modulator and additional analgesic and/or anti-inflammatory agent may be present in the same pharmaceutical composition, or may be administered separately in either order. Administration to the patient can be by way of any means discussed above, including oral, topical, nasal or transdermal administration, or intravenous, intramuscular, subcutaneous, intrathecal, epidural, intrac ere bro ventricular or like injection. Oral administration is preferred in certain embodiments (e.g., formulated as pills, capsules, tablets or the like).

Treatment regimens may vaiy depending on the compound used and the particular condition to be treated. Tn general, a dosage regimen of 4 times daily or less is preferred, with 1 or 2 times daily particularly preferred. It will be understood, however, that the specific dose and treatment regimen for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex and diet of the patient, the time of administration, the route of administration, the rate of excretion, any drug combination and the severity of the particular disease undergoing therapy. Dosages are generally as described above; in general, the use of the minimum dose sufficient to provide effective therapy is preferred. Patients may generally be monitored for therapeutic effectiveness using medical or veterinary criteria suitable for the condition being treated or prevented.

Suitable dosages for Bj modulators (either alone or within such combination therapy) are generally as described above. Dosages and methods of administration of any additional agent(s) (e.g., anti-inflammatory and/or analgesic agents) can be found, for example, in the manufacturer's instructions or in the Physician's Desk Reference. In certain embodiments, combination administration results in a reduction of the dosage of the additional agent required to produce a therapeutic effect (i.e., a decrease in the minimum therapeutically effective amount). Thus, preferably, the dosage of additional agent in a combination or combination treatment method of the invention is less than the maximum dose advised by the manufacturer for administration of the agent without combination with a compound of Formula I. More preferably this dose is less than %, even more preferably less than ¹A, and highly preferably less than ^]Λ of the maximum dose, while most preferably the dose is less than 10% of the maximum dose advised by the manufacturer for administration of the agent(s) when administered without combination administration as described herein. It will be apparent that the dose of compound as provided herein needed to achieve the desired effect may similarly be affected by the dose and potency of the additional agent.

Within separate aspects, the present invention provides a variety of non-pharmaceutical in vitro and in vivo uses for the compounds provided herein. For example, such compounds may be labeled and used as probes for the detection and localization of Bj (in samples such as cell preparations or tissue sections, preparations or fractions thereof). In addition, compounds provided herein that comprise a suitable reactive group (such as an aryl carbonyl, nitro or azide group) may be used in photoafftnity labeling studies of receptor binding sites. In addition, compounds provided herein may be used as positive controls in assays for receptor activity, as standards for determining the ability of a candidate agent to bind to _Bi, or as radiotracers for positron emission tomography (PET) imaging or for single photon emission computerized tomography (SPECT). Such methods can be used to characterize Bj receptors in living subjects. For example, a compound may be labeled using any of a variety of well known techniques (e.g., radiolabeled with a radionuclide such as tritium, as described herein), and incubated with a sample for a suitable incubation time (e.g., determined by first assaying a time course of binding). Following incubation, unbound compound is removed (e.g., by washing), and bound compound detected using any method suitable for the label employed (e.g., autoradiography or scintillation counting for radiolabeled compounds; spectroscopic methods may be used to detect luminescent groups and fluorescent groups). As a control, a matched sample containing labeled compound and a greater (e.g., 10-fold greater) amount of unlabeled compound may be processed in the same manner. A greater amount of detectable label remaining in the test sample than in the control indicates the presence of B₅ in the sample. Detection assays, including receptor autoradiography (receptor mapping) of Bj in cultured cells or tissue samples may be performed as described by Kuhar in sections 8.1.1 to 8.1.9 of Current Protocols in Pharmacology (1998) John Wiley & Sons, New York.

The following Examples are offered by way of illustration and not by way of limitation. Unless otherwise specified all reagents and solvent are of standard commercial grade and are used without further purification. Using routine modifications, the starting materials may be varied and additional steps employed to produce other compounds provided herein. EXAMPLES

Mass spectroscopy data in the following Examples is Eiectrospray MS, obtained in positive ion mode using a Micromass Time-of-Flight LCT (Micromass, Beverly MA), equipped with a Waters

600 pump (Waters Corp.; Milford, MA), Waters 996 photodiode array detector, and a Gilson 215 autosampler (Gilson, Inc.; Middleton, WI). MassLynx (Advanced Chemistry Development, Inc;

Toronto, Canada) version 4.0 software with OpenLynx Global Server™, OpenLynx™ and

AutoLynx™ processing is used for data collection and analysis. MS conditions are as follows: capillary voltage = 3.5 kV; cone voltage = 30 V, desolvation and source temperature = 35O⁰C and

12O⁰C, respectively; mass range = 181-750 with a scan time of 0.22 seconds and an interscan delay of 0.05 seconds.

Sample volume of 1 microliter is injected onto a 50x4.6mm Chromolith SpeedROD RP-18e column (Merck KGaA, Darmstadt, Germany), and eluted using a 2-phase linear gradient at a flow rate of 6 ml/min. Sample is detected using total absorbance count over the 220-340nm UV range. The elution conditions are: Mobile Phase A - 95% water, 5% MeOH with 0.05% TFA; Mobile Phase B - 5% water, 95% MeOH with 0.025% TFA. The following gradient is used: 0-0.5 min 10-100%B, hold at 100%B to 1.2 min, return to 10%B at 1.21 min. Inject to inject cycle is 2.15 min.

EXAMPLE 1. SYNTHESIS OF 1 -({3-[4-METHOXY-2,6-DIMETHYLPHENYL)SULFONYL]BUTOXY} ACETYL)-4-

(3 -PIPERIDlN- 1 -YLPROPYL)PIPERAZINE

Step 1. 4-Methoxy-2,6-dimethy!benzenethiol 4-Methoxy-2,6-dimethylbenzenesuifonyl chloride (6 g, 25.6 mmol) is added dropwise to a suspension of LAH (2.43 g, 64.1 mmol) in THF (200 niL) at 0 ⁰C under N₂. The mixture is stirred at rt for 2h, and then refluxed for 3 h. The reaction mixture is cooied to 0 ⁰C, quenched with Na₂SOj 10H₂O, and then stirred at rt for 1 h. The suspension is filtered through celite, and the filter cake is washed with THF. The filtrate and wash are combined, and concentrated under reduced pressure to afford the title compound as a yellow oil.

Step 2. /er/-Butyl{3-[(4-methoxy-2,6-dimethylphenyf)thio]propoxy}dimethylsilane

To a suspension of NaH (1.09 g. 27.2 mmol, 60% in mineral oil) in DMF (20 niL) at 0 ⁰C under N₂ is added a solution of 4-methoxy-2,6-dimethylbenzenethiol in DMF (20 mL) dropwise. After stirring for 20 min, (3-bromopropoxy)(/er/-butyl)dimethylsilane (5.05 mL, 21.7 mmol) is added. The reaction is warmed to rt. After stirring for 16 h. the reaction is quenched with 50% saturated brine, and extracted with EtOAc (2x). The combined organic extracts are washed with water and brine, dried over Na₂SO₄, and concentrated under reduced pressure. Purification by silica gel chromatography (hexane/EtOAc: 95/5) gives the title compound as a yellow oil.

Step 3. /ert-Butyl{3-[(4-methoxy-2,6-dimethylρhenyl)sulfonyl]propoxy}dimethylsilane To a solution of the oil generated in step 2 in CH₂Cl₂ (100 mL) at 0 ⁰C is added mCPBA

(77%, 8.40 g, 37.4 mmol) portion-wise. The reaction is warmed to rt. After stirring at rt for 16 h, the reaction mixture is diluted with CH₂Cl₂, washed with 50% sat. NaHCO₃ and brine, dried over Na₂SO₄, and concentrated under reduced pressure. Purification by siϋca gel chromatography (hexane/EtOAc: 4/1) gives the title compound as a colorless oil.

Step 4. 3-[(4-Methoxy-2.6-dimethylphenyl)su!fonyl]butan-l-ol To a solution of /er/-butyl{3-[(4-metlioxy-2,6-dimethylphenyI)suIfonyl]propoxy} dimelhylsilane (2.2 g, 5.91 mmol) in THF (30 mL) at -78 ⁰C under N₂ is added n-BuLi (1.6 M in hexane, 4.25 mL, 6.80 mmol) dropwise. After stirring at -78 ⁰C for 1 h, iodomethane (0.37 mL, 5.91 mmol) is added. The mixture is stirred at -78 °C for 30 min, then allowed to warm to rt, and stirred at rt overnight. The reaction mixture is quenched with 50% sat. NH₄Cl, and extracted with EtOAc. Organic layers are combined, washed with brine, dried over Na₂SO₄, and concentrated under reduced pressure to afford a yellow oil that contains a mixture of the title compound and starting material. About 2/3 of the oil is dissolved in THF (6 mL), and treated with TBAF (IM solution in THF, 5.3 mL) at rt overnight. The reaction is diluted with EtOAc, washed with 50% brine and brine, dried over Na₂SO₄ and concentrated under reduced pressure. The residue is purified by reverse-phase HPLC to afford 3-[(4-methoxy-2,6-dimethy1phenyl) sulfonyl]propan-l-ol (colorless oil) and the title compound as a colorless oil.

Step 5. /er/-Buty!{3-[(4-methoxy-2,6-dimethylphenyl)sulfonyi]butoxy} acetate

To a solution of 3-[(4-methoxy-2,6-dimethylphenyl)sulfonyl]butan-l-ol (380 mg, 1.40 mmol) in DMF (5 mL) at 0 ⁰C is added NaH (60% in mineral oil, 83.8 mg, 2.10 mmol). After stirring at 0 ⁰C for 20 min, t-butyi bromoacetate (246.3 μL, 1.67 mmoi) is added. The reaction is allowed to warm to rt. After stirring at rt for 16 h, the reaction is quenched with 50% sat. NH₄Cl, and extracted with EtOAc. Combined organic layers are washed with water and brine, dried over Na₂SO₄, and concentrated under reduced pressure. Purification by silica gel chromatography affords the title compound as a colorless oil. Step 6. {3-[(4-Methoxy-2,6-dimethylphenyl)sulfonyl]butoxy}acetic acid

/er;-Butyl{3-[(4-methoxy-2,6-dimethylphenyl)suifonyl]butoxy} acetate (349 mg, 0.90 mmoi) is treated with TFA (1 mL) at rt for 10 min. TFA is then removed under reduced pressure at rt. Purification by flash chromatography (hexane/EtOAc: 1/3) affords the title compound as a white solid. Step 7. l-({3-[(4-methoxy-2,6-dimethylphenyl)sulfonyi]butoxy}acet>'l)-4-(3-piperidin-l- ylpropyl)piperazine

A LO M solution of TEA in toluene (0.12 mL) is added to a solution of the acid prepared in step Vl (20 mg, 60 μmol), l-[3-(l-piperidinyl)propyl-piperazine (13 mg, 60 μmol), and dimethylacetamide (0.3 mL) under N₂. A 0.2 M solution of 2-chloro-l,3-dimethylimidazolidinium chloride in acetonitrile (0.5 mL) is added. The reaction vessel is sealed and the mixture is warmed to

50 ⁰C for 2.5 h. After cooling to ambient temperature, 1 M aqueous NaOH (1.5 mL) is added and then the volatiles are removed under reduced pressure. The aqueous residue is extracted with EtOAc (2 X 1.5 mL). The organics are loaded onto two 0.5 g SCX columns. Each column is washed with EtOAc (3 X 3 mL) and then eluded with 10:5:2 EtOAc : MeOH : TEA (4.5 mL). Solvent removal under reduced pressure affords the title compound as a yellow oil. ¹H-NMR (400 MHz, CDCI3) S: 6.65 (s, 2H), 4.02-4.13 (m, 2H), 3.82 (s, 3H), 3.57-3.64 (m, 4H), 3.35-3.42 (m, 3H), 2.66 (s, 6H), 2.26-2.50 (m, 13H), 1.74-1.82 (m, 3H), 1.68 (bs, 4H), 1.47 (bs, 2H), 1.30 (d, 3H). LOMS m/z (M + H"): 524.3; retention time = 1.09 min.

EXAMPLE 2. SYNTHESIS OF N-[4-(4,5-DlHYDRO- lH-IMlDAZOL-2-YL)BENZYL]-2- {3 -[(4-METHOXY- 2,6-DIMETHYLPHENYL)SULFONYL]BUTOXYI-N-IVIETHYLACETAMIDE

The title compound is prepared using the procedure illustrated in Example I , above. ¹H-NMR (400 MHz, CDCl₃) δ: 7.89-7.92 (m, 2H), 7.21-7.28 (m, 2H), 6.64 (s, 2H), 4.53-4.58 (m, 2H), 4.16 (d, 1.3 H), 4.12 (d, 0.7 H), 3.85 (s, 4H), 3.82 (s, 3H), 3.58-3.71 (m, 3H), 3.31 (m, I H). 2.92 (s, IH), 2.87 (s, 2H), 2.64 (s, 4H), 2.62 (s, 2H), 2.24 (m. I H), 1.72 (m, I H), 1.29 (d, 2H), 1 .23 (d, I H). LC-MS m/z (M + H^H): 502.2; retention time = 0.92 min.

EXAMPLE 3. SYNTHESIS OF N-[4-(4,5-DlHYDRO-l H~IMΪDAZOL-2-YL)BENZYL]-2-{3-[(4-METHOXY~2,6~ DIMETHYLPHENYL)SULFONYL]PROIOXY)-N-METHYLACETAMIDE

The title compound is prepared using the procedure illustrated in Example 1, above, ¹H-NMR (400 MHz. CDCI₃) & 7.87-7.91 (m, 2H), 7.23-7.28 (m, 2H), 6.63 (s, 2H), 4.56 (s, 1.3H), 4.55 (s, 0.7H), 4.20 (s, 1.3H), 4.13 (s, 0.7H), 3.86 (s, I H), 3.84 (s, 2H), 3.82 (s, 3H). 3.66 (t, 1.3H), 3.54 (t. 0.7H), 3.21 -3.25 (m, 2H), 3.02-3.07 (m, 2H). 2.93 (s, IH), 2.90 (s, 2H). 2.63 (s, 4H), 2.60 (s. 2H), 2.05-2.10 (m, 2H). LC-MS m/z (M + H"): 488.2; retention time = 1.12 min. EXAMPLE 4. ADDITIONAL REPRESENTATIVE ARYL SULFONES

Using routine modifications, the starting materials may be varied and additional steps employed to produce other compounds provided herein. Compounds listed in Table I are prepared using such methods. All compounds in Table I exhibit an IC₅₀ (determined as described in Example 7) that is I micromolar or less. "Ret Time" is the retention time in minutes and mass spectroscopy data generated as described above is presented as in the column headed "MS". All mass spectroscopy data is presented as M+l unless otherwise noted.

Table I Representative Aryl Sulfones

Ret

Compound Name Time MS

1 - 1.04 482.2

1.03 470.2

1.05 510.2

Ret

Compound Name Time MS

l-({3-[(4-methoxy-2,6- dimethylρhenyl)suifonyl ] butoxy } acety l)-4-(3 - 1.09 524 piperidin-1- ylpropyl)piperazine

N-[4-(4,5-dihydro-l H- imidazol-2-yl)benzyI]-2- {3 -[(4-methoxy-2,6- dimethylphenyi)sulfonyl 0.92 502

]butoxy}-N- methylacetamide

N-[4-(4,5-dihydro-l H- imidazoϊ-2-yl)benzy!]-2-

{3-[(4-methoxy-2,6- dimethylphenyl)sulfoπyi 1.12 488

]propoxy}-N- methylacetamide

l-[({2-[(4-methoxy-2,6- d imethy lpheny l)su I fony I ] cyclohexy 1 } methoxy)ac etyl]-4-(3-piperidin-l - 1 .1 564.3 ylpropyOpiperazine

Ret

Compound Name Time MS

2-({2-[(4-methoxy-2,6- d i methyl phenyl) sulfony I ]cyclohexyl}methoxy)- N-raethyl-N-[4-( 1,4,5,6- 1.1 556.0 tetrahydropyrimidin-2- yl)benzyl]acetamide

Additional representative aryl sulfones are provided in Table IL

Table II Representative Aryl Sulfones

EXAMPLE 5. PREPARATION OF B₁-TRANSFECTED CELLS

This Example illustrates the preparation of B]-transfected cells for use in Bi binding and modulation assays (Examples 6 and 7).

Cynomolgus macaque lung total RNA is isolated as described by Chomzynski et al. (1987) Anal. Biochem. /62: 156-159. A cDNA encoding Bi is cloned from the total RNA by reverse transcriptase-polymerase chain reaction (RT-PCR) with the following oligonucleotides:

Primer 1 : GGCGCTAGCCACCATGGCATCCTGGCCCCCTC (SEQ ID NO: 1)

Primer 2: AGCCGTCCCAGATCTGAAC (SEQ ID NO:2) Primer 3: GATCTGG GACGGCTTGGATG (SEQ 1D NO:3) Primer 4: CGGAGCTCTTAATTCCGCCAGAAAAGTTGGA (SEQ ID NO:4) Primer pairs 1 & 2 and 3 & 4 are used to generate overlapping cDNA fragments corresponding to the entire protein coding sequence of cynomolgus macaque B, cDNA are isolated and linked to form the full-length coding sequence (GenBank Accession Number AY788905). The construct is cloned into pcDNA 3.1 (Invitrogen. Carlsbad, CA) and transfected into Chinese hamster ovary (CHO) ceils using Lipofectamine (Invitrogen), resulting in cynomolgus macaque Bi-expressing CHO cells. Alternatively, the construct is cioned into pBAKPAK9 (Clontech, Mountain View. CA) and transfected into Sf9 cells to generate clonal baculovirus stocks. Clonal cell lines stably expressing the cynomolgus macaque Bi receptor are selected in G418. A single clonal line that exhibits high levels of receptor expression is chosen For use in binding and calcium mobilization assays (Examples 6 and 7). Clonal baculovirus stocks are used to infect Sf9 cells such that the infected cells express high levels of recombinant Bj receptors. These cells are used in radioligand binding assays (Example 6),

EXAMPLE 6. B, RECEPTOR BINDING ASSAYS

This Example illustrates a representative Bj receptor binding assay that may be used to determine the binding affinity of compounds for Bj.

A. [3H]-DESARG¹⁰KALLIDiN BINDING TO INTACT 1MR-90 CELLS OR CHO CELLS STABLY EXPRESSING RAT B₁ IMR-90 cells, which endogenously express human B₁, are seeded into 24 well plates at

65,000 cells per well, cultured overnight, and then treated for 3 h with 0.2 ng/niL interleukin-1 beta to induce Bj expression (Menke. et al. (1994) J. Biol. Chern. 269:21583-86). CHO cells stably expressing rat Bj are seeded into 24 well plates at 200,000 ceils per well and cultured overnight. The cells are then washed 3 times with phosphate buffered saline (PBS). One hundred fifty microliters of binding buffer (50 mM Tris 7.4, 0.14 mg/mL, bacitracin, and 1 mg/mL BSA) is added to each well. Various concentrations of test compound are added to each well from DMSO solutions such the final DMSO concentration is 1 % by volume: some wells receive DMSO only, and some wells receive DMSO plus 10 μM desArg^!°Kallidin to define non-specific binding. All wells then receive 0.3 nM (final concentration) [3H]-desArg^!0Kallidin. The plates are allowed to sit for 2 h at room temperature. Cells are then washed three times, and lysed with 400 μl Ultima Gold scintillation fluid (Perkin Elmer; Boston. MA; 20 min incubation). The fluid is then transferred to counting vials counted in a Packard liquid scintillation counter (PerkinElmer). The number of counts present in the scintillation fluid is plotted as a function of antagonist compound concentration and fitted to a logistical equation using SigmaPlot (Systat Software, Point Richmond. CA) to determine each compound's IC₅₀ and K₁ (e.g., as described by Szallasi, et al. (1993) J. Pharmacol Exp. Ther. 266:678-83). B. [3 H] -DE SARD ¹⁰KALLIDIN BINDING TO MEMBRANE HOMOGENATES OF SF9 CELLS EXPRESSING CYNOMOLOUS MACAQUE B_I

Sf9 cells infected with a baculovirus caπying the coding sequence for cynoraolgus macaque Bi are harvested by centrifugation and frozen at -80 ⁰C. Pellets are subsequently resuspended on ice in Tris buffered saline (TBS; 50 mM Tris (pH 7.4), 120 mM NaCl), and cells are homogenized using a polytron for 30 seconds. The crude membrane fraction is collected by centrifugation at 20,000 rpm. Membranes are washed two times with TBS and collected by centrifugation each time. Protein content of the membranes is determined after the last wash and the concentration is adjusted to 0.7 μg/uL with binding buffer (50 mM Tris 7.4, 0.14 mg/mL bacitracin, and 1 ,0 mg/mL BSA). To perform the binding assay, 150 microliters of membrane fraction is added to each well of a 96-well plate along with 50 μl [³H]-desArg^I0Kallidin (0.3 nM final) and test compound in DMSO (final DMSO concentration = 1%). Some wells receive DMSO only, and some wells receive DMSO plus 10 μM desArg¹⁰Kallidin to define non-specific binding. The 96 well plates are allowed to sit for 2 h at room temperature. Membrane proteins are then harvested by filtration onto GF/C fsltermats (PerkinElmer) pre-soaked for 1 hr in 0.5 % polyethyienimine. After filtration, filters are dried and then counted in a Beta plate counter. The number of counts present in the scintillation fluid is plotted as a function of antagonist compound concentration and fitted to a logistical equation using SigmaPlot (Systat Software, Point Richmond, CA) to determine each compound's IC₅₀ and K, (e.g., as described by Szallasi, et al (1993) J. Pharmacol. Exp. Ther. 266:678-83).

EXAMPLE 7. CALCIUM MOBILIZATION ASSAY

This Example illustrates representative calcium mobilization assays for use in evaluating test compounds for agonist and antagonist activity.

Cynomoigus macaque Bi-expressing CHO cells (Example 5) are plated in a 96 well plate. The cells are cultured for 1 day, after which culture media is emptied from the plate and replaced with 50 μl of KRH (Krebs-Ringer HEPES buffer: 25 mM HEPES, 5 mM KCl, 0.96 mM NaH₂PO4, 1 mM MgSO._t, 2 mM CaCi₂, 5 mM glucose, 1 mM probenecid, pH 7.4) supplemented with the calcium- sensitive fluorescent dye Fluo4-AM (5 μg/ml; Teflabs, Austin, TX). The cells are then incubated at 37 ⁰C in an environment containing 5% CO₂. After the 1 hour incubation, the dye solution is removed from the plate, the plate is washed once with KRH, and 100 μL KRH is added. DETERMINATION OF B, AGONIST EC₅₀

100 μL KRH + 2% DMSO is added to each well of cells, such that the final volume in each well is 200 microliters and the final DMSO concentration is 1%. Various concentrations of the Bi agonist desArg¹⁰Kallidin are added. Addition of desArg'°Kallidin elicits a fluorescent response as consequence of increased intracellular calcium. This response is measured with a FLlPR instrument (Molecular Devices, Sunnyvale, CA) and determined to be desArg'°Kallidin concentration dependent. A plot of maximum fluorescent response as a function of desArg Kalligin is generated and an EC_S0 (concentration required to elicit a 50% of maximal response) for the response is determined using the equation: y=a*(l/(l+(b/x)^c)) In this equation, y is the maximum fluorescence signal, x is the concentration of the Bi agonist, a is the E_max, b corresponds to the EC₅O value and c is the Hill coefficient.

By replacing the desArg^!°KaIlidin with a test compound, this assay is also used to assess Bi agonist activity of the test compound.

DETERMINATION OF ANTAGONIST ACTIVITY Various concentrations of test compounds are added to the cell plate prepared as described above in 100 μL KRH + 2% DMSO. such that the Final volume in each well is 200 microliters and the final DMSO concentration is 1 %. The EC₅₀ concentration of desArg ¹⁰KaI lidin is then added to each well of plates containing test compound to determine the extent to which each test compound inhibits an agonist-induced Bi response. The maximum fluorescent response is plotted as a function of test compound concentration in order to determine the IC₅₀ (concentration required to inhibit 50% of the effect of agonist) for each compound at Bj . Antagonists of B₁ decrease this response by at least about 20%, preferably by at least about 50%, and most preferably by at least 80%, as compared to matched control (i.e., cells treated with desArg¹⁰Kallidin at the EC₅₀ concentration in the absence of test compound), at a concentration of 10 micromolar or less, preferably 1 micromolar or less. Alternatively, the data is analyzed as follows. First, the average maximum relative fluorescent unit (RPU) response from negative control wells (no agonist) is subtracted from the maximum response detected for each of the other experimental wells. Second, average maximum RFU response is calculated for the positive control wells (agonist wells). Then, percent inhibition for each compound tested is calculated using the equation: n i ₁ ■: ■ • , ΛΛ , _nn f Peak Signal in Test Wells 1

Percent inhibition = 100 - 100 * - — ; — : — , . — : : — 777Tr

L Peak signal in Agonist Wells J The % inhibition data is plotted as a function of test compound concentration and test compound IC₅₀ is determined using a linear regression in which x is fn(concentration of test compound) and y is In(percent inhibttion/(100 - percent inhibition). Data with a percent inhibition that is greater than 90% or less than 15% are rejected and are not used in the regression. The IC_TO is

(-intercept slope)

EXAMPLE 8. MDCK CYTOTOXICITY ASSAY

This Example illustrates the evaluation of compound toxicity using a Madin Darby canine kidney (MDCK) eel! cytotoxicity assay.

1 μL of test compound is added to each well of a clear bottom 96-well plate (Packard, Meriden, CT) to give final concentration of compound in the assay of 10 μM, 100 μM or 200 μM. Solvent without test compound is added to control wells.

MDCK cells, ATCC no. CCL-34 (American Type Culture Collection, Manassas. VA), are maintained in sterile conditions following the instructions in the ATCC production information sheet. Confluent MDCK cells are trypsinized, harvested, and diluted to a concentration of 0.1 x 10⁶ cells/mL with warm (37⁰C) medium (VITACELL Minimum Essential Medium Eagle, ATCC catalog # 30-

2003). 100 μL of diluted cells is added to each well, except for five standard curve control wells that contain 100 μL of warm medium without cells. The plate is then incubated at 37°C under 95% O₂,

5% CO₂ for 2 hours with constant shaking. After incubation, 50 μL of mammalian cell lysis solution (from the Packard (Meriden, CT) ATP-LITE-M Luminescent ATP detection kit) is added per well, the wells are covered with PACKARD TOPSEAL stickers, and plates are shaken at approximately

700 rpm on a suitable shaker for 2 min.

Compounds causing toxicity will decrease ATP production, relative to untreated cells. The ATP-LITE-M Luminescent ATP detection kit is generally used according to the manufacturer's instructions to measure ATP production in treated and untreated MDCK ceils. PACKARD ATP LlTE-M reagents are allowed to equilibrate to room temperature. Once equilibrated, the lyophilized substrate solution is reconstituted in 5.5 mL of substrate buffer solution (from kit). Lyophilized ATP standard solution is reconstituted in deionized water to give a 10 niM stock. For the five control wells, 10 μL of serially diluted PACKARD standard is added to each of the standard curve control wells to yield a final concentration in each subsequent well of 200 nM, 100 nM. 50 nM, 25 tiM, and 12.5 nM. PACKARD substrate solution (50 μL) is added to all wells, which are then covered, and the plates are shaken at approximately 700 rpm on a suitable shaker for 2 min. A white PACKARD sticker is attached to the bottom of each plate and samples are dark adapted by wrapping plates in foil and placing in the dark for 10 min. Luminescence is then measured at 22°C using a luminescence counter (e.g., PACKARD TOPCOUNT Microplate Scintillation and Luminescence Counter or TECAN SPECTRAFLUOR PLUS), and ATP levels calculated from the standard curve. ATP levels in cells treated with test compound(s) are compared to the levels determined for untreated cells. Cells treated with 10 μM of a preferred test compound exhibit ATP levels that are at least 80%, preferably at least 90%, of the untreated cells. When a 100 μM concentration of the test compound is used, cells treated with preferred test compounds exhibit ATP levels that are at least 50%, preferably at least 80%, of the ATP levels detected in untreated cells.

Claims

CLAIMSWhat is claimed is:

1. A compound of the Formula:

or are a pharmaceutically acceptable salt or hydrate thereof, wherein: == represents a single or double bond; B is N or CH; Ar is phenyl or a 5- or 6-membered heteroaryl, each of which is unsubstituted or substituted on one or more ring carbon atoms with a substituent independently chosen from Ri;

Y is a group of the formula (CH₂)_r-W-(CH₂)_p, which is optionally substituted and is preferably substituted with from 0 to 4 substituents independently chosen from (i) amino, hydroxy, cyano, Q- Qalkyl, C₂-Qalkenyl, C₂-C₆alkynyl and C_rC₆haloalkyl; (ii) substituents of the same carbon atom or adjacent carbon atoms that are taken together to form Cj-Cgcycloalkyl, and (iii) substituents that are taken together with R₂ or R₃ to form a 4- to 7-membered carbocycle or heterocycle, wherein: W is CH₂, O, S or NR_!3, wherein R_]3 is hydrogen or Cj-Qalkyl; and r and p are independently chosen integers ranging from 0 to 6, such that the sum of r and p ranges from 1 to 6; each R] is independently chosen from:

(I) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl, aminosulfonyl and -COOH; (ii) CrQalkyl, C₂-C₆alkenyl, C₂-Qaikynyl, C_rC₆haIoaIkyl, C_rC₆alkyl ether, (C₃-C₈cyc!oalkyl)C₀- C₄alkyl, Ci-Cβalkoxy. Ci-C₆alkylthio, C|-C₆alkylsulfmyl. C_rC₆alkoxycarbonyl, Q- C₆aIkylsulfonylC₀-C^alkyl, mono- or di-(C]-C_όaikyl)aminoCo-C₄alkyl, mono- or di-(C]- C₆alkyl)aminosulfonylCo-C₄alkyl, and (4- to 8-membered heterocycloalkyl)Co-C₄alkyl; each of which is substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino: and

(iii) groups that are taken together with an Ri attached to an adjacent ring carbon atom to form a fused 5- to 10-membered carbocycle or heterocycle that is substituted with from 0 to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, oxo, Q- C₆alkyl, C_rC₆haloalky!, Q-Qalkoxy, Ci-C₆haloalkoxy, and mono- or di-(Ci-C6alkyf)aminoC₀- C₄alkyl; R₂ and R₃ are:

(i) independently chosen from: (a) hydrogen; and

(b) C,-C₆aϊkyl, C₂-C₆alkenyl₎ C₂-C₆alkynyl, Q-Qhaioalkyl, and (C₃-C₈cycloalky!)C₀-C₄alkyL each of which is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, amino and Ci-Qalkyl; or

(ii) taken together to form a 4- to 10-membered carbocycle or heterocycle that is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, halogen, amino and C₁- Cgalkyl; R₄ and R₅ are:

(i) independently chosen from:

(a) hydrogen; and

(b) C_rC₆aIkyi, C₂-C₆alkenyl, C_rC₆alkynyl, C,-C₆ha!oalkyl, C₂-C₆alkyl ether, mono- or di-(C_r C_caϊkyI)aminoCj-C₄alkyl, (3- to 10-membered carbocyc]e)C₀-C₄aIkyl or (4- to 10- membered heterocycle)C₀-C₄alkyi, each of which is substituted with from 0 to 6 substituents independently chosen from (1) oxo, hydroxy, cyano, halogen, amino, aminocarbonyl, aminosujfonyl, and -COOH; and (2) C i -galley 1, C]-C₆alkyl, (C₃- CgCycloalkyl)Co-C₄alkyl, Ci-Cjalkoxy, pheny!Co-C₄alky! and (5- or 6-membered heterocycle)Co-C₄alkyl, each of which is further substituted with from 0 io 4 substituents independently chosen from amino, cyano, halogen, hydroxy, Ci-C₆alkyl, (C₃- C_scycloalky])Co-C₄alkyi, Cj-Cehaloalkyl, C_rC₆aIkoxy, Cj-Q,alkoxycarbonyl, mono- or di- (CrCealky^amino, phenylC₀-C₄a[kyl and phenylCo-C₄alkoxy; or

(ii) taken together to form a 4- to 10-membered heterocycle that is substituted with from 0 to 4 substituents independently chosen from:

(a) hydroxy, oxo, cyano and amino;

(b) CrCgalkyl, C_rC₆aikoxy, mono- or di-(Ci-C₆alkyl)aminoCo-C₄a!kyl, (C₃-C_!0carbocycle)Co- C₄alkyl and (4- to 10-membered heterocycle)C₀-C₄alkyi; each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, Q-Cβalkyi, Q- Qalkoxy, (CVCιncarbocycie)Co-GialkyΙ and (4- to 10-membered heterocycle)C₀-C4aikyl.

2. A compound or salt or hydrate thereof according to claim 1. wherein Y is a group of the formula (CH₂VO-(CH₂)_P that is substituted with from 0 to 4 substituents independently chosen from amino, hydroxy, cyano, Cj-Cgalkyl, Cj-Cealkenyl, C?-C₆alkynyl, C_!-C₆hajoalkyi and substituents of the same carbon atom or adjacent carbon atoms that are taken together to form Ca-Cecycloalkyl.

3. A compound or salt or hydrate thereof according to claim 2, wherein Y is -CH₂-O- CH₂- -0-CH₂-CH₂^, -CH₂-O-CH₂-CH₂- or -CH₂-CH₂-O-CH₂-.

4. A compound or salt or hydrate thereof according to any one of claims 1-3, wherein p is not zero.

5. A compound or salt or hydrate thereof according to any one of claims 1-4, wherein B is CH.

6. A compound or salt or hydrate thereof according to any one of claims 1-4, wherein B is

N.

7. A compound or salt or hydrate thereof according to any one of claims 1-6, wherein Ar is phenyl, naphthyl, pyridyl or pyrimidinyl, each of which is substituted with from 0 to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, C_rC₆alkyi, Q-Cehaioalkyl, C₁- C₆alkoxy, and mono- or di-(Ci-Csalkyl)aminoCo-C₄alkyi.

8. A compound or salt or hydrate thereof according to any one of claims 1 -6, wherein Ar is phenyl that is substituted with from 0 to 4 substituents independently chosen from R].

9. A compound or salt or hydrate thereof according to claim 8, wherein Ar is phenyl that is substituted with 1, 2 or 3 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, CrQalkyl, Cj-C_όhaloalkyl, C_rC₆aikoxy, and mono- or di-(Cj-C₆aJkyl)aminoCo-C₄a!kyl.

10. A compound or salt or hydrate thereof according to any one of claims 1-9, wherein each substituent represented by Rj is independently chosen from halogen, hydroxy, C_rC₆aiky!, Q- C_fihaloalkyl, C_rC₆alkoxy and Cj-C₆haioaikoxy.

1 1. A compound or salt or hydrate thereof according to any one of claims 1 -10, wherein R₂ and R₃ are independently chosen from hydrogen and Cj-C₆aikyl.

12. A compound or salt or hydrate thereof according to any one of claims 1-10, wherein R₂ and R₃ are taken together to form an optionally substituted aromatic group.

13. A compound or salt or hydrate thereof according to claim 12, wherein the aromatic group is naphthyl, quinolinyl, phenyl or pyridyl.

14. A compound or salt or hydrate thereof according to any one of claims 1-10, wherein R₂ and Ri are taken together to form an optionally substituted partially or fully saturated ring.

15. A compound or salt or hydrate thereof according to claim 14, wherein the compound satisfies the formula:

wherein: X is CH₂, NR₇, O₃ S, SO or SO₂: m and q are independently 0, 1 or 2, such that the sum of m and q is 1 , 2 or 3; R₆ represents from 0 to 4 substituents independently chosen from oxo, hydroxy and C]-C₃aikyl; and R₇ is hydrogen or Cj-Cealkyl.

16. A compound or salt or hydrate thereof according to claim 15, wherein R₆ represents from 0 Io 4 substituents independently chosen from Ci-C₂alkyl.

17. A compound or salt or hydrate thereof according to claim 16, wherein R₆ represents gem-dimethyl.

18. A compound or salt or hydrate thereof according to any one of claims 1 -17, wherein the compound satisfies the formula:

wherein

represents a 4- to 7-membered, N-linked heterocycloalkyl that is substituted with from 0 to 4 substituents independently chosen from:

(i) hydroxy, oxo, cyano and amino; and

(ii) C|-C₆alkyl, Ci-Qalkoxy, mono- or dϊ-fCi-CsalkyOaminoCo-C^alkyl, (C₃-C, ₀carbocycle)C₀- C₄aikyl and (4- to 10-membered heterocyc!e)C₀-C₄alky];each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, Cj-Cβalkyl, Cp C₆alkoxy, (C₃-C ₁₀carbocycle)Co-C₄alky! and (4- to 10-rnembered heterocycle)C₀-C₄a]kyl.

19. A compound or salt or hydrate thereof according to claim 18, wherein

represents piperidine, piperazine, morpholine, thiomorpholine, imidazolidine or pyrrolidine, each of which is substituted with from 0 to 4 substituents independently chosen from: (i) hydroxy, oxo, cyano and amino; and

(ii) C_rC₆alkyl, Ci-Qalkoxy, mono- or di-(CrC₆alkyl)arnmoCo-C₄alkyL (C3-C_!0carbocycle)Co- C₄alkyl and (4- to 10-membered heterocycle)Co-C₄alkyl;each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, C,-C₆alkyL Cp C₆alkoxy, (C₃-Ci ₀carbocycle)Co-Cjalkyl and (4- to 10-membered heterocycle)C₀-C₄alkyI.

20. A compound, salt or hydrate according to claim 18, wherein the compound satisfies the formula:

wherein: n is 0, 1, 2 or 3; Z Is CR₇R₈ Or NR₉;

R₇ and Rg are independentϊy chosen from: (i) hydrogen, hydroxy and cyano; and

(ii) Ci-Qalkyl, C₂-C(ialkenyl, Ci-Ceaikynyl, C_rQalkoxy, mono- or di-(Ci-C₆alkyl)aminoCo- Qalkyl, (C₃-CgcycIoalkyl)Co-C₄aIkyl, phenylC₀-C₄alkyl, (4- to 8-membered heterocycloalkyi)Co-QaikyI and (5- or 6-membered heteroaryi)C₀-C₄alkyl, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, cyano, oxo and CVQalkyl; and

R₉ is:

(i) hydrogen; or

(ii) CrQalky], C₂-Qalkenyl, C₂-C₆alkynyl, mono- or di-(C]-Cήalkyl)aminoCi-C₄alkyl. (C₃- Cgcycloalkyl)Co-C₄alkyi. phenylCo-C₄alkyl, (4- to 8-membered heterocyc!oalkyl)C₀-C₄a!kyI and (5- or 6-membered heteroaryl)C₀-C₄alkyl, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, cyano, oxo and CpCealkyt.

21. A compound, salt or hydrate according to claim 20, wherein the compound satisfies the formula:

22. A compound, salt or hydrate according to claim 21, wherein the compound satisfies the formula:

23. A compound, salt or hydrate according to claim 20, wherein the compound satisfies the formula:

wherein R₁₀, R₁₁ and R₁₂ are independently chosen from hydrogen, halogen, hydroxy, C₁-C₆alkyI, C₁ C₆haloalkyl, C₁-C₆alkoxy and C₁-C₆haloalkoxy, such that at least one of R₁₀, R₁₁ and R₁₂ is not hydrogen.

24. A compound, salt or hydrate according to any one of claims 20-23, wherein Z is CR₇R₈.

25. A compound, salt or hydrate according to any one of claims 1-17, wherein:

R₄ is hydrogen, C₁-C₆alkyI, C₂-C₆alkenyl, C₂-C₆alkynyl, (C₃-C₈cycloalkyl)C₀-C₄ alkyl, C₂-C₆alkyl ether , or mono- or di-(C₁-C₆alkyI)aminoC₁-C₄alkyl; and R₅ is C₁-C₆alkyI. C₂-C₆alkenyl, C₂-C₆alkynyl, C₂-C₆alkyl ether, mono- or di-{C₁-C₆alkyI)amino C₁

C₄alkyl, (C₃-C₈cycloalkyl)C₀-C₄alkyl, phenylC₀-C₄alkyl, (4- to 7-membered heterocycloalkyl)C₀-

C₄alkyl or (5- or 6-membered heteroaryl)C₀-C₄alkyL each of which is substituted with from 0 to 6 substituents independently chosen from:

(i) amino, halogen, hydroxy, cyano and oxo; and

(ii) C₁-C₆alkyI, (C₃-C₈cycloalkyl)C₀-C₄alkyl , C₁C₆alkoxy, phenyIC₀-C₄alkyl and (5- or 6- membered heterocycIe)C₀-C₄alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from amino, cyano. halogen, hydroxy, C₁-C₆alkyl, (C₃-C₈cycloalkyl)C₀- C₄alkyl, C₁-C₆haloalkyl, C₁-C₆alkoxy. C₁C₆aikoxycarbonyl, mono- or di-( C₁-C₆alkyl)amino, phenyl C₀-C₄alkyl and phenylC₀-C₄alkoxy.

26. A compound or salt or hydrate thereof according to claim 25, wherein: (i) R₄ is hydrogen or Q^alkyl; and

(ii) R.₅ is mono- or di-(C;-C₆aIkyl)aminoC|-C₄alkyl₃ phenylC₀-C₄alkyl, (4- to 7-membered heterocycloa!kyl)Co-C₄alky! or (5- or 6-membered heteroary I)Co-C₄ alky], each of which is substituted with from 0 to 6 substituents independently chosen from:

(a) amino, halogen, hydroxy, cyano and oxo; and

(b) C,-C₆alkyl, (C₃-C₃cycloalkyl)C₀-Cιalky[, C,-C₆alkoxy, phenyiC₀-C₄alky! and (5- or 6- membered heterocycle)Co-C₄alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from amino, cyano, halogen, hydroxy, Ci-C₄aikyl, C]-C₄haloaikyl, Q- C₄EIkOXy, Ci-C₄a]koxycarbonyl., and mono- or di-(CrC₄alkyl)aminoCo-C₂alkyl.

27. A compound or salt or hydrate thereof according to any one of claims 1-17, wherein the compound satisfies the formula:

28. A compound or salt or hydrate thereof according to claim 27, wherein R₂ and Rj are independently chosen from:

(a) hydrogen; and

(b) C,-C₆alkyl, C₂-C₆alkenyl, C₂-C₆alkynyl, C,-C₆haloalkyl, and (C_rC_gcycloaIkyl)Co-C₄alkyl, each of which is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, amino and Ci-C₄a]ky!.

29. A compound or salt or hydrate thereof according to claim 27 or claim 28, wherein Ar is phenyl that is substituted with from 1 to 3 substituents independently chosen from halogen, hydroxy, Ci-C₆alkyl, Ci-Qhaloalkyl, C]-C₆alkoxy and Cj-C₆haloalkoxy.

30. A compound or salt or hydrate thereof according to any one of claims 27-29, wherein: (i) R₄ is hydrogen or C|-C₄alkyl: and

(ii) R₅ is mono- or di-(Ci-C_<,aIkyl)aminoCi-C₄alkyl, phenyfCo-G₄alkyl, (4- to 7-membered heterocycloalkyl)Co-C₄a!kyl or (5- or 6-membered heteroaryI)Co-C₄aikyL each of which is substituted with from 0 to 6 substituents independently chosen from:

(a) amino, halogen, hydroxy, cyano and oxo; and

(b) C_rC₆aikyL (C_rC₈cycloaikyl)Co-C₄alkyI, CpQalkoxy, phenylC₀-C₄alkyl and (5- or 6- membered heterocycle)Co-C₄alkyI, each of which is substituted with from 0 to 4 substituents independently chosen from amino, cyano, halogen, hydroxy, Ci-C₄alkyl, Ci-Gjhaloalkyl, C₁- C₄alkoxy, C_rC₄alkoxycarbonyl, and mono- or di-(C]-C₄alkyl)aminoCo-C₂alkyl.

31. A compound or salt or hydrate thereof according to any one of claims 27-29, wherein R₄ and R₅ are taken together to form piperidine, piperazine, morpholine, thiomorpholine, imidazolidine or pyrrolidine, each of which is substituted with from 0 to 4 substituents independently chosen from:

(i) hydroxy, oxo, cyano and amino; and

(ii) CpQalkyi, Ci-Qalkoxy. mono- or

(C₃-Ci ocarbocycle)C₀- C₄alkyl and (4- to 10-membered heterocycle)Co-C₄alkyl;each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, C_rC₆alkyI. Q- C₆alkoxy, (C₃-C _!0carbocycle)C₀-C₄alkyl and (4- to 10-membered heterocycle)C₀-C₄aIkyl.

32. A compound of the Formula:

or are a pharmaceutically acceptable salt or hydrate thereof, wherein: === represents a single or double bond; B is N or CH; Ar is phenyl or a 5- or 6-membered heteroaryl, each of which is unsubstituted or substituted on one or more ring carbon atoms with a substituent independently chosen from Ri;

Y is a group of the formula (CH₂VW-(CH₂)_P, which is optionally substituted and is preferably substituted with from 0 to 4 substituents independently chosen from (i) amino, hydroxy, cyano, C_r Qalkyl, C₂~Qalkenyl, C₂-C_<;alkynyl and CpC_όhaloalkyl; (ii) substituents of the same carbon atom or adjacent carbon atoms that are taken together to form Cj-Qcycloalkyl, and (iii) substituents that are taken together with R₂ or R₃ to form a 4- to 7-membered carbocycle or heterocycle, wherein: W is absent, CH₂, O, S or NR]₃, wherein Rj₃ is hydrogen or d-Qalkyl; and r and p are independently chosen integers ranging from 0 to 6, such that the sum of r and p ranges from I to 6; each Ri is independently chosen from:

(i) halogen, hydroxy, cyano, amino, nitro, aminocarbonyl. aminosulfonyl and -COOH; (ii) CpQalkyl, C₂-C₆alkenyl, C₂-C₆alkynyl, C_rC₆haloalkyl, C,-C₆alkyl ether, (C₃-Cgcycloalkyl)C₀- C₄alkyl, C_rC₆aikoxy, Ci-C₆alkylthio, Ci-Qalkylsulfmyl, Ci-C₆a]koxycarbonyl, Cj- C₆alkylsulfonylC₀-C₄alkyl, mono- or di-(C_rC₆alkyl)aminoCo-C₄alkyl, mono- or di-(C_r Qalkyl)aminosuIfonyICo-C₄alkyl, and (4- to 8-membered heterocycloalkyl)C₀-C₄alkyl; each of which is substituted with from 0 to 4 substituents independently chosen from oxo, halogen, hydroxy, cyano and amino; and (iii) groups that are taken together with an R] attached to an adjacent ring carbon atom to form a fused 5- to 10-niembered carbocycle or heterocycle that is substituted with from 0 to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, oxo, C₁- C₆alkyl, CpCehaloalkyl, CpQalkoxy, C_rC₆ha!oaIkoxy, and mono- or di-(Ci-C6aIkyI)aminoC₀- C₄alkyl;

represents a 4- to 10-membered carbocycle or heterocycle that is substituted with from 0 to 4 substituents independently chosen from oxo, hydroxy, halogen, amino and Ci-C₈alkyl; R₄ and R₅ are:

(i) independently chosen from:

(a) hydrogen; and

(b) CrQalkyl, C₂-Qalkenyl, C₂-C₆aikynyϊ, Q-C₆haloalkyi, C₂-C₆alkyl ether, mono- or di-(C,- C₆alkyl)arninoC]-C₄alkyl, (3- to 10-membered carbocycle)C₀-C₄alkyl or (4- to 10- membered heterocycle)C₀-C₄aIkyl, each of which is substituted with from 0 to 6 substituents independently chosen from (1) oxo, hydroxy, cyano, halogen, amino, aminocarbonyl, aminosulfonyi, and -COOH; and (2) C|-C₄aikyl, C_rC₆alky!, (C₃- Cgcycloalkyl)Co-C₄alkyl, C]-C₆alkoxy, phenylC₀-C₄alkyl and (5- or 6~membered heterocycle)C₀-C₄a]ky!, each of which is further substituted with from 0 to 4 substituents independently chosen from amino, cyano, halogen, hydroxy, C_rC₆alkyI, (C₃- Cgcycloalkyl)C₀-C₄alkyI, C|-C₆haloalkyl, CrCβalkoxy, C_rC₆alkoxycarbonyl, mono- or di~ (C_rC₆alkyl)amino, phenylC₀-C₄alkyl and phenylQK^alkoxy; or

(ii) taken together to form a 4- to 10-membered heterocycle that is substituted with from 0 to 4 substituents independently chosen from:

(a) hydroxy, oxo, cyano and amino;

(b) C_rC₆alkyl, Q-Qaikoxy, mono- or di-(C|-C₆alkyl)aminoCo-C₄aikyl, (C3-C_!0carbocycIe)C₀- Qalkyl and (4- to 10-membered heterocycle)Co-C₄alkyl; each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, Ci-Cgalkyl, C_r C₆alkoxy, (C₃-C]ocarbocycle)Co-C.ialkyl and (4- to 10-membered heterocycie)C₀-C₄alkyl.

33. A compound or salt or hydrate thereof according to claim 32, wherein Y is a group of the formula (CH₂)_r-O-(CH₂)_p that is substituted with from 0 to 4 substituents independently chosen from amino, hydroxy, cyano, Cj-C₆alkyl, C₂-C₆alkenyl, C₂-C₆alkynyl. Ci-C₆haloalkyl and substituents of the same carbon atom or adjacent carbon atoms that are taken together to form C₃-C₆cycloalkyl.

34. A compound or salt or hydrate thereof according to claim 33, wherein Y is -CH₂-O- CH₂- -0-CH₂-CH₂-, -CH₂-O-CH₂-CH₂- Or -CH₂-CH₂-O-CH₂-.

35. A compound or salt or hydrate thereof according to claim 32, wherein Y is a group of the formula (CH₂V(CH₂)_;, that is substituted with from 0 to 4 substituents independently chosen from amino, hydroxy, cyano, Cj-Cgalkyl,

and substituents of the same carbon atom or adjacent carbon atoms that are taken together to form CrCβcycloalkyl.

36. A compound or salt or hydrate thereof according to any one of claims 32-35, wherein B is CH.

37. A compound or salt or hydrate thereof according to any one of claims 32-35, wherein B is N.

38. A compound or sait or hydrate thereof according to any one of claims 32-37, wherein Ar is phenyl, naphthyl. pyridyl or pyrimidinyl, each of which is substituted with from 0 to 4 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro,

Q- Cghaloalkyl. Ci-C₆alkoxy, and mono- or di-(C_rC₆aIkyl)amiirtoCo-C₄alkyϊ.

39. A compound or salt or hydrate thereof according to any one of claims 32-37, wherein Ar is phenyl that is substituted with from 0 to 4 substituents independently chosen from R].

40. A compound or salt or hydrate thereof according to claim 39, wherein Ar is phenyl that is substituted with I₅ 2 or 3 substituents independently chosen from halogen, hydroxy, cyano, amino, nitro, C]-C_βalkyl, C_rC₆haloalkyl, C_rC₆alkoxy, and mono- or di-(C]-C₆alkyi)aminoCo-C₄alkyl.

41 . A compound or salt or hydrate thereof according to any one of claims 32-40, wherein each substituent represented by R_t is independently chosen from halogen, hydroxy, Cj-Cβalkyi, Cp C₆haloalkyl, C,-C₆alkoxy and Cj-Cehaloalkoxy.

42. A compound or salt or hydrate thereof according to any one of claims 32-41 , wherein

is an optionally substituted aromatic group.

43. A compound or salt or hydrate thereof according to claim 42, wherein the aromatic group is naphthyl, quinolinyl. phenyl or pyridyl.

44. A compound or salt or hydrate thereof according to any one of claims 32-41, wherein

Q ) is an optionally substituted partially or fully saturated ring.

45. A compound or salt or hydrate thereof according to claim 44, wherein the compound satisfies the formula:

wherein:

X is CH₂, NR₇. O. S, SO or SO₂; tn and q are independently O, 1 or 2, such that the sum of m and q is 1, 2 or 3;

Re represents from 0 to 4 substituents independently chosen from oxo, hydroxy and CpCgalkyl; and

R₇ is hydrogen or C_rC₆alkyl.

46. A compound or salt or hydrate thereof according to claim 45, wherein R₆ represents from 0 to 4 substituents independently chosen from C]-C₂alkyl.

47. A compound or salt or hydrate thereof according to claim 46, wherein R_<;, represents gem-dimethyl.

48. A compound or salt or hydrate thereof according to any one of claims 45-47, wherein the compound satisfies the formula:

wherein

represents a 4- to 7-membered, N-linked heterocycloalkyl that is substituted with from 0 to 4 substituents independently chosen from:

(i) hydroxy, oxo, cyano and amino; and

(ii) CrCήalkyl, Q-Qjalkoxy, mono- or di-(Ci-C6alkyl)aminoCo-Qalky!, (C₃-Ci₀carbocycle)Co- Qalkyl and (4- to 10-membered heterocycle)C₀-C₄alkyI:each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano. CpQalkyf, C,- C₆a!koxy. (C_rCiocarbocycle)Co-C₄alkyl and (4- to 10-membered heterocycle)Co-C₄alkyl.

49. A compound or salt or hydrate thereof according to claim 48, wherein

represents piperidine, piperazine. morpholine, thiomorpholiπe, imidazolidine or pyrroϋdine, each of which is substituted with from 0 to 4 substituents independently chosen from: (i) hydroxy, oxo, cyano and amino; and

(ii) C]-C₆alkyl, C_rC₆alkoxy, mono- or di-(C]-Qa1kyl)aminoCo-C₄alkyl, (C₃-Ciocarbocycle)Co- C₄alkyl and (4- to 10-membered helerocycle)Co-C₄alkyl;each of which is substituted with from 0 to 2 substituents independently chosen from hydroxy, halogen, oxo, cyano, Ci-Cealkyl, Cp Qalkoxy, (C₃-Ciocarbocycle)Co-C₄alkyl and (4- to 10-membered heterocycle)C₀-C₄alkyl.

50. A compound, salt or hydrate according to claim 48, wherein the compound satisfies the formula:

wherein: n is 0, 1 , 2 or 3; Z is CR₇R₈ or NR₉;

R₇ and R_s are independently chosen from: (i) hydrogen, hydroxy and cyano; and

(ii) Ci-Cgalkyl, Ca-Cealkenyl, Q-Csalkynyl, CpQalkoxy, mono- or di-(Cj-C₆alkyl)aminoCo- Qalkyl, (C₃-C₈cycloalkyl)Co-Qalkyl, pheny!C₀-C₄aikyl, (4- to 8-membered hetefOcycloaiky!)Co~C₄a]ky] and (5- or 6-membered heteroaryl)C₀-C₄atkyl, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, cyano, oxo and C_rC₆alkyl; and R₉ is:

(i) hydrogen; or

(ii) Ci-Qalkyl, C₂-C₆alkenyl, C₃-C₆alkynyl, mono- or di-(C_rC_fcalkyI)aminoC]-C₄a]kyl, (C₃- Cgcycloalkyl)Co-C₄alkyl, phenylCo-C₄alkyl, (4- to 8-membered heterocycloalkyOCo-Cjalkyl and (5- or 6-membered heteroaryI)Co-C₄alky!, each of which is substituted with from 0 to 3 substituents independently chosen from halogen, hydroxy, cyano, oxo and Cj-Qalkyl.

51. A compound, salt or hydrate according to claim 50, wherein the compound satisfies the formula:

52. A compound, salt or hydrate according to claim 51, wherein the compound satisfies the formula:

53. A compound, salt or hydrate according to claim 50, wherein the compound satisfies the formula:

wherein R₁₀, R₁₁ and R₁₂ are independently chosen from hydrogen, halogen, hydroxy, C₁-C₆alkyl, C₁- C₆haloalkyL C₁C₆alkoxy and C₁-C₆haloalkoxy, such that at least one of R₁₀, R₁₁ and R₁₂ is not hydrogen.

54. A compound, salt or hydrate according to any one of claims 50-53, wherein Z is CR₇R₈.

55. A compound, salt or hydrate according to any one of claims 32-47, wherein:

R₄ is hydrogen, C₁-C₆alkyI, C₂-C₆alkenyl, C₃-C₆alkynyl, (C₃-C₈cycloalkyl)C₀-C₄alkyl, C₂-C₆alkyl ether, or mono- or di-( C₁-C₆alkyl)aminoC₁C₄aIky!; and R₅ is C₁-C₆alkyl, C₂-C₆alkenyl, C₂-C₆alkynyl, C₂-C₆alkyl ether, mono- or di-( C₁-C₆alkyl)aminoC₁-

C₄alkyl, (C₃-C₈cycloalkyI)C₀-C₄alkyl, phenylC₀-C₄alkyl, (4- to 7-membered heterocycloalky I)C₀- C₄a!kyl or (5- or 6-membered heteroaryl JC₀-C₄ alky 1, each of which is substituted with from 0 to 6 substituents independently chosen from:

(i) amino, halogen, hydroxy, cyano and oxo; and

(ii) C_rC₆alkyi, (C₃-Cgcycloalky!)Co-C₄aIkyl₎ C_rC₆alkoxy, phenylC₀-C₄alkyl and (5- or 6- membered heterocyc Ie)Co- C₄ alky], each of which is substituted with from 0 to 4 substituents independently chosen from amino, cyano, halogen, hydroxy, C_t-Cβalkyl, (Cs-CscycIoalkylJCo- C₄alky], C_rC₆haIoa]kyi, Q-Qalkoxy, Ci-Cealkoxycarbonyl. mono- or di-(C_rC6alkyl)amino, phenylCo-C₄a!kyl and phenylCo-C₄alkoxy.

56. A compound or salt or hydrate thereof according to claim 55, wherein: (i) R₄ is hydrogen or CrC₄alkyI; and (ii) R₅ is mono- or di-(Ci-C₆alkyl)ammoC_rC₄aIky], phenylCo-C^alkyl, (4- to 7-membered heterocycloalkyl)Co-C₄alkyl or (5- or 6-membered heteroaryl)Co-C₄alkyl, each of which is substituted with from 0 to 6 substituents independently chosen from:

(a) amino, halogen, hydroxy, cyano and oxo; and

(b) Ci-Qalkyl (QrC_scycloalkyl)Co-C₄alkyl, Q-Qalkoxy, phenylQ-Qalkyl and (5- or 6- membered heterocycleJCo-Qalkyl, each of which is substituted with from 0 to 4 substituents independently chosen from amino, cyano, halogen, hydroxy, Cj-C₄alkyl, Ci-C₄haloalkyl, Cj- Qalkoxy. C_rC₄alkoxycarbonyl, and mono- or di-(Cj-C₄alky])aminoC₀-C₂alkyl.

57. A compound or salt or hydrate thereof according to claim 1 , wherein the compound is: l-({3-[(4-methoxy-2,6-dimethylphenyl)siilfonyl]butoxy}acetyl)-4-(3-piperidin-l-ylpropyl)piperazine; N- [4-(4, 5 -d ihydro- 1 H- imidazol-2-yl)benzy 1 ]-2- { 3 - [(4-methoxy-2 , 6- dimethylρhenyl)su]fonyl]butoxy}-N-methylacetamide; N-[4-(4,5-dihydro-] H-imida2θl-2-yl)benzyI]-2-{3-[(4-methoxy-2,6- dimethylphenyl)sulfonyl]propoxy}-N-methylacetamide; l-({3-[(4-methoxy-2,6-dimethyiphenyI)sulfonyl]propoxy}acetyl)-4-(l-methyipiperidin-4- yl)piperazine; 3-[4-({3-[(4-methoxy-2,6-dimethylphenyl)sulfonyl]propoxy}acetyl)piperazin-I-yl]-N,N- dimethylpropan-1 -amine; ] -({3-[(4-methoxy-2,6-dimethyIphenyl)su!fonyl]propoxy}acetyl)-4-(3-piperidin-l - yl propy l)pi perazin e: l-({3-[(4-methoxy-2,6-dimethylphenyi)sulfonyl]butoxy}acetyl)-4-(3-piperidin-l-ylpropyl)piperazine N-[4-(4,5-dihydro-lH-imidazol-2-yl)benzyl]-2-{3-[(4-methoxy-2,6- dimethylρhenyI)sulfony[]butoxy}-N-methyIacetamide N-[4-(4,5-dihydro-lH-imidazo]-2-yl)benzyl]-2-{3-[(4-methoxy-2,6- dimethylphenyl)suIfonyl]propoxy}-N-methyIacetamide 1 -({3-[(4-methoxy-2.6-dimethylphenyl)suIfonyl]butoxy}acetyl)-4-(3-piperidin-l-y!propyl)piperazine; N-[4-(4,5-dihydro-lH-imidazoI-2-yl)benzyl]-2-{3-[(4-methoxy-2,6- dimethylphenyl)sulfonyl]butoxy}-N-methylacetamide; N-[4-(4,5-dihydro-lH-imidazol-2-yl)ben2yl]-2-{3-[(4-methoxy-2,6- dimethy (phenyl )s u lfo ny ljpropoxy } -N -methyl acetam i d e ; l-[({2-[(4-methoxy-2,6-dimethylphenyl)su]fonyl]cyclohexy]}methoxy)acetyl]~4-(3-piperidin»l - ylpropyi)piperazine; l-[({2"[f4-methoxy-2,6-dimethyIphenyl)suifony]]cycIohexyl}methoxy)acetyI]-4-(l-methylpiperidin-

4-yl)piperazine; N-[4-(4,5-dihydiO-lH-imidazol-2-yl)benzyi]-2-({2-[(4-methoxy-2,6- dimethy!phenyI)sulfonyI]cyciohexyl}methoxy)-N-methylacetamide; N-[4-(4,5-dihydro-l H-imidazol-2-yl)benzyl]-N-ethyl-2-{3-[(4-methoxy-2,6- diniethylphenyl)sulfonyl]butoxy}acetamide; N-[4-(4,5-dihydiO-lH-imida2oi-2-yl)benzy]]-N-ethyl-2-{3-[(4-methoxy-2_s6- dimethylphenyl)suifonyl]propoxy} acetamide; or 2-({2-[(4-metlioxy-2_J6-dimethy!phenyl)sulfonyl]cyc!ohexy^{}methoxy)-N-methyl-N-[4-(l, 4,5,6- tetrahydropyrimidin-2-yl)benzyl]acetamide.

58. A compound or salt or hydrate thereof according to any one of claims 1-57, wherein the compound exhibits no detectable agonist activity an in vitro assay of Bj agonism.

59. A compound or salt or hydrate thereof according to any one of claims 1-58, wherein the compound has an ICso value of 1 micromolar or less in an in vitro assay of Bi antagonism.

60. A pharmaceutical composition, comprising at least one compound or salt or hydrate thereof according to any one of claims 1-59, in combination with a physiologically acceptable carrier or excipient.

61. A pharmaceutical composition according to claim 60, wherein the composition is formulated as an injectible fluid, an aerosol, a cream, a gel, a pill, a capsule, a syrup or a transdermal patch.

62. A method for inhibiting induction of agonist-induced Bi activity in vitro, the method comprising contacting Bi receptor with at least one compound or salt or hydrate thereof according to any one of claims 1-59, under conditions and in an amount sufficient to detectably inhibit agonist- induced B] activity.

63. A method for inhibiting induction of agonist-induced B₁ activity in a patient, comprising contacting cells expressing B₁ receptor with at least one compound or salt or hydrate thereof according to any one of claims 1-59, in an amount sufficient to detectably inhibit agonist-induced Bi activity in cells expressing a cloned B₅ receptor in vitro, and thereby inhibiting agonist-induced Bj activity in the patient.

64. A method according to claim 63, wherein the patient is a human.

65. A method for treating a condition responsive to B] receptor modulation in a patient, comprising administering to the patient a therapeutically effective amount of at least one compound or salt or hydrate thereof according to any one of claims 1-59, and thereby alleviating the condition in the patient.

66. A method according to claim 65, wherein the condition is inflammation or pain.

67. A method according to claim 65, wherein the condition is cough, asthma, vascular edema, or epilepsy.

68. A method for treating pain in a patient, comprising administering to a patient suffering from pain a therapeutically effective amount of at least one compound or salt or hydrate thereof according to any one of claims 1-59, and thereby alleviating pain in the patient.

69. A method according to claim 68, wherein the patient is suffering from inflammatory pain, acute pain, dental pain, back pain, surgical pain, headache, neuropathic pain or pain from osteoarthritis or trauma.

70. A method according to claim 68 or claim 69, wherein the patient is a human,

71. A compound or salt or hydrate thereof according to any one of claims 1-57, wherein the compound is radiolabeled.

72. A method for determining the presence or absence of B] receptor in a sample, comprising the steps of:

(a) contacting a sample with a compound or salt or hydrate thereof according to any one of claims 1-59, under conditions that permit binding of the compound to Bi receptor; and

(b) detecting a signal indicative of a level of the compound bound to Bj receptor, and therefrom determining the presence or absence of Bi receptor in the sample.

73. A method according to claim 72. wherein the compound is radiolabeled, and wherein the step of detection comprises the steps of:

(i) separating unbound compound from bound compound; and

(ii) detecting the presence or absence of bound radiolabel in the sample.

74. A packaged pharmaceutical preparation, comprising:

(a) a pharmaceutical composition according to claim 60 in a container; and

(b) instructions for using the composition to treat pain.

75. The use of a compound or salt or hydrate thereof according to any one of claims 1-59 for the manufacture of a medicament for the treatment of a condition responsive to Bi receptor modulation.

76. A use according to claim 75, wherein the condition is an inflammatory condition or pain.