WO2008001376A2

WO2008001376A2 - Detection of analytes in a medium

Info

Publication number: WO2008001376A2
Application number: PCT/IL2007/000794
Authority: WO
Inventors: Itamar Willner; Yossi Weizmann; Moritz K. Beissenhirtz; Zoya Cheglakov
Original assignee: Yissum Research Development Company Of The Hebrew University Of Jerusalem
Priority date: 2006-06-28
Filing date: 2007-06-28
Publication date: 2008-01-03
Also published as: WO2008001376A3

Abstract

A nucleotide construct is provided that comprises a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A. Sequence A is complementary to sequence A'. Hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, yields synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B. Sequence B' being a reporting sequence that upon becoming freed from said construct after may be detected. This construct may be used for detection of analytes in a medium. The analyte may be a nucleotide sequence comprising sequence A', or a substrate that facilitates hybridization of sequence A' to A.

Description

DETECTION OF ANALYTES IN A MEDIUM

FIELD OF THE INVENTION

This invention relates to a new method, system and reagents for the detection of analytes, in particular nucleic acid sequences and low molecular weight substrates.

BACKGROUND OF THE INVENTION

Amplification is a fundamental element in bioanalysis. En2ymes, ^l DNAzymes, ² magnetic particles³¹ and lately, nanoparticles³ or nanocontainers⁴ are widely employed for the sensitive detection of biorecognition events. Within these efforts, the amplified and sensitive detection of DNA is particularly challenging and directed to the analysis of pathogens, the detection of genetic disorders, and for forensic applications. The polymerase chain reaction (PCR) provides a general protocol for the amplified detection of DNA. Although the PCR method is time-consuming, and not free of limitations, it provides the most versatile method to detect minute amounts of DNA. The design of alternative approaches for the sensitive detection of DNA is of continuous demand. Substantial research efforts were lately directed to the development of DNA-based machines⁵. A DNA-based machine that cleaves RNA by a DNAzyme⁶, DNA- based tweezers, , motors , autonomous DNA walkers on pre-architectured tracks. ^" and signal-triggered switchable structural transformations between duplex DNA and G-quadruplex configurations¹² were reported. The use of the DNA machines as computing systems^13"15 or as sensor systems¹⁶' ¹⁷ was discussed. The mechanical opening of a functional hairpin DNA as a result of hybridization with a target DNA and its re-organization into a DNAzyme structure represents a simple sensing system duplicating machinery functions.² Circular DNA is often used as a template for the Rolling Circular Amplification (RCA) that yields single-stranded chains of repeated units of the circular template.³⁸ The RCA process was employed in different sensing schemes, ³⁶ and it was used to generate templates for nanoparticle aggregation.³⁷

Optical, ^j3' ³⁴ or piezoelectric³⁵ readout signals were used to probe the nucleic acid recognition events as well as electrical readout signals . The nucleic acid- induced opening of a redox-tethered DNA hairpin structure associated with an

OO electrode as a result of hybridization or the protein-induced organization of a redox-tethered aptamer linked to an electrode²³ represent electrochemical sensor configurations mimicking machine functions. The strength of machine-based DNA sensors relies, however, on the possibility that the mechanical operation of the DNA machine continuously generates a reporter product as a result of the sensing event, thus amplifying the recognition event. The information stored in DNA sequences, and the availability of polymerization or scission biocatalysts (polymerases, endonucleases, and nicking enzymes) allows the design of biomolecular machines for the amplification of biosensing events. Recently, the autonomous replication of DNA/Fok I cutter units and the generation of a fluorescent waste product was used as a machine to amplify DNA analysis.¹⁶

The nucleic acid-induced aggregation of Au nanoparticles (NPs) was extensively used as an optical label for DNA analysis. The color transition from red isolated Au NPs to a blue color, originating from interparticle plasmon coupling of aggregated Au NPs, was used to image DNA hybridization and analysis^24"26. Also, other sensor systems were based on the aggregation or de- on o 8 aggregation of Au NPs ' .

SUMMARY OF THE INVENTION

The present invention teaches a method, and assay system for the detection of analytes, e.g. nucleic acid sequences, low molecular weight substrates or macromolecules as well as nucleic acid constructs, particularly DNA constructs, for use in said method and assay system. The method taught by the invention may be carried out under isothermic conditions.

The nucleic acid construct of the invention will be referred to herein, occasionally, for convenience as a "DNA machine". It should, however, be noted that the nucleic acid construct is not limited to DNA and can also be RNA or at times a DNA-RNA combination (a construct with both DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) nucleotides). Where the construct is instead an RNA construct, the enzymes and nucleotides that are used may be different. As known, an RNA construct may serve, with use of appropriate enzymes and nucleotides, as a template for synthesis of a DNA molecule; similarly, a DNA template may be used for the synthesis of an RNA molecule, etc. The DNA machine of the invention comprises two basic elements: a recognition sequence for detection of the analyte which upon binding to the target analyte activates the DNA machine; and a nucleic acid template which is used as a "track" on which the machine operates producing repeatedly a single stranded DNA stretch which serves as a detection element generating a signal which may be a colorimetric, chemiluminescence, optical or electronic signal.

The term "complementary" is used herein to denote that two nucleotide (DNA or RNA) sequences that are complementary to one another pair with one another; complementary sequences have thus the feature that one sequence has the ability to hybridize and form a duplex with the other sequence. A complementary sequence may be a sequence displaying a complete match, namely precise pairing of bases between one strand of DNA or RNA and its complementary strand. A complete match occurs when one nucleotide stand is synthesized where a complementary one serves as a template. However, depending on the stringency of the hybridization, mismatches between bases in one sequence to a complementary one are possible without substantially impairing the ability of the two complementary sequences to hybridize to one another under appropriate conditions. At times, one sequence may even have stretches of mismatch with the complementary sequence which results, upon hybridization of such two partially complementary sequences, in the formation of single stranded loops in the double- stranded duplex. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. Thus, while sequence B' and C described and defined below will typically have full complementarity with sequence B and C, respectively, that serve as a template for their synthesis, sequences A' and D' may have full or partial complementarity with respective sequence A and D.

The term "detection" used herein denotes both qualitative as well as quantitative determination.

The present invention provides a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to sequence A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, yields synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that upon becoming freed from said construct after its synthesis may be detected. In some embodiments of the invention sequence B' is included in a nucleic acid molecule that may comprise also other sequences.

The present invention also provides an assay system that comprises the above nucleotide construct.

Further provided by the present invention is a method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, the method comprising the following steps carried out in the specified or another order:

(a) providing a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, permitting an A' -primed synthesis (namely a synthesis in which A' serves as primer) of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected;

(b) contacting said nucleotide construct with the assay sample under conditions enabling hybridization of sequence A' with sequence A;

(c) providing conditions for synthesis of a nucleotide stretch that comprises a sequence B', in which sequence A' serves as a primer; and

(d) assaying the presence of synthesized sequence B ' .

The present invention still further provides a method for detecting an analyte in a medium, the method comprising the following steps carried out in the specified or another order:

(a) providing a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, permitting an A' -primed synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected;

(b) contacting said nucleotide construct with the assay sample to yield a reaction medium under conditions such that in the presence of said analyte sequence A' hybridizes with sequence A, sequence A' being included in said reaction medium (e.g. added to the assay sample, included as an integral component of the nucleotide construct or complexed therewith, or being an a priori separate entity within the reaction medium);

(d) assaying the presence of synthesized sequence B ' . The construct according to the latter method has a recognition region that serves as an aptamer which typically undergoes a conformational or other change in the presence of an analyte and consequently sequence A' can hybridize with sequence A. Said analyte may, for example be a small molecule, e.g. a drug of abuse such as cocaine, an explosive, etc. Said analyte may also be, for example, a macromolecule, e.g. a protein. Sequence A', in accordance with one embodiment, forms an integral part of said construct with its hybridization to sequence A being essentially inhibited; for example by the existence of a blocker (such as a sequence that is bound to a complementary sequence on the construct), by the native conformation that is favored by the constructs in its native form, etc. Upon contact with the analyte, there occurs a conformational change in the construct, involving, for example, removal of the blocker that permits hybridization. The construction of analyte-specific aptamers is known and can be accomplished through known techniques, such as, for example, via in vitro evolution methods.

In accordance with an embodiment of the teaching herein use is made of the DNA machine with an auxiliary construct being a nucleotide construct that comprises a sequence A'. The sequence A' in the auxiliary construct is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte. An example of such a construct is one that has a stem-loop structure, comprising a double-stranded portion with the two strands being linked via a loop. One of the two strands includes the sequence A', while the other includes a sequence at least partially complimentary thereto. In the presence of the appropriate analyte, e.g. a nucleotide sequence with a sequence complementary to a sequence in the loop portion, the stem-loop structure opens allowing sequence A' to hybridize with sequence A in said construct, whereby said DNA machine is activated.

In accordance with an embodiment of the teaching herein use is made of the DNA machine with an auxiliary construct being a nucleotide construct that comprises a sequence A'. The sequence A' in the auxiliary construct is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte. An example of such a construct is one that has a stem-loop structure, comprising a double-stranded portion with the two strands being linked via a loop. One of the two strands includes the sequence A', while the other includes a sequence at least partially complimentary thereto. In the presence of the appropriate analyte, e.g. a nucleotide sequence with a sequence complementary to a sequence in the loop portion, the stem-loop structure opens allowing sequence A' to hybridize with sequence A hϊsaid construct, whereby said DNA machine is activated.

In one embodiment of the teaching herein the "track" consists of three basic regions: a first, sequence A (that is identified in the specific embodiments described below and in the appended Figures, as region "I"), is complementary to a primer of sequence A', while hybridization of sequence A' to A leads to onset of synthesis of a DNA strand with the "track" serving as a template, in the presence of the polymerase and dNTPs; a second, sequence C (that is identified in the specific embodiments described below and in the appended Figures, as region "II"), that is complementary to a nucleic acid of a sequence C that upon formation of a C-C double-strand can bind a nicking endonuclease that nicks sequence C; and a third region, B (that is identified in the specific embodiments described below and in the appended Figures, as region "III"), that is complementary to a sequence B'. The nicking enzyme thus cuts the synthesized strand at the predefined sequence and yields a new onset of DNA synthesis site. The subsequent replication results in strand displacement and the autonomous formation of displaced strands of a third region, B, as the machine's product. The third region, sequence B, comprises a sequence whose complementary strand has the ability to generate a detection signal. This process progresses autonomously as long as the appropriate enzymes and the dNTPs are present in the medium. As may be appreciated, the nucleic acid molecule that comprises sequence B', may also comprise a portion of the 3 '-end of the sequence C. In accordance with another embodiment of the teaching herein the method and, the assay system are used for detecting the presence of an analyte in a medium, making use of an auxiliary nucleotide construct. The auxiliary construct in this embodiment comprises a sequence A', which is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte. There are a variety of approaches to obtain nucleotide constructs that can undergo an appropriate conformational change upon contact with a specific analyte, such as to reveal a desired, a priori hidden, sequence to permit its subsequent hybridization to a complementary sequence. Such approaches are known per se. Nucleotide constructs may be designed to have a relatively high degree of analyte-specificity in undergoing the appropriate conformational change. Nucleotide constructs may be designed to undergo such conformational change upon contact with analytes including macromolecules such as proteins (antibodies, enzymes, etc.), glycoproteins, immunocomplexes and others. A specific example of such an auxiliary construct is one that has a stem-loop structure. Such a construct consists of a single strand that has two nucleotide stretches that are hybridized to one another defining the stem and are linked to one another through a loop. One of the hybridized stretches includes a sequence A' which as a result of its hybridization with the stretch is blocked from hybridization with sequence A of the nucleotide construct (the DNA machine). In accordance with an exemplary embodiment the auxiliary construct has a sequence D such that upon hybridization of a sequence D' thereto, the auxiliary construct changes its conformation whereby the stem Opens' and the sequence A' is freed for hybridization with the complementary sequence A in the DNA machine. Thus, the assay system of this exemplary embodiment is useful for detecting the presence of sequence D' in a medium, for example: a sequence of a DNA or an RNA of a microorganism, e.g. viral DNA or RNA; a DNA or an RNA characteristic of a mutated, e.g. a pathological cell, a specific cDNA, etc. In one embodiment, the detection element (B') generated by the DNA machine consists of a nucleotide sequence which following its synthesis folds to assume a three-dimensional structure in which it becomes catalytically active, e.g. a DNAzyme. The catalytic activity gives rise to synthesis or degradation of detectable products, such as colored, light-emitting or phosphorescent products. The detection according to this embodiment comprise providing (i) conditions for said catalytic domains to become catalytically active, and (ii) a substrate for the catalytic activity of the catalytically active B' to yield a reaction product; and determining existence and optional amount of the reaction product.

For example, the resulting synthesized DNAzyme acts as a peroxidase- mimicking enzyme, and as an amplifying label for the analysis of the target DNA. The operation of the machine or the detection of the DNA is readout by colorimetric or chemiluminescent signals.

In one specific embodiment the synthesized DNAzyme is a G-quadruplex nucleic acid structure that intercalates hemin and mimics peroxidase activity. The hemin/G-quadruplex complex catalyzes the generation of chemiluminescence, in the presence of luminal/H₂O₂, and biocatalyses the oxidation of 2, 2'-azino-bis (3- ethylbenzothiazoline-6-sulfonic acid), ABTS ^', by H₂O₂.

In another embodiment the "track" of the DNA machine consists of a circular DNA comprising two basic regions: a first sequence A that is complementary to a primer sequence A' and one or more second sequences B complementary to a nucleic acid sequence characterized by its ability to generate a detection signal. Accordingly, upon recognition of the target DNA a rolling circle amplification process (RCA) is activated. In a specific, example sequence B', which is complimentary to sequence B, is a sequence of a catalytic nucleotide, e.g. a DNAzyme that can assume a three-dimensional structure in which it becomes catalytically active, thus yielding a nucleic acid molecule with a plurality of catalytic domains. Where the circular "track" includes a plurality of repeats of sequence B, even a single circle synthesis will give rise to a nucleic acid molecule with a plurality of sequence B', yielding after folding a corresponding plurality of catalytic domains. The detection according to this embodiment, similarly to that described above, comprise providing (i) conditions for said catalytic domains to become catalytically active, and (ii) a substrate for the catalytic activity of the catalytically active B' to yield a reaction product; and determining existence and optional amount of the reaction product.

In another embodiment, the detection element of the DNA machine generates a nucleic acid product B' that has at least a portion that is complementary to a sequence immobilized on a solid support. The solid support may, for example, comprise one or more particles, e.g. a plurality of colloidal particle, such as gold nanoparticles (Au NPs). The particles typically consist of at least two groups, of which a first group has a first nucleotide molecule bound thereto having at least a portion that is complementary to a first portion of B' and a second group that has a second nucleotide molecule bound thereto have at least a portion which is complementary to a second portion of B'. Similarly there may also be, by some embodiments, three or more different groups each of which has a different nucleotide molecule bound thereto with at least a portion complementary to a portion of B' different than that of nucleotide molecules of other groups of particles. A typical example includes nanoparticles that comprise a first group of nanoparticles having a nucleic acid molecule that has at least a portion complementary to the 5 '-end of B' and a second group of nanoparticles having a nucleic acid molecule that has at least a portion complementary to the 3 '-end of B'. Thus, generation of B' induces aggregation of the particles and the detection may involve measuring changes in optical properties of the medium. Au NPs change their color upon aggregation. It should be noted that the 5 '-end of sequence B' is often linked to the 3 '-end of C remaining after the nick. Thus, at times the nucleic acid molecule bound to a particle may also include a sequence complementary to that portion of C such that that portion also participates in the binding (through hybridization) of the B '-comprising nucleotide molecule to the immobilized nucleotide molecule.

The substrate may also be part of a sensor body adapted to sense binding of nucleotides measurable by: (i) gravitometric analysis making use of a sensor that can assay a change of mass on its surface, e.g. through the use of a piezoelectric crystal that changes its vibration frequency upon change of mass, or (ii) electric analysis through determination of changes of electric properties of an exposed surface as a results of binding of the nucleotides thereto. An example of an electric analysis is impedance measurement in which binding is determined through changes of impedance. Such sensors are well known in the art. It is possible also at times to use in parallel different types of sensors, each of which has a different nucleotide molecule immobilized thereon. Such a sensors may be used jointly with a corresponding assay system having different types of nucleotide constructs that is adapted to react to a different analyte and generate each a different sequence B'. Thus, based on the sensor on which binding is detected, a determination of which analyte was in the assays sample can be made. For example, a system with a plurality of different sensors and corresponding plurality of nucleotide constructs, each of which constructs yielding the generation of a different B' reporting sequence each of which binds to a different electrode, may serve for the detection of presence and optionally amount of one of a plurality of different agents, e.g. in assaying simultaneously a number of different viruses.

The DNA machine of the invention in its various embodiments may be used for the detection of a variety of different analytes including, but not limited to DNA or RNA sequences, for example sequences of pathogens such as viruses. The present invention may also be used to analyze non-nucleic acid low molecular weight substrates, such as cocaine. According to this embodiment, the recognition area "I" consists of an aptamer, a nucleic acid sequence with specific recognition properties towards low molecular weight substrates or macromolecules. The present invention may also be used to analyze other biorecognition events, such as immunocomplexes. That is, primer-functionalized antibodies may act as triggers of the DNA- machine and allow amplified readout of the immunocomplex formation.

DESCRIPTION OF EMBODIMENTS

Some embodiments of the invention are described in the following numbered paragraphs. As will be understood, these embodiments are non-limiting. Furthermore, some specific embodiments that are described and defined below are exemplary to multitude of potential embodiments that fall within the scope of the invention as defined and described herein.

1. A nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to sequence A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, yields synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected.

2. A nucleotide construct according to 1, comprising a sequence C between sequences A and B, sequence C together with a complementary sequence C hybridized thereto forming a recognition site for an endonuclease that nicks the complementary sequence; said synthesis, yielding a complementary stretch that comprises in the 5' to 3' direction sequences A', C and B', whereupon after nicking at sequence C, the 3' portion of the synthesized stretch comprising sequence B' is freed.

3. A nucleotide construct according to 1 or 2, wherein B' has a catalytic nucleotide sequence. 4. A nucleotide construct according to 3, wherein following its synthesis sequence B' folds to assume a three-dimensional structure in which it becomes catalytically active.

5. A nucleotide construct according to 4, wherein the catalytic activity of the folded sequence B' requires a co-factor.

6. A nucleotide construct according to 4 or 5, wherein the catalytic activity gives rise to synthesis or degradation of detectable product.

7. A nucleotide construct according to 6, wherein said detectable product is colored product.

8. A nucleotide construct according to 4 or 5, wherein the catalytic activity causes the generation of a light signal.

9. A nucleotide construct according to 4 or 5, wherein the catalytic activity gives rise to the synthesis of a light-emitting or a phosphorescent product.

10. A nucleotide construct according to 1, being circular, whereby said synthesis gives rise to a long stretch of nucleotides with multiple repeats of sequence B'.

11. A nucleotide construct according to 10, wherein sequence B' has a catalytic nucleotide sequence.

12. A nucleotide construct according to 11, wherein following their synthesis a plurality of sequences B' fold to assume a three-dimensional structure in which they become catalytically active, giving rise to a nucleic acid molecule with a plurality of catalytic domains.

13. A nucleotide construct according to 12, wherein the catalytic activity of the folded sequence B' requires a co-factor.

14. A nucleotide construct according to 12 or 13, wherein the catalytic activity gives rise to synthesis or degradation of detectable product.

15. A nucleotide construct according to 14, wherein said detectable product is colored product. 16. A nucleotide construct according to 12 or 13, wherein the catalytic activity causes the generation of a light signal.

17. A nucleotide construct according to 12 or 13, wherein the catalytic activity gives rise to the synthesis of a light-emitting or a phosphorescent product.

18. A nucleotide construct according to 1 or 2, wherein B' has a sequence that is complementary to a sequence in a nucleotide stretch bound to a substrate, e.g. a bead, an immobilized substrate.

19. A nucleotide construct according to any of embodiments 1-18, comprising a sequence A\ which is in a state in which it is not hybridized to sequence A and becomes hybridized thereto in the presence of a specific analyte.

20. An assay system comprising a nucleotide construct according to any one of 1-19.

21. An assay system according to 20, comprising an auxiliary construct being a nucleotide construct that comprises a sequence A', said sequence A' in the auxiliary construct is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte.

22. An assay system according to 21, wherein said auxiliary construct has a stem-loop structure, having a double-stranded portion with the two strands thereof being linked to one another via a loop; sequence A' being included in one of the two strands of the stem.

23. An assay system according to 21 or 22, wherein the analyte is a nucleic acid molecule.

24. An assay system according to 23, wherein the analyte is a viral DNA or RNA.

25. An assay system according to 21 or 22, wherein the analyte is a small molecule substrate.

26. An assay system according to 25, wherein the analyte is a drug of abuse, e.g. cocaine. 27. An assay system according to 21 or 22, wherein the analyte is a macromolecule, e.g. a protein.

28. An assay system according to 22, wherein the loop of said auxiliary construct comprises a sequence D complementary to sequence D' in the analyte nucleic acid molecule; upon hybridization of said D' sequences with said D sequence, the stem-loop structure opens and the two initially hybridized stems are released from one another, whereby sequence A' of one of the stems can hybridize with sequence A in said nucleotide construct.

29. An assay system according to any of 19-28, comprising enzymes, e.g. nucleic acid polymerase (i.e. DNA or RNA polymerase), endomiclease, and others, and nucleotides.

30. An assay system according to 29, wherein said enzymes comprise an enzyme that can cleave a specific nucleic acid sequence.

31. A method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, the method comprising the following steps carried out in the specified or another order:

(a) providing a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, yields synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected;

(d) assaying the presence of synthesized sequence B ' . 32. A method for detecting an analyte in a medium, the method comprising the following steps carried out in the specified or another order:

(d) assaying the presence of synthesized sequence B ' .

33. A method according to 31 or 32, wherein (c) comprises providing a DNA or RNA polymerase and free nucleotides.

34. A method according to any of 31-33, wherein:

(i) said construct comprises a sequence C between sequences A and B, sequence C together with a complementary sequence C hybridized thereto forming a recognition site for an endonuclease that nicks the complementary sequence; said synthesis, yielding a complementary stretch that comprises in the 5' to 3' direction sequences A', C and B', whereupon after nicking at sequence C, the 3' portion of the synthesized stretch comprising sequence B' is freed; and (ii) step (c) comprises providing conditions for synthesis of a nucleotide stretch that comprises a sequence C and B', in which sequence A' serves as a primer, and conditions for nicking sequence C after its formation.

35. A method according to 33, wherein (c) comprises providing a DNA or RNA polymerase, free nucleotides and an enzyme for nicking sequence C.

36. A method according to 31, wherein said target nucleotide sequence is a sequence A' included in an auxiliary construct being a nucleotide construct in which said sequence A' is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte.

37. A method according to 36, wherein said auxiliary construct has a stem-loop structure in which the construct' s stems are hybridized to one another; sequence A' being included in one of the two stems.

38. A method according to 37, wherein the loop of said auxiliary construct comprises a sequence D complementary to sequence D' in the analyte nucleic acid molecule; upon hybridization of said D' sequences with said D sequence, the stem-loop structure opens and the two initially hybridized stems are released from one another, whereby sequence A' of one of the stems can hybridize with sequence A in said nucleotide construct.

39. A method according to 37 or 38, wherein the target nucleotide sequence is an isolated nucleic acid sequence.

40. A method according to 39, wherein the target nucleotide sequence is a nucleotide sequence included in a DNA or RNA of a microorganism, e.g. viral DNA or RNA.

41. A method according to 32, wherein the analyte is a small molecule substrate.

42. A method according_, to 41, wherein the small molecule substrate is a drug of abuses, e.g. cocaine. 43. A method according to 32, wherein the analyte is a macromolecule, e.g. a protein.

44. A method according to any one of 31-43, wherein B' has a catalytic nucleotide sequence and following synthesis said sequence B' assume a three- dimensional structure in which it becomes catalytically active.

45. A method according to 44, wherein (d) comprises the following steps carried out in the specified or another order:

(dl) providing conditions for B' to become catalytically active; (d2) providing a substrate for the catalytic activity of the catalytically active B' to yield a reaction product; and

(d3) determining existence and optional amount of the reaction product.

46. A method according to 45, wherein (dl) comprises providing a co-factor.

47. A method according to 45 or 46, wherein the catalytic activity gives rise to synthesis or degradation of detectable product.

48. A method according to 47, wherein the substrate or the product is colored and said determining in (d3) comprises determining a change in color.

49. A method of 48, wherein the catalytic activity gives rise to the synthesis of a light-emitting or a phosphorescent product.

50. A method according to any one of 31-49, wherein said nucleotide construct is circular and said synthesis gives rise to a long stretch of nucleotides with multiple repeats of sequence B'.

51. A method of 50, wherein sequence B' has a catalytic nucleotide sequence.

52. A method of 51, wherein following their synthesis a plurality of sequences B' fold to assume a three-dimensional structure in which they become catalytically active, giving rise to a nucleic acid molecule with a plurality of catalytic domains.

53. A method according to 52, wherein (d) comprises the following steps carried out in the specified or another order:

(dl) providing conditions for said catalytic domains to become catalytically active; (d2) providing a substrate for the catalytic activity of the catalytically active B' to yield a reaction product; and

(d3) determining existence and optional amount of the reaction product.

54. A method according to 53, wherein (dl) comprises providing a co-factor.

55. A method according to 53 or 54, wherein the catalytic activity gives rise to synthesis or degradation of detectable product.

56. A method according to 53, wherein the substrate or the reaction product is colored and said determining in (d3) comprises determining a change in color.

57. A method of 55, wherein the catalytic activity gives rise to the synthesis of a light-emitting or a phosphorescent product.

58. A method according to 53 or 54, wherein the catalytic activity or the reaction product causes light emission.

59. A method according to any one of 31-42, wherein (d) comprises the following steps carried out in the specified or another order:

(dl) providing nucleotide strands bound to a substrate, said strands comprising a sequence E complementary to at least a portion of sequence B'; and (d2) detecting hybridization of B' to E.

60. A method according to 59, wherein said substrate comprises colloidal particles, and in the presence of nucleotide molecules of sequence B' said particles aggregate and said detecting comprises measuring change in properties as a result of the aggregation.

61. A method according to 60, comprising first particles with an immobilized nucleotide strand comprising a sequence El and second particles with an immobilized nucleotide strand comprising a sequence E2, each of El and E2 being each complementary to a different portion of sequence B'.

62. A method according to 60 or 61, wherein said colloidal particles are colloidal gold particles.

63. A method according to 59, wherein said substrate is a solid substrate of a sensor adapted to sense binding of nucleotide molecules thereto. 64. A method according to 63, wherein said sensor is a gravitometric or amperometric sensor.

65. A method for detecting an analyte in an assay system, the method comprising the following steps carried out in the specified or another order:

(al) providing a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, permitting an A'-primed synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected;

(a2) providing an auxiliary construct being a nucleotide construct that comprises a sequence A', said sequence A' in the auxiliary construct is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte;

(c) providing conditions for synthesis of a nucleotide stretch that comprises a sequence B', in which synthesis sequence A' serves as a primer; and

(d) assaying the presence of synthesized sequence B ' .

66. A method according to 65 for detecting the presence of an analyte nucleic acid molecule, wherein said auxiliary construct has a stem-loop structure with a double-stranded stem the two strands of which being linked to one another through a nucleotide loop, sequence A' being included in one of the two strands forming the stem and the loop of said auxiliary construct comprises a sequence D complementary to a sequence D' in the analyte nucleic acid molecule; upon hybridization of said D' sequences with said D sequence, the stem-loop structure opens and the two initially hybridized stems are dissociated from one another, whereby sequence A' of one of the stems can hybridize with sequence A in said nucleotide construct.

67. A method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, the method comprising the following steps carried out in the specified or another order:

(a) providing a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides permitting an A'-primed synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; B' having the sequence of a catalytic nucleic acid that following synthesis can assume a three-dimensional structure in which it becomes catalytically active;

(d) providing (i) conditions for B' to become catalytically active, and (ii) a substrate for the catalytic activity of the catalytically active B' to yield a reaction product; and determining existence and optional amount of the reaction product.

68. A method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, the method comprising the following steps carried out in the specified or another order:

(a) providing a nucleotide construct, comprising: a sequence A, a sequence B and a sequence C between A and B, on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, permitting an A'-primed synthesis of a complementary stretch of nucleic acids which comprises a sequence C that is complementary to C and sequence B' that is complementary to sequence B; C having a sequence such that C together with a complementary sequence C hybridized thereto forming a recognition site for an endonuclease that nicks the complementary sequence; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected;

(c) providing conditions for synthesis of a nucleotide stretch that comprises a sequence C-B', in which synthesis sequence A' serves as a primer and a nicking enzyme for nicking sequence C; and

(d) assaying the presence of synthesized sequence B ' .

69. A method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, the method comprising the following steps carried out in the specified or another order:

(a) providing a circular nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, permits an A'- primed synthesis of a long complementary stretch of nucleic acids which comprises a a plurality of B' sequences that are each complementary to sequence B; B' having the sequence of a catalytic nucleic acid that following synthesis can each assume a three-dimensional structure in which it becomes catalytically active yielding a nucleic acid molecule with a plurality of catalytic domains;

(c) providing conditions for synthesis of a nucleotide stretch that comprises a a plurality of sequences B', in which synthesis sequence A' serves as a primer; and (d) providing (i) conditions for said catalytic domains to become catalytically active, and (ii) a substrate for the catalytic activity of the catalytically active B' to yield a reaction product; and determining existence and optional amount of the reaction product.

70. A method for detecting a target small molecule substrate in an assay sample, the method comprising the following steps carried out in the specified or another order:

(a) providing a nucleotide construct, comprising: a sequence A, a sequence B and a sequence C between A and B, on a single nucleotide stretch, sequence B being on the 5' side of sequence A; binding of sequence A to the small molecule substrate in the presence of a polymerase and nucleotides, induces a conformational change permitting hybridization of a sequence A' to sequence A, sequence A' being complementary to sequence A; said hybridization permitting synthesis of a complementary stretch of nucleic acids which comprises a sequence C that is complementary to C and sequence B' that is complementary to sequence B, with A' serving as the synthesis primer; C having a sequence such that C together with a complementary sequence C hybridized thereto forming a recognition site for an endonuclease that nicks the complementary sequence; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected;

(b) contacting said nucleotide construct with the assay sample under conditions enabling binding of said small molecule substrate with sequence A;

(c) providing conditions such that upon formation of an A'-A hybrid, a nucleotide stretch that comprises a sequence C-B' is synthesized, and providing a nicking enzyme for nicking sequence C; and

(d) assaying the presence of synthesized sequence B ' . BRIEF DESCRIPTION OF THE DRAWINGS

• In order to understand the invention and to see how it may be carried out in practice, preferred embodiments will now be described, by way of non-limiting examples only, with reference to the accompanying drawings, in which:

Fig. IA is s schematic representation of primer-induced autonomous synthesis of DNAzyme units on a template DNA using polymerase/dNTPs and a nicking enzyme as biocatalysts.

Fig. IB is a schematic representation of primer-induced autonomous generation of bligonucleotide-modifϊed Au Nanoparticles aggregation.

Fig. 2 depicts results of experiments conducted in a system of the kind depicted in Fig. IA. Fig. 2A depicts absorbance changes and Fig. 2B depicts Chemiluminescence intensities observed upon the oxidation of ABTS^2" by H₂O₂ or the light emission by luminol/ H₂O₂, using different concentrations of the template: (a) IxIO-⁶M, (b) IxIO-⁸M, (c) IxIO-¹⁰ M, (d) IxIO-¹² M, (e) IxIO^"14 M. (f) is an analysis of the foreign Calf-Thymus ssDNA, lxlO^"8 M. Fig. 2C depicts absorbance changes and Fig. 2D depicts chemiluminesence intensities observed upon the oxidation of ABTS^2" by H₂O₂ or light emission by luminol/ H₂O₂ and the DNAzyme synthesized at different time-intervals and at a concentrations of Ix 10^"6 M of both the template and of the primer: (a) 0 min, (b) 10 min, (c) 30 min, (d) 60 min, (e) 90 min.

Fig. 3 shows a non-denaturating PAGE analysis of the DNAzyme synthesized by the system according to Fig. IA, under the following conditions: (1) template only; (2) primer only; (3) the product, 5'- TGAGGCACTTTGGGTAGGGCGGGTTGGG-S', only; (4) template and primer; (5) template and product. (6) template, primer and the product; (a) to (e) products generated at different time-intervals: (a) t=0, (b) t=10, (c) t= 30, (d) t=60 and (e) t=90 minutes. Fig. 4: Schematic representation of the analysis of M13 phage ssDNA by the hairpin (3) and the DNA-based machine using template (5).

Fig. 5 depicts results of experiments conducted in a system of the kind depicted in Fig. 4. Fig. 5A depicts absorbance changes and Fig. 5B depicts chemiluminescence intensities upon the oxidation of ABTS^2" by H₂O₂ or the light emission by luminol/H₂O₂ by the DNA-based machine depicted in Fig. 4, analyzing different concentrations of Ml 3 phage ssDNA: (a) Ix 10^'9 M, (b) 1x10^' ¹¹ M, (c) IxIO^'12 M, (d) IxIO^"14 M. (e) Analysis of the foreign Calf-Thymus ssDNA, IxIO^"8 M. The concentrations of both the hairpin and the template was Ix 10^"6 M. Polymerase, 0.4 units, dNTPs, 0.2 mM and N.BbvC IA, 0.5 units were included in all of the systems. Fig. 5C depicts absorbance changes and Fig. 5D depicts chemiluminesence intensities upon analyzing Ml 3 phage ssDNA, IxIO^"9 M, by the DNA-based machine at different time-intervals and at concentrations of IxIO^'6 M of both the hairpin and the template: (a) 0 min, (b) 10 min, (c) 30 min, (d) 60 min and (e) 90 min. For the absorbance studies, ABTS^2", 1.8 x 10^"4 M, H₂O₂, 4.4 x 10^"5 M and hemin, 4 x 10^"7 M, were included in the system. For the chemiluminescence studies luminol, 1 x 10 M, H₂O₂, 3 x 10^" M and hemin, 5 x 10^"4 M, were included in the system. In all systems polymerase, 0.4 units, dNTPs, 0.2mM, and the N.BbvC IA, 0.5 units, were included. Systems include HEPES buffer 25 mM, 20 mM KCl and 200 mM NaCl, pH 9.0. Absorbance spectra were recorded at λ=415 nm. Chemiluminescence was monitored at λ_em=420 nm. Detailed description of the experimental conditions is provided as supporting material.

Fig. 6 depicts absorbance changes in an experiment using a system of the kind shown in Fig. IB. Fig. 6A depicts aabsorbance changes for different time intervals in the presence of 1.5*10^"9 M of each of the two types of the functionalized gold nano-particles (Au-NPs): (a) 0 minutes, (b) 30 minutes, (c) 60 minutes, (d) 90 minutes, (e) 120 minutes. The concentration of the template and the primer was each 1*10^" M. Fig. 6B depicts absorbance changes originating from the aggregation of Au NPs in the presence of the primer at a concentration of l*10^'6 M for a fixed time interval of 120 minutes, using luminal. Concentrations of the templates were, (a) 0 M, (b) l*10^"6 M, (c) l*10^"7 M, (d) l*10^"8 M, (e) PlO^"9 M. AU experiments were performed in a buffer solution pH = 7.9 in the presence of polymerase (0.15 U μl^"1), the nicking enzyme (0.3 U μl^"1), and dNTPs (0.6 mM).

Fig. 7 shows transmission electron microscopy images following employment of the system of Fig. IB: Fig. 7B shows Au NP aggregation upon operation of the system as shown in Fig. IB. Fig. 7B shows a control experiment where a non-matching DNA sequence was used instead of that marked (2) in Fig. IB. As can be seen, no aggregation is obtained in (B).

Fig. 8 is Schematic representation of analysis of M 13 phage DNA through a DNA machine-induced aggregation of Au NPs.

Fig. 9 depicts absorbance changes in an experiment using a system of the kind shown in Fig. 8. Fig. 9 A shows absorbance spectra under the following conditions: (a) DNA machine "track" (1) - l*10^"9 M, the hairpin (6) - l*10^"9 M, the two functionalized Au NPs - 1.5*10^"9 M, polymerase - 0.15 U μl^"1, the nicking enzyme — 0.3 U μl^"1, and dNTPs — 0.6 mM before addition of the Ml 3 phage DNA; (b) 120 minutes after the addition of l*10^"9 M M13 phage DNA; (c) Control experiment where the M13 phage DNA is substituted with 1* 10^"9 M of the calf thymus DNA and the system was allowed to run for 120 minutes. Fig. 9B shows a calibration curve corresponding to the spectral changes of the systems analysing different concentrations of Ml 3 phage DNA through the aggregation of AuNPs using the system of Fig. IB.

Fig. 10 shows a system for the detection of a nucleic acid by the rolling circle amplification (RCA) synthesis of DNAzyme units.

Fig. 11 depicts results of an experiment with the RCA system of Fig. 10. Fig. HA shows a time-dependant absorbance changes upon analyzing the target nucleic acid ((1) in Fig, 10), at a concentration of 2 x 10^'8 M, for different time- intervals: (A) 0 min, (B) 10 min (C) 30 min and (D) 60 min. (E) Analyzing of the target with circular DNA being open (i.e. not treated with kinase and ligase to form the closed circular DNA). The concentration of the circular DNA was 2 x 10^" ⁸ M. Fig. HB shows the chemiluminescence intensities observed upon the light emission by luminol/ H₂O₂, at different time-intervals and at a concentrations of both the target and the circular template DNA being 2 x 10^"8 M: (A) 0 min, (B) 10 min, (C) 30 min and (D) 60 min.

Fig. 12 shows gel electrophoresis and AFM images following an RCA process according to Fig. 10. Fig. 12a is a gel agarose electrophortic image: Lane (A) lkb DNA ladder, lane (B) 0 min, lane (C) 10 min, lane (D) 30 min, lane (E) 60 min and lane (F) 90 min. Fig 12b and 12c are AFM images of the DNA chains synthesized by the RCA process with a primer at a concentration of 2 x 10^" M.

Fig. 13: shows detection of M13 phage DNA by rolling circle amplification synthesizing DNAzyme chains.

Fig. 14 depicts results of an experiment with the RCA system of Fig. 13. Fig. 14A shows absorbance changes and Fig. 14B chemiluminescence intensities upon the oxidation of ABTS^2" by H₂O₂ or the light emission by luminol/H₂O₂ by the DNA-based RCA process, analyzing different concentrations of Ml 3 phage ssDNA: (F) IxIO^"9 M, (E) lxlO^'11 M, (D) lxlO^'12 M, (C) IxIO^"14 M and as controls (B) Analysis of the foreign Calf-Thymus ssDNA, Ix 10^"8 M. and (A) absence of Ml 3 phage DNA. The concentration of the hairpin ((4) in Fig. 13) was 2x10^~7 M and that the Circular DNA ((2) in Fig. 13) was 2xlO^"8 M. Polymerase Klenow exonuclease at 0.4 units/μl and dNTPs, 0.2 mM were included.

Fig. 15 shows an aptamer-based system for the amplified analysis of a small molecule such as cocaine.

Fig. 16 shows a time-dependent fluorescence spectra, measured at 10 min timeintervals, a-g, observed upon operating the aptamer-based machine of Fig. 15, in the presence of cocaine, 0.4 mM. The analysis was performed in the presence of polymerase 10 units, Nt.BbvC I, 20 units, dNTPs, 0.1 mM, and the nucleic acid template ((1) in Fig. 15), 5*10^"8 M. To the reaction product the hairpin ((5) in Fig. 15), 6.7*10-8 M, was added, and the fluorescence was recorded after a time- interval of 8 min. The inset shows the time-dependent fluorescence changes at a wavelength of 520 following excitation at a wavelength of 480 nm.

Fig. 17 Fluorescence spectra observed with the system of Fig. 15, upon analyzing different concentrations of cocaine in the presence of the nucleic acid template ((1) in Fig. 15), 5*10^"8 M: (a) 0.005, (b) 0.05, (c) 0.1, (d) 0.4, (e) 0.7, (f) 1 mM. Experimental were as in Fig. 16. The inset shows the derived calibration curve.

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS

The present invention introduces a new paradigm for the sensitive analysis of DNA using a DNA-based machine that consists of a DNA template, polymerization/nicking enzymes, and the strand-displacement of the synthesized detection element. The operation of the DNA machine is triggered, in accordance with some embodiments, by the opening of a pre-designed hairpin nucleic acid by the analyte DNA. The system produces colorimetric, chemiluminescence, optical or electronic signals which allow the readout of the DNA machine function and operation.

The resultant nucleotide, e.g. DNA strand may be, by some embodiments, self assembled into a biocatalytic DNAzyme that enables the colorimetric or chemiluminescent imaging of the analysis. Alternatively, the resultant nucleotide, e.g. DNA strand may be used as a promoter for the aggregation of nanoparticles, e.g. Au NPs, thus enabling the optical imaging of the analyte through the operation of the machine. Or, a parallel use of several DNA machines may lead to the generation of nucleic acid barcodes that are analyzed on an array of electrodes (e. g. by electrochemical impedance spectroscopy).

A schematic representation of different embodiments of DNA machines is depicted in the Figures. Fig. IA demonstrates a DNA machine comprising a DNAzyme as a detection element. A template (1), consisting of three regions is used as the "track" on which the autonomous synthesis of the DNAzyme is activated. Region I is complementary to the primer. The segment II is complementary to a nucleic acid that, upon hybridization, yields a double-strand that binds a nicking endonuclease (for example, the N.BbvC IA enzyme). The segment III is complementary to the DNAzyme that is synthesized by the machine. Upon the hybridization of the primer (2), and in the presence of exonuclease-free Klenow (Klenow fragment, exo-) polymerase, and the nucleotides mixture, dNTPs, as fuel, the machine is activated. The polymerase- induced reaction replicates the template. The replication of the template yields, however, the double stranded domain that associates N.BbvC IA, and this results in the nicking (scission) of the replicated single-strand at the marked position. The cleavage of the single-strand generates a new site for the initiation of replication. Thus, the polymerase terminates the replication of the DNAzyme, and the reactivated replication at the scission site displaces the already synthesized DNAzyme. Subsequently, in the presence of hemin, the autonomous synthesis of the G-quadruplex DNAzyme structure is activated.

Fig. IB illustrates a DNA machine comprising aggregation of oligonucleotide-modified Au NPs as a detection element. The ends of the displaced strand are complementary to the (4) — and (5)-functionalized Au NPs and, thus, the release of (3) induces aggregation and alters the optical properties of the system.

Fig. 4 illustrates an embodiment making use of an auxiliary hairpin (stem- loop) construct. This is exemplified with the analysis of Ml 3 phage DNA. The hairpin structure (3) includes in the single-stranded loop, the recognition sequence for hybridization with the Ml 3 phage DNA analyte (4), and (3) is opened upon hybridization with (4). The template of the machine (5) includes the domain I₅ that is complementary to the single-strand nucleic acid of the stem of (3), released upon hybridization with Ml 3 phage DNA, the region II, that associated the nicking enzyme, N.BbvC IA₅ in a double-stranded configuration, and the region III that is complementary to the DNAzyme sequence. The hybridization of M13 phage DNA with (3) results in the binding of the opened hairpin structure to the template (5). This activates, in the presence of the nucleotides mixture, dNTPs, polymerase, and the nicking enzyme N.BbvC IA, the autonomous operation of the machine and the synthesis of the DNAzyme.

Fig. 1OA illustrates an embodiment of activating a DNAzyme synthesizing machine by a rolling circle amplified process using circular DNA as the template. Upon recognition of the target DNA a rolling circle amplification process (RCA) is activated, and it yields chains composed of DNAzyme units. The DNAzyme units amplify the recognition events and allow the colorimetric or chemiluminescent readout of the sensing process allowing the detection of M 13 phage ssDNA with a sensitivity limit of Ix 10^"14 M. One amplification step involves the RCA synthesis of numerous DNAzyme units as a result of a single recognition (hybridization) event. The second amplification step originates from the catalytic activities of the synthesized labels that lead to the colorimetric or chemiluminescent detection of DNA.

Methods

Operation of the DNA machine for use with DNAzyme

Materials: Oligonucleotides and the "product", 5'- TGAGGCACTTTGGGTAGGGCGGGTTGGG-S' (Genosys, Sigma), the deoxynucleotide solution mixture, dNTPs, in NEBbuffer 2, 50 mM NaCl, lOmMTris/HCl, 1OmM MgCl₂, ImM dithiothreitol, pH=7.9, the N.BbvC IA endonuclease (New England BioLabs, Inc.), M13mpl 8(+) STRAND DNAand polymerase klenow fragment exo^" (Amersham Biosciences Corp), Hemin (Frontier Scientific, Inc.) were used without any further purification. A hemin stock solution was prepared in DMSO and stored in the dark at 20⁰C. The single-stranded calf thymus DNA, luminal and H₂O₂ were purchased from Sigma.

In all systems polymerase, 0.4 units, dNTPs, 0.2 mM, and the N.BbvC IA, 0.5 units, were included.

Colorimetric measurement assay for the system depicted in Fig. IA:

The experiment was performed in a solution consisting of the products; hemin, 4 x 10^"7 M, H₂O₂, 4.4 x 10^"5 M, ABTS^2", 1.82 x 10^'4 M, in a buffer solution consisting of 1OmM Tris-HCl, 1OmM MgCl₂, 50 mM NaCl, and 1 mM dithiothreitol, pH=7.9, 25⁰C. Absorbance spectra were recorded at λ=415 nm to characterize the rate of oxidation of ABTS ^2".

Colorimetric measurement assay for the system_depicted in Fig. 4:

The experiment was performed in a solution consisting of the products; hemin, 4 x 10^"7 M, H₂O₂, 4.4 x 10^"5 M, ABTS^2", 1.82 x 10^"4 M, in a buffer solution consisting of 25 mM HEPES, 2OmM KCl, and 200 mM NaCl, pH=9, 25⁰C. Absorbance spectra were recorded at λ=415 nm to characterize the rate of oxidation of ABTS ^".

Chemiluminescence measurements

Light emission experiments were performed using a photon counting spectrometer (Edinburgh Instruments, FLS 920) equipped with a cooled photomultiplier detection system, connected to a computer (F900 v.6.3 software). Measurements were made in a cuvette that included a buffer solution consisting of 25 mM HEPES, 2OmM KCl, and 200 mM NaCl, pH=9, which included hemin, 1 x 10^"9 M, 0.5mM luminal and 30 mM H₂O₂, . Chemiluminescence was monitored

Preparation of DNA-modified Au nanoparticles:

Gold nanoparticles with an average diameter of 13 nm were prepared using the citrate capping method and modified with thiolated DNA according to published protocols²⁹'³⁰. Briefly, Au nanoparticles were prepared by boiling an aqueous solution of 1 mM HauCl₄ (100 ml) under rapid stirring and adding 10 ml of a 38 mM solution of sodium citrate. After 10 more minutes of boiling, the solution was allowed to cool to room temperature, and filtered through a 0.8 μm membrane.

5 ml of this aqueous Au nanoparticle solution and thiolated DNAs 4 or 5 (Fig. IB), respectively (final concentrations of 5 μM, about 3.5 OD, each), were incubated together for 16 h under constant stirring. The solution was slowly brought up to final salt concentrations of 0.1 M NaCl and 10 mM phosphate (pH 7) and allowed to stand for 40 h. Centrifugation was performed for 40 min at 14,000 rpm in order to remove excess reagents. The precipitate was washed with a stock of 0.1 M NaCl, 10 mM phosphate buffer (pH 7) solution, recentrifuged, and finally dispersed in 0.3 M NaCl, 10 mM phosphate buffer (pH 7) to yield stock solutions of 1.5 * 10^"8 M DNA-modified Au nanoparticles.

Operation of the DNA machine for use with Au nanoparticles

1 μM of each 1 and 2 (Fig. IB) were incubated in the presence of 0.6 mM dNTPs, 0.15 U μl^"1 Klenow exo minus and 0.3 U μl^"1 of Nb. BbvC I and 1.5* 10^"9 M 4- and 5-modified Au nanoparticles, respectively, at 37° C under constant shaking (total volume was 100 μl in Ix NEBuffer 2, i.e. 50 mM NaCl, 10 mM TRIS-HCl, 10 mM MgCl₂, 1 mM Dithiothreitol, pH 7.9) for the chosen time interval. For time-dependence measurements, the incubation was performed in a cuvette, which was kept at 37° C, regularly vortexed with a pipette, and measured at the relevant times. For the M13 phage detection, 2 was substituted by 6 (1*10^"9 M)₅. and M 13 DNA was added in the appropriate amount. To calibrate the DNA detection sensor system, the absorption value at 525 nm of each concentration was divided by the corresponding value at 700 nm.

TEM images were obtained by drying a 10 μl drop of the machine solution on a 3 mm copper TEM grid and studied using a Tecnai F20 G2 (FEI, Hillsboro, USA).

Circular DNA template preparation

The circular DNA template was prepared as follows: First, the linear DNA (5'-GATCCTAACCCAACCCGCCCTACCCAAAAC

CCAACCCGCCCTACCCAAAACCCAACCCGCCCTACCCAACCACAC-B'), 6x10-6 M, was phosphorylated using T4 polynucleotide kinase, 0.4 units/μl, the ligation template (5'-TTAGGATCGTGTGGTT^'), 3.6X10-⁵ M, and Quick Ligation™ Kit buffer, at 37° C for 30 min. The synthesis was completed by the Quick Ligation™ Kit, using the manufacturer-supplied protocol. The enzymes were denatured by heating at 90° C for 10 min. The ligated circular DNA was then purified and separated from the ligation template by urea, 8 M, using a centricon filtration device (10,000 cutoff, Millipore Inc.).

RCA assay.

In all systems fixed concentrations of the hairpin (4), 2χlO^"7 M and the circular DNA (2), 2x10^" M were employed. Polymerase Klenow exo-, 0.4 units/μl and dNTPs, 0.2 mM were included. The RCA process was performed in a buffer solution consisting of 50 mM Tris-HCl, pH 7.5, 10 mM MgCl₂, 1 mM DTT and 50 μg/ml BSA. Colorimetric / Chemiluminescence measurements following RCA

. Colorimetric measurement The experiment was performed in a solution consisting of the products; hemin, 4 x 10^"7 M; H₂O₂, 4.4 x 10^"5 M; ABTS^2', 1.82 x 10^~4 M in a buffer solution consisting of 25 mM HEPES, 20 mM KCl and 200 niM NaCl, pH 7.4, 25° C. Absorbance changes at 415 nm were followed to characterize the rate of the oxidation of ABTS^2".

Chemiluminescence measurements Light emission experiments were performed using a photon counting spectrometer (Edinburgh Instruments, FLS 920) equipped with a cooled photomultiplier detection system, connected to a computer (F900 v.6.3 software). Measurements were made in a cuvette that included a buffer solution consisting of 25 mM HEPES, 20 mM KCl and 200 mM NaCl, pH 9.0, which included the product; hemin, I x 10^'9 M; 0.5 mM luminol and 30 mM H₂O₂. The light emission was monitored at λ_em=420 nm.

Operation of aptamer-based DNA machine

Light emission was measured using a photon counting spectrometer (Edinburgh Instruments, FLS 920) equipped with a cooled photomultiplier detection system, connected to a computer (F900 v. 6.3 software).

The nucleic acids were obtained from Sigma Genosys, Inc. The following oligonucleotide sequences were used: DNA-"track" (1)

3^f-CCC TCT GGG TGA AGT AAC TTC CTA AAT AGG AAC AGA GGG GGA GTC GTT TTATA TTA TTA CG -5¹ DNA-blocker (Ia)

3'- CTT ACT CCCCC TCTG-5' DNA-"waste product" (4)

3'-GCT AAT AAT ATA AAA CGA CTG -5' DNA-beacon (5)

3 '-TAMRA- ATC GC AGT CG TT TTA TA TTA TTA GC GAT-

FAM -5'

The deoxynucleotide solution mixture (dNTPs) in NEB buffer solution, and the NtBbvC I endonuclease were purchased from New England BioLabs, Inc. Polymerase Klenow fragment exo- was obtained from Amersham Biosciences Corp.

Example 1

Fig. 2(A) shows the rate of ABTS2- oxidation by H2O2 in the presence of the DNAzymes generated within 5 minutes using different concentrations of the template DNA. As the concentration of the template increases, the formation of oxidized ABTS^2" is enhanced, implying an increased content of the generated DNAzyme. Control experiments indicate that no oxidation of ABTS^2" by H₂O₂ occurs in the absence of hemin, or in the presence of hemin without the generation of the nucleic acid sequence that generates the DNAzyme. Furthermore, the exclusion of either the nicking endonuclease, or polymerase, or the dNTPs mixture prohibits the biocatalytic oxidation of ABTS^2". Thus, the cooperative polymerization by polymerase, and scission by the nicking enzyme, is essential to self-assemble the DNAzyme in the presence of hemin. The operation of the biomolecular machine was readout by chemiluminescence signals, Fig. 1. The DNAzyme catalyzes the generation of chemiluminescence in the presence of uminal/H₂O₂. Fig. 2(B) shows the chemiluminescence intensities generated by the DNAzymes formed by the biomolecular machine after a time-interval of 90 min., in the presence of variable concentrations of the template (1). The chemiluminescence intensities are enhanced, as the concentration of the template is higher, indicating that the contents of the synthesized DNAzymes increase with the template concentration. As before, the different control experiments indicate that all of the components included in the system are essential to drive the synthesis and self-assembly of the DNAzymes. Fig. 2(C) shows the rate of oxidation of ABTS^2" by H₂O₂ in the presence of DNAzyme units generated by the biomolecular machine, in the presence of a constant concentration of the template (1), IxIO^"6 M, at different time-intervals. The rate of ABTS^2' oxidation is enhanced as the time interval for formation of the DNAzymes is prolonged. Fig. 2(D) shows the light intensities generated by DNAzymes formed in the presence of a fixed concentration of the template (1), 1 x 10^"6 M, at different time- intervals of the machine operation. As the operation of the biomolecular machine is prolonged, the emitted light intensities are higher, indicating increased contents of the DNAzyme.

Example 2

The autonomous synthesis of the DNAzyme units, via the operation of the DNA machine, is further confirmed by electrophoretic experiments. Fig. 3 depicts the electrophoresis results corresponding to the operation of the DNA machine that synthesized the DNAzymes upon analyzing the model primer DNA (2). Runs (a) to (e) show the resulting nucleic acid bands generated at different time- intervals by the machine. As the operation of the machine is prolonged, the content of the DNAzyme product increases, as expected (note that at t=0 min. no DNAzyme is present). Furthermore, a new band that corresponds in its size to the original template is intensified, as the operation of the DNA machine is prolonged. This band is attributed to the non-nicked nucleic acid product, which is dissociated from the double-strand by a thermal treatment prior to the electrophoresis (the heat treatment deactivates the enzymes, and allows the imaging of the system at a defined time interval. Note that the formation of the double-strand between the non-nicked product, and the template, is inhibited by the competitive association of the excess of DNAzyme to the template). Example 3

• The general scheme of the method described in the example is depicted in Fig. 4, described above. Fig. 5(A) shows the rate of ABTS^2" oxidation by the hemin-functionalized DNAzyme synthesized by the template (5), upon analyzing different concentrations of Ml 3 phage DNA. The control experiment, where calf thymus DNA, I xIO^"8 M, is examined by the DNA template does not lead to any DNAzyme formation and yields a trace oxidation of ABTS^2", Fig. 5(A), curve (e). Also, in the absence of the Ml 3 phage DNA, or upon exclusion of the hairpin (3), no oxidation of ABTS^2" occurs. As the concentration of the analyte decreases, the rate of ABTS^2" oxidation decreases, implying that less DNAzyme is synthesized by the machine. The control experiments reveal that the analysis of Ml 3 phage DNA is specific, and that the analyte can be detected with a sensitivity limit that corresponds to IxIO^"14 M. The analysis of the Ml 3 phage ssDNA was also readout by the DNAzyme-generated chemiluminescence, Fig. 5(B). The generated chemiluminescence decreases in its intensity as the concentration of Ml 3 phage DNA is lowered, and a foreign DNA leads to a trace chemiluminescence. Fig. 5(C) shows the rate of ABTS ^" oxidation by the DNAzyme synthesized by the machine at different time-intervals of operation, and upon analyzing a fixed M13 phage DNA concentration of Ix IO^"9 M. As the time-interval for operating the machine is prolonged, the rate of ABTS ^" oxidation is enhanced, indicating that the content of synthesized DNAzyme increases with the operating time of the machine. Also, upon analyzing a fixed concentration of Ml 3 phage DNA, the chemiluminescence is intensified as the operation time of the DNA machine is prolonged, Fig. 5(D).

Example 4

The following example illustrates a DNA machine comprising aggregation of oligonucleotide-modified Au Nanoparticles as a detection element (Fig. IB). The ends of the displaced strand are complementary to nucleotide functionalized Au NPs and, thus, the release of the displaced strand induces aggregation and alters the optical properties of the system.

The following oligonucleotides were used in this experiment (the numbers correspond to the schematic illustration in Fig. IB):

1: 5' GCGCGAACCGTATATCTATCCTACGCTCCTCAGCCCA CAC

GAT CCT 3;

2: 5' AGGATCGTGTGG 3';

4: 5' SH-(CH₂)₆-GCGCGAACCGTATA 3';

5: 5' TCTATCCTACGCT-(CH₂)₆-SH 3';

6: 5' CACACGCAAAAAGATTAAGAGAGGATCGTGTGG S' The modified Au NPs (13 nm) are prepared by citrate reduction of HauCl₄ and functionalized with the thiolated oligonucleotides, and their loading is determined spectroscopically to be ca. 150 molecules per particle. Fig. 6(A) shows the time-dependent spectral changes of the system upon interaction of (1) with (2) and triggering of the machine function,_ and analyzing the product (3) generation through the aggregation of the (4)- and (5)-functionalized Au nanoparticles by the product (3). The absorbance of the individual Au NPs at 525 nm decreases, while a broad red-shifted band is intensified, consistent with the aggregation of the Au NPs⁴⁰. Control experiments verified that all of the components are essential to induce the aggregation process, and exclusions of either (2), polymerase, dNTPs or the nicking enzyme prohibits the aggregation process. These results depicted in Fig. 6(A) show that the spectral changes in the system are intensified as the time-interval for the operation of the machine is prolonged. This is consistent with the fact that at longer time-intervals of operating the machine the content of (3) increases, thus enhancing the aggregation process. Fig. 6(B) shows the spectral changes occurring in machine-activated systems where the assemblies include different concentrations (1 *1 (T⁶ to l *10^~9 M) of the template (1), a constant concentration of 2 (l*10^~6 M), and a fixed time interval for the operation of the machine (120 minutes). As the concentration of the template increases, the spectral features that correspond to aggregated Au NPs are intensified, consistent with the fact that elevated amounts of the NP bridging units (3) are synthesized.

Further support that the operation of the DNA machine results in the aggregation of the Au NPs is obtained from microscopy experiments. Fig. 7(A) shows the TEM image of the clusters of the Au NP aggregates generated by the DNA machine after a time-interval of 120 minutes. For comparison, Fig. 7(B) depicts the control system, where the track nucleic acid is reacted with a non- hybridizing ^N DNA (that substitutes (2)) in the presence of dNTPs/polymerase/nicking enzyme. While only individual Au NPs are observed in the control system, clusters of aggregated NPs consisting of 4 to 8 NPs are observed in the case of the active machine. The extent of the aggregation is controlled by the time-intervals used to operate the DNA machine, and as the operation time is prolonged, the degree of the nanoparticle aggregation increases.

The aggregation of the NPs by the polymerase/Nb. BbvC I activated synthesis of (3) on the template can be used as a colorimetric assay for the amplified analysis of a target DNA, and this is exemplified here with the detection of M 13 phage DNA, Fig. 8. Towards this goal, a hairpin nucleic acid structure, (6) is designed. It includes in its single-stranded loop a sequence complementary to a domain in the Ml 3 phage, and one part of the stem structure is complementary to the primer domain of the machine-template. The hybridization of the hairpin (6) with M 13 phage DNA results in its opening, and the subsequent hybridization of the opened stem with the machine-track. The association of the opened hairpin to (1) triggers the machine's operation, the synthesis of (3) as the nucleic acid product, resulting in the aggregation of the Au NPs. Fig. 9(A) depicts the spectral changes caused by the machine-induced aggregation of the NPs, upon analyzing different concentrations of M 13 phage DNA, l*10^"9 to l*10^"12 M. In these experiments, a constant concentration of the template was used, and the machine was activated for a fixed time-interval of 120 minutes. As before, the activation of the machine induces the aggregation of the Au NPs, evident by the decrease in the plasmon absorbance of the individual Au NPs and the increase in the red-shifted absorbance originating from the coupled interparticle plasmons. As the concentration of Ml 3 phage is higher, the yield of production of (3) increases, and the aggregation of the NPs is enhanced. Control experiments indicate that the system is specific. The substitution of the Ml 3 phage DNA with the foreign calf thymus DNA does not activate the machine and no noticeable aggregation of the Au NPs was observed. Also, the hairpin structure, (5), is sufficiently stable in its closed form to prevent the self-activation of the machine. These results clearly indicate that the specific hybridization of the target DNA with the hairpin structure is essential to trigger on the machine functions and to induce the aggregation of the NPs. The method enables the analysis of M13 phage DNA with a sensitivity limit that corresponds to l*10^"12 M (see calibration curve, Fig. 9(B)).

Example 5

The concept of activating a DNAzyme synthesizing machine by the RCA process is depicted in Fig. 10. The circular DNA was constructed from 75 bases that include one segment, A, complementary to the primer (1), and three segments B, C, and D, each complementary to the DNAzyme, where the segments are separated one from another by a sequence of 4 bases. The cyclic DNA was prepared by the hybridization of the ends of linear (2) with the nucleic acid (1) followed by phosphorylation of the nucleic acid with kinase, and ligation of the two ends with ligase to form the circular DNA (2).

Fig. HA depicts the rate of ABTS ^" oxidation by the DNAzymes synthesized by the RCA process, using a fixed concentration of the primer, (1), and variable time-intervals for the RCA reaction. As the RCA process is prolonged, more DNAzyme units are generated, and the oxidation of ABTS^2" is enhanced. Control experiments reveal that the interaction of a non-ligated circular ssDNA with the primer (1) does not lead, in the presence of dNTPs/polymerase, to any replication of the DNAzyme chain (Fig. HA, curve-E). Other control experiments that were performed revealed that no ABTS^2" oxidation was observed upon performing the RCA of the nucleic acid chains in the presence of (1) and dNTPs/polymerase, but in the absence of hemin. Also, no oxidation of ABTS^2" was observed when (1) was interacted with the circular DNA (2) in the absence of either the dNTPs or polymerase. These results imply that only (1) triggers the RCA reaction and the synthesis of the DNAzyme units (hemin intercalated in the G-quadruplex units), that catalyze the oxidation of ABTS ^".

The synthesis of the DNAzyme chains by the RCA process was also followed by chemiluminescence. Fig. 1 IB shows the integrated light intensities generated by the DNAzyme chains synthesized by the RCA process, using a fixed concentration of the primer (1), and H2O2/luminol as the substrates that stimulate the light emission. As the RCA reaction is prolonged, the content of synthesized DNAzymes increases and the resulting chemiluminescence is enhanced.

The synthesis of the DNAzyme chains through the RCA process was further supported by electrophoresis and atomic force microscopy (AFM) studies. Fig. 12a depicts the electrophoretic results corresponding to the products formed by the RCA system at time intervals of reactions. It is evident that as the RCA process is prolonged products of higher molecular weights are generated and ca. 1,500 bp-containing nucleic acid products are formed. Figs. 12 b and 12c show the AFM images of the resulting DNA products. Numerous nucleic acids exhibiting lengths of 20 to 30 nm (60 to 100 bp, respectively) are observed together with substantially longer DNA chains (Fig. 12b). Also, very long, micrometer-long, DNA chains (Fig. 12c) could be detected.

The RCA reaction synthesizing DNAzymes may be used as a versatile catalytic process for the amplified analysis of any DNA. Fig. 13 presents the method to trigger the RCA process upon analyzing the ssDNA Ml 3 phage, (3), that includes 7229 bases. A hairpin nucleic acid, (4), consisting of a single- stranded loop complementary to the Ml 3 phage ssDNA is designed. The hairpin nucleic acid (4) opens upon hybridization with Ml 3 phage and the opening of the hairpin stem yields a single-stranded tether acting as primer that binds to segment of the circular DNA (2). The hybridization of the resulting tethered primer to the circular DNA (2) triggers, in the presence of dNTPs/polymerase, the RCA process, and the synthesis of the DNAzyme units. Fig. 14A shows the rate of ABTS^2" oxidation by the DNAzyme synthesized by the RCA upon analyzing different concentrations of Ml 3 phage ssDNA. As the concentration of Ml 3 phage increases more of the primer units (4)/ (2) are generated, and more RCA cycles are activated, leading to an increased content of the DNAzyme. Control experiment (Fig. 14A, curve-B) shows where the foreign calf thymus DNA, IxIO^"8 M, is analyzed in the presence of the circular DNA (2), according to Fig. 13. A minute rate of ABTS^2" oxidation by the free hemin in the system is observed. This rate of ABTS ^' oxidation may be considered as the background noise level of the system. Fig. 14B shows the integrated light intensities observed upon analyzing different concentrations of Ml 3 phage ssDNA according to Fig. 13, using chemiluminescence as the readout signal. As before, as the concentration of the Ml 3 phage is higher, more DNAzyme units are synthesized, and the resulting light emission is intensified.

Example 6

The following example illustrates an autonomous DNA machine that amplifies a recognition event between a DNA molecule (an "aptamer") and a small molecule analyte (e.g. cocaine) through the operation of the machine.

The operation of the machine and the readout of the analysis of the substrate are accomplished by a fluorescence signal.

Fig. 15 outlines the principles for analyzing cocaine by the aptamer-based machines. The nucleic acid 1 provides the skeleton that self-assembles to the "functional" machine in the presence of cocaine, 2. The nucleic acid 1 consists of three regions. Region I includes the aptamer region for cocaine. Region II is the "heart" of the machine, and upon a formation of a double strand of this region a nicking site for Nt.BbvC I is formed. Region III consists of a sequence that is complementary to the nucleic acid sequence that is designed to act as a "product" that leads to the transduction of the cocaine-activated machine. The nucleic acid 1 is blocked with the nucleic acid Ia to prevent uncontrolled folding of 1 to an active "machine" configuration. The double-strand 1/1 a is interacted with polymerase, dNTPs mixture, and the nicking enzyme Nt.BbvC I. This assembly exists in an active mute configuration. Note that the blocker Ia is terminated at the 3'-end with a Homain non-complementary base to prevent undesired replication of the 1/1 a assembly.

Addition of cocaine 2 to the system separated the blocked double-stranded assembly and folds the aptamer into its stable aptamer- cocaine complex, 3, that includes a 7-base duplex structure that can initiate replication. In the presence of the dNTPs mixture, the polymerase-induced replication of the single-stranded domain activates the autonomous operation of the machine. Replication of the single strand yields the duplex that includes the nicking site for Nt.BbvC I. Scission of the replicated strand results in a new replication site for polymerase and the concomitant replacement of the nicked strand 4. The system includes as reporter unit the hairpin nucleic acid 5, that is substituted at the end of the stem with the dyes, FAM and TAMRA. In the closed configuration of the hairpin, 5, the photo-excitation of FAM at λ=480 nm results in the fluorescence resonance energy transfer (FRET) to TAMRA and the fluorescence of TAMRA at 580 nm, with only a residual minute emission of FAM at 520 nm. The displaced nucleic acid generated by the machine, 4, is, however, complementary to the single stranded loop of 5. This leads to the hybridization of 4 with 5, resulting in the hairpin opening. The spatial separation of the dyes prohibits the FRET process between the donor-acceptor pair of dyes, resulting in the emission from the FAM component. Fig. 16 shows the changes in the fluorescence of FAM at time intervals of operation of the machine, upon analyzing cocaine at a concentration corresponding to 0.4mM. As the time interval for operating the machine is prolonged, the fluorescence of FAM is intensified. The time-dependent operation of the "machine" reveals, however, an induction time and an "S"-shape kinetics. This is because a sufficiently high concentration of the product, 4, must be accumulated to stimulate the opening of 5 at a reasonable rate.

Fig. 17 shows the changes in the fluorescence intensities of the system upon analyzing different concentrations of cocaine by the aptamer-based machine 1/1 a. The machine was operated for 60 min, followed by 10 min of beacon opening. The inset in Fig. 17 shows the respective calibration curve. Using a time- interval of 60 min for operating the machine, the detection limit for analyzing cocaine is 5x10⁶M.

Control experiments revealed that the 1/1 a system generated a small background fluorescence of FAM upon operating,, the machine in the absence of cocaine. This background fluorescence is attributed to minute quantities of unhybridized 1 that folds to the active aptamer structure that activates the machine even in the absence of cocaine. Similarly, treatment of the machine 1/1 a with the foreign substrate adenosine leads only to the residual fluorescence observed in the absence of cocaine, indicating that the machine 1/la is selectively activated by the cocaine substrate.

Further support that confirms the activation of the aptamer machine by cocaine was obtained by complementary gel-electrophoresis experiments, Fig. 16. The runs f and g correspond to the system where the machine is activated for 1 h using 0.4mM and ImM of cocaine, respectively; product 4 is generated in the absence of the probing beacon 5. As the concentration of cocaine increases, the band of 4 is intensified, consistent with the enhanced formation of the product.

Thus, the above example demonstrates the novel amplified detection of a small molecule by an aptamer-based machine. REFERENCES

1) Patolsky, F., Lichtenstein, A. And Willner L, Nat. Biotechnol. 19, 253 - 257 (2001).

2) Y. Xiao et al., J. Am. Chem. Soc. 126, 7430 (2004)

3) J. Wang, G. Liu, A. Merkoci, J. Am. Chem. Soc. 125, 3214 (2003)

4) J. Wang, O. Rincon, R. Polsky, E. Dominguez, Electrochem. Commun. 5, 83 (2003) _x

5) F. C. Simmel, W. U. Dittmer, Small 1 ,284 (2005)

6) J. Liu, Y. Lu, J. Am. Chem. Soc. 125, 6642 (2003)

7) B. Yurke, A. J. Turberfield, A. P. Mills Jr., F. C. Simmel, J. L. Neumann , Nature 406, 605 (2000)

8) J.-S. Shin, N. A. Pierce, J. Am. Chem. Soc. 126, 10834 (2004)

9) W. B. Sherman, N. C. Seeman, Nano Lett. 4, 1203 (2004)

10) P. Yin et al., Angew. Chem. Int. Ed. 43, 4906 (2004)

11) J. Bath, S. J. Green, A. J. Turberfield, Angew. Chem. Int. Ed. 44, 4358 (2005)

12) P. Alberti and J.-L. Mergny, Proc. Natl. Acad. Sci. USA 100, 1569 (2003)

13) Y. Benenson et al., Nature 429, 423 (2004)

14) Y. Benenson et al., Proc. Natl. Acad. Sci. USA 100, 2191 (2003)

15) M. N. Stojanovic, D. Stefanovic, Nat. Biotechnol. 21, 1069 (2003)

16) Y. Weizmann. Z. Cheglakov, V. Pavlov, I. Willner, Angew. Chem. Int. Ed. 45, 2238 (2006)

17) S. Beyer, F. C. Simmel, Nucl. Acid Res. 34, 1581 (2004)

18) P. Travascio, P. K. Witting, A. G. Mauk, D. Sen, J. Am. Chem. Soc. 123, 1337 (2001)

19) P. Travascio, Y. Li, D. Sen, Chem. Biol. 5, 505 (1998)

20) T. Niazov, V. Pavlov, Y. Xiao, R. Gill, I. Willner, Nano Lett. 4, 1683 (2004)

21) J. J. Li and W. Tan, Nano Lett., 2, 315-318 (2002) 22) C. Fan, K. W. Plaxco, and A. J. Heeger, Proc. Natl. Acad. Sci. USA, 100, . 9134-9137 (2003)

23) Y. Xiao, A. A. Lubin, A. J. Heeger, and K. W. Plaxco, Angew. Chem. Int. Ed. Engl., 44, 5456-5459 (2005)

24) R. Elghanian, J. J. Storhoff, R. C. Mucic, R. L. Letsinger, and C. A. Mirkin, Science, 277, 1078-1081 (1997)

25) J. J. Storhoff, R. Elghanian, R. C. Mucic, C. A. Mirkin, and R. L. Letsinger, J. Am. Chem. Soc, 120, 1959-1964 (1998)

26) C. J. Loweth, W. B. Caldwell, X. Peng, A. P. Alivisatos and P. G. Shultz, Angew. Chem. Int. Ed. Engl, 38, 1808-1812 (1999)

27) J. Liu and Y. Lu, J. Am. Chem. Soc, 125, 6642-6643 (2003)

28) J. Liu, D. P. Wernette, and Y. Lu, Angew. Chem. Int. Ed. Engl., 44, 7290- 7293 (2005)

29) K. C. Grabar, R. G. Freeman, M. C. Hommer, and M. J. Natan, Anal. Chem., 67, 735-743 (1995)

30) J. J. Storhoff, R. Elghanian, R. C. Mucic, C. A. Mirkin, and R. L. Letsinger, J. Am. Chem. Soc, 120, 1959-1964 (1998)

31) Weizmann, Y, Patolsky, F., Katz, E, J. Am. Chem. Soc 125, 3452-3454 (2003).

32) Kelley, S. O, Barton, J. K., Bioconjugate Chem. 8, 31-37 (1997).

33) Storhoff, J. J., Lazarides, A. A, Mucic, R., Mirkin, C. A, Letsinger, R, J. Am. Chem. Soc. 122, 4640-4650 (2000).

34) Taton, T. A, Mirkin, C. A., Letsinger, R. L, Science 289, 1757-1760 (2000).

35) Patolsky, F., Ranjit, K. T, Lichtenstein, A, Willner, I, Chem. Commun. 12,1025-1026 (2000).

36) Lizardi, P.M., at al., Nat. Genet. 19, 225 - 232 (1998).

37) Zhao, W., Gao, Y., Kandadai, S. A., Brook, M. A., Li, Y. Angew. Chem. Int. Ed. 45, 2409 -2413 (2006).

38) Fire, A. & Xu, S.Q. Proc Natl Acad. Sci. USA 92, 4641^645 (1995).

Claims

1. . A nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to sequence A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, yields synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected.

2. A nucleotide construct according to claim 1, comprising a sequence C between sequences A and B, sequence C together with a complementary sequence C hybridized thereto forming a recognition site for an endonuclease that nicks the complementary sequence; said synthesis, yielding a complementary stretch that comprises in the 5' to 3' direction sequences A', C and B', whereupon after nicking at sequence C, the 3' portion of the synthesized stretch comprising sequence B' is freed.

3. A nucleotide construct according to claim 1 or 2, wherein B' has a catalytic nucleotide sequence.

4. A nucleotide construct according to claim 3, wherein following its synthesis sequence B' folds to assume a three-dimensional structure in which it becomes catalytically active.

5. A nucleotide construct according to claim 3 or 4, wherein the catalytic activity gives rise to synthesis or degradation of detectable product.

6. A nucleotide construct according to claim 1, being circular, whereby said synthesis gives rise to a long stretch of nucleotides with multiple repeats of sequence B'.

7. A nucleotide construct according to claim 6, wherein following their synthesis a plurality of sequences B' fold to assume a three-dimensional structure in which they become catalytically active, giving rise to a nucleic acid molecule with a plurality of catalytic domains.

8. A nucleotide construct according to claim 1 or 2, wherein B' has a sequence that is complementary to a sequence in a nucleotide stretch bound to a substrate.

9. A nucleotide construct according to any of claims 1-8, comprising a sequence A', which is in a state in which it is not hybridized to sequence A and becomes hybridized thereto in the presence of a specific analyte.

10. An assay system comprising a nucleotide construct according to any one of claims 1-9.

11. An assay system according to claim 10, comprising an auxiliary construct being a nucleotide construct that comprises a sequence A', said sequence A' in the auxiliary construct is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte.

12. An assay system according to claim 11, wherein said auxiliary construct has a stem-loop structure, having a double-stranded portion with the two strands thereof being linked to one another via a loop; sequence A' being included in one of the two strands of the stem.

13. An assay system according to claim 11 or 12, wherein the analyte is a nucleic acid molecule.

14. An assay system according to claim 13, wherein the analyte is a viral DNA or RNA.

15. An assay system according to claim 11 or 12, wherein the analyte is a small molecule substrate.

16. An assay system according to claim 11 or 12, wherein the analyte is a macromolecule.

17. An assay system according to claim 12, wherein the loop of said auxiliary construct comprises a sequence D complementary to sequence D' in the analyte nucleic acid molecule; upon hybridization of said D' sequences with said D sequence, the stem-loop structure opens and the two initially hybridized stems are released from one another, whereby sequence A' of one of the stems can hybridize with sequence A in said nucleotide construct.

18. An assay system according to any of 19-28, comprising enzymes and nucleotides.

19. An assay system according to 18, wherein said enzymes comprise DNA or RNA polymerase and an enzyme that can cleave a specific nucleic acid sequence.

20. A method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, the method comprising the following steps carried out in the specified order, another order or one or more being carried out simultaneously:

(d) assaying the presence of synthesized sequence B ' .

21. A method for detecting an analyte in a medium, the method comprising the following steps carried out in the specified order, another order or one or more being carried out simultaneously:

(a) providing a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, yields synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that. upon becoming freed from said construct may be detected;

(d) assaying the presence of synthesized sequence B ' .

22. A method according to claim 20 or 21, wherein (c) comprises providing a DNA or RNA polymerase and free nucleotides.

23. A method according to any one of claims 21-23, wherein:

(i) said construct comprises a sequence C_ between sequences A and B, sequence C together with a complementary sequence C hybridized thereto forming a recognition site for an endonuclease that nicks the complementary sequence; said synthesis, yielding a complementary stretch that comprises in the 5 ' to 3' direction sequences A', C and B', whereupon after nicking at sequence C, the 3' portion of the synthesized stretch comprising sequence B' is freed; and

(ii) step (c) comprises providing conditions for synthesis of a nucleotide stretch that comprises a sequence C and B', in which sequence A' serves as a primer, and conditions for nicking sequence C after its formation.

24. A method according to claim 23, wherein (c) comprises providing a DNA or RNA polymerase, free nucleotides and an enzyme for nicking sequence C.

25. A method according to claim 20, wherein said target nucleotide sequence is a sequence A' included in an auxiliary construct being a nucleotide construct in which said sequence A' is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte.

26. A method according to claim 25, wherein said auxiliary construct has a stem-loop structure in which the construct's stems are hybridized to one another; sequence A' being included in one of the two stems.

27. A method according to claim 27, wherein the loop of said auxiliary construct comprises a sequence D complementary to sequence D' in the analyte nucleic acid molecule; upon hybridization of said D' sequences with said D sequence, the^sstem-loop structure opens and the two initially hybridized stems are released from one another, whereby sequence A' of one of the stems can hybridize with sequence A in said nucleotide construct.

28. A method according to claim 21, wherein the target nucleotide sequence is a sequence included in a DNA or RNA of a microorganism.

29. A method according to claim 21, wherein the analyte is a small molecule substrate or a macromolecule.

30. A method according to any one of claims 21-29, wherein B' has a catalytic nucleotide sequence and following synthesis said sequence B' assume a three- dimensional structure in which it becomes catalytically active.

31. A method according to claim 30, wherein (d) comprises the following steps carried out in the specified order, another order or one or more being carried out simultaneously:

(d3) determining existence and optional amount of the reaction product.

32. A method according to any one of claims 21-31, wherein said nucleotide construct is circular and said synthesis gives rise to a long stretch of nucleotides with multiple repeats of sequence B'.

33. A method according to claim 32, wherein following their synthesis a plurality of sequences B' fold to assume a three-dimensional structure in which they become catalytically active, giving rise to a nucleic acid molecule with a plurality of catalytic domains.

34. A method according to any one of claims 21-29, wherein (d) comprises the following steps carried out in the specified order, reverse order or simultaneously:

35. A method according to claim 34, wherein said substrate comprises colloidal particles, and in the presence of nucleotide molecules of sequence B' said particles aggregate and said detecting comprises measuring change in properties as a result of the aggregation.

36. A method according to claim 35, comprising first particles with an immobilized nucleotide strand comprising a sequence El and second particles with an immobilized nucleotide strand comprising a sequence E2, each of El and E2 being each complementary to a different portion of sequence B'.

37. A method according to claim 34, wherein said substrate is a solid substrate of a sensor adapted to sense binding of nucleotide molecules thereto.

38. A method for detecting an analyte in an assay system, the method comprising the following steps carried out in the specified order, another order or one or more being carried out simultaneously:

(al) providing a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides, permitting an A'-primed synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; sequence B' being a reporting sequence that upon becoming freed from said construct may be detected; (a2) providing an auxiliary construct being a nucleotide construct that comprises a sequence A', said sequence A' in the auxiliary construct is in a state in which its hybridization to a complementary sequence is initially inhibited but becomes hybridizable upon contact of the auxiliary construct with an analyte;

(d) assaying the presence of synthesized sequence B ' .

39. A method according to claim 38 for detecting the presence of an analyte nucleic acid molecule, wherein said auxiliary construct has a stem-loop structure with a double-stranded stem the two strands of which being linked to one another through a nucleotide loop, sequence A' being included in one of the two strands forming the stem and the loop of said auxiliary construct comprises a sequence D complementary to a sequence D' in the analyte nucleic acid molecule; upon hybridization of said D' sequences with said D sequence, the stem-loop structure opens and the two initially hybridized stems are dissociated from one another, whereby sequence A' of one of the stems can hybridize with sequence A in said nucleotide construct.

40. A method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, comprising (the steps outlined below being performed in the written or any other order or are all carried out simultaneously):

(a) providing a nucleotide construct, comprising: a sequence A and a sequence B on a single nucleotide stretch, sequence B being on the 5' side of sequence A; sequence A being complementary to A', hybridization of sequence A' to the sequence A in the presence of a polymerase and nucleotides permitting an A' -primed synthesis of a complementary stretch of nucleic acids which comprises a sequence B' that is complementary to sequence B; B' having the sequence of a catalytic nucleic acid that following synthesis can assume a three-dimensional structure in which it becomes catalytically active;

41. A method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, comprising (the steps outlined below being performed in the written or any other order or are all carried out simultaneously):

(c) providing conditions for synthesis of a nucleotide stretch that comprises a sequence C-B', in which synthesis sequence A' serves as a primer and a nicking enzyme for nicking sequence C; and (d) assaying the presence of synthesized sequence B ' .

42. , A method for detecting a target nucleotide sequence comprising a sequence A' in an assay sample, comprising (the steps outlined below being performed in the written or any other order or are all carried out simultaneously):

(c) providing conditions for synthesis of a nucleotide stretch that comprises a plurality of sequences B', in which synthesis sequence A' serves as a primer; and

(d) providing (i) conditions for said catalytic domains to become catalytically active, and (ii) a substrate for the catalytic activity of the catalytically active B' to yield a reaction product; and determining existence and optional amount of the reaction product.

43. A method for detecting a target small molecule substrate in an assay sample, comprising (steps outlined below being performed in the written or any other order or are all carried out simultaneously):

(a) providing a nucleotide construct, comprising: a sequence A, a sequence B and a sequence C between A and B, on a single nucleotide stretch, sequence B being on the 5' side of sequence A; binding of sequence A to the small molecule substrate in the presence of a polymerase and nucleotides, induces a conformational change permitting hybridization of a sequence A' to sequence A, sequence A' being complementary to sequence A; said hybridization permitting synthesis of a complementary stretch of nucleic acids which comprises a sequence C that is complementary to C and sequence B' that is complementary to sequence B, with A' serving as the synthesis primer; C having a sequence such that C together with a complementary sequence C hybridized thereto forming a recognition site for an endonuclease that nicks the complementary sequence; sequence B' being a reporting sequence that upon becoming freed from said construct may^xbe detected;

(c) providing conditions such that upon formation of an A' -A hybrid, a nucleotide stretch that comprises a sequence C-B' is synthesized, and providing a nicking enzyme for nicking sequence C; and

(d) assaying the presence of synthesized sequence B ' .