WO2008001597A1 - Method for production of protein - Google Patents

Abstract

Disclosed is a method for secreting/producing a protein with high efficiency by using a coryneform bacterium. Specifically, disclosed is a method for producing a protein of interest, comprising culturing a coryneform bacterium to secrete the protein and collecting the secreted protein, wherein the coryneform bacterium is so modified as to have an enhanced serine/threonine phosphatase activity and therefore has an ability of secreting/producing the protein.

Description

 Specification

 Protein production method

 Technical field

 [0001] The present invention relates to a method for producing (producing and secreting) a target protein in a coryneform bacterium. In particular, the present invention relates to a method for secretory production of various proteins including industrially useful enzymes and physiologically active proteins in coryneform bacteria.

 Background art

 [0002] Coryneform bacteria are very useful bacteria in the fermentation industry as L-amino acid and nucleic acid-producing bacteria such as L-glutamic acid and L-lysine. Coryneform bacteria also have a simpler purification process when producing proteins that produce significantly less protein that is secreted outside the cells than mold, yeast and Bacillus bacteria, which are suitable for protein secretion. It grows quickly on simple media such as sugar, ammonia and inorganic salts, and is excellent in terms of medium cost, culture method and culture productivity, and is a very useful bacterium for protein production. It is thought that there is.

[0003] As a method for efficiently secreting and producing heterologous proteins using coryneform bacteria, nuclease lipase secretion by Corynebacterium glutamicum (hereinafter sometimes abbreviated as C. glutamicum) [USA] Patent No. 4965197, Bacteri ol., 174, 1854-1861 (1992)] and secretion of protease such as subtilisin [Non-patent document 2: Appl. Environ. Microbiol., 61, 1610-1613 (1995)], Coryne Secretion of cell surface proteins of type Bacteria [Tokuhei Hei 6-502548], secretion of fibronectin binding protein using coryneform bacteria Appl. Environ. Microbiol., 63, 4392-4400 (1997)], variant secretion Secretion method of protein using apparatus [JP-A-11-169182], secretory production of transdaltaminase [Appl. Environ. Microbiol., 69, 358-366 (2003)], transglutaminase using mutant strain Secretion production method [WO02 / 81 694] etc. In terms of the amount of protein accumulated, the alkaline protease gene derived from Dichelobacter no dosus was obtained using the promoter, ribosome binding site and signal peptide sequence of the subtilisin gene (aprE) derived from Bacillus subtilis. Expressed in C. glutamicum, Example of accumulating about 2.5 mg / ml [Appl. Environ. Microbiol., 61, 1610-1613 (1995)], and confirming that transdaltaminase secretion is a maximum of 930 mg / L. [WO02 / 81694].

 In addition, by using the secretory pathway called Tat system, industrially useful proteins such as isomaltdextranase and plotting glutaminase, which have been difficult to produce by the secretory pathway known as Sec system, have been known so far. Have been reported to be efficiently secreted [WO2005 / 103278L

[0004] A pstP gene, which is a gene encoding serine Z threonine phosphatase, has been found in Mycobacterium spp., A closely related species of coryneform bacteria. pstP forms an operon structure together with the rodA gene, pbpA gene involved in cell growth and morphogenesis, and genes pknA and pknB encoding serine / threonine kinases. RodA, PbpA force Phosphorylation by SPknA and PknB, PstP regulates cell growth and morphogenesis, PstP has the ability to dephosphorylate PbpA, PknA and PknB [WO2005 / 007880, Molecular Microbiology (2003) 4 9 (6), 1493-1508, Biochemical and Biophysical Reseach ommumcations 311 (2003) 112-120].

 [0005] In addition, it is known that an operon structure containing pstP also exists in coryneform bacteria [Molecular Microbiology (2003) 49 (6)]. As a gene having high homology with pstP in coryneform bacteria, NCgl0044 (gene name) is registered in Genbank in the genome sequence of Corynebacterium glutamicum ATCC13032 (46666..44802 of accession NC_003450.3). However, the effect of this gene on protein secretion was obvious.

 Disclosure of the invention

 [0006] An object of the present invention is to provide a method for efficiently producing a target protein in coryneform bacteria.

 More specifically, the present invention efficiently produces a target protein in a coryneform bacterium and efficiently secretes the produced target protein outside the cell (secretory production). The object is to provide a method of manufacturing.

[0007] The present inventors have provided a secretory protein production ability and a cell encoded by pstP. By culturing coryneform bacteria with enhanced phosphorus / threonine phosphatase activity, various proteins such as transglutaminase and plotting noretaminase produced in the coryneform bacteria can be efficiently secreted. The present invention was completed.

 [0008] That is, the present invention comprises culturing a coryneform bacterium modified so that serine Z threonine phosphatase activity is enhanced and imparted with the ability to produce the target protein, and recovering the secreted target protein. The present invention is also the above production method, wherein serine Z threonine phosphatase is encoded by pstP.

 In addition, the present invention is enhanced by increasing the expression of serine Z threonine phosphatase activity pstP, enhanced by increasing the copy number of pstP, or enhanced by modifying the expression control region of pstP. It is also a method for producing a target protein, comprising culturing a coryneform bacterium that has been modified to the above and imparted with the ability to produce the target protein, and recovering the secreted target protein.

 Furthermore, the present invention is also the above production method, wherein the target protein is a protein selected from the group consisting of transgnoretinase, plotting glutaminase, interferon, interleukin, insulin, IGF-1 and peptide synthesis enzyme. .

 In particular, the present invention is a gene wherein pstP encodes a protein having an amino acid sequence having at least 80% homology with the sequence shown in SEQ ID NO: 2 or 4, and having serine / threonine phosphatase activity, or The above production method is also a gene having a sequence of a nucleic acid molecule that hybridizes under stringent conditions with a nucleic acid molecule having the sequence set forth in SEQ ID NO: 1 or 3.

 BEST MODE FOR CARRYING OUT THE INVENTION

[0009] In one embodiment of the method of the present invention, the ability to secrete and produce a target protein is imparted to a coryneform bacterium modified so that serine Z threonine phosphatase activity (PstP activity) is enhanced. In another embodiment of the method of the present invention, the coryneform bacterium to which the target protein is secreted and produced is modified so that the serine / threonine phosphatase activity is enhanced. The target protein may be a secreted protein. It may be a protein that is not produced. When the protein is not secreted naturally, it can be secreted by expressing it in a form to which a signal peptide that can function in coryneform bacteria is added.

 In the present invention, a phosphatase is a protein that catalyzes the hydrolysis of phosphate esters and polyphosphates. In particular, a serine Z threonine phosphatase is a dephosphorylation of phosphorylated Ser and Thr residues in a protein. It is a protein that catalyzes oxidation (EC 3.1.3.16). The present inventors named the coryneform bacterium serine / threonine phosphatase PstP and the gene encoding the protein pstP.

 In the present specification, “modified so that serine Z threonine phosphatase activity is enhanced” means that the number of serine / threonine phosphatase (PstP) molecules per cell is increased compared to the parent strain or the wild strain. Or when the activity per serine / threonine phosphatase (PstP) molecule is increased. In addition, wild-type strains to be compared include, for example, corynebacterium 'Dartamicam (Brevibaterium' latatofamentum) ATCC13869 and ATCC13032 in the case of coryneform bacteria.

[0010] In one embodiment of the method of the present invention, a coryneform bacterium modified to enhance serine / threonine phosphatase activity encoded by pstP is used as a host vector system. An expression construct having a target protein gene secreted downstream of a signal peptide that can function in coryneform bacteria is introduced into the coryneform bacterium having enhanced phosphatase activity, whereby the gene is expressed. The target protein is produced and secreted. Either the modification for enhancing serine / threonine phosphatase activity encoded by pstP or the provision of protein production ability may be performed first.

[0011] As a gene (pstP) encoding the serine Z threonine phosphatase (PstP) of coryneform bacteria, the f-line is climbed to Genbank and the corynebacterium glutamicum (C. glutamicum) ATCC13032 NCg0044 (accession NC_003450.3 46666..448021) can be used. The nucleotide sequence of pstP of C. glutamicum ATCC13032 is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2. The nucleotide sequence of pstP of C. glutamicum ATCC1386 9 strain is shown in SEQ ID NO: 3, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 4. In the present invention, pstP may be a homologue of pstP derived from other microorganisms as long as the protein encoded thereby has serine / threonine phosphatase (PstP) activity in coryneform bacteria. The homologue of pstP can be searched by referring to the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3 using BLAST (http: 〃 blast.ge nome.jp/).

 The pstP that can be used in the present invention is a coryneform using a primer prepared based on the nucleotide arrangement 1J already disclosed, for example, SEQ ID NO: 1 or 3, such as the primers shown in SEQ ID NOs: 5 and 6. PCR method using bacterial chromosome DNA (PCR: polym erase chain reaction; see White, TJ et al, Trends Genet. 5, 185 (1989)). A region containing the control region of pstP can also be obtained, and pstP homologues of other microorganisms can be obtained in the same manner using these primer pairs.

 [0012] In addition, pstP used in the present invention is not limited to the sequence of SEQ ID NO: 1 or 3 and may be encoded because there may be differences in the nucleotide sequence of pstP depending on the strain of coryneform bacterium. As long as it has the function of PstP protein and serine / threonine phosphatase activity, substitution, deletion, insertion or addition of one or several amino acids at one or more positions in the amino acid sequence of SEQ ID NO: 2 or 4 It may be a mutant or artificially modified protein that codes for a protein having the sequence to be included. Here, “several” means a force that varies depending on the position and type of the amino acid residue protein in the three-dimensional structure. Specifically, 2 forces 20 pieces, preferably 2 forces 10 pieces, more preferably 2 to 5 pieces. It is. In addition, such amino acid substitutions, deletions, insertions, additions, or inversions may be caused by naturally occurring mutations (mutants or variants) such as those based on individual differences or species differences of microorganisms that retain pstP. It also includes those produced by.

[0013] The substitution is preferably a conservative substitution which is a neutral mutation that does not change functionally. A conservative mutation is a polar amino acid between Phe, Trp, and Tyr when the substitution site is an aromatic amino acid, and between Leu, Ile, and Val when the substitution site is a hydrophobic amino acid. In the case of G1 n and Asn, in the case of a basic amino acid, between Lys, Arg and His, in the case of an acidic amino acid, it is an amino acid having a hydroxyl group between Asp and Glu. In this case, connect between Ser and Thr. Mutations that replace each other. More specifically, conservative substitutions include substitution from Ala to Ser or Thr, substitution from Arg to Gln, His or Lys, substitution from Asn to Glu, Gln, Lys, His or Asp, Asp force Asn, Glu or Gin substitution, Cys to Ser or Ala substitution, Gin to Asn, Glu, Lys, His, Asp or Arg substitution, Glu to Gly, Asn, Gln, Lys or Asp substitution, Gly to Pro, His to Asn, Lys, Gln, Arg or Tyr, lie to Leu, Met, Val or Phe, Leu to Ile, Met, Val or Phe, Lys To Asn, Glu, Gln, His or Arg, Met to Ile, Leu, Val or Phe, Phe to TYp, Tyr, Met, lie or Leu, Ser to Thr or Ala , Thr to Ser or Ala, TYp to Phe or Tyr, Tyr to His, Phe or TYp, and Val force Met, lie or Leu. The

[0014] Further, pstP is 70% or more, preferably 80% or more, more preferably 90, with respect to the entire amino acid sequence of SEQ ID NO: 2 or 4. / o or more, more preferably 95. A nucleic acid molecule encoding a protein having a homology of / ₀ or more, particularly preferably 97% or more, particularly preferably 99% or more, and having serine / threonine phosphatase (PstP) activity can be used. As used herein, “homology” refers to the ratio of identity to the full length of the sequence, and can be calculated by BLAST, Genetyx, etc. Furthermore, since the degeneracy of the gene differs depending on the host to be introduced, at least one codon in these nucleic acid molecules can be replaced with a codon that is easy to use in the host into which pstP is introduced.

 Similarly, as long as pstP has serine / threonine phosphatase activity, it may be an N-terminal side or C-terminal side extended or shortened. For example, the length to be extended or shortened is 50 or less, preferably 20 or less, more preferably 10 or less, and particularly preferably 5 or less in amino acid residues. More specifically, the amino acid sequence of SEQ ID NO: 2 or 4 may be shortened by 5 amino acids from the N-terminal side of 50 amino acids and 5 amino acids from the C-terminal side of 50 amino acids.

[0015] Such a gene homologous to pstP is identified by SEQ ID NO: such that the amino acid residue at a specific site of the encoded protein includes substitution, deletion, insertion or addition, for example, by site-directed mutagenesis. It can be obtained by modifying the nucleotide sequence of 1 or SEQ ID NO: 3. It can also be obtained by a conventionally known mutation treatment as follows. . Mutation treatment includes in vitro treatment of the above nucleotide sequence with hydroxynoreamine or the like, and microorganisms carrying the gene, such as coryneform bacteria, with ultraviolet light or N-methyl-N, -nitro-N-nitrosoguanidine. (NTG) or ethyl methane sulfonate (E MS), etc., which are usually used for mutagenesis, are treated with mutagens, erlapron PCR, DNA shuffling, StEP_PCR, It is possible to artificially introduce a mutation into pstP to obtain pstP encoding highly active PstP (Firth AE, Patrick WMj Bioinformatics. 2005 Jun 2; Statistics of protein library construction.). Whether or not these pstP homologous genes encode serine Z threonine phosphatase can be confirmed, for example, by measuring the enzyme activity by the method described above.

 [0016] pstP is a sequence complementary to SEQ ID NO: 1 or 3 or a probe that can be prepared from these sequences under a stringent condition and encodes a protein having phosphotransferase activity. DNA to do. Here, the “stringent condition” refers to a condition in which a so-called specific hybrid is formed and a non-specific hybrid is not formed. “Stringent conditions” refers to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. For example, DNAs having high homology, for example, DNAs having 80, 90, 95, 97, or 99% or more homology are hybridized, and DNAs having lower homology are not hybridized. Alternatively, the normal Southern hybridization s washing conditions are 60 ° C, lxS SC, 0.1% SDS, preferably 0.1xSSC, 0.1% SDS, more preferably 68. C, O.lxSS

C, salt concentration and temperature corresponding to 0.1% SDS, conditions of washing once, more preferably 2-3 times.

[0017] A partial sequence of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3 can also be used as a probe. Such a probe can be prepared by PCR using an oligonucleotide prepared based on the nucleotide sequence as a primer and a DNA fragment containing the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence of SEQ ID NO: 3 as a saddle. it can. For example, when a DNA fragment having a length of about 300 bp is used as a probe, the conditions for washing the hybridization include 50 ° C., 2 × SSC, and 0.1% SDS. [0018] As used herein, "secretion" of a protein or peptide means that the protein or peptide molecule is transferred outside the bacterial cell (extracellular). This includes not only the case where the protein or peptide molecule is completely free in the medium, but also the case where only a part of the protein or peptide molecule is present outside the cell or the surface of the cell. It is known that secreted proteins are generally translated as pre-peptides or pre-mouth peptides and then become mature proteins. That is, generally, after being translated as a prepeptide or prepeptide, the signal peptide (“pre-part”) is cleaved and converted to a mature peptide or propeptide, which is further cleaved by the protease. It is known to become a mature peptide. In the present specification, “signal distribution lj” refers to a sequence that exists at the N-terminus of a secretory protein precursor and does not exist in a natural mature protein, and “signal peptide” Such protein precursor force refers to a peptide that is cleaved off. In general, a signal sequence is cleaved by a protease (generally called a signal peptidase) with secretion outside the cell. Such a signal peptide has certain common sequence characteristics across species, but a signal peptide that exhibits a secretory function in one species does not necessarily exhibit a secretory function in another species. .

[0019] In the present specification, a protein having both a signal peptide and a pro moiety, that is, a primary translation product may be referred to as a "preb mouth protein", and a protein that does not have a signal peptide but has a pro moiety. Sometimes referred to as “proprotein”. The pro-pro part of a pro-protein is sometimes referred to as the “pro-structure part” or simply “pro-structure”, and the “pro-structure part / pro-structure” of the protein and the “pro part” of the protein are used interchangeably herein. Is done. In the preproprotein or preprotein, the signal peptide may be derived from a different protein or may be a signal peptide naturally present in the target protein, but it may be a secreted protein of the host used. It is preferable to derive from. Or you may modify | change so that it may have an optimal codon according to the codon usage frequency of the host to be used. Furthermore, the signal peptide that can be used for the purpose of the present invention may contain a part of the N-terminal amino acid sequence of the natural mature protein from which it is derived. Preb if the signal peptide is derived from a different protein Oral proteins are sometimes referred to specifically as “heterologous preb oral proteins”. As described above, in the present invention, the target protein may be a secreted protein or a protein that is not secreted in nature. When the protein is not secreted naturally, it can be expressed in a form in which the above-mentioned signal peptide is attached when the protein is expressed. Even if it is an intrinsically secreted protein, the natural signal peptide and / or pro-structure may be replaced with a heterologous signal peptide and / or hetero-pro-structure as described above. In addition, this target protein has a plug structure.

 [0020] For example, when the target protein is a plotting glutaminase, they are referred to as “preb mouth plotting lutaminase”, “proproteing lutaminase” and “heterologous fusion pretaminuta lutaminase”, respectively. A “pro-part cleaved protein” refers to a protein in which at least one amino acid constituting the pro part has been removed by cleaving the peptide bond, and the N-terminal region of the protein is a natural mature protein. And a mature protein that has one or more extra amino acids derived from the pro moiety at the N-terminus as compared to a natural protein, as long as it has the activity of the protein. Proteins with shorter amino acid sequences are also included. Any of the above-mentioned forms of plotting rutaminase can be secreted and produced efficiently according to the present invention.

 [0021] The coryneform bacterium referred to in the present invention is an aerobic Gram-positive gonococcus and includes a bacterium that has been conventionally classified into the genus Brevibaterium but is now integrated into the genus Corynebatarum (Int. J. Syst. Bacteriol., 41, 255 (1981)), and Brevibaterium bacterium belonging to the genus Corynebataterium. The advantage of using coryneform bacteria is that there are very few proteins that are inherently extracted outside the fungus compared to fungi, yeast and Bacillus bacteria that have been suitable for protein secretion so far. When the target protein is secreted and produced, its purification process can be simplified and omitted, and because it grows easily on a simple medium containing sugar, ammonia, inorganic salts, etc., the medium cost, culture method, and culture productivity It is included that is superior. Examples of such coryneform bacteria include the following.

[0022] Corynebataterum 'acetoside filam, Corynebatarum, Acetoglutamicum,

 Coryne Batterium 'Al Force Nority Cam,

 Coryne Batterium, Karnaye,

 Corynebatterium, Dartamicam,

 Corynebatterium, Lilium,

 Coryne Batterium 'Merase Cola,

 Corynebatterium, Thermoaminogenes,

 Corynebatterium

 Brevibaterium, Divarikatam,

 Brevibaterium, Flabum,

 Brevibaterium, Mario Filam,

 Brevibaterium, Ratatofamentum,

 Brevibaterium, Rosem,

 Brevibacterium * saccharity cam,

 Brevibaterium.

 Corynebatterium, ammoniagenes,

 Brevibaterium album,

 Brevibaterium, Selinum,

 Microbatterium · Ammonia film.

 Specifically, the following strains can be exemplified. Corynebatarum.acetoglutamicum ATCC15806,

 Coryne Batterium 'Al Force Nority Cam ATCC21511,

 Coryne Batterium 'Karnaye ATCC15991,

 Corynebaterium 'Glutamicum ATCC13020, ATCC13032, ATCC13060, ATCC13 869, FERM BP-734,

 Corynebatterium Lilium ATCC 15990,

Coryne Batterium 'Merase Cola ATCC17965, Corynebatterium 'Etsuhuience AJ12340 (FERM BP_1539),

 Corynebatterium Herkiuris ATCC 13868,

 Brevibaterium Divivacatam ATCC14020,

 Brevibaterium Flavum ATCC13826, ATCC14067, AJ12418 (FERM BP-2205) Brevibaterium Inmariophyllum ATCC14068,

 Brevibaterium 'Ratatofmentum ATCC 13869,

 Brevibaterium 'Rozeum ATCC13825,

 Brevibaterium, Saccharolytic Cam ATCC14066,

 Brevibaterium, Chageni Talis ATCC 19240,

 Corynebatarum 'Ammonia Genes ATCC6871, ATCC6872,

 Brevibaterium 'Album ATCC15111,

 Brevibaterium 'Serineum ATCC 15112,

 Microbatterium. Ammonia phyllus ATCC15354.

 You can get them from, for example, an American 'type' culture 'collection. In other words, a corresponding registration number is assigned to each strain. This registration number is described in the catalog of the American 'Type' Culture 'collection, and each strain can be sold with reference to this number.

 In particular, corynebacterium glutamicum AJ12036 (FERM BP-734) isolated from the wild strain Corynebacterium glutamicum AT CC13869 as a streptomycin (Sm) -resistant mutant strain. (Now deposit) (National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center, Tsukuba Sakai Higashi, Japan 11-1 1 1 1st, 6th, ZIP code 305-8566) compared to its parent strain (wild strain) It is predicted that there will be mutations in the functional genes involved in secretion, and the protein production capacity for secretion is extremely high, about 2 to 3 times as the amount accumulated under optimal culture conditions. / 081694).

Furthermore, if a strain modified so as not to produce cell surface proteins from such a strain is used as a host, the target protein secreted into the medium can be easily purified. Is preferable. Such modification can be performed by introducing a mutation into a cell surface protein on the chromosome or its expression regulatory region by mutation or gene recombination. Examples of coryneform bacteria modified so as not to produce cell surface proteins include Corynebacterium glutamicum (C. glutamicum) YDK010 strain, which is a cell surface protein (PS2) disruption strain of AJ12 036 (International Publication Pamphlet WO 01 / 23591).

[0025] The coryneform bacterium imparted with the ability to produce the target protein used in the present invention introduces, for example, a gene construct containing a nucleic acid encoding the target protein into the coryneform bacterium described above. Can be obtained. Here, a gene construct for conferring protein production ability to coryneform bacteria generally includes a promoter, a sequence encoding an appropriate signal peptide and a nucleic acid fragment encoding a target protein, and a coryneform bacterium. In addition, control sequences (operators, terminators, etc.) necessary for expressing the target protein gene are placed at appropriate positions so that they can function. The target protein may have a prostructure at the N-terminus. The vector that can be used for this construct is not particularly limited, and it can be integrated into the bacterial chromosome even if it can grow autonomously outside the chromosome, such as a plasmid, as long as it can function in coryneform bacteria. It may be. Examples of such include PAM330 (Japanese Unexamined Patent Publication No. 58-067699), pHM1519 (Japanese Unexamined Patent Publication No. 58-77895), and pSFK6 (Japanese Unexamined Patent Publication No. 2000-262288). In addition, DNA fragments capable of autonomously replicating plasmids in coryneform bacteria can be taken out of these vectors and inserted into the E. coli vector to be used as so-called shuttle vectors that can replicate in both E. coli and coryneform bacteria. To do. Artificial transposons can also be used. When a transposon is used, the target gene is introduced into the chromosome by homologous recombination or its own ability to transfer.

[0026] The promoter that can be used in the present invention is not particularly limited, and any promoter can be used as long as it can function in the cells of coryneform bacteria. It can be a promoter from E.coli). Among them, a strong promoter such as tac promoter is more preferable. Examples of promoters derived from coryneform bacteria include promoters of cell surface proteins PS1, PS2, and SlpA, Amino acid biosynthetic system, for example, glutaremic acid biosynthetic glutamate dehydrogenase gene, gnoretamine synthesizing glutamine synthase gene, lysine biosynthetic aspartokinase gene, threonine biosynthetic homoserine dehydrogenase gene, isoleucine And palin biosynthetic acetohydroxy acid synthase gene, leucine biosynthetic 2-isopropylmethyl malate synthase gene, proline and arginine biosynthetic gnoretamic acid kinase gene, histidine biosynthetic phosphoribosyl-ATP pyrone In the nucleic acid biosynthesis system such as phosphorylase gene, deoxyarabinohepturonic acid phosphate (DAHP) synthase gene of aromatic amino acid biosynthetic system such as tryptophan, tyrosine and phenylalanin, inosinic acid and guanylic acid Phosphoribosi Pyrophosphate (PRPP) amide trans luciferase gene, include the promoters inosinate dehydrogenase gene and Guaniru synthase gene.

 [0027] The signal peptide used in the present invention is not particularly limited as long as it is a signal peptide that can function in the cells of coryneform bacteria, and any signal peptide that can function in the cells of coryneform bacteria should be used. Can do. Therefore, a signal peptide derived from a different species, for example, E. coli or Bacillus subtilis, can be used in the present invention as long as it can function in the cells of coryneform bacteria. A part of the N-terminal amino acid sequence of the secretory protein from which it is derived is added to the signal peptide. Signal binding IJ is cleaved by signal peptidase when the translation product is secreted outside the cell. The gene encoding the signal peptide can be used in its natural form, but may be modified so as to have an optimal codon according to the codon usage frequency of the host to be used. When using these signal peptides, the gene that encodes the target protein is connected to the 3'-terminal side of the gene that encodes the signal peptide, and the expression is controlled by the promoter. To do.

 [0028] The target protein that can be produced and secreted by the present invention is not particularly limited, and includes all proteins including intracellular proteins derived from animals and plants and microorganisms, and even proteins derived from coryneform bacteria serving as hosts. Even a heterogeneous protein can be used. Examples of proteins that can be secreted and produced according to the present invention include:

Transglutaminase (EC 2.3.2.13; Genbank Accession No., etc.); Plotting noretaminase (EC 3.5.1; Genbank Accession No. BAB21508, Eur. J. Biochem. 268. 1410-1421 (2001) etc.);

Interferon (Genbank Accession No. CAA23802 etc.);

Interleukin 2 (IL2: Genbank Accession No. AAK26665 etc., mature type 21-: amino acid sequence at position 153);

Insulin (JP 07-284394 A, etc.);

 IGF-1 (insulin-like growth factor 1: Genbank Accession No. CAA01954 etc.); peptide synthase (WO 2004/011653, WO2004 / 065610);

 The genes encoding these proteins can be modified depending on the host used and Z or to obtain the desired activity, including the addition, deletion, substitution, etc. of one or more amino acids. It is. If necessary, it may be converted to an optimal codon according to the frequency of codon usage of the host. Such general molecular biology techniques, including modification techniques, gene cloning techniques, and production protein detection techniques, are well known to those skilled in the art, for example, Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Third Edition (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, DNA cloning: A Practical Approach, Volumes I and II (DN Glover ed. 198 5), FM Ausubel et al (eds), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994), PCR Technology: Principles and Application for DNA Amplificatio, H. Erlich, ed., Stockton Press, and the like.

The method for introducing a gene construct that can be used in the present invention into coryneform bacteria is not particularly limited, and a commonly used method such as the protoplast method (Gene, 39, 281-286 (1985), the electoral position method ( Bio / Technology, 7, 1067_1070) (1989)), etc. The resulting gene-transformed transformant can be cultivated according to commonly used methods and conditions. It can be cultured in a normal medium containing a carbon source, nitrogen source, and inorganic ions, and organic micronutrients such as vitamins and amino acids can be added as needed to achieve higher growth. Can use carbohydrates such as glucose and sucrose, organic acids such as acetic acid, alcohols, etc. As the nitrogen source, ammonia gas, ammonia , Anmoniu Mus salt and others can be used. As inorganic ions, calcium ions, magnesium ions, phosphate ions, potassium ions, iron ions, and the like can be appropriately used as necessary. Cultivation may be carried out under aerobic conditions in a suitable range of pH 5.0 to 8.5 and 15 ° C. to 37 ° C. The culture period may be:! To 7 days. By culturing the transformant under such conditions, the target protein is produced in a large amount in the microbial cell and efficiently secreted outside the microbial cell.

 [0030] As described above, the coryneform bacterium imparted with the ability to produce and secrete the target protein is modified so that serine / threonine phosphatase activity is enhanced, or modified in advance so that serine / threonine phosphatase activity is enhanced. By imparting the ability to secrete and produce the target protein to the coryneform bacterium, the coryneform bacterium used for the production of the protein by the method of the present invention can be obtained.

 [0031] An example of a method for constructing a coryneform bacterium modified so as to increase serine Z threonine phosphatase (PstP) activity is shown below. These methods can be performed according to a manual such as Molecular cloning (Cold spring Harbor Laboratory Press, Cold Spring Harbor (USA), 2001). Other microorganisms can be similarly modified to increase serine / threonine phosphatase activity.

Modifications that enhance serine / threonine phosphatase activity can be achieved, for example, by enhancing the expression level of pstP. Enhancement of the expression level of pstP is achieved, for example, by increasing the copy number of pstP. More specifically, a fragment containing pstP is ligated with a vector that functions in a coryneform bacterium, preferably a multicopy vector, to produce a recombinant DNA, which has the ability to produce L amino acids as described above. It may be introduced into a microorganism and transformed. Alternatively, the recombinant DNA may be introduced into a wild-type microorganism to obtain a transformed strain, and then the protein-producing ability may be imparted to the transformed strain. An increase in the number of copies can also be achieved by transferring one or more copies of the pstP-encoding fragment onto the chromosome. Confirmation of transfer of pstP on the chromosome can be confirmed by Southern hybridization using a part of pstP as a probe. Furthermore, enhancement of pstP expression can also be achieved by modifying the expression regulatory region of pstP. For example, it can be achieved by replacing the promoter sequence of pstP with a stronger promoter, or bringing the promoter sequence closer to consensus (International Publication No. WO00). / 18935 pamphlet).

[0032] In one embodiment of the present invention, enhancement of the expression level of pstP is achieved by increasing the copy number of pstP. Increasing the copy number can be achieved, for example, by amplifying pstP with a plasmid as follows. First, pstP is cloned from the chromosome of a coryneform bacterium. Chromosomal DNA is derived from bacteria that are DNA donors, for example, the method of Saito and Miura (H. Saito and K. Miura, Biochem. Biophys. Acta, 72, 619 (1963), Biological Experiments, Japan. Ability to prepare according to the Biotechnology Society, pages 97-98, Bafukan, 1992). Oligonucleotides used for PCR can be synthesized based on the above known information. For example, pstP can be amplified using synthetic oligonucleotides described in SEQ ID NOs: 5 and 6.

 The gene fragment containing pstP amplified by the PCR method is connected to a vector DNA capable of autonomous replication in cells of coryneform bacteria to prepare a recombinant DNA, which is introduced into Escherichia coli. The operation becomes difficult. Examples of vectors capable of autonomous replication in Escherichia coli cells include pUC19, pUC18, pHSG299, pHSG399, pHSG398, RSF1010, pBR322, pACYC184, and pMW219.

[0033] The DNA is introduced into a vector that can function in coryneform bacteria. The vector that functions in coryneform bacteria is, for example, a plasmid that can autonomously replicate in coryneform bacteria. Specifically, as a plasmid capable of autonomous replication in coryneform bacteria, for example, plasmid pCRY30 described in JP-A-3-210184; JP-A-2-72876 and US Pat. No. 5,185, Plasmids pCRY21, pCRY2KE, pCRY2KX, pCRY31, pCRY3KE and PCRY3KX described in JP-A No. 62; plasmids pCRY2 and pCRY3 described in JP-A 1-191686; pAM330 described in JP-A-58-67679; PHM1519 described in Kokai 58-77895; pAJ655, pAJ611 and pAJ1844 described in JP-A-58-192900; pCGl described in JP-A-57-134500; JP-A-58-35197 PCG2 described in JP-A-10-215883, such as PCG4 and pCGll described in JP-A-57-183799, and the like.

[0034] In order to prepare a recombinant DNA by ligating a vector that functions in pstP and coryneform bacteria, the vector can be cleaved with a restriction enzyme that matches the end of pstP. This restriction enzyme part The position is introduced in advance into a synthetic oligonucleotide used for pstP amplification. Ligation can be performed using a ligase such as T4 DNA ligase.

 In order to introduce the recombinant plasmid prepared as described above into a coryneform bacterium, transformation methods that have been reported so far may be used. For example, a method to increase DNA permeability by treating recipient cells with calcium chloride, as reported in Escherichia coli K-12 strain (Mandel, M. and Higa, AJ Mol. Biol, 53, 159 (1970)), and a method for introducing DNA by preparing a competent cell from proliferating cells, as reported for B. noles subtilis (Duncan, CH, Wilson). GAand Young, FE, Gene, 1, 153 (1977)). Alternatively, DNA-receptive cells, such as those known for Bacillus subtilis, actinomycetes, and yeast, can be put into a protoplast or a squirrel-mouth plast that readily incorporates recombinant DNA into the recombinant DNA. (Chang, S. and Choen, SN, Mol. Gen. Genet., 168, lll (1979); Bibb, MJ, Ward, JMandHopwood, OA, Nature, 274, 398 (1978); Hinnen, A., Hicks JBand Fink, GR, Proc. Natl. Acad. Sci. USA, 75 1929 (1978)). Coryneform bacteria can also be transformed by the electric pulse method (Japanese Patent Laid-Open No. 2-207791) and the junction transfer method (Biotechnology (NY). 1991 Jan; 9 (l): 84_7).

[0035] Increasing the copy number of pstP can also be achieved by having multiple copies of pstP on the chromosomal DNA of coryneform bacteria. In order to introduce multiple copies of pstP into the chromosomal DNA of coryneform bacteria, homologous recombination is carried out using the sequence present in the chromosomal DNA as a target. As a sequence present in multiple copies on chromosomal DNA, a repetitive DNA or an inverted 'repeat present at the end of a transposable element can be used. Alternatively, as disclosed in Japanese Patent Application Laid-Open No. 2-109985, it is possible to mount pstP on a transposon, transfer it, and introduce multiple copies onto chromosomal DNA. (JP-A-2-109985, JP-A-7-107976, Mol. Gen. Genet., 245, 397-405 (1994), Plasmid. 2000 Nov; 44 (3): 285-91) ₀

[0036] In addition, a method in which pstP is introduced into a replication origin that cannot replicate in the host, or a plasmid that has the ability to transfer the junction to the host and the replication origin that cannot replicate in the host, and is amplified on the chromosome can also be applied. For example, the vector that can be used is pSUP301 (Simo et al., Bio / Technol ogy 1, 784-791 (1983)), pK18mob or pK19mob (Schaefer et al., Gene 145, 69-73 (1994)), pGEM-T (Promega corporation, Madison, WI, USA), pCR2.1-TOPO (Shu man (1994) .Journal of Biological Chemisty 269: 32678-84; US-A 5487993), pCR ( ^R ) Blunt (Invitrogen, Groningen, Netherlands; Bernard et al, Journal of Molecular Biolog, 234: 534-541 (1993) )), PEMl (Schrumpf et al., 1991, Journal of Bacteriology 173: 4510-4516) or pBGS8 (spratt et al., 1986, Gene, 41: 337-342). The plasmid vector containing pstP is transferred into a coryneform bacterium by conjugation or transformation. Joining methods are described, for example, in Schaefer et al. (Applied and Environmental Microbiology 60, 756-759 (1994)). Transformation methods are described in, for example, Theirbach et al. (Applied Microbiology and Biotechnology 29, 356-362 (1988)), Dunican and Shivinan (Bio / Technology 7, 1067-1070 (1989)) and Tauch et al. (FEMS Microbiological Letters 123, 3 43-347 (1994)).

[0037] In addition, as a means for increasing the activity of pstP, substitution of an expression control sequence such as a promoter of pstP on a chromosomal DNA or plasmid with a strong one, factors involved in pstP expression control, such as an operator It can also be achieved by modifying the repressor and connecting a strong terminator. (Hamilton et al ,; Journal of Bacterology 71: 4617-4622) For example, lac promoter, t 卬 promoter, trc promoter, PS2 promoter and the like are known as strong promoters. Methods for evaluating promoter strength and examples of strong promoters are described in Goldstein et al. (Prokaryotic promoters in biotechnology. Biotechnol. Annu. Rev., 1995, 1, 105-128). In addition, as disclosed in International Publication WO00 / 18935, it is also possible to introduce a base substitution of several bases into the promoter region of the target gene, replace it with a sequence closer to consensus, and modify it to a stronger one. is there. For example, it is conceivable to replace the _35 region with TTGACA and TTGCCA array 1J and replace 10 regions with TATAAT and TATAAC sequences. In addition, it greatly affects the translation efficiency of the spacer between the ribosome binding site (RBS) and the start codon, especially the substitution of several nucleotides in the sequence immediately upstream of the start codon. Are known and can be modified.

[0038] Expression control sequences such as promoters upstream of pstP are used as promoter search vectors and GENs. It can also be determined using genetic analysis software such as ETYX. These promoter substitutions or modifications enhance pstP expression. The substitution of the expression regulatory sequence can be performed using, for example, a temperature sensitive plasmid. The modification of the expression regulatory sequence may be combined with increasing the number of pstP copies.

 An increase in the expression level can also be achieved by prolonging the survival time of m-RNA or preventing degradation of the enzyme protein in the cell.

[0039] The enhanced serine / threonine phosphatase (PstP) activity is known in the art, for example, the method described by Boitel et al. (Brigitte Boitel, Miguel Ortiz-Lombardia, Rosario Duran, Frederique Pompeo, Stewart T. Cole , Carlos Cervenansky and Pedro M. Alzari (2003) Molecular Microbiology. 49 (6), 1493-1508), and can be confirmed by measuring the PstP enzyme activity and comparing it with the wild type or unmodified strain. Confirmation that serine / threonine phosphatase (PstP) activity was enhanced was compared to the wild-type or unmodified strain in the amount of m-RNA of the gene encoding serine Z-threonine phosphatase (PstP). This can also be confirmed. As a method for confirming the expression level, Northern hybridase ~~ Cillon, RT-P and R force, (Molecular cloning (Cold spring Harbor Laboratory Press, Cold spring Harbor (USA), 2001)) _{o In the} present invention The enhanced serine / threonine phosphatase (PstP) activity or expression level can be any activity or expression level as long as it is statistically significantly higher than that of the wild-type or non-modified strain. . According to the present invention, the serine / threonine phosphatase (PstP) activity is increased by 1.5 times or more, more preferably by 2 times or more, and even more preferably by 3 times or more compared to the wild type strain or the unmodified strain.

[0040] The protein secreted into the medium according to the present invention can be separated and purified from the cultured medium according to a method well known to those skilled in the art. For example, after removing cells by centrifugation, etc., salting out, ethanol precipitation, ultrafiltration, gel filtration chromatography, ion exchange column chromatography, affinity chromatography, medium to high pressure liquid chromatography, reverse phase chromatography Separation and purification can be performed by known appropriate methods such as chromatography and hydrophobic chromatography, or a combination thereof. Proteins secreted into the cell surface by the present invention are also well known to those skilled in the art, for example, increasing the salt concentration, After solubilization by use of a surfactant or the like, separation and purification can be performed in the same manner as when secreted into the medium. In some cases, the protein secreted to the surface of the bacterial cell may be used as, for example, an immobilized enzyme without solubilizing the protein.

 The invention is further illustrated by the following examples, which should not be construed as limiting the invention in any way.

 Example

Example 1. Cloning of phosphatase gene ostP from C glutamicum ATCC13869 and amplification of ostP on secretory cow

(1) Cloning of pstP of C. glutamicum ATCC13869

 The genomic sequence of C. glutamicum ATCC13032 has already been determined [Eur. J. Biochem., 257, 570-576 (1998)]. With reference to this sequence, the primers shown in SEQ ID NO: 5 and SEQ ID NO: 6 were synthesized and prepared according to a conventional method (Saito, Miura method [Biochim. Biophys. Acta, 72, 619 (1963)]). A region encoding pstP was amplified by PCR from the chromosomal DNA of C. glutamicum ATCC13869. Pyrobest DNA polymerase (Takara Shuzo) was used for the PCR reaction, and the reaction conditions followed the protocol recommended by the manufacturer. The sequence of SEQ ID NO: 5 contains the recognition sequence of the restriction enzyme Pstl, and the sequence of SEQ ID NO: 6 contains the sequence of the restriction enzyme EcoRI. (SEQ ID NO: 5) 5'- CACGGATATCCGTACTGCAGGTACAACAGT -3 '

(SEQ ID NO: 6) 5'-CACATTTCCGTGCGGCGAATTCTTAATCGT -3 '

<Sequence Listing Free Text>

 SEQ ID NOs: 5, 6: PCR primers

Next, the amplified DNA fragment was digested with Pstl and EcoRI, and a fragment of about 1.4 kb was recovered by agarose gel electrophoresis using EASYTRAP Ver.2 (Takara Shuzo Co., Ltd.). This was recovered by pVC7 described in JP-A-9-070291. It was inserted into the Pstl and EcoRI sites of a shuttle vector that can replicate in both E. coli and coryneform bacteria, and then introduced into the Escherichia coli JM109 (Takara Shuzo Co.) cell. A strain carrying the plasmid in which the pstP fragment was cloned was obtained, from which the plasmid was recovered and named pVpstP. The nucleotide sequence of the fragment cloned in pVpstP is the DNA Terminator Cycle Sequencing Kit (PE Applied Biosystems) and DNA Sequencer 377A (PE Applied Biosystems). Determined by the As a result of nucleotide sequencing, it was found that the nucleotide sequence of pstP of C. glutamicum A TCC13869 obtained was partially different from the nucleotide sequence of pstP of C. glutamicum ATCC13032. The nucleotide sequence of pstP derived from C. glutamicum ATCC13869 is shown in SEQ ID NO: 3, and the entire amino acid sequence encoded is shown in SEQ ID NO: 4. Further, the nucleotide sequence of pstP of C. efficiens YS-314 is shown in SEQ ID NO: 7, and the entire amino acid sequence encoded is shown in SEQ ID NO: 8. Figure 3 shows the alignment of these amino acid sequences. Thus, the sequence of pstP is well conserved among coryneform bacteria. The homology between ATC C13032 and ATCC13869 is 99.8% of the total amino acid sequence, and the homology between ATCC1 3032 and ATCC13869 and YS-314. One was 72.3% of the total length of the amino acid sequence. Alignment creation and homology calculation were performed using Genetyx_Version7 (Genetics).

(2) Effects of pstP amplification on protein secretion production in C. glutamicum ATCC13869

Example 1 Using the plasmid pVpstP constructed in (1), the C. glutamicum ATCC13869 and glutamicum ATCC13869 streptomycin (sm) resistant mutant AJ12036 cell surface protein (PS2) disruption strain YDK010 strain (WO 01/23591 CM2G agar medium containing 5 mg / 1 chloramphenicol (yeast extratate 10 g, tryptone 10 g, glucose 5 g, NaCl 5 g, DL_methionine 0.2 g, agar 20 g, water 1 U) ) Was selected. Next, using these transformants and pVC7 introduced into C. glutamicum A TCC13869 and YDK010 as controls, the production of proteins secreted into the culture supernatant was compared and evaluated. Strains grown at 30 ° C on the above CM2G agar medium containing 5 mg / l chloramphenicol were grown in MMTG liquid medium (glucose 60 g, magnesium sulfate heptahydrate 3 g, ammonium sulfate 30 g, potassium dihydrogen phosphate 1.5 g, iron sulfate heptahydrate 0.03 g, manganese sulfate tetrahydrate 0.03 g, thiamine hydrochloride 0.45 mg, piotin 0.45 mg, DL-methionine 0.15 g, calcium carbonate 50 g, 1 L with water to pH 7.5 In a large test tube containing 4 ml of medium supplemented with chloramphenicol 5 mg / l, the cells were cultured at 30 ° C for 48 hours. The amount of protein in the culture supernatant after culturing was quantified using Protein Assay CBB Solution (manufactured by Nacalai Testa). Measurement conditions The matter followed the protocol recommended by the vendor. As a result, in both C. glutamicum ATCC13869 and YDK010, the amount of total protein secreted in the culture supernatant of transformed YDK010 was increased by about 1.2 times by having pVpstP compared to the control. Tables 1 and 2 show the relative ratios of secretion with pVC7 as a control.

 Table 1. Effect of pstP amplification on protein production of C. glutamicum ATCC13869 Plasmid protein secretion (mg / 1) Relative ratio

 pVC7 8 1 .6 1 .0 pVpstP 9 7 .6 1 .2

[0044] Table 2. Effect of pstP amplification on protein secretion of C. glutamicum YDKOIO

 Plus protein secretion (mg / 1) Relative ratio

 pVC7 1 2 8 .9 0 pVpstP 1 5 4. 3 2

[0045] Example 2. Amplifying effect of DstP on the secretory cow producing the target protein in C glutamicum

(1) Secretory production of protransglutaminase using pstP amplified strain of C. glutamicum ATCC13869

Example 1 Using the plasmid pVpstP constructed in (1), the Sec system secretion signal sequence described in WO01 / 23591 has a pro-structured transgnoreminase-expressing plasmid pPKSPTGl having a CspA signal sequence. C. glutamicum ATCC13869 And YDKOIO were transformed, and a strain grown on the CM2G agar medium containing 5 mg / l chloramphenicol and 25 mg / l kanamycin was selected. Next, these transformants were compared with those obtained by introducing pVC7 and pPKSPTG1 into C. glutamicum ATCC13869 and YDKOIO, and evaluated by comparison with the amount of secretory production. Add 5 mg / l chloramphenicol and 25 mg / l kanamycin to the above MMTG liquid medium with 5 mg / l chloramphenicol and 25 mg / l kanamycin grown on the above CM2G agar medium at 30 ° C. Inoculated into a large test tube containing 4 ml of the prepared medium, and cultured at 30 ° C for 48 hours, respectively. As a result of subjecting 10 μΐ of the culture supernatant to SD S-PAGE after completion of the culture, both C. glutamicum ATCC13869 and YDKOIO strains secreted approximately 1.5 times as much as the control using pVC7. An increase in quantity was observed. Furthermore, even when the Sec-type secretion signal sequence was used due to the presence of pVpstP, an increase in the secretory production of protransglutaminase was observed in both C. glutamicum ATCC13869 and YDK010 strains (Fig. 1).

[0046] (2) Production of plotting rutaminase using pstP amplified strain of C. glutamicum ATCC13869

 In the same manner as in Example 2 (1), using the plasmid pVpstP constructed in Example 1 (1), a Tat secretion signal distribution IjTorA signal sequence described in WO 02/081694 C. glutamicum A TCC13869 carrying the secretory expression plasmid pPKT_PPG was transformed, and a strain grown on the CM2G agar medium containing 5 mg / l chloramphenicol and 25 mg / l kanamycin was selected. Next, this transformant was compared with the one obtained by introducing pVC7 and pPKT_PPG into C. glutamicum ATCC13869, and evaluated by comparison with the amount of secretory production. Strains grown at 30 ° C on the above CM2G agar medium containing 5 mg / l chloramphenicol and 25 mg / l kanamycin were added to the above MMTG liquid medium with 5 mg / l kanalamphenicol and 25 mg / l kanamycin. A large test tube containing 4 ml of the added medium was inoculated and cultured at 30 ° C for 48 hours, respectively. After completion of the culture, 10 μΐ of the culture supernatant was subjected to SDS-PAGE. As a result, pVpstP increased secretion volume about 1.5 times compared with the control. Furthermore, in the secretory production using the Tat secretion signal sequence, the production of the plotting noretaminase with prostructure by transformed C. glutamicum ATCC13869 was increased by having pVpstP (Fig. 2).

[0047] According to the present invention, the efficiency of protein secretion production using coryneform bacteria is dramatically increased. In other words, according to the present invention, the coryneform of which the secretion efficiency of the target protein is enhanced by enhancing the serine Z threonine phosphatase activity (PstP activity) of the coryneform bacterium imparted with the ability to produce the target protein. Bacteria are obtained. By culturing this coryneform bacterium, a method for efficiently producing the target protein is provided.

[0048] References

 1.US Patent No. 4965197

 2.Special Table No. 6-502548

3. JP 11-169182 A 4. International Publication No. 02/81694 Pamphlet

 5.International Publication No. 05/103278 Pamphlet

 6. International Publication No. 05/007880 Pamphlet

(. Liebl W, Smskey AJ, Schleirer KH, Expression, secretion, and processing of sta phylococcal nuclease by Corynebacterium glutamicum _Λ J. Bacteriology (1992), 174, 1 854-1861

 8. Billman-Jacobe H, Wang L, Kortt A, Stewart D, Radford A, Expression and seer etion of heterologous proteases by Corynebacterium glutamicum ^ Applied Environmental Microbiology, (1995), 61, 1610-1616

 9. Salim K, Haedens V, Content J, Leblon G, Huygen K, Heterologous expression of the mycobacterium tuberculosis gene encoding antigen 85A in Corynebacterium glutamicum, Applied Environmental Microbiology, (1997), 63, 4392-4400

 10. Kikuchi Y, Date M, Yokoyama K, Umezawa Y, Matsui H, Secretion of active-fo rm Streptoverticillium mobaraense transglutaminase by Corynebacterium glutamicum: rocessing of the pro-transglutaminase by a cosecreted subtilisin-Like protease fr om Streptomyces albogrisetalus, Applied Enviromen Microbiology, (2003), 69, 358- 366

 11. Brigitte Boitel, Miguel〇rtiz_Lombardia, Rosario Duran, Frederique Pompeo, S tewart T. Cole, Carlos Cervenansky and Pedro M. Alzari, PknB kinase activity is re gulated by phosphorylation in two Thr residues and dephosphorylatin by PstP, the c ognate phospho -Ser / Thr phosphatase, in Miycobacterium tubeculosis ^ Molecular Mi crobiology, (2003), 49 (6), 1493-1508

 12. Puneet Chopra, Bhuminder Singh, Ramandeep Singh, Reena Vohra, Anil Koul, L axman S. Meena, Harshavardhan Koduri, Megha Ghildiyal, Parampal Deol, Taposh K. Das, Anil K. Tyagi, and Yogendra Singh, Phosphoprotein Mycophosbact erium tubeculosis dephosphorylates serine-threonine kinases PknA and PknB, Biochemical and Biophysical Research Communications, 311, (2003), 112-120.

Brief Description of Drawings [Fig. 1] shows the effect of pstP amplification on secretory production of protransdaltaminase by C. glutamicum ATCC13869 and YDK010 when Sec secretion signal sequence is used. Lanes 1 and 2 (ATCC13869 / pPKSPTGl), 5 and 6 (YDKOlO / pPKSP TGI) are pstP non-amplified strains, lanes 3 and 4 (ATCC13869 / pPKSPTGl), 7 and 8 (YDK010 / pPKSPTGl) are pstP amplified strains. Each represents the production of dartaminase.

 FIG. 2 shows the effect of pstP amplification on the secretory production of pro-structured plotting glutaminase produced by C. glutamicum ATCC13869 when a Tat secretion signal sequence is used. Lanes 1 and 2 represent the production of plotting taminaminase in the pstP non-amplified strain (ATCC13869 / pPKT-PPG) and lanes 3 and 4 represent the pstP amplified strain (ATCC13869 / pPKT_PPG), respectively.

 [FIG. 3] Alignment of amino acid sequences of serine / threonine phosphatase encoded by pstP of C. glutamicum ATCC13032, C. glutamicum ATCC13869, and C. efficiens Y S-314. Indicates the same position in the three species, and “·” indicates the position of the amino acid that is the same in ATCC13032 and ATCC13869 but different in the force YS-314.

Claims

The scope of the claims

 [1] Cultivation of a coryneform bacterium modified so that serine / threonine phosphatase activity is enhanced and imparted with the ability to produce the target protein, and recovering the secreted target protein A method for producing a target protein.

 [2] The method of claim 1, wherein the serine / threonine phosphatase is encoded by pstP.

 [3] The method according to claim 1, which is enhanced by increased expression of serine / threonine phosphatase activity pstP.

[4] The method according to claim 1, wherein the serine / threonine phosphatase activity is enhanced by an increase in the copy number of pstP.

[5] The method according to claim 1, wherein the serine / threonine phosphatase activity is enhanced by modifying an expression control region of pstP.

6. The target protein according to any one of claims 1 to 5, wherein the target protein is a protein selected from the group consisting of transglutaminase, plotting glutaminase, interferon, interleukin, insulin, IGF-1 and peptide synthase. the method of.

[7] The method according to any one of [6] to [6], wherein pstP is a gene derived from a coryneform bacterium modified so that serine / threonine phosphatase activity is enhanced.

[8] The pstP is a gene encoding a protein having an amino acid sequence having at least 70% homology with the sequence of SEQ ID NO: 2 or 4, and having a serine / threonine phosphatase activity: The method according to any one of the above.

[9] The method according to any one of claims 1 to 6, wherein pstP has a sequence of a nucleic acid molecule that hybridizes under stringent conditions with a nucleic acid molecule having the sequence of SEQ ID NO: 1 or 3.