WO2007147159A2 - Functional nucleic acid ligands to fluorescent proteins - Google Patents

Functional nucleic acid ligands to fluorescent proteins Download PDF

Info

Publication number
WO2007147159A2
WO2007147159A2 PCT/US2007/071470 US2007071470W WO2007147159A2 WO 2007147159 A2 WO2007147159 A2 WO 2007147159A2 US 2007071470 W US2007071470 W US 2007071470W WO 2007147159 A2 WO2007147159 A2 WO 2007147159A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
fluorescent protein
aptamer
fluorescence
molecular complex
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/071470
Other languages
French (fr)
Other versions
WO2007147159A3 (en
Inventor
Michael Kotlikoff
John T. Lis
Bo Shui
Hua Shi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cornell Research Foundation Inc
Original Assignee
Cornell Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cornell Research Foundation Inc filed Critical Cornell Research Foundation Inc
Priority to US12/305,102 priority Critical patent/US8445655B2/en
Publication of WO2007147159A2 publication Critical patent/WO2007147159A2/en
Anticipated expiration legal-status Critical
Publication of WO2007147159A3 publication Critical patent/WO2007147159A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids

Definitions

  • This invention relates to nucleic acid aptamers that bind fluorescent proteins, aptamer-fluorescent protein complexes, their expression, and methods of
  • GFP In the jellyfish from which it was isolated, GFP is involved in physiological interactions with the biolummescent protein aequorm and shifts its blue light absorption to green light emission through energy transfer In most applications of GFP, this dual-component configuration is not recapitulated, and the excitation of GFP or its derivatives is afforded through optical instrumentation Other than aequorm, one type of molecule that binds directly to GFP and its derivatives has been developed These are antibodies, both polyclonal and monoclonal, which are usually used for signal amplification purposes when the GFP signal is too weak, or the protein has been denatured and is no longer fluorescent In the methods utilizing these antibodies, GFP and its derivatives are treated as generic protein tags, and as such the invention of GFP antibodies and the utility thereof resides within the scope of conventional lmmuno-chemistry
  • the present invention is directed to overcoming these and other limitations in fluorescent protein technology
  • a first aspect of the present invention relates to a nucleic acid aptamer having a first domain that binds to a fluorescent protein [0011]
  • a second aspect of the present invention relates to a molecular complex containing the nucleic acid aptamer according to the first aspect of the present invention, with the nucleic acid aptamer bound to a fluorescent protein at the first domain
  • a host cell containing the molecular complex is also described
  • a third aspect of the present invention relates to a method of detecting a molecular target This method involves providing a molecular complex according to the second aspect of the present invention and contacting a molecular target with the molecular complex under conditions effective to cause a change in fluorescence of the fluorescent protein, whereby the change in fluorescence detects presence of the molecular target
  • a fourth aspect of the present invention relates to a method of determining location of a molecular target This method involves providing a molecular complex according to the second aspect of the present invention A molecular target is contacted with the molecular complex and the fluorescence of the fluorescent protein is detected, whereby location of the molecular target is determined
  • a fifth aspect of the present invention relates to a constructed DNA molecule containing a first region encoding a nucleic acid aptamer having a first domain and a second region encoding a fluorescent protein capable of binding the nucleic acid aptamer at the first domain
  • Expression systems and host cells containing the constructed DNA molecule are also described
  • nucleic acid aptamers of the present invention operate as relatively simple fluorescent switches
  • the affinity of nucleic acid aptamers to fluorescent proteins will be regulated by the binding of a molecule to be detected This binding will perturb the highly specific structural interaction between the aptamer and fluorescent protein, thereby resulting in unbinding and a fluorescent signal proportional to the concentration of the analyte
  • the present invention also provides a flexible, genetically encoded, real time detector system Given the extreme size and diversity of the aptamer structural space, this strategy may be applied to sensors for virtually any defined target [0017] Distinctive from previous approaches to modifying GFP per se, the present invention enables the integration of any fluorescent protein and its derivatives into any natural or synthetic molecular network As
  • the present invention provides several advantages to other methods of detecting the presence of and/or determining the location of target molecules
  • the methods are rapid and do not require special processing for detection, but can be simply analyzed by optical detection of fluorescence
  • the molecular complexes and systems for carrying out the methods of the invention can be entirely genetically encoded, providing for generalized detection of biomarkers in cells and animals
  • the systems take advantage of many existing cells and tissues that have been genetically engineered to express fluorescent proteins in specific contexts
  • the methods can be carried out in simple organisms such as bacteria or yeast, which can act as living biodetectors of accumulated exposure to biohazards, through the progressive accumulation or metabolism of substances
  • multiple signals could be simultaneously detected through the use of 5 discreet sensing aptamers with affinity for specific fluorescent proteins and target molecules
  • the present invention affords the construction of a cellular imaging system based on RNA aptamers that functionally interact with fluorescent proteins As hundreds of lines of mice expressing variants of GFP in a tissue-specific,
  • RNA aptamer-expressmg lines 10 subcellularly localized, or temporally controlled manner currently exist, such a system can immediately be used to examine cell signaling in various experimental contexts by crossing these mice with RNA aptamer-expressmg lines Ideally, these systems can be flexibly adapted to the detection of a wide range of molecules, which would have high signal characteristics, and would allow dynamic monitoring of molecular
  • aptamers with specificity for other fluorescent proteins can be developed, providing the potential of monitoring multiple cellular signals simultaneously
  • Figures IA-C illustrate one embodiment of an aptamer/fluorescent protein signaling system of the present invention
  • a bivalent aptamer bound to a fluorescent protein markedly reduces fluorescence of the fluorescent protein
  • Binding of a target molecule leads to an alteration in the tertiary structure of the aptamer, resulting in unbinding from the fluorescent protein and
  • Figures 2A-C demonstrate the structure and function of one embodiment of nucleic acid aptamers of the present invention
  • Figure 2A is an image showing binding of representatives of two selected aptamer families to GFP on a nitrocellulose membrane
  • Figure 2B is an emission spectrum for eGFP (excited at
  • Figures 3A-C are illustrations of the predicted secondary structure of nucleic acid aptamers described in Figure 2C As shown, the structures have a three- way junction (J) that connects two stems (Sl, S2) and a third stem (S3) with an apical loop and an internal loop or bulge
  • Figure 3 A is the predicted structure of the aptamers having any of the core sequences identified in Figure 2C, which demonstrates the ability to make conservative substitutions in the core sequence without altering the secondary structure of the nucleic acid aptamer
  • activity can be preserved with permutations of the core sequence at the indicated sites
  • substitutions within the iterated sequences also conserve this secondary structure
  • Figures 4A-D show the second round design of nucleic acid aptamers according to one embodiment of the present invention
  • a general sequence of the aptamer is identified in Figure 4A "N45" and "N40" represent random nucleotides flanking the core sequence identified in the first SELEX (i e , the sequences shown in Figure 2C)
  • Figure 4B is an image showing GFP binding of individual clones from the second SELEX (AP2-AP6) A markedly higher binding affinity was achieved relative to G16 (first SELEX)
  • the random N40 sequences of AP2 and AP3 were shortened to random N20 and N26 sequences, respectively
  • Figure 4C is an image comparing (shortened) AP3 and G16 binding to GFP on nitrocellulose membrane
  • Figure 4D is a graph of the fluorescence inhibition caused by G16 and AP3, showing the higher affinity and greater maximum effect of AP3 GFP concentration was 10 nM
  • Figures 5A-C show the specificity of nucleic acid apt
  • Figures 6A-C are graphs showing the effect of AP3 on GFP fluorescence Spectra show effect of AP3 on GFP absorbance (Figure 6A) and emission with 470 nm ( Figure 6B) and 390 nm (Figure 6C) excitation There is a marked decrease in absorption at 470 nm, with a quantitatively smaller increase in absorption at 390 nm Emission is reduced by approximately 75% at 470 nm excitation, but increased slightly when excited at the lower absorption peak
  • Figures 6A-C are normalized to GFP fluorescence
  • Figures 7A-D are graphs showing aptamer binding to GFP Figures
  • FIGS. 7A-C show emission spectra for GFP and GFP/aptamer (1 ⁇ M aptamer) at varied concentrations of GFP, including 10 nm (Figure 7A), 100 nm (Figure 7B), and 500 nm (Figure 7C)
  • the graph in Figure 7D demonstrates that the 470/426 fluorescence ratio is insensitive to the GFP concentration Note that the fractional change in the ratio with aptamer binding is stable (varies less than 3%) and displays a dynamic range of approximately 3
  • FIGS 8 A-B are illustrations showing the structure of GFP aptamers
  • Figure 8 A is the confirmed structure of a GFP aptamer, where the dotted lines show other fully functional 573' sites
  • the dotted circle on stem 3 indicates an example of a site in which addition of a pair of nucleotides at position 21 and 79 does not alter function, whereas impairing circled nucleotides resulted m loss of function Extension of angle between Stem 1 and Stem 2 by insertion of nucleotides (arrow 1) also degraded function
  • Figure 8B illustrates that reoptimization of Stem 3 resulted m reduction to only molecules containing the critical midstem loop Removal of nucleotides within this loop, even m the open form shown m Figure 8A, resulted m loss of function
  • Figures 9A-I illustrate chimeric RNA expression vectors to be tested for direction of nuclear and cytoplasmic expression of FQAs
  • Figures 9A-B illustrate the Pol III vector which is commonly used for siRNA expression Without nuclear export signals, little aptamer is expected to be transported to the cytoplasm
  • Figures 9C-I are illustrations of chimeric constructs designed to mimic ⁇ bosomal ( Figures 9C-F) or tRNA ( Figures 9G-I) processing
  • the black boxes denote structural RNA sequence from sn, ⁇ bosomal, or tRNA
  • the GFP aptamer will be inserted at the Sall/Xbal site in all constructs
  • Figures 9B, 9D, 9F, 9H, and 91 illustrate the chimeric RNA with the GFP aptamer location indicated by the partial box identified as "GFP Apt "
  • the fluorescence quenching aptamer is encoded beginning with the end of stem 2 ( Figure 8A
  • Figure 11 is an illustration of an aptamer structure used to demonstrate alloste ⁇ c selection of a bridge domain
  • the cGMP aptamer sequence will be separated by a short stretch of randomized sequences sufficient to optimize the alloste ⁇ c bridge (24) (N indicates random nucleotide)
  • One aspect of the present invention relates to a nucleic acid aptamer having a first domain that binds to a fluorescent protein
  • nucleic acid includes both DNA and RNA, in both D and L enantiomeric forms, as well as derivatives thereof (including, but not limited to, 2'-fluoro-, 2'-ammo, 2'O-methyl, 5'iodo-, and 5'-bromo-modified polynucleotides) Nucleic acids containing modified nucleotides (Kubik et al , "Isolation and Characterization of 2'fluoro-, 2'ammo-, and 2'fluoro-/ammo-modified RNA Ligands or Human IFN-gamma that Inhibit Receptor Binding," J Immunol 159 259-267 (1997), Pagratis et al , "Potent 2'-ammo, and 2'-fluoro-2'-deoxy- ⁇ bonucleotide RNA Inhibitors of Keratmocyte Growth Factor,” Nat Biotechnol 15 68-
  • Nucleic acid aptamers of the present invention include multivalent
  • nucleic acid aptamers of the present invention when minimized, can be operably joined in a single molecular entity with other aptamers or other elements, or both, in which the other elements may be structural or functional, or both
  • Identifying suitable nucleic acid aptamers basically involves selecting aptamers that bind the fluorescent protein with sufficiently high affinity (e g , Kj ⁇ 50 nM) and specificity from a pool of nucleic acids containing a random region of varying or predetermined length (Shi et al , "A Specific RNA Hairpm Loop Structure Binds the RNA Recognition Motifs of the Drosophila SR Protein B52," MoI Cell
  • identifying suitable nucleic acid aptamers of the present invention can be carried out using an established in vitro selection and amplification
  • SELEX 25 scheme known as SELEX
  • the SELEX scheme is described in detail in U S Patent No 5,270,163 to Gold et al , Ellington and Szostak, "In Vitro Selection of RNA Molecules that Bind Specific Ligands," Nature 346 818-822 (1990), and Tuerk and Gold, “Systematic Evolution of Ligands by Exponential Enrichment RNA Ligands to Bacteriophage T4 DNA Polymerase," Science 249 505-510 (1990), which are hereby
  • the fluorescent proteins capable of forming the molecular complex with the aptamer of the present invention can be any protein or polypeptide that has the ability to fluoresce
  • the fluorescent protein can be a naturally occurring protein or an engineered protein, such as a derivative of the naturally occurring fluorescent proteins
  • Exemplary fluorescent proteins include, without limitation, Aequorea- de ⁇ ved proteins such as GFP, enhanced Green Fluorescent Protein (“eGFP”), Yellow Fluorescent Protein (“YFP”), and Cyan Fluorescent Protein (“CFP”), as well as proteins derived from coral species including, but not limited to, Discosoma and Trachyphyllia geoffroyi Other proteins having fluorescent or other signaling properties can also be used
  • Exemplary modified fluorescent proteins include those that contain one or more of the following modifications circular permutation (Baird et al , "Circular Permutation and Receptor Insertion Withm Green Fluorescent Proteins,” Proc Natl Acad Sci USA 96 11241-11246 (1999), which is hereby incorporated by reference in its entirety), splitting (Zhang et al , “Combinatorial Marking of Cells and Organelles with Reconstituted Fluorescent Proteins," Cell 119 137-144 (2004), which is hereby incorporated by reference in its entirety), enhanced folding (Pedelacq et al , “Engineering and Characterization of a Superfolder Green Fluorescent Protein,” Nat Biotechnol 24 79-88 (2006), which is hereby incorporated by reference in its entirety), or other modifications (Zhang et al , “Creating New Fluorescent Probes for Cell Biology,” Nat Rev MoI Cell Biol 3 906-918 (2002), which is hereby incorporated by reference in its entirety) [0038]
  • the nucleic acid aptamers of the present invention are selected based on their functional ability to interact at the first domain with the "beta cage" structure of a fluorescent protein
  • a fluorescent protein Both the Aequorea victona- de ⁇ ved fluorescent proteins and the fluorescent proteins derived from coral proteins share the overall 11 -stranded ⁇ can structure (Tsien, "The Green Fluorescent Protein,” Annu Rev Biochem 67 509-544 (1998), Verkhusha et al , "The Molecular Properties and Applications of Anthozoa Fluorescent Proteins and Chromoprotems,” Nat Biotechnol 22 289-296 (2004), each of which is hereby incorporated by reference in its entirety)
  • the nucleic acid aptamers have a sequence containing a core region and one or both of a 5' primer region and a 3' primer region
  • the core region includes the portion of the aptamer having the first domain (i e , fluorescent protein binding activity)
  • the 5' and 3' primer regions are intended to provide sites to which primers can bind to the aptamer or its complement In this manner, an aptamer population can be in vitro amplified or in vivo amplified
  • the 5' and 3' regions are preferably between about 15 to about 50 nucleotides in length, more preferably about 20 to about 25 nucleotides in length
  • the primer regions are preferably substantially unique so as to promote amplification of only (or substantially only) the aptamer sequence
  • One class of exemplary nucleic acid aptamers of the present invention have a G3 nucleotide core sequence, as follows
  • G3 core sequences may include
  • Another class of exemplary nucleic acid aptamers of the present invention have a G16 nucleotide core sequence, as follows NGNGAAUUGNGUGGGGAAAGUCCUNAAAAGAGGGCCACNGCCGA AACGCC (SEQ ID NO 4), where N is any nucleotide (A, U, C, or G) Specific G16 core sequences are identified in Figure 2C, and include UGUGAAUUGGGUGGGGAAAGUCCUGAAAAGAGGGCCACCGCCGA AACGCC (SEQ IDNO 5),
  • nucleotide cores may include the following sequences GlO GUUGGAUUGUUAGGAUAAAGCCCGUAAAGGAGGGUCCUU
  • AAGAGCUCCAG (SEQ ID NO 12)
  • Figure 3 A sequences include end primer sequences having a three-way junction that connects two stems and a third stem with an apical loop and an internal loop or bulge
  • the sequences from 17-66 represent the core sequences of SEQ ID NOs 1-13 Sequence switches or substitutions that preserve the illustrated pairing preserve aptamer function, and are therefore encompassed by the present invention
  • This concept is further illustrated in Figure 3B, where permutation of the core sequence at the indicated sites preserve activity, as do substitutions within the iterated sequences that conserve this secondary structure (Figure 3C)
  • additions of non-complementary sequences such as polyA sequences do not alter aptamer function and may therefore be included in the nucleic acid aptamer sequence
  • Other nucleotide cores may also be developed according to the above- identified selection procedures and used according to their ability to bind fluorescent proteins Binding of the fluorescent protein to the first domain of the nucleic acid aptamer may alter fluorescence of the fluorescent protein
  • the nucleic acid aptamer has a sequence containing a 5' primer region, a 5' random nucleotide sequence region, a core sequence, a 3' random nucleotide sequence region, and a 3' primer region
  • An exemplary nucleic acid aptamer according to this embodiment is illustrated in Figure 4A and has a core sequence of 36 nucleotides, which is a consensus sequence shared by families G3 and G16, as follows
  • N is optional and can be A, flanked by regions of 45 (5 1 ) and 40 (3 1 ) random nucleotides and the constant primer sequences 5' primer GGGAGCACGAUUCCAU (SEQ ID NO 20) and 3' primer UACAAGCUUCUGGACUCGGU (SEQ ID NO 21)
  • AP2-AP8 Members of this family, designated AP2-AP8, have the following core sequences flanked by SEQ ID NOS 20 and 21 AP2 (N40 ⁇ N20)
  • the nucleic acid aptamer of the present invention may also have a second domain that binds to a molecule different from the fluorescent protein
  • the nucleic acid aptamer may have a first domain that binds to a fluorescent protein and a second domain capable of binding with a molecule other than the fluorescent protein, such as a target molecule
  • the target molecule can be any molecule whose presence (or absence) is of interest
  • the second domain of the nucleic acid aptamer of the present invention may be a functional aptamer core that binds to a molecule other than the fluorescent protein Suitable second domains can be identified by SELEX (described above) and then fused to aptamer structures to form multi-valent aptamers having a first and second (and additional) domains [0051
  • binding of the target at the second domain precludes binding, alters the binding configuration, or results in a conformation change in the nucleic acid aptamer or fluorescent protein at the first domain, thereby modulating the functional interaction of the nucleic acid aptamer with the fluorescent protein ( Figures IA-C)
  • binding of the target to the second domain can result in a detectable change (e g , a change in wavelength or intensity) in the fluorescence of the fluorescent protein
  • the nucleic acid aptamer of the present invention can be used as a signaling system to detect presence or location of target molecules, as described in greater detail infra
  • Another aspect of the present invention relates to a molecular complex containing the nucleic acid aptamer of the present invention bound to a fluorescent protein at the first domain
  • the nucleic acid aptamer is preferably reversibly bound to the fluorescent protein
  • the functional interaction between the nucleic acid aptamer and the fluorescent protein at the first domain can be disrupted by, e g , conformational changes occurring in the nucleic acid aptamer and/or the fluorescent protein
  • a further aspect of the present invention relates to a constructed DNA molecule containing a first region encoding a nucleic acid aptamer of the present invention and a second region encoding a fluorescent protein capable of binding to the first domain of the nucleic acid aptamer
  • DNA ligation utilizes DNA hgase enzymes to covalently link or hgate fragments of DNA together by catalyzing formation of a phosphodiester bond between the 5' phosphate of one strand of DNA and the 3' hydroxyl of another Typically, ligation reactions require a strong reducing environment and ATP
  • T4 DNA hgase is an exemplary DNA hgase in preparing the DNA molecule of the present invention
  • the DNA molecule of the present invention may have a first promoter operably coupled to the first region to control expression of the nucleic acid aptamer and a second promoter operably coupled to the second region to control expression of the fluorescent protein
  • the DNA molecule can be bicistromc, having a single promoter that directs transcription of both the aptamer-encodmg DNA sequence and the fluorescent protein
  • the DNA sequences of eukaryotic promoters differ from those of prokaryotic promoters
  • eukaryotic promoters and accompanying genetic signals may not be recognized in or may not function in a prokaryotic system and, further, prokaryotic promoters are not recognized and do not function in eukaryotic cells
  • Promoters vary in their "strength" (i e , their ability to promote transcription) It is desirable to use strong promoters in order to obtain a high level of transcription Depending upon the host cell system utilized, any one of a number of suitable promoters may be used For instance, when cloning in E coh, its bacteriophages, or plasmids, promoters such as the T7 phage promoter, lac promoter, trp promoter, recA promoter, ⁇ bosomal RNA promoter, the P R and P L promoters of coliphage lambda and others, including but not limited, to / ⁇ cUV5, ompF, bla, Ipp, and the like, may be used to direct high levels of transcription of adjacent DNA segments Additionally, a hybrid trp-lacUV5 (tac) promoter or other E coh promoters produced by recombinant DNA or other synthetic DNA techniques may be used to provide for transcription of the inserted gene [0060] Bac
  • the glyceraldehydes-3-phosphate dehydrogenase (GPD) promoter in yeast is a strong constitutive promoter driven by RNA polymerase II (Bitter et al , "Expression of Heterologous Genes in Saccharomyces cerevisiae from Vectors Utilizing the Glyceraldehyde-3-phosphate Dehydrogenase Gene Promoter," Gene 32 263-274 (1984), which is hereby incorporated by reference in its entirety)
  • the galactokmase (GALl) promoter in yeast is a highly inducible promoter driven by RNA polymerase II (John
  • the DNA molecule of the present invention can be incorporated into cells using conventional recombinant DNA technology Generally, this involves inserting the DNA molecule into an expression system to which the DNA molecule is heterologous (i e , not normally present)
  • the heterologous DNA molecule is inserted into the expression system or vector in proper sense orientation
  • the vector contains the necessary elements for their persistent existence inside cells and for the transcription of an RNA molecule that can be translated into the molecular complex of the present invention
  • U S Patent No 4,237,224 to Cohen and Boyer which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA hgase These recombinant plasmids are then introduced by means of transformation and transfection, and replicated in cultures including prokaryotic organisms and eukaryotic cells grown in tissue culture
  • Recombinant viruses can be generated by transfection of plasmids into cells infected with virus
  • Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gtl 1, gt WES tB, Charon 4, and plasmid vectors such as pBR322, pBR325, pACYC177, pACYC184, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKClOl, SV 40, pBluesc ⁇ pt II SK +/- or KS +/- (see “Stratagene Cloning Systems” Catalog (1993) from Stratagene, La Jolla, Calif which is hereby incorporated by reference), pQE, pIH821, pGEX, pET series (see Studier et al , "Use of T7 RNA Polymerase to Direct Expression of Cloned Genes," Gene Expression Technology, vol 185 (1990), which is hereby incorporated by reference in its entirety),
  • Host-vector systems include but are not limited to the following bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA, microorganisms such as yeast containing yeast vectors, mammalian cell systems infected with virus (e g , vaccinia virus, adenovirus, adeno-associated virus, retrovial vectors, etc ), insect cell systems infected with virus (e g , baculovirus), and plant cells infected by bacteria or transformed via particle bombardment (i e , biohstics)
  • the expression elements of these vectors vary in their strength and specificities Depending upon the host-vector system utilized, any one of a number of suitable transcription elements can be used [0075]
  • Mammalian cells suitable for carrying out the present invention include, without limitation, COS (e g , ATCC No CRL 1650 or 1651), BHK (e g , ATCC No CRL 6281), CHO (ATCC No CCL 61), HeLa (e g , ATCC No CCL 2), 293 (ATCC No 1573), CHOP, NS-I cells, and primary cells recovered directly from a mammalian organism With regard to primary cells recovered from a mammalian organism, these cells can optionally be reintroduced into the mammal from which they were harvested
  • One technique of transforming plants with the DNA molecules in accordance with the present invention is by contacting the tissue of such plants with an inoculum of a bacteria transformed with a vector comprising a DNA molecule in accordance with the present invention Generally, this procedure involves inoculating the plant tissue with a suspension of bacteria and incubating the tissue for 48 to
  • Bacteria from the genus Agrobacterium can be utilized to transform plant cells Suitable species of such bacterium include Agrobacterium tumefaciens and Agrobacterium rhizogenes Agrobacterium tumefaciens (e g , strains C58, LBA4404, or EHA105) is particularly useful due to its well-known ability to
  • Heterologous genetic sequences can be introduced into appropriate plant cells by means of the Ti plasmid of A tumefaciens or the Ri plasmid of A rhizogenes
  • the Ti or Ri plasmid is transmitted to plant cells on infection by Agrobacterium and is stably integrated into the plant genome (Schell, "Transgenic
  • Another aspect of the present invention relates to a system containing a first DNA molecule encoding a nucleic acid aptamer as described above and a second DNA molecule encoding a fluorescent protein capable of being bound by the first domain
  • the first and second DNA molecules each have a promoter operably coupled to the regions encoding, respectively, the nucleic acid aptamer and the fluorescent protein
  • the system of the invention may be incorporated into expression systems and/or host cells as described supra
  • a further aspect of the present invention relates to a method of detecting a molecular target
  • This method involves providing a molecular complex as described above and contacting a molecular target with the molecular complex under conditions effective to cause a change in fluorescence of the fluorescent protein (i e , upon binding of the target to the second domain of the aptamer) As a consequence, the change in fluorescence indicates (i e , allows detection of) presence of the molecular target
  • the method of the invention may be carried out in a cell by introducing the molecular complex into the cell
  • the complex is recombmantly expressed in a cell
  • Methods for introducing the molecular complex into a cell are described supra
  • the molecular complex employed in the method of the present invention enhances fluorescence of the fluorescent protein when the fluorescent protein is bound to the first domain
  • contacting the molecular complex with a target molecule at the second domain may cause a change in the functional interaction of the nucleic acid aptamer with the fluorescent protein at the first domain which results in a decreased fluorescence signal (i e , the fluorescence of the fluorescent protein is no longer enhanced)
  • contacting the molecular complex with a target molecule at the second domain may cause a change in the functional interaction of the nucleic acid aptamer with the fluorescent protein at the first domain which results in an altered fluorescence signal
  • Another aspect of the present invention relates to a method of determining location of a molecular target This method involves providing a molecular complex as described above
  • RNAs with full function contained sequences with predicted Stem 2 of variable length (up to 11 pairs), decreasing this stem to 7 pairs retained full function, but a 6 pair stem achieved only a 45% decrease in GFP fluorescence
  • sequence of the first 6 pairs could be substituted with no loss in function, whereas the changes in the C-G pair at the internal loop resulted in
  • RNA/fluorescent protein sensor system A fundamental requirement for the development of the proposed RNA/fluorescent protein sensor system is the efficient and balanced expression of
  • RNA and GFP Efficient genetic expression systems will be developed for FQAs and their function in live cells will be assessed
  • the development of functional, chimeric RNAs will be useful both for the expression of the GFP signaling system ⁇ infra) and as a means of localizing YFP or CFP to non-protem biological molecules, as the chromaphores are not quenched by binding
  • GFP or GFP flanked by a nuclear localization signal are stably expressed These lines have been developed through transfection of cells with bicistromc mammalian expression vectors that include GFP and the neomycin resistance cassette under control of a strong viral promoter (CMV) Cells have been selected with neomycin and clones established that display a modest and stable degree of cytoplasmic or nuclear GFP expression This strategy eliminates difficulties related to the kinetics of RNA and protein expression in transient transfection assays [0114] HEK293T cells will be transfected in 6 well plates with varying concentrations of vector DNA prepared from bicistromc constructs encoding chimeric RNAs and an mCherry reporter that will serve as a marker for gene transfer These cells will be transfected with the vector DNA using LipofectAMINE PLUSTM reagent (Life Technologies, Invitrogen Corporation, Carlsbad, CA) [0115] The chimeric aptamer constructs described below will be driven by RNA polyme
  • RNA aptamers The function of the RNA aptamers will be determined by assessing GFP fluorescence in mCherry-positive cells during flow cytometry
  • cGMP is an important intracellular second messenger for which existing sensors have distinct limitations (Wild et al , "Expression of a Chimeric, cGMP- Sensitive Regulatory Subumt of the cAMP-Dependent Protein Kinase Type I Alpha," FEBS Letters 374 356-362 (1995) Aptamers for cGMP will be used, as well as one for which allosterically regulated RNA aptamers have been successfully selected (Koizumi et al , “Alloste ⁇ c Ribozymes Sensitive to the Second Messengers cAMP and cGMP," Nucleic Acids Symp Ser 275-276 (1999), Koizumi et al , "Alloste ⁇ c Selection of Ribozymes
  • the cGMP aptamer sequence will be separated by a short stretch of randomized sequences sufficient to optimize the allosteric bridge (Soukup et al , “Engineering Precision RNA Molecular Switches,” Proc Natl Acad Sa USA 96 3584-3589 (1999), which is hereby incorporated by reference in its entirety) (N indicates random nucleotide)
  • This strategy will rely on the ability to allosterically link previously optimized structures and assumes only that selection will produce a linkage with sufficient flexibility to retain the individual binding structures, and provide the allosteric interactions If the structure is too stable, then the length of the random sequence will be altered to adjust stability
  • the primers will be chosen from Stem 2, minimizing the interference on selection from unrelated primer sequence This pool will also likely be useful for future
  • RNA pool contains 1-2 copies of 1- 2x10 unique RNAs
  • the selection scheme will contain four steps, as described briefly below
  • Step 1 RNA binding to GFP will be performed in 500 ⁇ l binding buffer
  • RNA-GFP complex (1 xPBS /5mM MgCl 2 )
  • the RNA-GFP complex will be partitioned with 045 ⁇ m nitrocellulose filter or Ni-charged beads (alternating to avoid selection of RNAs binding to either substrate), Step 2 Elution of RNA from GFP with 100 ⁇ M cGMP in PBS, Step 3 Negative selection will be performed by reacting the eluted mixture with GFP bound to nitrocellulose membrane or Ni-charged beads to eliminate c-GMP independent RNAs in the eluted mixture, and
  • Step 4 Amplify selected RNAs by RT-PCR and RNA for next round synthesized by in vitro transcription using T7-MEGAshortsc ⁇ pt Following 10-15 selection rounds, RNAs will be amplified by RT- PCR, and the DNAs cloned in pGEM-T and sequenced
  • RNAs found to be regulated by cGMP stop-flow fluorescent measurements will be performed to determine the kinetics of the signal under conditions of millisecond rise of cGMP Fluorescence will be determined in a fluorescence spectrophotometer (FluoroMax 3, Jobm-Yvon, Ho ⁇ ba)
  • fluorescence spectrophotometer Jobm-Yvon, Ho ⁇ ba

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a nucleic acid aptamer having a first domain that binds to a fluorescent protein. The nucleic acid aptamer forms a molecular complex whereby the aptamer binds a fluorescent protein at the first domain. A constructed DNA molecule, expression systems, and host cells containing the molecular complex are also disclosed. The invention also relates to a system containing a first DNA molecule encoding the nucleic acid aptamer of the present invention and a second DNA molecule encoding a fluorescent protein capable of being bound by the first domain. Methods of detecting a molecular target and determining location of a molecular target using the nucleic acid aptamer of the invention are also disclosed.

Description

FUNCTIONAL NUCLEIC ACID LIGANDS TO FLUORESCENT PROTEINS
[0001] This application claims the priority benefit of U S Provisional Patent Application Serial No 60/804,982, filed June 16, 2006, which is hereby incorporated by reference in its entirety
FIELD OF THE INVENTION
[0002] This invention relates to nucleic acid aptamers that bind fluorescent proteins, aptamer-fluorescent protein complexes, their expression, and methods of
BACKGROUND OF THE INVENTION
[0003] In the environments of living systems, protein functions are actuated through interaction with other molecules These interactions, stable or transient, between a protein and another protein or non-protem molecule, enhance or inhibit the stability or function of one, the other, or both partners involved in the interaction When the interaction results in a stable complex, the complex's association to yet other proteins or non-protem molecules, or a supramolecular assembly, will be affected When a protein functions as a reagent, its specific interaction with hgands is often exploited to maximize its utility A case in point is the fortuitous recognition of the mammalian antibody immunoglobulin G ("IgG") by the bacterial cell wall proteins streptococcal protein G and Staphylococcus aureus protein A [0004] Genetically encoded sensors that have tightly controlled and subcellularly localized expression have been constructed from polypeptides to exploit the binding characteristics of specific peptide domains (detector) to alter protein fluorescence (reporter) either directly or through resonance energy transfer, requiring a known binding partner of appropriate affinity and specificity However, in many cases such a detector motif is not known Examples of this difficulty include the detection of specific phosphoprotems, for which hundreds of variants may exist, and the detection of aberrantly-folded proteins, for which no known binding partners exist [0005] Green Fluorescent Protein ("GFP") is a natural fluorescing protein produced by the jellyfish Aequorea victoria Some ammo acid residues in the native protein spontaneously form a fluorophore when the polypeptide is folded into an 11- strand beta-barrel threaded by an alpha-helix running up the axis of the internal cylinder Because it tolerates N- and C-termmal fusion to a broad variety of proteins, GFP has been used primarily as a fluorescent protein tag, i e , for making chimeric proteins of GFP linked to other proteins where it functions as an indicator to reveal when, where, and how much of the protein it fuses to is present In this capacity, it has been expressed in bacteria, yeast, slime mold, plants, Drosophύa, zebrafish, and in mammalian cells
[0006] In the jellyfish from which it was isolated, GFP is involved in physiological interactions with the biolummescent protein aequorm and shifts its blue light absorption to green light emission through energy transfer In most applications of GFP, this dual-component configuration is not recapitulated, and the excitation of GFP or its derivatives is afforded through optical instrumentation Other than aequorm, one type of molecule that binds directly to GFP and its derivatives has been developed These are antibodies, both polyclonal and monoclonal, which are usually used for signal amplification purposes when the GFP signal is too weak, or the protein has been denatured and is no longer fluorescent In the methods utilizing these antibodies, GFP and its derivatives are treated as generic protein tags, and as such the invention of GFP antibodies and the utility thereof resides within the scope of conventional lmmuno-chemistry
[0007] The prior art in the GFP related biotechnology has mainly focused on modification of the wild type GFP to increase the intensity of its fluorescence, change the wavelength of its fluorescence, and make its fluorescence conditional General approaches to achieving these goals include (i) point mutations that change the physical-chemical environment in the vicinity of the fluorophore and (ii) topological rearrangement of the polypeptide chain that results in circular permutated or bipartite versions of the protein These efforts have yielded many GFP derivatives that, as noninvasive fluorescent markers in living cells, allow for a wide range of applications where it may function as a cell lineage tracer, reporter of gene expression, or as a measure of protein-protein interactions [0008] It is desirable to find or create ligands that specifically recognize GFP and other fluorescent proteins It is further desirable that these fluorescent protein- specific ligands can be rationally connected to ligands of other protein or non-protem molecules so that the FP-ligand complex can be recognized by other molecules, indicating the presence or absence of these other molecules
[0009] The present invention is directed to overcoming these and other limitations in fluorescent protein technology
SUMMARY OF THE INVENTION [0010] A first aspect of the present invention relates to a nucleic acid aptamer having a first domain that binds to a fluorescent protein [0011] A second aspect of the present invention relates to a molecular complex containing the nucleic acid aptamer according to the first aspect of the present invention, with the nucleic acid aptamer bound to a fluorescent protein at the first domain A host cell containing the molecular complex is also described
[0012] A third aspect of the present invention relates to a method of detecting a molecular target This method involves providing a molecular complex according to the second aspect of the present invention and contacting a molecular target with the molecular complex under conditions effective to cause a change in fluorescence of the fluorescent protein, whereby the change in fluorescence detects presence of the molecular target
[0013] A fourth aspect of the present invention relates to a method of determining location of a molecular target This method involves providing a molecular complex according to the second aspect of the present invention A molecular target is contacted with the molecular complex and the fluorescence of the fluorescent protein is detected, whereby location of the molecular target is determined
[0014] A fifth aspect of the present invention relates to a constructed DNA molecule containing a first region encoding a nucleic acid aptamer having a first domain and a second region encoding a fluorescent protein capable of binding the nucleic acid aptamer at the first domain Expression systems and host cells containing the constructed DNA molecule are also described [0015] A sixth aspect of the present invention relates to a system containing a first DNA molecule encoding a nucleic acid aptamer according to the first aspect of the present invention and a second DNA molecule encoding a fluorescent protein capable of being bound by the nucleic acid aptamer at the first domain thereof Expression systems and host cells containing the system are also described
[0016] The present invention is directed to novel nucleic acid hgands to fluorescent proteins and their derivatives that are capable of (i) modulating the fluorescence of the protein and (ii) being connected arbitrarily to hgands directed to other protein or non-protem molecules According to some embodiments, nucleic acid aptamers of the present invention operate as relatively simple fluorescent switches The affinity of nucleic acid aptamers to fluorescent proteins will be regulated by the binding of a molecule to be detected This binding will perturb the highly specific structural interaction between the aptamer and fluorescent protein, thereby resulting in unbinding and a fluorescent signal proportional to the concentration of the analyte The present invention also provides a flexible, genetically encoded, real time detector system Given the extreme size and diversity of the aptamer structural space, this strategy may be applied to sensors for virtually any defined target [0017] Distinctive from previous approaches to modifying GFP per se, the present invention enables the integration of any fluorescent protein and its derivatives into any natural or synthetic molecular network As a result, the utility of fluorescent proteins and their derivatives are extended from passively reporting the presence of a protein to which the fluorescent protein is covalently fused, to actively functioning as a component of molecular control devices or as a method of detecting the presence of other molecules that are not covalently linked to the fluorescent protein
[0018] The present invention provides several advantages to other methods of detecting the presence of and/or determining the location of target molecules The methods are rapid and do not require special processing for detection, but can be simply analyzed by optical detection of fluorescence The molecular complexes and systems for carrying out the methods of the invention can be entirely genetically encoded, providing for generalized detection of biomarkers in cells and animals In addition, the systems take advantage of many existing cells and tissues that have been genetically engineered to express fluorescent proteins in specific contexts The methods can be carried out in simple organisms such as bacteria or yeast, which can act as living biodetectors of accumulated exposure to biohazards, through the progressive accumulation or metabolism of substances In carrying out the methods of the invention, multiple signals could be simultaneously detected through the use of 5 discreet sensing aptamers with affinity for specific fluorescent proteins and target molecules
[0019] The present invention affords the construction of a cellular imaging system based on RNA aptamers that functionally interact with fluorescent proteins As hundreds of lines of mice expressing variants of GFP in a tissue-specific,
10 subcellularly localized, or temporally controlled manner currently exist, such a system can immediately be used to examine cell signaling in various experimental contexts by crossing these mice with RNA aptamer-expressmg lines Ideally, these systems can be flexibly adapted to the detection of a wide range of molecules, which would have high signal characteristics, and would allow dynamic monitoring of molecular
15 interactions in vivo Moreover, aptamers with specificity for other fluorescent proteins can be developed, providing the potential of monitoring multiple cellular signals simultaneously
BRIEF DESCRIPTION OF THE DRAWINGS
20 [0020] Figures IA-C illustrate one embodiment of an aptamer/fluorescent protein signaling system of the present invention In Figure IA, a bivalent aptamer bound to a fluorescent protein markedly reduces fluorescence of the fluorescent protein Binding of a target molecule (Figure IB) leads to an alteration in the tertiary structure of the aptamer, resulting in unbinding from the fluorescent protein and
25 recovery of fluorescence (Figure 1C)
[0021] Figures 2A-C demonstrate the structure and function of one embodiment of nucleic acid aptamers of the present invention Figure 2A is an image showing binding of representatives of two selected aptamer families to GFP on a nitrocellulose membrane Figure 2B is an emission spectrum for eGFP (excited at
30 488 mn) in the presence of an increasing concentration of aptamer G16 The inset graph of Figure 2B shows fit of fluorescence at 510 nm to a Hill plot The nucleic acid aptamers themselves had no measurable fluorescence Figure 2C shows sequence results from 15 rounds of SELEX The first sequence in each family was amplified for the experiments shown in Figures 2A-B
[0022] Figures 3A-C are illustrations of the predicted secondary structure of nucleic acid aptamers described in Figure 2C As shown, the structures have a three- way junction (J) that connects two stems (Sl, S2) and a third stem (S3) with an apical loop and an internal loop or bulge Figure 3 A is the predicted structure of the aptamers having any of the core sequences identified in Figure 2C, which demonstrates the ability to make conservative substitutions in the core sequence without altering the secondary structure of the nucleic acid aptamer As illustrated in Figure 3B, activity can be preserved with permutations of the core sequence at the indicated sites As shown in Figure 3C, substitutions within the iterated sequences also conserve this secondary structure
[0023] Figures 4A-D show the second round design of nucleic acid aptamers according to one embodiment of the present invention A general sequence of the aptamer is identified in Figure 4A "N45" and "N40" represent random nucleotides flanking the core sequence identified in the first SELEX (i e , the sequences shown in Figure 2C) Figure 4B is an image showing GFP binding of individual clones from the second SELEX (AP2-AP6) A markedly higher binding affinity was achieved relative to G16 (first SELEX) The random N40 sequences of AP2 and AP3 were shortened to random N20 and N26 sequences, respectively Figure 4C is an image comparing (shortened) AP3 and G16 binding to GFP on nitrocellulose membrane Figure 4D is a graph of the fluorescence inhibition caused by G16 and AP3, showing the higher affinity and greater maximum effect of AP3 GFP concentration was 10 nM [0024] Figures 5A-C show the specificity of nucleic acid aptamers of the present invention Figure 5 A is an image demonstrating binding of two aptamer families to GFP and eGFP, showing similar affinities to both proteins, but markedly high binding affinity of AP3 Binding is roughly equivalent to all of the fluorescent proteins In Figure 5B, fluorescence emission scans of enhanced fluorescence proteins show the effect of AP3 aptamer All spectra are normalized to peak fluorescence in the absence of aptamer An increase in eCFP and eYFP fluorescence is noted in the presence of aptamer Figure 5C is a graph showing that AP3 decreases absorbance of eGFP at excitation peaks, whereas eCFP and eYFP fluorescence is slightly increased
[0025] Figures 6A-C are graphs showing the effect of AP3 on GFP fluorescence Spectra show effect of AP3 on GFP absorbance (Figure 6A) and emission with 470 nm (Figure 6B) and 390 nm (Figure 6C) excitation There is a marked decrease in absorption at 470 nm, with a quantitatively smaller increase in absorption at 390 nm Emission is reduced by approximately 75% at 470 nm excitation, but increased slightly when excited at the lower absorption peak Figures 6A-C are normalized to GFP fluorescence [0026] Figures 7A-D are graphs showing aptamer binding to GFP Figures
7A-C show emission spectra for GFP and GFP/aptamer (1 μM aptamer) at varied concentrations of GFP, including 10 nm (Figure 7A), 100 nm (Figure 7B), and 500 nm (Figure 7C) The graph in Figure 7D demonstrates that the 470/426 fluorescence ratio is insensitive to the GFP concentration Note that the fractional change in the ratio with aptamer binding is stable (varies less than 3%) and displays a dynamic range of approximately 3
[0027] Figures 8 A-B are illustrations showing the structure of GFP aptamers
Figure 8 A is the confirmed structure of a GFP aptamer, where the dotted lines show other fully functional 573' sites The dotted circle on stem 3 indicates an example of a site in which addition of a pair of nucleotides at position 21 and 79 does not alter function, whereas impairing circled nucleotides resulted m loss of function Extension of angle between Stem 1 and Stem 2 by insertion of nucleotides (arrow 1) also degraded function Figure 8B illustrates that reoptimization of Stem 3 resulted m reduction to only molecules containing the critical midstem loop Removal of nucleotides within this loop, even m the open form shown m Figure 8A, resulted m loss of function
[0028] Figures 9A-I illustrate chimeric RNA expression vectors to be tested for direction of nuclear and cytoplasmic expression of FQAs Figures 9A-B illustrate the Pol III vector which is commonly used for siRNA expression Without nuclear export signals, little aptamer is expected to be transported to the cytoplasm Figures 9C-I are illustrations of chimeric constructs designed to mimic πbosomal (Figures 9C-F) or tRNA (Figures 9G-I) processing In Figures 9A, 9C, 9E, and 9G, the black boxes denote structural RNA sequence from sn, πbosomal, or tRNA The GFP aptamer will be inserted at the Sall/Xbal site in all constructs Figures 9B, 9D, 9F, 9H, and 91 illustrate the chimeric RNA with the GFP aptamer location indicated by the partial box identified as "GFP Apt " The fluorescence quenching aptamer is encoded beginning with the end of stem 2 (Figure 8A) [0029] Figure 10 is an illustration of an aptamer structure used to demonstrate allosteπc selection strategy The midstem loop, which is known to be tolerant of nucleotide additions, will be opened up and a pool of RNAs will be synthesized with 45 randomized nucleotides inserted at this position The 5' and 3' RNA ends will be at the end of Stem 2, which maintains full function The random nucleotide stretch (N45) is designed to provide structural flexibility for the stabilization of the core structure and also the adoption of a simple cyclic nucleotide-bmdmg structure, which requires approximately 32 nucleotides
[0030] Figure 11 is an illustration of an aptamer structure used to demonstrate allosteπc selection of a bridge domain The cGMP aptamer sequence will be separated by a short stretch of randomized sequences sufficient to optimize the allosteπc bridge (24) (N indicates random nucleotide)
DETAILED DESCRIPTION OF THE INVENTION
[0031] One aspect of the present invention relates to a nucleic acid aptamer having a first domain that binds to a fluorescent protein
[0032] As used herein, "nucleic acid" includes both DNA and RNA, in both D and L enantiomeric forms, as well as derivatives thereof (including, but not limited to, 2'-fluoro-, 2'-ammo, 2'O-methyl, 5'iodo-, and 5'-bromo-modified polynucleotides) Nucleic acids containing modified nucleotides (Kubik et al , "Isolation and Characterization of 2'fluoro-, 2'ammo-, and 2'fluoro-/ammo-modified RNA Ligands or Human IFN-gamma that Inhibit Receptor Binding," J Immunol 159 259-267 (1997), Pagratis et al , "Potent 2'-ammo, and 2'-fluoro-2'-deoxy-πbonucleotide RNA Inhibitors of Keratmocyte Growth Factor," Nat Biotechnol 15 68-73 (1997), which are hereby incorporated by reference in their entirety) and the L-nucleic acids (sometimes termed Spiegelmers®), enantiomeric to natural D-nucleic acids
(Klussmann et al , "Mirror-image RNA that Binds D-adenosme," Nat Biotechnol 14 1112-1115 (1996) and Williams et al , "Bioactive and nuclease-resistant L-DNA Ligand of Vasopressin," Proc Natl Acad Sa USA 94 11285-11290 (1997), which are hereby incorporated by reference in their entirety), are used to enhance biostabihty
[0033] Nucleic acid aptamers of the present invention include multivalent
5 aptamers and bivalent aptamers Methods of making bivalent and multivalent aptamers and their expression in multi-cellular organisms are described in U S Patent No 6,458,559 to Shi et al , which is hereby incorporated by reference in its entirety A method for modular design and construction of multivalent nucleic acid aptamers, their expression, and methods of use are described in U S Patent Publication No
10 2005/0282190, which is hereby incorporated by reference in its entirety According to these methods, nucleic acid aptamers of the present invention, when minimized, can be operably joined in a single molecular entity with other aptamers or other elements, or both, in which the other elements may be structural or functional, or both
15 [0034] Identifying suitable nucleic acid aptamers basically involves selecting aptamers that bind the fluorescent protein with sufficiently high affinity (e g , Kj < 50 nM) and specificity from a pool of nucleic acids containing a random region of varying or predetermined length (Shi et al , "A Specific RNA Hairpm Loop Structure Binds the RNA Recognition Motifs of the Drosophila SR Protein B52," MoI Cell
20 Biol 17 1649-1657 (1997), Shi, "Perturbing Protein Function with RNA Aptamers," Thesis, Cornell University, University Microfilms, Inc (1997), which are hereby incorporated by reference in their entirety)
[0035] For example, identifying suitable nucleic acid aptamers of the present invention can be carried out using an established in vitro selection and amplification
25 scheme known as SELEX The SELEX scheme is described in detail in U S Patent No 5,270,163 to Gold et al , Ellington and Szostak, "In Vitro Selection of RNA Molecules that Bind Specific Ligands," Nature 346 818-822 (1990), and Tuerk and Gold, "Systematic Evolution of Ligands by Exponential Enrichment RNA Ligands to Bacteriophage T4 DNA Polymerase," Science 249 505-510 (1990), which are hereby
30 incorporated by reference in their entirety The SELEX procedure can be modified so that an entire pool of aptamers with binding affinity can be identified by selectively partitioning the pool of aptamers This procedure is described in U S Patent Apphcation Publication No 2004/0053310, which is hereby incorporated by reference in its entirety
[0036] The fluorescent proteins capable of forming the molecular complex with the aptamer of the present invention can be any protein or polypeptide that has the ability to fluoresce The fluorescent protein can be a naturally occurring protein or an engineered protein, such as a derivative of the naturally occurring fluorescent proteins Exemplary fluorescent proteins include, without limitation, Aequorea- deπved proteins such as GFP, enhanced Green Fluorescent Protein ("eGFP"), Yellow Fluorescent Protein ("YFP"), and Cyan Fluorescent Protein ("CFP"), as well as proteins derived from coral species including, but not limited to, Discosoma and Trachyphyllia geoffroyi Other proteins having fluorescent or other signaling properties can also be used
[0037] Exemplary modified fluorescent proteins include those that contain one or more of the following modifications circular permutation (Baird et al , "Circular Permutation and Receptor Insertion Withm Green Fluorescent Proteins," Proc Natl Acad Sci USA 96 11241-11246 (1999), which is hereby incorporated by reference in its entirety), splitting (Zhang et al , "Combinatorial Marking of Cells and Organelles with Reconstituted Fluorescent Proteins," Cell 119 137-144 (2004), which is hereby incorporated by reference in its entirety), enhanced folding (Pedelacq et al , "Engineering and Characterization of a Superfolder Green Fluorescent Protein," Nat Biotechnol 24 79-88 (2006), which is hereby incorporated by reference in its entirety), or other modifications (Zhang et al , "Creating New Fluorescent Probes for Cell Biology," Nat Rev MoI Cell Biol 3 906-918 (2002), which is hereby incorporated by reference in its entirety) [0038] Specific examples of fluorescent proteins (and their encoding nucleic acids) are well known in the art including, without limitation, those reported as Genbank Accessions AB195239, DD431502-DD431504, DD420089-DD420091, AY013821, AY013824-AY013827, EF064258-EF064259, AF435427- AF435434, DQ092360-DQ092365, DQ525024-DQ525025, X83959-X83960, AY533296, AB041904, X96418, BD136947-BD136949, U73901, AX250563-AX250571,
AF302837, AF183395, AF058694-AF058695, U50963, L29345, M62653-M62654, DQ301560, AY679106-AY679108, AY678264-AY678271, AF 168419-AF 168420, AF272711, AY786536-AY786537, AF545828, AF506025-AF506027, AF420593, BAC20344, BD440518-BD440519, and AB085641, each of which is hereby incorporated by reference in its entirety
[0039] In a preferred embodiment, the nucleic acid aptamers of the present invention are selected based on their functional ability to interact at the first domain with the "beta cage" structure of a fluorescent protein Both the Aequorea victona- deπved fluorescent proteins and the fluorescent proteins derived from coral proteins share the overall 11 -stranded β can structure (Tsien, "The Green Fluorescent Protein," Annu Rev Biochem 67 509-544 (1998), Verkhusha et al , "The Molecular Properties and Applications of Anthozoa Fluorescent Proteins and Chromoprotems," Nat Biotechnol 22 289-296 (2004), each of which is hereby incorporated by reference in its entirety)
[0040] According to one embodiment, the nucleic acid aptamers have a sequence containing a core region and one or both of a 5' primer region and a 3' primer region The core region includes the portion of the aptamer having the first domain (i e , fluorescent protein binding activity) The 5' and 3' primer regions are intended to provide sites to which primers can bind to the aptamer or its complement In this manner, an aptamer population can be in vitro amplified or in vivo amplified The 5' and 3' regions are preferably between about 15 to about 50 nucleotides in length, more preferably about 20 to about 25 nucleotides in length The primer regions are preferably substantially unique so as to promote amplification of only (or substantially only) the aptamer sequence
[0041] One class of exemplary nucleic acid aptamers of the present invention have a G3 nucleotide core sequence, as follows
AUCGAAUUGUNNGGUAGAAAGUCCUUUGAGAGNAACCNGGGNGG AUACUG (SEQ ID NO 1), where N is any nucleotide (A, U, C, or G) Specific G3 core sequences may include
AUCGAAUUGUUAGGUAGAAAGUCCUUUGAGAGGAACCUGGGAGG AUACUG (SEQ IDNO 2) and
AUCGAAUUGUGUGGUAGAAAGUCCUUUGAGAGAAACCAGGGGGG AUACUG (SEQ IDNO 3)
[0042] Another class of exemplary nucleic acid aptamers of the present invention have a G16 nucleotide core sequence, as follows NGNGAAUUGNGUGGGGAAAGUCCUNAAAAGAGGGCCACNGCCGA AACGCC (SEQ ID NO 4), where N is any nucleotide (A, U, C, or G) Specific G16 core sequences are identified in Figure 2C, and include UGUGAAUUGGGUGGGGAAAGUCCUGAAAAGAGGGCCACCGCCGA AACGCC (SEQ IDNO 5),
UGCGAAUUGGGUGGGGAAAGUCCUGAAAAGAGGGCCACCGCCGA AACGCC (SEQ IDNO 6),
UGUGAAUUGAGUGGGGAAAGUCCUGAAAAGAGGGCCACUGCCGA AACGCC (SEQ IDNO 7),
UGUGAAUUGGGUGGGGAAAGUCCUUAAAAGAGGGCCACCGCCGA AACGCC (SEQ IDNO 8),
GGUGAAUUGGGUGGGGAAAGUCCUUAAAAGAGGGCCACCGCCGA AACGCC (SEQ IDNO 9), UGUGAAUUGAGUGGGGAAAGUCCUGAAAAGAGGGCCACCGCCGA AACGCC (SEQ IDNO 10), and
UGUGAAUUGAGUGGGGAAAGUCCUGAAAAGAGGGCCACAGCCGA AACGCC (SEQ IDNO 11)
[0043] Other suitable nucleotide cores may include the following sequences GlO GUUGGAUUGUUAGGAUAAAGCCCGUAAAGGAGGGUCCUU
AAGAGCUCCAG (SEQ ID NO 12) and
Artificial G3, G16, GlO family derived UUGGGGUGGGGUGGGGAAAG UCCUUAAAAGAGGGCCACCACAGAAGCAAU (SEQ ID NO 13) or slight variations thereof [0044] SEQ ID NOs 1-13 share a predicted secondary structure, as shown in
Figure 3 A (sequences include end primer sequences) having a three-way junction that connects two stems and a third stem with an apical loop and an internal loop or bulge In Figure 3 A, the sequences from 17-66 represent the core sequences of SEQ ID NOs 1-13 Sequence switches or substitutions that preserve the illustrated pairing preserve aptamer function, and are therefore encompassed by the present invention This concept is further illustrated in Figure 3B, where permutation of the core sequence at the indicated sites preserve activity, as do substitutions within the iterated sequences that conserve this secondary structure (Figure 3C) Furthermore, additions of non-complementary sequences such as polyA sequences do not alter aptamer function and may therefore be included in the nucleic acid aptamer sequence [0045] Other nucleotide cores may also be developed according to the above- identified selection procedures and used according to their ability to bind fluorescent proteins Binding of the fluorescent protein to the first domain of the nucleic acid aptamer may alter fluorescence of the fluorescent protein In one embodiment, binding quenches fluorescence of the fluorescent protein In an alternative embodiment, binding enhances fluorescence of the fluorescent protein In yet another embodiment, binding does not alter fluorescence of the fluorescent protein Accordingly, the molecular complex may have a fluorescent protein with normal fluorescence, enhanced fluorescence, or quenched fluorescence properties [0046] In one embodiment, the nucleotide core forms high affinity fluorescent protein binding aptamers that do not alter protein fluorescence Exemplary aptamers possessing this characteristic include, without limitation No Quench 1 UUCGACCGAGCGAGGCCUAGAACCGAGUACCAACAU AAAAAAAAAAACCGA (SEQ IDNO 14),
No Quench 2 CGCAAAUAAUAAGAACAACAAAGAUGGCCUAGACAA AAACCCGGAGCGAU (SEQ IDNO 15),
No Quench 3 CUUGAAAAAACUCCUGAAACCGAGGCAGAAUUAAAA ACAAUUACAACAGA (SEQ IDNO 16),
No Quench4 CGUGCAAUGACACGCAGCGUCAAGACUGAGUGAUUC GACCAACGACCGCA (SEQ IDNO 17), and
No Quench 5 GCCAGUGAGCCGAUGGAACCGAGGCGACUUAAAGAA AAACACAACAGAGC (SEQ IDNO 18) [0047] According to another embodiment, the nucleic acid aptamer has a sequence containing a 5' primer region, a 5' random nucleotide sequence region, a core sequence, a 3' random nucleotide sequence region, and a 3' primer region [0048] An exemplary nucleic acid aptamer according to this embodiment is illustrated in Figure 4A and has a core sequence of 36 nucleotides, which is a consensus sequence shared by families G3 and G16, as follows
GAAUUGDKWGGKNAAAGUCCUGAAAAGAGGGCCACC (SEQ ID NO 19), where N is optional and can be A, flanked by regions of 45 (51) and 40 (31) random nucleotides and the constant primer sequences 5' primer GGGAGCACGAUUCCAU (SEQ ID NO 20) and 3' primer UACAAGCUUCUGGACUCGGU (SEQ ID NO 21)
Members of this family, designated AP2-AP8, have the following core sequences flanked by SEQ ID NOS 20 and 21 AP2 (N40^N20)
GCAAUUGUCGAGUUGUUAGCAGCAGCUUGCAUAUUGAGUCGUGGCGAA
UUGGGUGGGGAAAGUCCUAAAAAGAGGGCCACCACAGAGGUUUGUACC
CAUAC (SEQ ID NO 22),
AP3 (N40^N26) GCGUGAGACGUCUUGAUGAAAUCCGGCUCGGCAAUGGUUCGUGGCGAA
UUGGGUGGGGAAAGUCCUUAAAAGAGGGCCACCACAGAAGCUUGUGGA
GUUAACAGCAA (SEQ ID NO 23),
AP4
GAUUCUCGUAUCAAGGAAGGGUUAUGAGAUUUAGGUAAACGUGGCGAA UUGGGUGGGGAAAGUCCUAAAAAGAGGGCCACCACAGAGGCUUGUAAU
CGAUGUUACUAUAGAGGGACACGAC (SEQ ID NO 24),
AP5
GUAGCGUGUGGAUCAUCACCUAUGACCCGGCUACGGUUUCGUGGCGAA
UUGGGUGGGGAAAGUCCURAAAAGAGGGCCACCACAGAAGCCAUUUCG AAUACUCGUCCUUGCACAGUAUCGA (SEQ ID NO 25),
AP6
UGGAUGCCACCGCGACUACGGUUAGUAGGCAUUCUGAGUCGUGGCGAA
UUGGGUGGGGAAAGUCCUGAAAAGAGGGCCACCACAGAGGCUCAAACU
GGACGUUAAUGACGUUUCGGUUCAG (SEQ ID NO 26), AP7
ACGGAAAGAGGUAAUUAUGCAUCUCCAAUGUGUAUGGUUCGUGGCGAA
UUGGGUGGGGAAAGUCCUGAAAAGAGGGCCACCACGGAAGCUUAACGG
AGAGGAGCUGGGGCGCCUUUUCCGA (SEQ ID NO 27), and
AP8 UUUUAAUUCGCCGUGACACGUCGCGGUCAAGAAUGGCUUCGUGGCGAA
UUGGGUGGGGAAAGUCCUGAAAAGAGGGCCACCACAGAAGCGCUGCUU
GACCAUCAAUCCGAAUCGUCAAGUG (SEQ ID NO 28) The minimal core sequence was identified as
GGGAGCACGAUGGCGUGGCGAAUUGGGUGGGGAAAGUCCUUAAAAGAG GGCCACCACAGAAGCAAUGGGCUUCUGGACUCGGU (SEQ ID NO 29) [0049] The nucleic acid aptamer of the present invention may also have a second domain that binds to a molecule different from the fluorescent protein Thus, the nucleic acid aptamer may have a first domain that binds to a fluorescent protein and a second domain capable of binding with a molecule other than the fluorescent protein, such as a target molecule The target molecule can be any molecule whose presence (or absence) is of interest [0050] The second domain of the nucleic acid aptamer of the present invention may be a functional aptamer core that binds to a molecule other than the fluorescent protein Suitable second domains can be identified by SELEX (described above) and then fused to aptamer structures to form multi-valent aptamers having a first and second (and additional) domains [0051] Molecules other than the fluorescent proteins to which the second domain of the nucleic acid aptamer of the present invention may bind include any target molecule, such as natural or synthetic small molecules, macromolecules, supramolecular assemblies, or combinations thereof In a preferred embodiment, the target molecule is a protein, nucleic acid, liposacchaπde, saccharide, lipoprotein, glycoprotein, or hydrocarbon polymer Other suitable molecular targets include small signaling molecules, cellular metabolic products, proteins that are produced by infectious agents, or oncogenic proteins
[0052] According to a preferred embodiment, binding of the target at the second domain precludes binding, alters the binding configuration, or results in a conformation change in the nucleic acid aptamer or fluorescent protein at the first domain, thereby modulating the functional interaction of the nucleic acid aptamer with the fluorescent protein (Figures IA-C) As a result, binding of the target to the second domain can result in a detectable change (e g , a change in wavelength or intensity) in the fluorescence of the fluorescent protein Thus, the nucleic acid aptamer of the present invention can be used as a signaling system to detect presence or location of target molecules, as described in greater detail infra [0053] Another aspect of the present invention relates to a molecular complex containing the nucleic acid aptamer of the present invention bound to a fluorescent protein at the first domain
[0054] The nucleic acid aptamer is preferably reversibly bound to the fluorescent protein Thus, the functional interaction between the nucleic acid aptamer and the fluorescent protein at the first domain can be disrupted by, e g , conformational changes occurring in the nucleic acid aptamer and/or the fluorescent protein [0055] A further aspect of the present invention relates to a constructed DNA molecule containing a first region encoding a nucleic acid aptamer of the present invention and a second region encoding a fluorescent protein capable of binding to the first domain of the nucleic acid aptamer
[0056] Preparation of the DNA molecule can be carried out by well-known methods of DNA ligation DNA ligation utilizes DNA hgase enzymes to covalently link or hgate fragments of DNA together by catalyzing formation of a phosphodiester bond between the 5' phosphate of one strand of DNA and the 3' hydroxyl of another Typically, ligation reactions require a strong reducing environment and ATP The commonly used T4 DNA hgase is an exemplary DNA hgase in preparing the DNA molecule of the present invention Once the DNA molecule of the present invention has been constructed, it can be incorporated into cells as described infra
[0057] Transcription of the DNA molecule of the present invention is dependent upon the presence of a promoter, which is a DNA sequence that directs the binding of RNA polymerase and thereby promotes RNA synthesis Accordingly, the DNA molecule of the present invention may have a first promoter operably coupled to the first region to control expression of the nucleic acid aptamer and a second promoter operably coupled to the second region to control expression of the fluorescent protein Alternatively, the DNA molecule can be bicistromc, having a single promoter that directs transcription of both the aptamer-encodmg DNA sequence and the fluorescent protein [0058] The DNA sequences of eukaryotic promoters differ from those of prokaryotic promoters Furthermore, eukaryotic promoters and accompanying genetic signals may not be recognized in or may not function in a prokaryotic system and, further, prokaryotic promoters are not recognized and do not function in eukaryotic cells
[0059] Promoters vary in their "strength" (i e , their ability to promote transcription) It is desirable to use strong promoters in order to obtain a high level of transcription Depending upon the host cell system utilized, any one of a number of suitable promoters may be used For instance, when cloning in E coh, its bacteriophages, or plasmids, promoters such as the T7 phage promoter, lac promoter, trp promoter, recA promoter, πbosomal RNA promoter, the PR and PL promoters of coliphage lambda and others, including but not limited, to /αcUV5, ompF, bla, Ipp, and the like, may be used to direct high levels of transcription of adjacent DNA segments Additionally, a hybrid trp-lacUV5 (tac) promoter or other E coh promoters produced by recombinant DNA or other synthetic DNA techniques may be used to provide for transcription of the inserted gene [0060] Bacterial host cell strains and expression vectors may be chosen which inhibit the action of the promoter unless specifically induced In certain operons, the addition of specific inducers is necessary for efficient transcription of the inserted DNA For example, the lac operon is induced by the addition of lactose or IPTG (isopropylthio-beta-D-galactoside) A variety of other operons, such as trp, pro, etc , are under different controls [0061] As described above, one type of regulatory sequence is a promoter located upstream or 5' to the coding sequence of the DNA molecule Depending upon the desired activity, it is possible to select the promoter for not only in vitro production of the nucleic acid aptamer and the fluorescent protein, but also in vivo production in cultured cells or whole organisms, as described below Because in vivo production can be regulated genetically, a preferable type of promoter is an inducible promoter which induces transcription of the DNA molecule in response to specific conditions, thereby enabling expression of the nucleic acid aptamer and the fluorescent protein according to desired therapeutic needs (i e , expression within specific tissues, or at specific temporal and/or developmental stages) [0062] Preferred promoters for use with the constructed DNA molecule of the present invention include a T7 promoter, a SUP4 tRNA promoter, an RPRl promoter, a GPD promoter, a GALl promoter, an hsp70 promoter, an Mtn promoter, a UAShs promoter, and functional fragments thereof The T7 promoter is a well-defined, short DNA sequence that can be recognized and utilized by T7 RNA polymerase of the bacteriophage T7 The T7 RNA polymerase can be purified in large scale and is commercially available The transcription reaction with T7 promoter can be conducted in vitro to produce a large amount of the molecular complex of the present invention (Milhgan et al , "Oligoπbonucleotide Synthesis Using T7 RNA Polymerase and Synthetic DNA Templates," Nucleic Acids Res 15(21) 8783-8798 (1987), which is hereby incorporated by reference in its entirety) The SUP4 tRNA promoter and RPRl promoter are driven by RNA polymerase III of the yeast Saccharomyces cerevisiae, and suitable for high level expression of RNA less than 400 nucleotides in length (Kuqan et al , Mutation at the Yeast SUP4 tRNA^ Locus DNA Sequence
Changes in Mutants Lacking Supressor Activity," Cell 20 701-709 (1980) and Lee et al , "Expression of RNase P RNA in Saccharomyces cerevisiae is Controlled by an Unusual RNA Polymerase III Promoter," Proc Natl Acad Sa USA 88 6986-6990 (1991), which are hereby incorporated by reference in their entirety) The glyceraldehydes-3-phosphate dehydrogenase (GPD) promoter in yeast is a strong constitutive promoter driven by RNA polymerase II (Bitter et al , "Expression of Heterologous Genes in Saccharomyces cerevisiae from Vectors Utilizing the Glyceraldehyde-3-phosphate Dehydrogenase Gene Promoter," Gene 32 263-274 (1984), which is hereby incorporated by reference in its entirety) The galactokmase (GALl) promoter in yeast is a highly inducible promoter driven by RNA polymerase II (Johnston and Davis, "Sequences that Regulate the Divergent GALl-GALlO Promoter in Saccharomyces cerevisiae," MoI Cell Biol 4 1440-1448 (1984), which is hereby incorporated by reference in its entirety) The heat shock promoters are heat inducible promoters driven by the RNA polymerase II in eukaryotes The frequency with which RNA polymerase II transcribes the major heat shock genes can be increased rapidly in minutes over 100-fold upon heat shock The heat shock promoter used in the present invention can be a Drosophύa hsp70 promoter, more preferably a portion of the Drosophύa hsp70 promoter which is fully functional with regard to heat mducibihty and designated heat inducible cassette, or Hie (Kraus et al , "Sex- Specific Control of Drosophύa melanogaster Yolk Protein 1 Gene Expression is Limited to Transcription," MoI Cell Biol 8 4756-4764 (1988), which is hereby incorporated by reference in its entirety) Another inducible promoter driven by RNA polymerase II that can be used in the present invention is a metallothionme (Mtn) promoter, which is inducible to the similar degree as the heat shock promoter in a time course of hours (Stuart et al , "A 12-Base-Pair Motif that is Repeated Several Times in Metallothionme Gene Promoters Confers Metal Regulation to a Heterologous Gene/' Prac Natl Acad Sci USA 81 7318-7322 (1984), which is hereby incorporated by reference in its entirety) An additional promoter used in the present invention is a constructed hybrid promoter in which the yeast upstream activation sequence for a GALl gene is fused to the core Drosophύa hsp70 promoter (Brand and Perrimon, "Targeted Gene Expression as a Means of Altering Cell Fates and Generating Dominant Phenotypes," Development 118 401-415 (1993), which is hereby incorporated by reference in its entirety) This promoter is no longer activated by heat shock Rather, it is activated by the yeast GAL4 protein, a transcription activator that is normally not present in Drosophύa The yeast GAL4 gene has been introduced into Drosophύa, and is itself under a variety of transcriptional control in different fly lines [0063] Initiation of transcription in mammalian cells requires a suitable promoter, which may include, without limitation, β-globm, GAPDH, β-actm, actin, Cstf2t, SV40, MMTV, metallothionme- 1, adenovirus EIa, CMV immediate early, immunoglobulin heavy chain promoter and enhancer, and RSV-LTR Termination of transcription in eukaryotic genes involves cleavage at a specific site in the RNA which may precede termination of transcription Also, eukaryotic termination varies depending on the RNA polymerase that transcribes the gene However, selection of suitable 3 ' transcription termination regions is well known in the art and can be performed with routine skill [0064] Spatial control of an RNA molecule can be achieved by tissue-specific promoters, which have to be driven by the RNA polymerase II The many types of cells in animals and plants are created largely through mechanisms that cause different genes to be transcribed in different cells, and many specialized animal cells can maintain their unique character when grown in culture The tissue-specific promoters involved in such special gene switching mechanisms, which are driven by RNA polymerase II, can be used to drive the transcription templates that code for the molecular complex of the present invention, providing a means to restrict the expression of the molecular complex in particular tissues [0065] For gene expression in plant cells, suitable promoters may include, without limitation, nos promoter, the small subumt πbulose bisphosphate carboxylase genes, the small subumt chlorophyll A/B binding polypeptide, the 35S promoter of cauliflower mosaic virus, and promoters isolated from plant genes, including the Pto promoter itself {See C E Vallejos, et al , "Localization in the Tomato Genome of DNA Restriction Fragments Containing Sequences Homologous to the RRNA (45S), the major chlorophyll A/B Binding Polypeptide and the Ribulose Bisphosphate Carboxylase Genes," Genetics 112 93-105 (1986) (disclosing the small subumt materials), which is hereby incorporated by reference in its entirety) The nos promoter and the 35S promoter of cauliflower mosaic virus are well known in the art [0066] In addition, the constructed DNA molecule may also include an operable 3' regulatory region, selected from among those which are capable of providing correct transcription termination and polyadenylation of mRNA for expression in plant cells A number of 3 ' regulatory regions are known to be operable in plants Exemplary 3 ' regulatory regions include, without limitation, the nopalme synthase 3' regulatory region (Fraley, et al , "Expression of Bacterial Genes in Plant Cells," Proc Natl Acad Sa USA, 80 4803-4807 (1983), which is hereby incorporated by reference in its entirety) and the cauliflower mosaic virus 3 ' regulatory region (Odell, et al , "Identification of DNA Sequences Required for Activity of the Cauliflower Mosaic Virus 35S Promoter," Nature, 313(6005) 810-812 (1985), which is hereby incorporated by reference in its entirety) Virtually any 3 ' regulatory region known to be operable in plants would suffice for proper expression of the coding sequence of the constructed DNA molecule of the present invention [0067] To obtain high level expression, the constructed DNA molecule can contain a plurality of monomeπc DNA sequences hgated "head-to-tail," each of which encodes a molecular complex of the present invention (i e , a nucleic acid aptamer having a first domain and a fluorescent protein capable of binding the nucleic acid aptamer at the first domain) This is particularly useful for augmenting the number of molecular complexes produced during each transcriptional event By plurality, it is intended that the number of monomeπc DNA sequences be at least two, preferably at least four, more preferably at least eight, and most preferably at least twelve Such tandemly arrayed sequences are known to be relatively stable in bacteria (Lmdquist, "Varying Patterns of Protein Synthesis in Drosophila During Heat Shock Implications for Regulation," Dev Biol 77 463-479 (1980), which is hereby incorporated by reference in its entirety) and can persist for many generations in transgenic fly lines (Xiao and Lis, "A Consensus Sequence Polymer Inhibits In Vivo Expression of Heat Shock Genes," MoI Cell Biol 6 3200-3206 (1986), Shopland and Lis, "HSF Recruitment and Loss at Most Drosophila Heat Shock Loci is Coordinated and Depends on Proximal Promoter Sequences," Chromosoma 105 158-171 (1996), which are hereby incorporated by reference in their entirety) This strategy should be applicable to other organisms For example, long direct repeating sequences have been used in yeast (Robmett et al , "In Vivo Localization of DNA Sequences and Visualization of Largescale Chromatin Organization Using lac Operator/Repressor Recognition," J Cell Biol 135 1685-700 (1996), which is hereby incorporated by reference in its entirety) It should be apparent to those of ordinary skill in the art, however, that the number of monomeπc DNA sequences can vary for each application of the DNA molecule [0068] Depending upon the desired application and intended use for the DNA molecule, it is possible to produce homopolymers containing a plurality of substantially identical monomeπc DNA sequences or copolymers containing a plurality of substantially different monomeπc DNA sequences It is also possible to produce copolymers, block polymers, or combinations thereof, that contain a plurality of substantially different monomeπc DNA sequences The molecular complexes produced from such a homopolymer are a single type In contrast, the molecular complexes produced from such a copolymer, a block polymer, or a combination thereof, are different types (i e , expressing different aptamers, different fluorescent proteins, or both) Thus, the plurality of monomeπc DNA sequences can be substantially identical (i e , producing substantially the same molecular complex) or they can be substantially different (i e , producing substantially different molecular complexes) When the plurality of monomeπc DNA sequences are substantially different, the resulting molecular complexes can be directed to the same or to different target molecules [0069] When the DNA molecule encodes a plurality of molecular complex sequences, it is important that the resulting RNA transcript be cleaved into individual RNA molecules corresponding to the molecular complexes of the present invention To this end, it is particularly desirable for each of the plurality of monomeπc DNA sequences to also encode a cis-actmg πbozyme that can cleave the RNA transcript of the DNA molecule to yield multiple copies of the RNA molecule giving rise to the molecular complexes Although any πbozyme sequence can be utilized, a hammerhead πbozyme sequence (Haseloff and Gerlach, "Simple RNA Enzymes with New and High Specific Endoπbonucleases Activities," Nature 334 585-591 (1988), which is hereby incorporated by reference in its entirety) is preferred because of its simplified and efficient structure The sequence encoding the hammerhead πbozyme is incorporated into each of the plurality of monomeπc DNA sequences, resulting in the hammerhead πbozyme being located at one end of each monomeπc unit of the immature RNA transcript The immature RNA transcript is self-cleaved by the cis- actmg πbozyme
[0070] Once the DNA molecule of the present invention has been constructed, it can be incorporated into cells using conventional recombinant DNA technology Generally, this involves inserting the DNA molecule into an expression system to which the DNA molecule is heterologous (i e , not normally present) The heterologous DNA molecule is inserted into the expression system or vector in proper sense orientation The vector contains the necessary elements for their persistent existence inside cells and for the transcription of an RNA molecule that can be translated into the molecular complex of the present invention [0071] U S Patent No 4,237,224 to Cohen and Boyer, which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA hgase These recombinant plasmids are then introduced by means of transformation and transfection, and replicated in cultures including prokaryotic organisms and eukaryotic cells grown in tissue culture
[0072] Recombinant viruses can be generated by transfection of plasmids into cells infected with virus
[0073] Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gtl 1, gt WES tB, Charon 4, and plasmid vectors such as pBR322, pBR325, pACYC177, pACYC184, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKClOl, SV 40, pBluescπpt II SK +/- or KS +/- (see "Stratagene Cloning Systems" Catalog (1993) from Stratagene, La Jolla, Calif which is hereby incorporated by reference), pQE, pIH821, pGEX, pET series (see Studier et al , "Use of T7 RNA Polymerase to Direct Expression of Cloned Genes," Gene Expression Technology, vol 185 (1990), which is hereby incorporated by reference in its entirety), pIIIEx426 RPR, pIIIEx426 tRNA (see Good and Engelke, "Yeast Expression Vectors Using RNA Polymerase III Promoters," Gene 151 209-214 (1994), which is hereby incorporated by reference in its entirety), p426GPD (see Mumberg et al , "Yeast Vectors for the Controlled Expression of Heterologous Proteins in Different Genetic Background," Gene 156 119-122 (1995), which is hereby incorporated by reference in its entirety), p426GALl (see Mumberg et al , "Regulatable Promoters of Saccharomyces cerevisiae Comparison of Transcriptional Activity and Their Use for Heterologous Expression," Nucleic Acids Research 22 5767-5768 (1994), which is hereby incorporated by reference in its entirety), pUAST (see Brand and Perrimon, "Targeted Gene Expression as a Means of Altering Cell Fates and Generating Dominant Phenotypes," Development 118 401-415 (1993), which is hereby incorporated by reference in its entirety), and any derivatives thereof Suitable vectors are continually being developed and identified
[0074] A variety of host- vector systems may be utilized to express the DNA molecule Primarily, the vector system must be compatible with the host cell used Host-vector systems include but are not limited to the following bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA, microorganisms such as yeast containing yeast vectors, mammalian cell systems infected with virus (e g , vaccinia virus, adenovirus, adeno-associated virus, retrovial vectors, etc ), insect cell systems infected with virus (e g , baculovirus), and plant cells infected by bacteria or transformed via particle bombardment (i e , biohstics) The expression elements of these vectors vary in their strength and specificities Depending upon the host-vector system utilized, any one of a number of suitable transcription elements can be used [0075] Once the constructed DNA molecule has been cloned into an expression system, it is ready to be incorporated into a host cell Such incorporation can be carried out by the various forms of transformation, depending upon the vector/host cell system such as transformation, transduction, conjugation, mobilization, or electroporation The DNA sequences are cloned into the vector using standard cloning procedures in the art, as described by Mamatis et al , Molecular Cloning A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, New York (1982), which is hereby incorporated by reference in its entirety Suitable host cells include, but are not limited to, bacteria, yeast, mammalian cells, insect cells, plant cells, and the like The host cell is preferably present either in a cell culture (ex vivo) or in a whole living organism (in vivo)
[0076] Mammalian cells suitable for carrying out the present invention include, without limitation, COS (e g , ATCC No CRL 1650 or 1651), BHK (e g , ATCC No CRL 6281), CHO (ATCC No CCL 61), HeLa (e g , ATCC No CCL 2), 293 (ATCC No 1573), CHOP, NS-I cells, and primary cells recovered directly from a mammalian organism With regard to primary cells recovered from a mammalian organism, these cells can optionally be reintroduced into the mammal from which they were harvested
[0077] The expression of high levels of functional RNA aptamers withm cells can be complicated by several factors including RNA stability, short half-life, and difficulties in cellular targeting Nonetheless, substantial progress has been achieved over the last several years The first demonstration of aptamer function in live cells involved nuclear targets (Klug et al , "In Vitro and In Vivo Characterization of Novel mRNA Motifs that Bind Special Elongation Factor SeIB," Proc Natl Acad Sci USA 94 6676-6681 (1997), Shi et al , "RNA Aptamers as Effective Protein Antagonists In a Multicellular Organism," Proc Natl Acad Sa USA 96 10033-10038 (1999), Thomas et al , "Selective Targeting and Inhibition of Yeast RNA Polymerase II by RNA Aptamers," J Biol Chem 272 27980-27986 (1997), which are hereby incorporated by reference in their entirety) It has been demonstrated, for example, that the RNAs directed against the Drosophila B52 protein inhibit B52 function and suppresses the phenotype of B52 overexpression in transgenic flies, and have pioneered the use of concatameπc genetic constructs that undergo self cleavage following transcription (Shi et al , "RNA Aptamers as Effective Protein Antagonists In a Multicellular Organism," Proc Natl Acad Sa USA 96 10033-10038 (1999), which is hereby incorporated by reference in its entirety) Aptamer function within the nucleus of mammalian cells has also been demonstrated (Symensma et al , "Polyvalent Rev Decoys Act as Artificial Rev-Responsive Elements," J Virol 73 4341-4349 (1999), which is hereby incorporated by reference in its entirety) More recently, effective strategies for cytoplasmic targeting of aptamer have also been developed For example, the human tRNA initiator sequence, which mediates highly efficient nuclear export to deliver functional chimeric RNA aptamers to the cytosol has been used (Chalom et al , "Endogenous Expression of a High- Affinity Pseudoknot RNA Aptamer Suppresses Replication of HIV-I," Nucleic Acids Res 30 4001-4008 (2002), which is hereby incorporated by reference in its entirety) Functional RNA aptamers have also been directly delivered to the cytoplasm by lipofection (Theis et al , "Discriminatory Aptamer Reveals Serum Response Element Transcription Regulated by Cytohesm-2," Proc Natl Acad Sci USA 101 11221- 11226 (2004), which is hereby incorporated by reference in its entirety) Finally, most recently, very high levels of aptamer expression (IxIO7 molecules per cell) have been achieved by fusion with a highly stable transcript (Choi et al , "Intracellular Expression of the T-cell Factor-1 RNA Aptamer as an Intramer," MoI Cancer Ther 5 2428-2434 (2006), which is hereby incorporated by reference in its entirety) The use of chimeric RNAs and other strategies will be systematically explored to achieve high levels of nuclear and cytoplasmic FQA expression [0078] Plant tissues suitable for transformation include leaf tissue, root tissue, meπstems, zygotic and somatic embryos, and anthers It is particularly preferred to utilize embryos obtained from anther cultures The expression system of the present invention can be used to transform virtually any plant tissue under suitable conditions, and the transformed cells can be regenerated into whole plants [0079] One approach to transforming plant cells and/or plant cell cultures, tissues, suspensions, etc with a DNA molecule of the present invention is particle bombardment (also known as biolistic transformation) of the host cell This technique is disclosed in U S Patent Nos 4,945,050, 5,036,006, and 5,100,792, all to Sanford, et al , which are hereby incorporated by reference in their entirety [0080] Another method of introducing DNA molecules into a host cell is fusion of protoplasts with other entities, either mimcells, cells, lysosomes, or other fusible hpid-surfaced bodies that contain the DNA molecule (Fraley et al , "Expression of Bacterial Genes in Plant Cells," Proc Natl Acad Sci USA 80 4803- 4807 (1983), which is hereby incorporated by reference in its entirety) [0081] The DNA molecule of the present invention may also be introduced into the plant cells and/or plant cell cultures, tissues, suspensions, etc by electroporation (Fromm et al , "Expression of Genes Transferred into Monocot and Dicot Plant Cells by Electroporation," Proc Natl Acad Sci USA 82 5824 (1985), which is hereby incorporated by reference in its entirety) [0082] In producing transgenic plants, the DNA construct in a vector described above can be micromjected directly into plant cells by use of micropipettes to transfer mechanically the recombinant DNA (Crossway, "Integration of Foreign DNA Following Microinjection of Tobacco Mesophyll Protoplasts," MoI Gen 5 Genetics 202 179-85 (1985), which is hereby incorporated by reference in its entirety) The genetic material may also be transferred into the plant cell using polyethylene glycol (Krens et al , "In Vitro Transformation of Plant Protoplasts with TI-Plasmid DNA," Nature 296 72-74 (1982), which is hereby incorporated by reference in its entirety)
10 [0083] One technique of transforming plants with the DNA molecules in accordance with the present invention is by contacting the tissue of such plants with an inoculum of a bacteria transformed with a vector comprising a DNA molecule in accordance with the present invention Generally, this procedure involves inoculating the plant tissue with a suspension of bacteria and incubating the tissue for 48 to
15 72 hours on regeneration medium without antibiotics at 25-28°C
[0084] Bacteria from the genus Agrobacterium can be utilized to transform plant cells Suitable species of such bacterium include Agrobacterium tumefaciens and Agrobacterium rhizogenes Agrobacterium tumefaciens (e g , strains C58, LBA4404, or EHA105) is particularly useful due to its well-known ability to
20 transform plants
[0085] Heterologous genetic sequences can be introduced into appropriate plant cells by means of the Ti plasmid of A tumefaciens or the Ri plasmid of A rhizogenes The Ti or Ri plasmid is transmitted to plant cells on infection by Agrobacterium and is stably integrated into the plant genome (Schell, "Transgenic
25 Plants as Tools to Study the Molecular Organization of Plant Genes," Science 237 1176-83 (1987), which is hereby incorporated by reference in its entirety) [0086] After transformation, the transformed plant cells must be regenerated
[0087] Plant regeneration from cultured protoplasts is described in Evans et al , Handbook of Plant Cell Cultures, VoI 1, MacMillan Publishing Co , New York
30 (1983) and Vasil (ed ), Cell Culture and Somatic Cell Genetics of Plants, Acad Press, Orlando, VoI I (1984) and VoI 111 (1986), which are hereby incorporated by reference [0088] It is known that practically all plants can be regenerated from cultured cells or tissues
[0089] Another aspect of the present invention relates to a system containing a first DNA molecule encoding a nucleic acid aptamer as described above and a second DNA molecule encoding a fluorescent protein capable of being bound by the first domain In a preferred embodiment of the system, the first and second DNA molecules each have a promoter operably coupled to the regions encoding, respectively, the nucleic acid aptamer and the fluorescent protein The system of the invention may be incorporated into expression systems and/or host cells as described supra
[0090] A further aspect of the present invention relates to a method of detecting a molecular target This method involves providing a molecular complex as described above and contacting a molecular target with the molecular complex under conditions effective to cause a change in fluorescence of the fluorescent protein (i e , upon binding of the target to the second domain of the aptamer) As a consequence, the change in fluorescence indicates (i e , allows detection of) presence of the molecular target
[0091] The method of the invention may be carried out in a cell by introducing the molecular complex into the cell In one embodiment, the complex is recombmantly expressed in a cell Methods for introducing the molecular complex into a cell are described supra
[0092] Contacting a target with the molecular complex of the present invention at the second domain can modulate binding of fluorescent protein at the first domain, inhibit binding of the fluorescent protein at the first domain, alter the binding configuration of the fluorescent protein at the first domain, or cause a conformational change in the nucleic acid aptamer or fluorescent protein that alters binding of the fluorescent protein at the first domain As a result, the functional interaction of the nucleic acid aptamer with the fluorescent protein can be altered and thereby result in a detectable change in fluorescence (e g , a shift in the fluorescence wavelength or intensity) of the fluorescent protein Accordingly, by this method, one can detect when the molecular complex of the present invention contacts a target molecule [0093] Detecting a change in fluorescence may be carried out by visual observation Alternatively, detecting a change in fluorescence may be carried out with a spectrophotometer, or a microscope or macroscope system coupled to a camera or photomultipher tube Coupled with proper instrumentation, the optical readout can be followed in real time in living systems to obtain spatio-temporal information (functional intracellular imaging) [0094] By way of example, if the molecular complex employed in the method of the present invention quenches fluorescence of the fluorescent protein when the fluorescent protein is bound to the first domain, contacting the molecular complex with a target molecule at the second domain may cause a change in the functional interaction of the nucleic acid aptamer with the fluorescent protein at the first domain which results in an unquenched fluorescence signal (i e , the fluorescence of the fluorescent protein is no longer quenched)
[0095] In another example, if the molecular complex employed in the method of the present invention enhances fluorescence of the fluorescent protein when the fluorescent protein is bound to the first domain, contacting the molecular complex with a target molecule at the second domain may cause a change in the functional interaction of the nucleic acid aptamer with the fluorescent protein at the first domain which results in a decreased fluorescence signal (i e , the fluorescence of the fluorescent protein is no longer enhanced) [0096] In yet another example, if the molecular complex employed in the method of the present invention does not alter the fluorescence of the fluorescent protein when the fluorescent protein is bound to the first domain, contacting the molecular complex with a target molecule at the second domain may cause a change in the functional interaction of the nucleic acid aptamer with the fluorescent protein at the first domain which results in an altered fluorescence signal [0097] Another aspect of the present invention relates to a method of determining location of a molecular target This method involves providing a molecular complex as described above A molecular target is contacted with the molecular complex and the fluorescence of the fluorescent protein is detected, whereby location of the molecular target is determined [0098] These aspects of the present invention are further illustrated by the examples below EXAMPLES
[0099] The following examples are provided to illustrate embodiments of the present invention, but they are by no means intended to limit its scope Example 1 - Development of Fluorescence Quenching Aptamers
[0100] A large RNA pool of randomized 50 nucleotides containing an estimated 10 -10 unique molecules was screened using a traditional selection scheme that relied on the immobilization of GFP on nitrocellulose membrane, as well as a negative selection step to remove membrane binding species This strategy was not successful, as multiple selection rounds resulted in highly enriched multi-G species and poor GFP specific binding These results occurred despite negative selection throughout the selection process, consistent with the selection of nitrocellulose membrane binding (multi-G) motifs and the incorporation of repeated πbonuclease H (RNase H) digestion steps, which did not markedly improve the selection of species demonstrating specific GFP binding (Shi et al , "Evolutionary Dynamics and Population Control During In Vitro Selection and Amplification with Multiple Targets," RNA 8 1461-1470 (2002), which is hererby incorporated by reference in its entirety) Parallel selection using a circularly permutate GFP protein resulted in excellent enrichment This complication may result from the low surface complexity of the 11 β-strand "can" structure of GFP and explains previously unsuccessful attempts to isolate aptamers with high affinity to GFP (Stanhs et al , "Smgle-strand DNA Aptamers as Probes for Protein Localization in Cells," J Histochem Cytochem 51 797-808 (2003), which is hereby incorporated by reference in its entirety) [0101] To overcome this problem, selection rounds were alternated by using
His-tagged GFP bound to Ni-charged beads and nitrocellulose membrane-bound GFP in the selection step Negative selection with nitrocellulose membrane or Ni-charged beads was also employed at each step This procedure resulted in strong selection pressure on the RNA pool and, following 15 iterations of binding and amplification, the sequenced RNA pool consisted of multiple copies of 2 highly related families, both of which displayed submicromolar binding affinity in a nitrocellulose membrane binding assay (Figure 2A) The higher affinity family (G16) decreased GFP/eGFP fluorescence in a concentration dependent manner in physiological buffer with a KD of approximately 30 nM (Figure 2B), consistent with the observation of a progressive loss of fluorescence of the immobilized GFP during the iterative aptamer binding steps of the selection The selected RNAs were highly related, falling in two general families, which were themselves homologous (Figure 2C) The total size of the functional aptamers was 100 nt, as 25 nt fixed PCR primers were included on either side of the selected 50 nt core Truncation of G16 by removal of either the 5' or 3' PCR primer regions resulted in a loss of activity, indicating that these 5' and 3' sequences were necessary for the functional secondary structure [0102] Using information on the core binding structure described above, a second pool of RNAs was designed that included the core 36 nt binding sequence shared by families G3 and G16 (SEQ ID NO 19), flanked by variable regions of 45 (51) and 40 (31) nucleotides and the constant PCR primer sequences (Figure 4A) This pool of 1014-1016 unique RNAs was subjected to 12 SELEX amplification rounds using alternating membrane and bead selection steps As shown in Figures 4B-C, clones from this selection showed distinctly higher binding affinity than G16, the most effective sequence from the initial selection Sequencing of individual clones again revealed multiple copies of individual sequences, with the two most abundant clones having been mutated and shortened within the 3' random sequence, either due to rare copies of shortened template DNA in the original pool or to PCR errors One of these clones, AP3 (SEQ ID NO 23, with primers SEQ ID NOS 20 and 21), showed the highest affinity (KD = 144 nM) and efficacy (70% inhibition) of GFP fluorescence inhibition (Figure 4D) Example 2 - Effect on Other Fluorescent Proteins
[0103] The Aequorea vwtona-deτived fluorescent proteins are highly homologous at the level of sequence and overall structure (Tsien, "The Green Fluorescent Protein," Annu Rev Biochem 67 509-544 (1998), which is hereby incorporated by reference in its entirety) Thus, eYFP differs by only 5 residues and eCFP by only 4 residues, relative to eGFP Moreover, fluorescent proteins derived from coral proteins also share the overall 11 -stranded β can structure, despite substantial sequence diversity (Verkhusha et al , "The Molecular Properties and Applications of Anthozoa Fluorescent Proteins and Chromoprotems," Nat Biotechnol 22 289-296) (2004), which is hereby incorporated by reference in its entirety) It was then determined whether the high affinity aptamers, selected by binding to GFP, would bind to and inhibit the fluorescence of other fluorescent proteins As shown in Figure 5A, AP3 binds with roughly equivalent affinity to GFP, eGFP, eCFP, and eYFP Surprisingly, however, aptamer binding enhances the eCFP and eYFP fluorescence (Figure 5B) Measurements of absorbance of these proteins in the presence of aptamer confirmed a distinct effect on GFP/eGFP, in that aptamer binding markedly reduced absorption of photons at peak excitation wavelengths, whereas this was not true for the other fluorescent proteins (Figure 5C) The pre- selected aptamer pool had no effect on fluorescence of any proteins Lower affinity binding of AP3 to the more distantly related Azumi green protein was observed
Example 3 - Mechanism of Fluorescence Quenching
[0104] Given the selective and potent effect of fluorescence quenching aptamers ("FQA"), the effect of aptamer binding on GFP photophysics was investigated One possible explanation for the observed effect would be a shift in the relative absorption peaks between the protonated (397 mn) and unprotonated (470 mn) forms of the GFP molecule, which account for the well known pH sensitivity of the 470 nm fluorescence The ionization state is modulated by a proton network, comprising an intricate network of polar interactions between the chromophore and several surrounding ammo acids Aptamer binding could either be changing the pKa of wtGFP or be binding in a manner that mimicks protonation Either mechanism could result in a change in the relative proportions of each species at a constant pH [0105] Emission scans indicate, however, that there is no significant difference in fluorescence exciting at 390 nm, despite a 74% decrease in 470 nm excited fluorescence (Figures 6A-C) This finding is also consistent with the effect of the aptamer on eGFP, which has a markedly reduced 390 nm absorption peak compared to the wild type form of the protein Quantitative measurements of the effect of AP3 RNA on the absorption spectra of GFP indicated a 50% decrease in absorption at 475 nm (ε = 6000 M ' cm ') yet only a 10% increase in the 397 nm (ε = 25000 M cm ) (Magde et al , "Fluorescence Quantum Yields and Their Relation to Lifetimes of Rhodamme 6G and Fluorescein in Nine Solvents Improved Absolute Standards for Quantum Yields," Photochem Photobwl 75 327-334 (2002), which is hereby incorporated by reference in its entirety)
[0106] If only a simple change in the relative proportion of the two states is involved, a concurrent 50% increase in the 390 nm absorption would be expected In addition, the 50% absorption decrease at 470 nm does not completely account for the 74% decrease seen in 470 nm excited fluorescence, indicating that the aptamer-bound GFP species has different absorption and different fluorescence properties than free GFP Bulk quantum yields under 470 nm excitation (referenced to fluorescein in 0 IN NaOH, φ= 0 925) (Wang et al , "Unnatural Ammo Acid Mutagenesis of Green Fluorescent Protein," J Org Chem 68 174-176 (2003), which is hereby incorporated by reference in its entirety), indicated -66% decrease, but no change in quantum yield when using 390 nm excitation These results are consistent with the fluorescence changes seen Interestingly, an initial measurement of fluorescence lifetimes showed that they were identical in the presence of the aptamer (~2 7 ns), indicating no evidence of direct quenching of the excited state by the aptamer A caveat of these measurements is that the data were obtained using two-photon excitation at 880 nm (and 780 nm) and may not be relevant since the initial excited state populated in two- photon absorption process is not the same as with single photon excitation Based on preliminary results, one interpretation is that the aptamer binds to both forms of GFP and has different effects on each species For the species of interest (470 nm unprotonated form) binding may alter the conformation of GFP in a manner that both reduces the absorption, possibly by altering the transition dipole, as well causing a reduction in the quantum yield (e g , increases the radiationless decay route) Example 4 - Dual Wavelength Measurements
[0107] As shown in Figures 6A-C, aptamer binding to GFP results in minimal changes in the fluorescence of the 390 nm-excited molecule, suggesting a strategy for dual wavelength fluorescence measurements that would be independent of fluorophore concentration or effective fluorescence pathlength As shown in Figures 7A-C, aptamer binding to GFP results in a small increase in the 390 nm fluorescence in addition to the marked decrease in 470 nm fluorescence, with an isosbestic point at 426 nm (see also Figures 6A-C) Aptamer binding to GFP results in a consistent fractional drop in fluorescence that is independent of the concentration of the fluorophore (Figure 7D) The 470/426 nm ratio preserves the approximately 3 fold dynamic range of the interaction It was found that the 470/390 nm fluorescence ratio was slightly less consistent Example 5 - Aptamer Secondary Structure
[0108] The structure for GFP aptamers has been further refined by identifying the core sequence underlying activity, creating a new RNA pool with this sequence and random flankmg nucleotides (40mers), and re-selectmg This process led to the identification of several sequences of different length, with identical high binding affinity The common predicted secondary structure of these RNAs was three short stems around a central loop (Figure 8A), with structures varying as to the length of the stems Through a series of substitutions, each stem was minimized until bmdmg/fluorescence activity was lost For example, RNAs with full function contained sequences with predicted Stem 2 of variable length (up to 11 pairs), decreasing this stem to 7 pairs retained full function, but a 6 pair stem achieved only a 45% decrease in GFP fluorescence Also, withm Stem 2, the sequence of the first 6 pairs (numbering from the end of the stem mward) could be substituted with no loss in function, whereas the changes in the C-G pair at the internal loop resulted in a slight decrease in function [0109] Following minimization of the stem lengths, the base pairing was confirmed by selected substitutions that destabilized specific stems For example, in Stem 3, the addition of paired nucleotides between positions 20/21 and 79/80 resulted in full function (dotted circle in Figure 8A), whereas single nucleotide additions at these positions destroyed function, confirming the secondary structure in this region Similar paired substitutions were performed in Stem 2 Insertions within the central loop resulted in full function, although the angle between loops 1 and 2 (arrow Figure 8A) was critical and insertion of a single nucleotide resulted in 50% fluorescence quench Circular permutation of the structures indicated that they could be opened at the ends of Stem 2 or Stem 3, further confirming this structure Importantly, addition of nucleotides from the open loop of Stem 2 retained full function Finally, the structure of Stem 3 was further confirmed by encoding from Stem 2, randomizing the nucleotides comprising Stem 3, and performing SELEX This process led to the identification of 24 highly related sequences, each of which consisted of two stems separated by a variation of the closed loop contained withm Stem 3 (Figure 8B) These experiments establish the 2° structure of FQAs and provide feasibility for the creation of allosteπcally regulated aptamers, as they have identified the minimal functional structures and the retention of this function when the aptamers are opened and elongated
Prophetic Example 6 - Developing Genetic Systems for the Balanced Expression of GFP and Aptamer RNA in the Nucleus and Cytosol of Mammalian Cells [0110] Genetically encoded sensors of cell signaling have distinct advantages as expression of these molecules can be tightly controlled and subcellularly localized To date, these sensors have been constructed from polypeptides, exploiting the binding characteristics of specific peptide domains (detector) to alter protein fluorescence (reporter) either directly or through resonance energy transfer In the case of FRET sensors, usually the detector consists of peptide elements with high affinity that bring the donor and acceptor reporter fluorophores into proximity sufficient for energy transfer There are several disadvantages to this approach First, reliance on specific protein binding motifs requires de novo design and optimization of each sensor, a process that is time consuming and often unsuccessful due to the requirement to effectively couple the conformational change of the detector to alterations in the reporter Second, binding of other proteins to the sensor (detector or reporter) may markedly alter its characteristics, an outcome made more likely by the use of peptide elements that have evolved to interact with other cellular partners Thus, cellular elements that bind, for example, to uncharacteπzed components of the detector can markedly alter its behavior in a living cell Finally, detection of a target requires a known binding partner of appropriate affinity and specificity However, in many cases such a detector motif is not known Examples of this difficulty include the detection of specific phosphoprotems for which hundreds of variants may exist and the detection of aberrantly-folded proteins for which no known binding partners exist
[0111] An alternative strategy relies on the use of structural RNAs as relatively simple fluorescent switches The affinity of RNA aptamers to fluorescent proteins will be regulated by the binding of a molecule to be detected This binding will perturb the highly specific structural interaction between the aptamer and fluorescent protein, thereby resulting in unbinding and a fluorescent signal proportional to the concentration of the analyte The use of FQAs as a flexible, genetically encoded, real time detector system will be investigated and genetic expression methods and allosteπc switches that are required to realize the potential of this system will be developed Given the extreme size and diversity of the aptamer structural space, this strategy may enable the development of sensors for virtually any defined target [0112] A fundamental requirement for the development of the proposed RNA/fluorescent protein sensor system is the efficient and balanced expression of
RNA and GFP Efficient genetic expression systems will be developed for FQAs and their function in live cells will be assessed The development of functional, chimeric RNAs will be useful both for the expression of the GFP signaling system {infra) and as a means of localizing YFP or CFP to non-protem biological molecules, as the chromaphores are not quenched by binding
[0113] Experiments will be conducted in stable HEK293T cell lines in which
GFP or GFP flanked by a nuclear localization signal are stably expressed These lines have been developed through transfection of cells with bicistromc mammalian expression vectors that include GFP and the neomycin resistance cassette under control of a strong viral promoter (CMV) Cells have been selected with neomycin and clones established that display a modest and stable degree of cytoplasmic or nuclear GFP expression This strategy eliminates difficulties related to the kinetics of RNA and protein expression in transient transfection assays [0114] HEK293T cells will be transfected in 6 well plates with varying concentrations of vector DNA prepared from bicistromc constructs encoding chimeric RNAs and an mCherry reporter that will serve as a marker for gene transfer These cells will be transfected with the vector DNA using LipofectAMINE PLUSTM reagent (Life Technologies, Invitrogen Corporation, Carlsbad, CA) [0115] The chimeric aptamer constructs described below will be driven by RNA polymerase III promoters, which have been shown to direct high concentrations of siRNA in cells and mice (Yu et al , "Reproducible and Inducible Knockdown of Gene Expression in Mice," Genesis 44 252-261 (2006), which is hereby incorporated by reference in its entirety) The chimeric systems to be used are U6 small nuclear RNA (snRNA) promoter and related adapter sequences for nuclear expression of the GFP aptamer (Figures 9A-B), the 5S πbosomal RNA promoter and 5S RNA sequences for cytoplasmic expression (these RNA sequences mediate protein binding and nuclear export) (Figures 9C-D), the 7SL RNA promoter and signal recognition particle sequences for cytoplasmic expression (Figures 9E-F), a chimeric construct containing flankmg tRNA methionine sequences previously shown to efficiently direct RNA aptamer nuclear export (Chalom et al , "Endogenous Expression of a High- Affinity Pseudoknot RNA Aptamer Suppresses Replication of HIV-I," Nucleic Acids Res 30 4001-4008 (2002), Thompson et al , "Improved Accumulation and Activity of Ribozymes Expressed From a tRNA-Based RNA Polymerase III Promoter," Nucleic Acids Res 23 2259-2268 (1995), which are hereby incorporated by reference in their entirety) (the tRNA sequence directs transcription) (Figures 9G-H), and a second tRNA construct using the valine tRNA flanking sequence (Figure 91) The adapter RNA sequences are included to provide stability, correct folding, and nuclear export All chimeric RNAs have been synthesized and their function has been confirmed in binding and fluorecence assays in vitro [0116] The degree of RNA expression in the nucleus and cytoplasm of cells will be quantitatively examined following flow cytometric sorting of mCherry positive cells At the time of analysis (initially 12, 24, 36, and 48h post-transfection), cells will be incubated in buffer containing 50 mM Tπs-HCl pH 8 0, 140 mM NaCl, 1 mM DTT, 1 5 mM MgCl2 and 0 5 % (v/v) NP-40 for 5 mm on ice Cytoplasmic RNA will be separated from nuclear RNA by centπfugation (2 mm at 300 g and 40C) Supernatant containing the cytoplasmic fraction and pellets containing the nuclear fraction will be incubated with Tπzol reagent and RNA purification performed The amount of RNA in each sample will be determined by OD260 measurements RNA samples will be subjected to electrophoresis in formaldehyde agarose gels (1 2%), transferred to a nylon membrane (Hybond N+, Amersham Pharmacia Biotech) and hybridized with 32P-labeled probes for the GFP aptamer, chimeric RNA, tRNA™1, tRNAmet ,7SL, 5S, or U6 snRNA probes (pseudoknot, tRNALys3 or U6 snRNA) Membranes will be extensively washed and imaged on a phosphoπmager (Fuji FLA 3000 radiolummograph scanner) Cytoplasmic RNA and nuclear RNA will also be assayed by Real-time RT-PCR using SYBR Green I RNA will be briefly exposed to RNAase-free DNAase I and 1 μg reverse transcribed to cDNA using chimeric RNA- specific primers and Thermoscπpt RT (Invitrogen, Carlsbad, CA) U6 and 18S RNA will be used as the endogenous control The real-time PCR reaction mixture (25 μl) with SYBR Green I will be amplified using an iCycler iQ Real-time PCR Detection System (BIO-RAD) PCR specificity will be examined by electrophoresis on a 2% agarose gel
[0117] The function of the RNA aptamers will be determined by assessing GFP fluorescence in mCherry-positive cells during flow cytometry
Prophetic Example 7 - Selection of RNA Aptamers that Bind to the Target Molecule (cGMP) and Alter the RNA Affinity to GFP [0118] As a proof-of-prmciple for the use of FQAs as intracellular sensors, it will be attempted to control the affinity of the aptamers to GFP by the binding of a second molecule, thereby creating fluorescent switches or detectors This will be enhanced by minimization of the sequence length and further information about the critical secondary structure However, it is believed that selection should yield regulatable aptamers, as this only requires two simple conditions (1) addition of a second binding motif/structure and (2) requirement that binding of the second molecule results in an allosteπc interaction that alters the tertiary structure of the molecule The first condition is routinely achieved through SELEX procedures and the second can be incorporated into the selection scheme However, we will also attempt to forward design the switch using approaches that have proved successful for smaller aptamers (Breaker et al , "Inventing and Improving Ribozyme Function Rational Design Versus Iterative Selection Methods," Trends Biotechnol 12 268-275 (1994), Koizumi et al , "Allosteπc Ribozymes Sensitive to the Second Messengers cAMP and cGMP," Nucleic Acids Symp Ser 275-276 (1999), Soukup et al , "Engineering Precision RNA Molecular Switches," Proc Natl Acad Sa USA
96 3584-3589 (1999), Stojanovic et al , "Modular Aptameπc Sensors," J Am Chem Soc 126 9266-9270 (2004), which are hereby incorporated by reference m their entirety) cGMP is an important intracellular second messenger for which existing sensors have distinct limitations (Wild et al , "Expression of a Chimeric, cGMP- Sensitive Regulatory Subumt of the cAMP-Dependent Protein Kinase Type I Alpha," FEBS Letters 374 356-362 (1995) Aptamers for cGMP will be used, as well as one for which allosterically regulated RNA aptamers have been successfully selected (Koizumi et al , "Allosteπc Ribozymes Sensitive to the Second Messengers cAMP and cGMP," Nucleic Acids Symp Ser 275-276 (1999), Koizumi et al , "Allosteπc Selection of Ribozymes that Respond to the Second Messengers cGMP and cAMP," Nat Struct Biol 6 1062-1071 (1999), which are hereby incorporated by reference in their entirety) [0119] Allosteric selection of the core fluorescence quenching protein sequence will start with an RNA pool that contains random nucleotides attached to the minimum GFP-bmdmg core sequence that was determined (Figure 10) To maximize the likelihood of obtaining allosteric linkage to the reporter (GFP binding) region, this core structure and a random pool sufficient to produce structures with high affinity binding to cGMP will be used The length of the randomized sequences has been chosen to allow sufficient structural complexity to specify the relatively short allosteric bridge structure, which is known to tolerate additions, and a known cGMP binding domain (minimum approximately 32 nucleotides) (Koizumi et al , "Allosteric Ribozymes Sensitive to the Second Messengers cAMP and cGMP," Nucleic Acids Symp Ser 275-276 (1999), Koizumi et al , "Allosteric Selection of Ribozymes that Respond to the Second Messengers cGMP and cAMP," Nat Struct Biol 6 1062-
1071 (1999), Breaker, "Engineered Allosteric Ribozymes as Biosensor Components," Curr Opin Biotechnol 13 31-39 (2002), which are hereby incorporated by reference in their entirety) As shown in Figure 11 , the cGMP aptamer sequence will be separated by a short stretch of randomized sequences sufficient to optimize the allosteric bridge (Soukup et al , "Engineering Precision RNA Molecular Switches," Proc Natl Acad Sa USA 96 3584-3589 (1999), which is hereby incorporated by reference in its entirety) (N indicates random nucleotide) This strategy will rely on the ability to allosterically link previously optimized structures and assumes only that selection will produce a linkage with sufficient flexibility to retain the individual binding structures, and provide the allosteric interactions If the structure is too stable, then the length of the random sequence will be altered to adjust stability The primers will be chosen from Stem 2, minimizing the interference on selection from unrelated primer sequence This pool will also likely be useful for future selection using other target analytes in addition to cGMP
[0120] Commercially synthesized and annealed dsDNA containing a T7 promoter will be used as the template for in vitro transcription with the T7-MEGA shortscript kit from Ambion Each aliquot of the RNA pool contains 1-2 copies of 1- 2x10 unique RNAs The selection scheme will contain four steps, as described briefly below
Step 1 RNA binding to GFP will be performed in 500 μl binding buffer
(1 xPBS /5mM MgCl2) The RNA-GFP complex will be partitioned with 045μm nitrocellulose filter or Ni-charged beads (alternating to avoid selection of RNAs binding to either substrate), Step 2 Elution of RNA from GFP with 100 μM cGMP in PBS, Step 3 Negative selection will be performed by reacting the eluted mixture with GFP bound to nitrocellulose membrane or Ni-charged beads to eliminate c-GMP independent RNAs in the eluted mixture, and
Step 4 Amplify selected RNAs by RT-PCR and RNA for next round synthesized by in vitro transcription using T7-MEGAshortscπpt Following 10-15 selection rounds, RNAs will be amplified by RT- PCR, and the DNAs cloned in pGEM-T and sequenced
[0121] Each selected and enriched RNA will be individually examined for its ability to bind to GFP and cGMP, and to GFP in the presence of cGMP GFP fluorescence in physiological solution will also be examined as a function of RNA concentration in the presence and absence of cGMP For active (quenching) aptamers, the effect of cGMP on fluorescence will be determined by tπtration from 10 nM to 10 mM For RNAs found to be regulated by cGMP, stop-flow fluorescent measurements will be performed to determine the kinetics of the signal under conditions of millisecond rise of cGMP Fluorescence will be determined in a fluorescence spectrophotometer (FluoroMax 3, Jobm-Yvon, Hoπba) [0122] Although the invention has been described in detail for the purpose of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims

Claims

WHAT IS CLAIMED:
1 A nucleic acid ajrtamer comprising a first domain that binds to a fluorescent protein
2 The nucleic acid aptamer according Ic claim 1 , wherein the aptamer is a multivalent aptamer
3 The nucleic acid aptamer according Ic claim 1 , wherein the aptamer is a bivalent aptamer
4 The nucleic acid aptamer according to claim 1 , wherein the nucleic acid is FXNA
5 The nucleic acid aptamer according Io claim 1 , wherein the nucleic acid is DNA
6 The nucleic acid aptamer according to claim 1 , wherein the nucleic acid aptaiπcr comprises. a core region, and one or both of a 5' primer region and a 3' primer region
7 The nucleic acid aptamer according to cLaim 6, wherein the core region comprises the sequence of SEQ ID NO 1
8 The nucleic acid aptamer according to claim 6, wherein the core region comprises the sequence of SEQ ID NO 4
9 The nucleic acid aptamer according Ic claim 6, wherein the core region comprises the sequence of SEQ ID NO 12
10 The nucleic acid aptamer according to claim 6, wherein the core region comprises the sequence of SEQ ID NO'13
11 The nucleic acid aptamer according tc claim 6 further comprising one or both of a 5' random nucleotide sequence region and a 3' random nucleotide sequence region.
12 The nucleic acid aptamer according tc daim 11 , wherein the 5' primer region has a sequence of SEQ ID NO 20, the 5' random nucleotide sequence region composes 45 random nucleotides, the core region has a sequence of SEQ ID NO 19, the 3' random nucleotide sequence comprises 40 random nucleotides, and the 3 ' primer region has a sequence of SEQ ID NO 21
13 The nucleic acid aptamer according Ic daim 11 , wherein the core region comprises the sequence of SEQ ID NO. 19, SEQ ID NO. 22, SEQ ID NO 23, SEQ ID NO 24, SEQ ID NO 25, SEQ ID NO 26, SEQ ID NO 27, or SEQ ID
NO 28.
14 The nucleic acid aptamer according tc cLaim 1 , wherein the first domain reversibly binds to the fluorescent protein.
15 The nucleic acid aptamer according tc daim 1 further comprising a second domain that hinds to a molecule different from the fluorescent protein
16 The nucleic acid according to claim 15, wherein binding of the molecule to the second domain either Lnhibits binding of the fluorescent protein to the first domain oτ causes the fluorescent protein to be displaced from the first domain
17. A molecular complex comprising the nucleic acid aptamer according to claim 1 and a fluorescent protein bound the nucleLC acid aptamer at the first domain
18 The molecular complex according to claim 17, wherein the fluorescent protein is selected from tic group consisting of green fluorescent protein, yellow fluorescent protein, red fluorescent protein, and cyan fluorescent protein.
19 The molecular complex according to claim 18, wherein the fluorescent protein is green fluorescent protein
20 The molecular complex according to claim 17, wherein the nucleic acid is RNA
21. The molecular complex according to claim 17, wherein the nucleic acid is DWA
22. The molecular complex according to claim 17, wherein the aptamer is a multivalent aptamer
23 The molecular complex according to claim 17, wherein the aptamer is a bivaient aptamer
24. The molecular complex according to claim 17, wherein the nucleic acid aptamer is reversibly bound to the fluorescent protein
25. The molecular complex according to claim 17, wherein said binding alters fluorescence of the fluorescent protein
26. The molecular complex according to claim 25, wherein said binding quenches fluorescence of the fluorescent protein
27 The molecular complex according to claim 15, wherein said binding enhances fluorescence of the fluorescent protein.
28. The molecular complex according to claim 17, wherein said binding does nol substantially alter fluorescence of the fluorescent protein
29. A host cell contaming the molecular complex according to claim 17.
30. The host cell according to claim 29, wherein the cell is ex vivo.
31 The host cell according to claim 29, wherem the cell is in vivo
32. A method of detecting a molecular target comprising, providing a molecular complex according to claim 17 and contacting a molecular taiget with the molecular complex under conditions effective to cause a change in fluorescence of the fluorescent protein, whereby the change in fluorescence detects presence of the molecular target 33 The method according to claim 32, wherein said contacting causes release of the fluorescent protem from the nucleic acid aptamer at the first domain
34 The method according to claim 32, wherein said contacting causes an increase in fluorescence
35 The method according to claim 32, wherein said contacting causes a decrease in fluorescence
36 The method according to claim 32, wherein said contacting inhibits fluorescence.
37 The method according to claim 32, wherein said contacting is carried out m a cell
38 The method according to claim 37 further comprising introducing the molecular complex into the cell
39 The method according to claim 37, wherein said providing is carried out by iecombinantly expressing the molecular complex in the cell
40 The method according to claim 37, wherein the cell is ex vivo
41 The method according to claim 37, wherein the cell is in ΎIVO.
42 The method according to claim 32 further comprising determining wliether the change occurs
43 The method according to claim 42 wherein said determining is detected by visual observation
44 The method according to claim 42, wherein said determining is detected with a spectrophotometer or i microscope/macroscope coupled to a camera or a photomultiplier tube 45 The method according to claim 44 further compnsing generating an image of said detection
46 A method of determining location of a molecular target comprising providing a molecular complex according to claim 28, contacting a molecular tuget with the molecular complex, and detecting the fluorescence of the fluorescent protein, whereby location of the molecular target is determined
47 The method according to claim 46 wherein said contacting is carried out in a cell
48 The method according to claim 47 further comprising introducing the molecular complex mto the cell
49 The method according to claim 47 wherein said providing is earned out by iccombinantly cxprcδsmε the molecular COIΠΓJICK in the cell
50 The method according to claim 47 wherein the cell is ex vivo
51 The method according to claim 47 wherein the cell is in vivo
52 A constructed DKA molecule comprising a first region encoding a nucleic acid aptamer having a. first domain and a second region encoding a fluorescent protein capable of binding the nucleic acid aptamer at the first domain
53 The constructed DNA molecule accordmg to claim 51 further composing a promoter operably coupled to the first and second regions to control expression of both the nucleic acid aplamer and the fluorescent protein
54 The constructed DNA molecule according to claim 52, wherein the promoter is a constitutive promoter
55 The constructed DNA molecule according to claim 52, wherein the promoter is an inducible promoter 56 The constructed DNA molecule according to claim 52 further composing a first promoter operably coupled to the first region to control expression of the nucleic acid aptamei md a second promoter opeiably coupled to the second region to control expression of the fluorescent protein
57 The constructed DNA molecule according to claim 56, wherein one or both of the first and second promoters are constitutive promoters
58 The constructed DNA molecule according to claim 56, wherein one or both of the first and second promoters are inducible promoters
59 An expression system comprising an expression vector into which is inserted a DNA molecule according to claim 52
60 A host cell conta. rung the expression system of claim 59
61 A system comprising a first DNA molecule encoding a nucleic acid aptamer according to claim 1 and a second DNA molecule encoding a fluorescent protein capable of bemg bound by the first domain
62 The system according to claim 61, wherein the first and second DNA molecules each compπse a promoter operably coupled to the regions encoding, respectively the nucleic acid aptamer and the fluorescent protein
63 An expression system comprising the system of claim 61
64 A host cell comprising the system according to claim 61
65 A host cell comprising the expression system of claim 63
PCT/US2007/071470 2006-06-16 2007-06-18 Functional nucleic acid ligands to fluorescent proteins Ceased WO2007147159A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/305,102 US8445655B2 (en) 2006-06-16 2007-06-18 Functional nucleic acid ligands to fluorescent proteins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US80498206P 2006-06-16 2006-06-16
US60/804,982 2006-06-16

Publications (2)

Publication Number Publication Date
WO2007147159A2 true WO2007147159A2 (en) 2007-12-21
WO2007147159A3 WO2007147159A3 (en) 2008-12-24

Family

ID=38832933

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/071470 Ceased WO2007147159A2 (en) 2006-06-16 2007-06-18 Functional nucleic acid ligands to fluorescent proteins

Country Status (2)

Country Link
US (1) US8445655B2 (en)
WO (1) WO2007147159A2 (en)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102405212A (en) * 2009-02-18 2012-04-04 康奈尔大学 Conjugated recognition/detection systems for use in vitro and in vivo
US20130122488A1 (en) * 2010-07-26 2013-05-16 Olympus Corporation Method of detecting sparse particles in a solution using a light-emitting probe
US8785886B2 (en) 2010-09-10 2014-07-22 Olympus Corporation Optical analysis method using the light intensity of a single light-emitting particle
US8803106B2 (en) 2010-10-19 2014-08-12 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis for observing polarization characteristics of a single light-emitting particle
US8900812B2 (en) 2011-01-26 2014-12-02 Olympus Corporation Method for identifying polymorphism of nucleic acid molecules
US8911944B2 (en) 2011-01-26 2014-12-16 Olympus Corporation Method for identifying polymorphism of nucleic acid molecules
US8958066B2 (en) 2010-09-10 2015-02-17 Olympus Corporation Optical analysis method using measurement of light of two or more wavelength bands
US9068944B2 (en) 2011-04-13 2015-06-30 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9103718B2 (en) 2010-11-25 2015-08-11 Olympus Corporation Optical analysis device and optical analysis method using a wavelength characteristic of light of a single light-emitting particle
US9116127B2 (en) 2011-04-18 2015-08-25 Olympus Corporation Quantitative determination method for target particles, photometric analysis device, and computer program for photometric analysis
US9188535B2 (en) 2012-04-18 2015-11-17 Olympus Corporation Single particle detection device, single particle detection method, and computer program for single particle detection, using optical analysis
US9329117B2 (en) 2011-11-10 2016-05-03 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9354176B2 (en) 2011-08-11 2016-05-31 Olympus Corporation Method for detecting a target particle
US9423349B2 (en) 2011-08-15 2016-08-23 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9428796B2 (en) 2012-02-22 2016-08-30 Olympus Corporation Method for detecting a target particle
US9435727B2 (en) 2011-03-29 2016-09-06 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9488578B2 (en) 2011-08-26 2016-11-08 Olympus Corporation Single particle detection device, single particle detection method, and computer program for single particle detection, using optical analysis
US9494779B2 (en) 2012-02-17 2016-11-15 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single particle detection
US9528923B2 (en) 2011-08-30 2016-12-27 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9575060B2 (en) 2012-04-18 2017-02-21 Olympus Corporation Method for detecting a target particle
US9664676B2 (en) 2013-09-06 2017-05-30 Cornell University RNA sequences that induce fluorescence of small molecule fluorophores
US9739698B2 (en) 2013-10-07 2017-08-22 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9771612B2 (en) 2012-03-21 2017-09-26 Olympus Corporation Method for detecting a target nucleic acid molecule
US9841418B2 (en) 2011-08-30 2017-12-12 Olympus Corporation Method for detecting target particle
US9863806B2 (en) 2011-01-20 2018-01-09 Olympus Corporation Optical analysis method and optical analysis device using the detection of light from a single light-emitting particle
US10310245B2 (en) 2013-07-31 2019-06-04 Olympus Corporation Optical microscope device, microscopic observation method and computer program for microscopic observation using single light-emitting particle detection technique
US10371631B2 (en) 2011-08-26 2019-08-06 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US10444224B2 (en) 2011-07-27 2019-10-15 Cornell University Method for RNA detection and quantification
US11016026B2 (en) 2015-12-09 2021-05-25 Olympus Corporation Optical analysis method and optical analysis device using single light-emitting particle detection
US20210254073A1 (en) * 2020-02-04 2021-08-19 Cornell University Methods for capture and analysis of macromolecular complexes

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7727721B2 (en) 2005-03-08 2010-06-01 California Institute Of Technology Hybridization chain reaction amplification for in situ imaging
EP1931806B1 (en) 2005-10-07 2011-10-05 California Institute Of Technology Pkr activation via hybridization chain reaction
WO2008106658A2 (en) 2007-03-01 2008-09-04 California Institute Of Technology TRIGGERED RNAi
WO2008144562A1 (en) * 2007-05-16 2008-11-27 California Institute Of Technology A versatile nucleic acid hairpin motif for programming biomolecular self-assembly pathways
US8497364B2 (en) * 2008-02-27 2013-07-30 California Institute Of Technology Triggered RNAi
US20100021904A1 (en) * 2008-05-21 2010-01-28 Pierce Niles A Shielded cross-linking probes
US8241854B2 (en) * 2008-05-22 2012-08-14 California Institute Of Technology Triggered RNAi
US20100021901A1 (en) * 2008-05-22 2010-01-28 Peng Yin Compositions and methods for detecting analytes
US8658780B2 (en) 2010-05-18 2014-02-25 California Institute Of Technology Triggered covalent probes for imaging and silencing genetic expression
US8877438B2 (en) 2010-07-20 2014-11-04 California Institute Of Technology Self-assembled polynucleotide structure
US8962241B2 (en) 2010-07-20 2015-02-24 California Institute Of Technology Triggered molecular geometry based bioimaging probes
US9834439B2 (en) 2010-07-20 2017-12-05 California Institute Of Technology Biomolecular self-assembly
CN101968447B (en) * 2010-09-26 2012-12-26 邓乐 Method for fast detecting enterotoxigenic Escherichia coli K88
US20120184460A1 (en) * 2011-01-13 2012-07-19 Liang Joe C Highly efficient gene-regulatory element screening assay and compositions for performing the same
US20130203071A1 (en) * 2011-01-14 2013-08-08 Purdue Research Foundation Peptide aptamers for manipulating protein function
WO2013025930A1 (en) * 2011-08-16 2013-02-21 Research Foundation of State University of New York at Albany Aptamer modulators of estrogen receptors
US9856472B2 (en) 2013-07-01 2018-01-02 California Institute Of Technology Small conditional RNAs
IL290679B2 (en) 2016-07-05 2023-10-01 California Inst Of Techn Fractional initiator hybridization chain reaction
CA3034617A1 (en) 2016-08-30 2018-03-08 California Institute Of Technology Immunohistochemistry via hybridization chain reaction
CN108823211A (en) * 2018-05-04 2018-11-16 中国医学科学院基础医学研究所 A kind of CD19 aptamer and its application
WO2022164796A1 (en) 2021-01-26 2022-08-04 California Institute Of Technology Allosteric conditional guide rnas for cell-selective regulation of crispr/cas

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6458559B1 (en) 1998-04-22 2002-10-01 Cornell Research Foundation, Inc. Multivalent RNA aptamers and their expression in multicellular organisms
US20030211516A1 (en) * 2001-07-05 2003-11-13 Davis Jonathan H Compounds and methods for fluorescently labeling nucleic acids
US7435542B2 (en) 2002-06-24 2008-10-14 Cornell Research Foundation, Inc. Exhaustive selection of RNA aptamers against complex targets
EP1700912B1 (en) 2003-11-22 2014-10-29 Techno Medica Co., Ltd. Method of detecting target molecule by using aptamer
WO2005106035A2 (en) 2004-04-09 2005-11-10 Cornell Research Foundation, Inc. Modular design and construction of nucleic acid molecules, aptamer-derived nucleic acid constructs, rna scaffolds, their expression, and methods of use
EP1799825B1 (en) 2004-10-05 2011-06-29 The California Institute of Technology Aptamer regulated nucleic acids and uses thereof
US7601823B2 (en) 2004-10-22 2009-10-13 Cornell University Nucleic acid inhibitors of glutamate receptors
JPWO2007032359A1 (en) 2005-09-12 2009-03-19 国立大学法人東京農工大学 Target molecule detection method using aptamer-probe complex

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102405212A (en) * 2009-02-18 2012-04-04 康奈尔大学 Conjugated recognition/detection systems for use in vitro and in vivo
US20120252699A1 (en) * 2009-02-18 2012-10-04 Cornell University Coupled recognition/detection system for in vivo and in vitro use
US10316000B2 (en) 2009-02-18 2019-06-11 Cornell University Coupled recognition/detection system for in vivo and in vitro use
US11629131B2 (en) 2009-02-18 2023-04-18 Cornell University Coupled recognition/detection system for in vivo and in vitro use
US20130122488A1 (en) * 2010-07-26 2013-05-16 Olympus Corporation Method of detecting sparse particles in a solution using a light-emitting probe
US9395357B2 (en) * 2010-07-26 2016-07-19 Olympus Corporation Method of detecting sparse particles in a solution using a light-emitting probe
US8785886B2 (en) 2010-09-10 2014-07-22 Olympus Corporation Optical analysis method using the light intensity of a single light-emitting particle
US8958066B2 (en) 2010-09-10 2015-02-17 Olympus Corporation Optical analysis method using measurement of light of two or more wavelength bands
US8803106B2 (en) 2010-10-19 2014-08-12 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis for observing polarization characteristics of a single light-emitting particle
US9103718B2 (en) 2010-11-25 2015-08-11 Olympus Corporation Optical analysis device and optical analysis method using a wavelength characteristic of light of a single light-emitting particle
US9863806B2 (en) 2011-01-20 2018-01-09 Olympus Corporation Optical analysis method and optical analysis device using the detection of light from a single light-emitting particle
US8911944B2 (en) 2011-01-26 2014-12-16 Olympus Corporation Method for identifying polymorphism of nucleic acid molecules
US8900812B2 (en) 2011-01-26 2014-12-02 Olympus Corporation Method for identifying polymorphism of nucleic acid molecules
US9435727B2 (en) 2011-03-29 2016-09-06 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9068944B2 (en) 2011-04-13 2015-06-30 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9116127B2 (en) 2011-04-18 2015-08-25 Olympus Corporation Quantitative determination method for target particles, photometric analysis device, and computer program for photometric analysis
US11453646B2 (en) 2011-07-27 2022-09-27 Cornell University Methods for RNA detection and quantification
US10444224B2 (en) 2011-07-27 2019-10-15 Cornell University Method for RNA detection and quantification
US9354176B2 (en) 2011-08-11 2016-05-31 Olympus Corporation Method for detecting a target particle
US9423349B2 (en) 2011-08-15 2016-08-23 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9488578B2 (en) 2011-08-26 2016-11-08 Olympus Corporation Single particle detection device, single particle detection method, and computer program for single particle detection, using optical analysis
US10371631B2 (en) 2011-08-26 2019-08-06 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9528923B2 (en) 2011-08-30 2016-12-27 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9841418B2 (en) 2011-08-30 2017-12-12 Olympus Corporation Method for detecting target particle
US9329117B2 (en) 2011-11-10 2016-05-03 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US9494779B2 (en) 2012-02-17 2016-11-15 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single particle detection
US9428796B2 (en) 2012-02-22 2016-08-30 Olympus Corporation Method for detecting a target particle
US9771612B2 (en) 2012-03-21 2017-09-26 Olympus Corporation Method for detecting a target nucleic acid molecule
US9575060B2 (en) 2012-04-18 2017-02-21 Olympus Corporation Method for detecting a target particle
US9188535B2 (en) 2012-04-18 2015-11-17 Olympus Corporation Single particle detection device, single particle detection method, and computer program for single particle detection, using optical analysis
US10310245B2 (en) 2013-07-31 2019-06-04 Olympus Corporation Optical microscope device, microscopic observation method and computer program for microscopic observation using single light-emitting particle detection technique
US9664676B2 (en) 2013-09-06 2017-05-30 Cornell University RNA sequences that induce fluorescence of small molecule fluorophores
US9739698B2 (en) 2013-10-07 2017-08-22 Olympus Corporation Optical analysis device, optical analysis method and computer program for optical analysis using single light-emitting particle detection
US11016026B2 (en) 2015-12-09 2021-05-25 Olympus Corporation Optical analysis method and optical analysis device using single light-emitting particle detection
US20210254073A1 (en) * 2020-02-04 2021-08-19 Cornell University Methods for capture and analysis of macromolecular complexes

Also Published As

Publication number Publication date
US20090197271A1 (en) 2009-08-06
WO2007147159A3 (en) 2008-12-24
US8445655B2 (en) 2013-05-21

Similar Documents

Publication Publication Date Title
US8445655B2 (en) Functional nucleic acid ligands to fluorescent proteins
US6458559B1 (en) Multivalent RNA aptamers and their expression in multicellular organisms
JP7412586B2 (en) VI-E and VI-F CRISPR-Cas systems and their use
ES2312753T3 (en) PROCEDURE TO PRODUCE INTERFERENCE RNA MOLECULES IN MAMMAL CELLS AND THERAPEUTIC USES FOR SUCH MOLECULES.
US9664676B2 (en) RNA sequences that induce fluorescence of small molecule fluorophores
Bai et al. A protein-independent fluorescent RNA aptamer reporter system for plant genetic engineering
WO2003020931A2 (en) Sirna knockout assay method and constructs
WO2022068912A1 (en) Engineered crispr/cas13 system and uses thereof
Halbig et al. The transcriptional activator ZNF143 is essential for normal development in zebrafish
EP4222253A1 (en) Engineered crispr/cas13 system and uses thereof
US20250043290A1 (en) Rna sequences that induce fluorescence of small molecule fluorophores, molecular complexes, sensors, and methods of use thereof
CA2523785A1 (en) Small interfering rna libraries and methods of synthesis and use
CN101522897A (en) A method of detecting and/or quantifying expression of a target protein candidate in a cell, and a method of identifying a target protein of a small molecule modulator
Liu et al. Transgenic expression of the von Willebrand A domain of the BONZAI 1/COPINE 1 protein triggers a lesion-mimic phenotype in Arabidopsis
CA2625169A1 (en) Methods of reducing repeat-induced silencing of transgene expression and improved fluorescent biosensors
Birch et al. Evaluation and application of a luciferase fusion system for rapid in vivo analysis of RNAi targets and constructs in plants
WO2021010442A1 (en) Protein and rna interaction evaluation method, interaction modulator evaluation method and interaction modulator detection method, and fusion protein, kit and biosensor using same
KR20060065693A (en) Functional nucleotide molecule detection method
Schöning Molecular and functional characterisation of circadian clock regulated RNA-binding proteins from Arabidopsis thaliana
Tamura High-resolution analysis of DNA binding property of VND7, the master transcription factor for vessel cell differentiation
WO2006006520A1 (en) Method of searching for novel target of drug discovery
Lynch Examination of ADAR-RNA and ADAR-ADAR interactions
LIU et al. Partial Abstracts of the 3rd Annual Meeting of the China RNA Society & 1st International RNA Workshop in China
Gangapatnam A NOVEL ROLE FOR dADAR ISOFORMS IN DROSOPHILA rnp-4f 5'-UTR INTRON SPLICING REGULATION
Billur The role of HP1β [HP1-beta] on genomic stability and cellular senescence

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07812185

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 12305102

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 07812185

Country of ref document: EP

Kind code of ref document: A2