WO2007143701A2

WO2007143701A2 - Monoclonal antibodies that potently neutralize hepatitis c virus (hcv) of diverse genotypes

Info

Publication number: WO2007143701A2
Application number: PCT/US2007/070541
Authority: WO
Inventors: Kirsten A. Nagashima; William C. Olson; Paul J. Maddon; Raju Koduri; Gerald P. Donovan; Naoya Tsurushita; J. Tso; Shankar Kumar
Original assignee: Progenics Pharmaceuticals, Inc.
Priority date: 2006-06-06
Filing date: 2007-06-06
Publication date: 2007-12-13
Also published as: WO2007143701A8; WO2007143701A3

Abstract

This invention provides potent HCV neutralizing monoclonal antibodies and portions thereof that inhibit entry of HCV into susceptible cells. The neutralizing monoclonal antibodies of the invention are broadly reactive against HCV of different genotypes, including genotypes 1 and 2. A particular monoclonal antibody, designated PA-29, does not bind soluble or independently-expressed HCV E1 and E2 envelope glycoproteins. A hybridoma cell line producing the PA-29 monoclonal antibody has been deposited under ATCC Accession No. PTA-7632. The described monoclonal antibodies, including PA-29 and humanized and chimeric forms thereof, serve as HCV antagonists for use in therapeutic and prophylactic methods of treating and preventing HIV infection of susceptible cells, in methods of blocking HCV entry into susceptible cells and in methods of diagnosis and detection of HCV in a sample of a subject and within a subject.

Description

MONOCLONAL ANTIBODIES THAT POTENTLY NEUTRALIZE HEPATITIS C VIRUS (HCV) OF DIVERSE GENOTYPES

This application claims benefit from U.S. Provisional Application Serial No. 60/811 ,352, filed on 06 June 2006.

[0001] Throughout this application, various publications are referenced in parentheses by author name and date. Full citations foτ these publications may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein. However, the citation of a reference herein should not be construed as an acknowledgement that such reference is prior art to the present invention. BACKGROUND OF THE INVENTION

[0002] First recognized in 1989, Hepatitis C virus (HCV) infects the liver and is responsible for the majority of cases of non-A, non-B hepatitis (Alter and Seef, 1993). Infections are typically chronic and lifelong; many infected individuals are healthy and unaffected for decades, while others develop chronic hepatitis or liver cirrhosis, the latter often leading to hepatocellular carcinoma (Fry and Flint, 1997; Lauer and Walker, 2001 ).

[0003] Although screening of the blood supply has drastically reduced new transmissions of the virus, there exists a large cohort of infected individuals who will require treatment in the coming decades. The World Health Organization estimates that 3% of the world's population, or some 170 million people, are currently infected with HCV, with another 3 to 4 million new infections occurring each year. Approximately 3.9 million Americans have been infected with HCV, making it the most common chronic blood-borne viral infection in the United States. Chronically infected persons are at risk of developing severe and potentially life-threatening liver disease, including cirrhosis and hepatocellular carcinoma, and HCV infection is the leading cause of liver transplantation in the U.S.

[0004J HCV infection and its clinical sequelae are the leading causes of liver transplantation in the Unites States. No vaccine is currently available, and the two licensed therapies, interferon- alpha and ribavirin, which are both non-specific anti-viral agents with incompletely understood mechanisms of action, are only modestly efficacious (McHutchison et al., 1998). Thus, while the best long-term response rates are obtained with a combination of interferon alpha-2b and ribavirin, only a minority of individuals treated with this combination achieves the desired result of no detectable serum HCV RNA six months after stopping treatment (McHutchison et al, 1998). Moreover, as an antiviral therapy, these drugs are expensive and exhibit severe, life- threatening toxicities, including neutropenia, hemolytic anemia and severe depression. Thus, there is an urgent need for the development of new therapeutic approaches and agents to combat HCV infection.

[0005] Co-infection with HIV-I and HCV is also common, particularly in intravenous drug abusers and hemophiliacs (Poles, M. A. and D. T. Dieterich, 2000). HIV-I infection increases HCV virus load, liver-related mortality and the risk of perinatal transmission of HCV and may accelerate the course of HCV disease (Dieterich, D. T., 2002). Similarly, HCV infection increases the frequency of complications in HIV-I - infected individuals, and co-infected individuals progress to AIDS or to death significantly faster than in patients infected with only HIV- 1. (Id.)

[0006] Hepatocytes are the primary target cells for HCV infection, and infection results in the progressive loss of liver function. HCV RNA, protein and virus-like particles have been visualized in liver biopsies of HCV-positive individuals and also have been correlated with liver disease (Boisvert, J. et al., 2001; Pal, S. et al., 2006).

Recent studies have demonstrated robust replication of cloned HCV isolates in human hepatoma cells but not other cell lines in vitro (Lindenbach, B. D. et al., 2005; Wakita, T. et al., 2005; Zhong, J., P. et al., 2005). Other cell types also maybe susceptible to HCV infection (Lerat, H. et al., 1998; Navas, M. C, et al., 2002) and may contribute to the extrahepatic manifestations of HCV infection (Agnello, V. and F. G. De Rosa, 2004).

[0007] HCV genomes exhibit considerable sequence diversity and have been classified into six major genotypes (exhibiting <70% sequence identity), which are further divided into subtypes (exhibiting >70% identity), (Manns, M. P., et al., 2001; Zein, N. N., 2000). Genotypes 1 and 2 of HCV constitute 80-100% of all HCV infections in North America, Europe and Japan. Of these, genotype Ib is a more aggressive strain that is associated with more severe liver disease and reduced response to existing therapies (Zein, N. N., 2000). Genotype 3 constitutes approximately one- third of infections in Southeast Asia and Australia. Genotype 4 accounts for nearly all infections in Egypt and was transmitted in large part by re-use of needles during a campaign to treat schistosomes (blood flukes), (Frank, C, et al., 2000). Genotypes 5 and 6 are most commonly found in Southern Africa and Southeast Asia (Zein, N. N., 2000).

[0008] The HCV genome is a 9.6 kb positive-sense, single-stranded RNA molecule that replicates exclusively in the cytoplasm of infected cells (Rice, 1996). The genomic RNA encodes a polyprotein of about 3000 amino acids that is processed to generate at least ten proteins termed C, El, E2, p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B (Grakoui et al., 1993; Rice, 1996; Lauer and Walker, 2001). The C protein constitutes the nucleocapsid; El and E2 are transmembrane envelope glycoproteins; p7 is a membrane spanning protein of unknown function; and the various non-structural (NS) proteins have replication functions (Bartenschlager and Lohmann, 2000; Op De Beeck et al., 2001). \

[0009] The envelope glycoproteins of HCV are thought to play a crucial role in viral infectivity through their direct effect on various processes, including the packaging of virions, the attachment of virions to target cells, fusion with and entry into these cells, and the budding of viruses from cell membranes before another round of cell infection can be initiated. In particular, virus entry into susceptible target cells is mediated by the HCV envelope glycoproteins El and E2. HCV entry into host cells requires attachment of the viral particle to the cell surface, followedby fusion of the viral envelope with the cellular membrane.

[0010] Liver tropism maps to the HCV envelope glycoproteins El and E2 (Bartosch, B., et al., 2003; Bertolini, L. et al., 1993; Cormier, E. G. et al., 2004; Hsu, M. et al.,

2003; Zhang, J. et al., 2004). El is homologous to Class II fusion proteins of flaviviruses and alphaviruses (Garry, R. F. and S. Dash, 2003). E2 is a receptor-binding subunit with affinity for both CD81 , which serves as an entry co-receptor for HCV (Cormier, E. G. et al., 2004) and scavenger receptor class B type 1 (SR-Bl) (Scarselli, E. et al., 2002), another molecule implicated in HCV entry (Bartosch, B. et al., 2003; Lavillette, D. et al., 2005; Voisset, C. et al., 2005). El and E2 are released from the HCV polyprotein by signal peptidase and associate into E1E2 heterodimers, which mediate fusion (Op De Beeck, A. et al, 2004; Voisset, C. and J. Dubuisson, 2004).

[0011 ] In mammalian cell-based expression systems, the molecular weight of mature, full length El is about.35 kDa and that of E2 is about.72 kDa (Grakoui et al., 1993; Matsuura et al., 1994; Spaete et al., 1992). El and E2 are present as a non-covalently associated heterodimer, hereinafter referred to as E1E2, on the virus surface and undergo extensive posttranslational modification by N-linked glycosylation (Lauer and Walker, 2001).

[0012] Synthesis of the HCV structural proteins, C-El-E2-p7, in the cell is followed by translocation into the endoplasmic reticulum (ER), which is accompanied by cleavage of internal signal sequences by ER-resident signal peptidases (Bartenschlager and Lohmann, 2000; Op De Beeck et al., 2001; Reed and Rice, 2000). It is assumed that HCV buds into the ER and matures by passage through cytoplasmic vesicles (Pettersson, 1991). Studies of the subcellular localization of HCV envelope glycoproteins and particles in cells transfected or infected in vitro suggest vesicle-based morphogenesis of HCV (Dash et al., 1997; Egger et al., 2002; Greive et al., 2002; Iocovacci et al., 1997; Pietschmann et al., 2002; Serafino et al., 1997; Shimizu et al., 1996). However, HCV- like particles have been detected in the cytoplasm of hepatocytes from infected patients, which suggests budding at the plasma membrane (DeVos et al., 2002), although the budding and maturation process of HCV have not yet been fully delineated.

[0013] Two, common, experimental models of viral entry are cell-cell membrane fusion between receptor- and envelope glycoprotein-expressing cells, and entry of "reporter" viruses pseudotyped with heterologous envelope glycoproteins. Both systems rely on cell surface-associated expression of functional envelope glycoproteins. However, achieving expression of El and E2 on the surface of cells has proven to be elusive.

[0014] There has also been some inconsistency in the results reported: one group showed that pH-independent entry of viral pseudotypes was mediated by either El or E2 (Lagging et al., 1998; Meyer et al., 2000; Lagging et al., 2002), whereas the other showed that pH-dependent fusion required both glycoproteins (Takikawa et al., 2000; Matsuura et al., 2001). Moreover, a more recent report that HCV-VSV chimeric envelope glycoproteins are not functional (Buonocore et al., 2002) contradicts the results of the earlier studies. It therefore appears that the chimeric VSV G system does not reproducibly model HCV envelope glycoprotein-mediated cell fusion and entry.

[0015] The apparent absence of E1E2 heterodimers on the cell surface and the lack of N-glycan modifications by Golgi enzymes have led to suggestions that HCV envelope glycoproteins are retained in the ER (Duvet et al., 1998; Martire et al., 2001; Michalak et al., 1997; Patel et al., 2001; Selby et al., 1994). Both ER retention of E1E2 and the heterodimerization of these glycoproteins are thought to be mediated by the TM domains of El and E2 (Cocquerel et al., 1999; Cocquerel et al., 1998; Cocquerel et al., 2000; Flint and McKeating, 1999; Flint et al., 1999; Deleersnyder et al., 1997; Dubuisson et al., 1994; Op De Beeck et al., 2000; Patel et al., 1999; Ralston et al., 1993; Selby et al., 1994), and this has made it difficult to generate cell surface-expressed El E2 heterodimers. In view of prior results, an experimental system for generating such surface-expressed E1E2 heterodimers, such as described in U.S. Patent Application No. 20050266400 to J. Dumonceaux et al., has application in the development of assays for measuring the extent of cell membrane fusion and pseudo virion entry and for identifying agents that inhibit HCV entry into susceptible cells, as well as the production of monoclonal antibodies and vaccines.

[0016) Serum- and plasma-associated HCV antibodies have been reported to prevent infection in humans. For example, prospective clinical trials and retrospective studies have demonstrated that neutralizing antibodies naturally present in polyclonal immune globulin preparations protect patients exposed to HCV via transfusions, dialysis, sexual contact and horizontal transmission (al Khaja, N. et al., 1991; Borgia, G., 2004; Conrad, M. E. and S. M. Lemon, 1987; Knodell, R. G. et al., 1976; Knodell, R. G. et al., 1977; Kuhns, W. J. et al., 1976; Piazza, M. et al., 1998; Sanchez-Quijano, A. et al., 1988; Seeff, L. B. et al., 1977; Simon, N., 1984; Sugg, U. et al., 1985). Immune globulin isolated from plasma containing hepatitis B virus (HBV) cross-protected against HCV re-infection following liver transplant. Because there is a high rate of co-infection with HBV and HCV, the cross-protection was attributed to HCV neutralizing antibodies in the preparations. In support of this view, when the source plasma was screened for HCV antibodies and HCV-positive units were excluded during manufacturing, cross-protection was significantly diminished, and rates of HCV re-infection increased (Feray, C. et al., 1998).

[0017] Additionally, prior to the introduction of methods for screening and removing plasma containing HCV antibodies, there were no documented cases of HCV transmission associated with FDA-approved intravenous immune globulin preparations (IVIG). However, an outbreak of HCV transmission did occur shortly after the introduction of HCV screening in what became known as the "Gammagard incident" (1994 MMWR Morb. Mortal. WkIy. Rep.; Bresee, J. S. et al., 1996; Flora, K. et al., 1996; Gomperts, E. D., 1996; Healey, C. J. et al., 1996). In this incident, approximately 80 cases of HCV infection were attributed to the first two lots of screened Gammagard, while no cases of infection were associated with the prior six lots of unscreened product. Gammagard is currently subjected during manufacturing to procedures that inactivate HCV.

[0018] Approximately 15% of infected patients clear HCV via immune mechanisms. Although the correlates of clearance remain pooriy understood, several studies have implicated humoral immune responses. Resolution of infection has been associated with the development of antibodies that block E2 binding to CD81 (Ishii, K., et al., 1998) or that bind the hypervariable region 1 (HVRl) of E2 (Allander, T. et al., 1997; Isaguliants, M. G. et al., 2002; Zibert, A. et al., 1997), which is important for HCV entry (Callens, N. et al., 2005). In a large, well-defined cohort of patients with acute HCV infection, outcome was associated with the extent of sequence evolution in E2. Self- limiting infection was associated with limited evolution in HRVl, whereas progression was associated with significant genetic evolution over the same time period (Farci, P. et al., 2000). The sequence changes were temporally associated with seroconversion and are consistent with selective pressure by the host humoral immune system. Collectively, these studies demonstrate that HCV antibodies can play an important τole in preventing and/or clearing virus in a number of clinical settings and provide clinical support for antibody-based therapies of HCV infection.

[0019] Despite the development of monoclonal antibodies which target HCV El and E2, such antibodies have shown limited breadth and potency. Most monoclonal antibodies were selected simply for the ability to bind recombinant forms of El or E2 in vitro for use as reagents to study HCV envelope expression and function. These monoclonal antibodies were not selected for virus-neutralizing activity and may not potently neutralize diverse strains of HCV. For example, a panel of three monoclonal antibodies was found to have IC50 values of 1-10 μg/mL against HCV genotypes Ia and Ib; however, these antibodies had limited activity (IC50 > 50 μg/mL) against other genotypes (Schofϊeld, D. J. et al., 2005). Monoclonal antibody AP33 was described as broadly neutralizing based on IC50 values of 1-30 μg/mL for HCV genotypes Ia and Ib, 20-30 μg/mL for genotype 2, and 50 μg/mL for genotype 3 (Owsianka, A., et al., 2005; Tarr, A. W. et al., 2006). Other monoclonal antibodies directed against El and E2 have shown comparable activities in limited testing (Bartosch, B. et al., 2003; Hsu, M., 2003; Keck, Z. Y. et al., 2004; Op De Beeck, A., 2004). Other monoclonal antibodies, HCV- AB68 and HCV-AB65, XTL Biopharmaceuticals (Rehovot, Israel), showed 60-70% neutralizing activity against a single HCV genotype Ib isolate at a concentration of 20 μg/mL (Borgia, G., 2004; Eren, R., 2006). Thus, the described antibodies showed limited breadth and neutralizing potency against HCV infection.

[0020] Because the mechanism(s) and target molecule(s) that allow HCV infection of susceptible cells are currently under investigation, the generation and production of agents that are able to reduce or prevent the ability of HCV to infect susceptible cells are important goals to achieve in the ongoing work to reduce and eradicate HCV and infection by HCV. In view of the clear need for safe, effective and targeted anti-HCV therapies, a variety of new therapeutic and prophylactic agents, e.g., anti-HCV antibodies, HCV inhibitory antibodies and the like, will be extremely beneficial as drug candidates for treating and preventing HCV infection. More particularly, the generation of HCV neutralizing monoclonal antibodies that exhibit potent neutralizing and anti- HCV activity against a broad spectrum of HCV genotypes offer a significant advance in the arena of HCV therapeutics and treatment as HCV drug candidates. Such antibodies are also useful as diagnostic tools for the screening of patient samples.

SUMMARY OF THE INVENTION

[0021] The present invention provides novel anti-HCV monoclonal antibodies (MAbs). In an embodiment of the invention, the anti-HCV monoclonal antibodies potently neutralize infection of susceptible cells by HCV of diverse genotypes and subtypes thereof. In an embodiment, the anti-HCV monoclonal antibodies bind Hepatitis C Virus (HCV) envelope glycoprotein. In an embodiment, the monoclonal antibodies bind one or more epitopes located within a region of the HCV envelope glycoprotein, namely, an epitope within or among the HCV El, E2 or E1E2 regions of the envelope glycoprotein expressed on HCV pseudoparticles.

[0022] The present invention provides an antibody or portion thereof characterized in that it potently neutralizes HCV of different genotypes. In an embodiment, the antibody is a monoclonal antibody (MAb) or a portion thereof characterized in that it potently neutralizes HCV of different genotypes. The neutralization activity of the antibody or portion thereof of this invention is represented by a median IC50 value of 1 μg/mL or less, OT 0.1 μg/mL or less, in a virus neutralization assay. In an embodiment, the neutralization activity of the monoclonal antibody is characterized by a median IC50 value of 1 μg/mL or less. In an embodiment, the neutralization activity of the monoclonal antibody is characterized by a median IC50 value of 0.1 μg/mL or less. [0023] The present invention provides an antibody as described above which neutralizes infection of susceptible cells by HCV of genotypes 1 and 2, including subtypes thereof, e.g., Ia, Ib, 2a, 2b, 2c, etc. The present invention provides a monoclonal antibody (MAb) or a portion thereof, characterized in that it potently neutralizes infection by HCV of genotypes Ia, Ib, 2b and 1 a/2b. In an embodiment, the antibody potently neutralizes infection by HCV clonal isolates of genotypes 1 a, Ib and 2b as characterized by a median IC50 value of less than 0.075 μg/mL. In an embodiment, the antibody potently neutralizes infection by HCV clonal isolates of genotypes 1 a, Ib , 2b and 1 a/2b as characterized by a median IC50 value of less than 0.050 μg/mL. It will be understood that a monoclonal antibody of the invention may embrace recombinant, chimeric, or humanized forms and portions thereof.

[0024] The present invention provides a monoclonal antibody which binds a conformational epitope of the HCV envelope glycoprotein. The present invention provides a monoclonal antibody which binds the HCV E2 envelope glycoprotein. In an embodiment, the monoclonal antibody binds soluble E2 (sE2) glycoprotein. The present invention further provides a monoclonal antibody which does not bind the HCV El and E2 envelope glycoproteins expressed separately. In an embodiment, the monoclonal antibody does not bind HCV E2 or sE2. In an embodiment, the monoclonal antibody of the invention binds HCV E1/E2 envelope glycoprotein heterodimer expressed on HCV pseudoparticles as determined in an HCVpp neutralization assay. In an embodiment, the E1/E2 heterodimer is in soluble form. In an embodiment, the E1/E2 heterodimer is expressed by a cell and is associated with the cell membrane. In an embodiment, the monoclonal antibody neutralizes infection of a susceptible cell by HCV, wherein the HCV may be complexed or associated with one or more soluble proteins, e.g., a serum protein. In an embodiment, the invention provides a monoclonal antibody or portion thereof, which (i) inhibits entry of HCV of genotypes 1 and 2, and subtypes and combinations thereof, into cells susceptible to infection by HCV, as characterized by a median IC50 value of less than 0.1 μg/mL in a virus neutralization assay; and (ii) does not bind soluble or independently-expressed HCV El or E2 envelope glycoproteins. In an embodiment, the monoclonal antibody or portion thereof inhibits entry of HCV of genotypes Ia, Ib, 2a, 2b, 2c, la/2b, 2a/2c, or combinations thereof, into cells susceptible to infection by HCV.

[0025] The present invention provides a monoclonal antibody as described above which exhibits a serum half-life of approximately two weeks as demonstrated in a pharmacokinetic assay.

[0026] The present invention provides a monoclonal antibody that potently neutralizes HCV, i.e. , by blocking or inhibiting the ability of HCV to infect cells that are susceptible to HCV infection. In an embodiment, a monoclonal antibody of the invention, designated PA-29, is produced by a hybridoma cell line, also designated PA-29, which was deposited at the American Type Culture Collection (ATCC Accession No. PTA- 7632) under the terms of the Budapest Treaty. In an embodiment, a monoclonal antibody of the invention, designated PA-25, binds the E2 envelope glycoprotein of HCV.

[0027] The present invention provides a monoclonal antibody PA-29 produced by a hybridoma cell line also designated PA-29 (ATCC Accession No. PTA-7632), or a portion of antibody PA-29. [0028] The present invention further provides a monoclonal antibody produced by a hybridoma cell line designated PA-29 (ATCC Accession No. PTA-7632), or a portion of antibody PA-29, which inhibits HCV infection of a cell susceptible to infection by HCV. Also according to the present invention, the PA-29 monoclonal antibody inhibits infection by HCV of different genotypes, including genotypes 1 and 2, including subtypes thereof, e.g., Ia, Ib, 2a, 2b, 2c, etc. In an embodiment, the PA-29 monoclonal antibody, or a portion thereof, is characterized in that it potently neutralizes infection by HCV of genotypes Ia, Ib, 2b and la/2b. In an embodiment, the PA-29 antibody potently neutralizes infection by HCV clonal isolates of genotypes 1 a, Ib and 2b as characterized by a median IC50 value of less than 0.075 μg/mL. In an embodiment, the PA-29 antibody potently neutralizes infection by HCV clonal isolates of genotypes 1 a, Ib, 2b and la/2b as characterized by a median IC50 value of less than 0.050 μg/mL.

[0029] The present invention provides a hybridoma cell line designated PA-29 (ATCC Accession No. PTA-7632), which produces a monoclonal antibody designated PA-29.

[0030] The present invention further provides a cell which expresses a monoclonal antibody designated PA-29 (ATCC Accession No. PTA-7632). The invention provides monoclonal antibody PA-29 produced by hybridoma cell line designated PA-29 (ATCC Accession No. PTA-7632).

[0031] The present invention provides an antibody, either polyclonal or monoclonal, that competes with PA-29 monoclonal antibody for neutralizing infection of susceptible cells by HCV of different genotypes and subtypes. In an embodiment, the antibody, either polyclonal or monoclonal, competes with PA-29 for binding the HCV envelope glycoprotein. In one embodiment, the competing antibody is a monoclonal antibody.

[0032] The present invention provides a method of detecting HCV infection, in which the method comprises providing a sample suspected of containing HCV; contacting the sample with a neutralizing monoclonal antibody of the invention, or a portion thereof, and detecting HCV infection by detecting the monoclonal antibody or a portion thereof which binds or interacts with HCV. In an embodiment, the HCV may be associated with a serum or cellular protein. Detection may involve a detectable label or a secondary detection molecule. In an embodiment, the monoclonal antibody is PA-29 (ATCC Accession No. PTA-7632). In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody. [0033] The present invention also provides a method of detecting HCV infection, in which the method comprises providing a sample suspected of containing HCV; contacting the sample with a neutralizing monoclonal antibody of the invention, or a portion thereof, which neutralizes infection by HCV of genotypes Ia, Ib, 2a, 2b, 2c, etc., or a combination thereof, e.g., la/2b, etc., and detecting HCV infection by detecting the neutralizing monoclonal antibody or a portion thereof which binds or interacts with HCV. In an embodiment, the HCV may be associated with a serum or cellular protein. Detection may involve a detectable label or a secondary detection molecule. In an embodiment, the monoclonal antibody is PA-29 (ATCC Accession No. PTA-7632). In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0034] The present invention also provides a method of inhibiting HCV infection of a cell susceptible to HCV infection, in which the method comprises contacting an HCV virion with an HCV neutralizing monoclonal antibody of the invention, or a portion thereof, in an amount and under conditions that inhibit HCV virion entry into the cell. In one embodiment, the monoclonal antibody is PA-29 (ATCC Accession No. PTA-7632), or a portion of antibody PA-29. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0035] The present invention also provides a method of inhibiting HCV infection of a cell susceptible to HCV infection, in which the method comprises contacting a cell susceptible to HCV infection with an HCV neutralizing monoclonal antibody of the invention, or a portion thereof, in an amount and under conditions that inhibit or block HCV infection of the cell. In an embodiment, the monoclonal antibody is PA-29 (ATCC Accession No. PTA-7632), or a portion of PA-29 which inhibits HCV infection of the cell. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0036] The present invention further provides a method for the treatment of HCV infection, comprising administering to an individual in need thereof a therapeutically effective amount of an HCV neutralizing monoclonal antibody of the invention, or a portion thereof, to treat HCV infection. In an embodiment, the monoclonal antibody or portion thereof is the PA-29 monoclonal antibody (ATCC Accession No. PTA-7632). In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0037] The present invention further provides a method for reducing the occurrence of HCV infection in a population of individuals, in which the method comprises administering to the population of individuals in need thereof a therapeutically effective amount of an HCV neutralizing monoclonal antibody of the invention, or a portion thereof, to reduce the occurrence of HCV infection in the population. In an embodiment, the monoclonal antibody is the PA-29 monoclonal antibody (ATCC Accession No. PTA- 7632), or a portion thereof In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0038] The present invention provides a composition which includes a therapeutically effective amount of an HCV neutralizing monoclonal antibody of the invention, or a portion thereof and a pharmaceutically acceptable carrier. In an embodiment, the antibody or portion thereof may be labeled with a detectable marker, which may be one or more of a radioactive marker, a chemiluminescent marker, a luminescent marker, a calorimetric marker, or a fluorescent marker. In an embodiment, the composition includes a therapeutically effective amount of the PA-29 monoclonal antibody (ATCC Accession No. PTA-7632), or a portion thereof, and a pharmaceutically acceptable carrier, excipient, or diluent. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0039] The present invention provides a composition which includes a therapeutically effective amount of an HCV neutralizing monoclonal antibody of the invention, or a portion thereof, and pharmaceutically acceptable carrier and which also includes at least one additive selected from the group consisting of antimicrobials, antioxidants, chelating agents and inert gases. In one embodiment, the monoclonal antibody is the PA-29 monoclonal antibody (ATCC Accession No. PTA-7632), or a portion thereof. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA- 29 antibody.

[0040] The present invention additionally provides a pharmaceutical composition comprising a therapeutically effective amount of an HCV neutralizing monoclonal antibody of the invention, or a portion thereof, in combination with at least one additional anti-viral active ingredient selected from interferons, anti-HCV monoclonal antibodies, anti-HCV polyclonal antibodies, RNA polymerase inhibitors, protease inhibitors, IRES inhibitors, helicase inhibitors, antisense compounds, antiviral active agents or drugs, anti-viral small molecules (non-protein, small organic molecules or drugs) and ribozymes. In one embodiment, the monoclonal antibody is the PA-29 monoclonal antibody (ATCC Accession No. PTA-7632), or a portion thereof. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA- 29 antibody. In an embodiment, the composition includes the one or more anti-viral active agents include, for example, ribavirin, interferon-α, interferon- α-2β, or a combination thereo f.

[0041 J The present invention provides a method of inhibiting HCV infection of a cell susceptible to HCV infection which comprises contacting the cell with an HCV neutralizing monoclonal antibody or portion thereof according to the invention in an amount effective to inhibit binding of an HCV envelope glycoprotein to an HCV- infectable cell, so as to thereby inhibit HCV infection of the cell susceptible to HCV infection. The monoclonal antibody or portion thereof in the.presence of infectable HCV potently inhibits infection of HCV susceptible cells by HCV. In an embodiment, the monoclonal antibody is PA-29 or a portion thereof. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody. [0042] The present invention provides methods in which an HCV susceptible cell is present in a subject (an individual or patient) and the contacting is effected by administering a monoclonal antibody of the invention, or a portion thereof, to the subject. The monoclonal antibody or portion thereof may be administered prior to, during, or post-infection of a subject by HCV. In accordance with an aspect of the method, the monoclonal antibody is PA-29 or a portion thereof. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0043] The present invention provides a method of treating or preventing HCV infection in a subject which comprises neutralizing or inhibiting HCV infection of the subject's cells susceptible to HCV infection by a method described herein, wherein the inhibition is effected by administering a monoclonal antibody of this invention, or a portion thereof, to the subject. In an embodiment of this method, the monoclonal antibody is PA-29 or a portion thereof. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29. In an embodiment, PA-29 is administered with one or more additional HCV antagonists or inhibitors, including antibodies and/or small molecules. [0044] The present invention provides a method of treating oτ preventing a liver disease in a subject which comprises administering to the subject an effective amount of a monoclonal antibody of this invention, or a portion thereof, that is capable of inhibiting infection of the subject's cells susceptible to HCV infection, so as to thereby treat or prevent the liver disease in the subject. In accordance with an aspect of this method, the monoclonal antibody is PA-29 or a portion thereof. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0045] The present invention provides a method of treating or preventing hepatocellular carcinoma in a subject which comprises administering to the subject an effective amount of amonoclonal antibody of this invention, or aportion thereof, which is capable of inhibiting binding of an HCV envelope glycoprotein to an HCV bindable protein present on the surface of the subject's hepatoma cells, so as to thereby treat oτ prevent hepatocellular carcinoma in a subject. In an embodiment of the method, the monoclonal antibody is PA-29 or a portion thereof. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody. [0046] The invention provides methods of diagnosing HCV infection in an individual comprising contacting a sample from an individual with a monoclonal antibody of the invention and detecting binding or interaction of an HCV component in the individual's sample with the monoclonal antibody. In an embodiment the monoclonal antibody is directly or indirectly labeled with a detectable label or marker. Conventional protocols and variations of such diagnostic methods are apparent to the skilled practitioner. In an embodiment, the monoclonal antibody is PA-29 or portion thereof. In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody.

[0047] This invention further provides an HCV neutralizing antibody comprising two light chain polypeptides, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 1 , and two heavy chain polypeptides, each heavy chain comprising a variable τegion comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID N0:2. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent.

[0048] This invention provides an isolated nucleic acid SEQ ID NO:3 which encodes the variable τegion comprising the amino acid sequence which is set forth in SEQ ID NO: 1. In an embodiment, this nucleic acid is included in a composition together with a carrier, excipient, or diluent.

[0049] This invention provides an isolated nucleic acid SEQ ID NO:4 which encodes the variable region comprising the amino acid sequence which is set forth in SEQ ID NO:2. In an embodiment, this nucleic acid is included in a composition together with a carrier, excipient, or diluent.

[0050] This invention provides a light chain polypeptide of an HCV neutralizing antibody, wherein the light chain comprises consecutive amino acids and includes a variable region and a constant region. The variable region of the light chain comprises three complementarity determining regions (CDRs) comprising consecutive amino acids, namely, CDRl (SEQ ID NO:5), CDR2 (SEQ ID NO:6), and CDR3 (SEQ ID NO:7). In an embodiment, the HCV neutralizing antibody contains two light chain polypeptides having the foregoing CDRs.

[0051] This invention provides a heavy chain polypeptide of an HCV neutralizing antibody, wherein the heavy chain comprises consecutive amino acids and includes a variable region and a constant region. The variable region of the heavy chain comprises three complementarity determining regions (CDRs) comprising consecutive amino acids, namely, CDRl (SEQ ID NO:8), CDR2 (SEQ ID NO:9), and CDR3 (SEQ ID NO: 10). In an embodiment, the anti-HCV envelope glycoprotein antibody contains two heavy chain polypeptides having the foregoing CDRs.

[0052] This invention provides an HCV neutralizing antibody comprising two light chains, each chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:1 1, and two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:12. [0053] This invention provides an isolated nucleic acid SEQ ID NO: 13 which encodes the polypeptide comprising the amino acid sequence which is set forth in SEQ ID NO: 11. In an embodiment, this nucleic acid is included in a composition together with a carrier, excipient, or diluent. [0054] This invention provides an isolated nucleic acid SEQ ID NO: 14 which encodes a polypeptide comprising the amino acid sequence which is set forth in SEQ ID NO: 12. In an embodiment, this nucleic acid is included in a composition together with a carrier, excipient, or diluent.

[0055] This invention provides an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO.15, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:18.

[0056] This invention provides an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 16, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18.

[0057] This invention provides an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 17, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18.

[0058] This invention provides an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 15, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19.

[0059] This invention provides an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 16, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19.

[0060] This invention provides an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 17, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19.

[0061] This invention also provides a composition comprising at least one of the above-described HCV neutralizing antibodies, which comprise two light chains and two heavy chains comprising a variable region and a constant region , or a portion thereof, together with a carrier, diluent, or excipient. In various embodiments, the light chain of the antibody may be of the λ or the K isotype, and the heavy chain of the antibody may be of the IgGl, IgG2, IgG2a, IgG2b, IgG3, IgG4, IgM, IgA, IgE, or IgD isotype or subtypes thereof. In an embodiment, the light chain is the of the λ isotype. In an embodiment, the light chain is of the K isotype. hi an embodiment, the heavy chain is of the IgGl isotype. In an embodiment, the heavy chain is of the IgG4 isotype. In an embodiment, the one or more antibodies have attached thereto a material such as a radioisotope, a toxin, polyethylene glycol, a cytotoxic agent and/or a detectable label. [0062] This invention also provides a method of inhibiting infection of an HCV susceptible cell which comprises contacting the HCV susceptible cell with an antibody which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 11 , and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, in an amount and under conditions such that HCV infection of the HCV susceptible cell is inhibited.

[0063] This invention also provides a method of treating a subject afflicted with HCV which comprises administering to the subject an effective HCV treating dosage of an HCV neutralizing antibody, which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 11 , and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12, or a fragment of such antibody, which neutralizes HCV infection of susceptible cells, under conditions effective to treat the HCV-infected subject. [0064] This invention also provides a method of preventing a subject from contracting an HCV infection which comprises administering to the subject an effective HCV infection-preventing dosage amount of an HCV neutralizing antibody comprising (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:11, and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12, or a fragment of such antibody, which neutralizes HCV infection of susceptible cells, under conditions effective to prevent the HCV infection in the subject.

[0065] This invention also provides a transformed host cell comprising one or more vectors, wherein the one or more vectors comprise (i) a nucleic acid sequence encoding heavy chains of an HCV neutralizing antibody, and/or (ii) a nucleic acid sequence encoding light chains of the HCV neutralizing antibody, wherein the HCV neutralizing antibody comprises two heavy chains having the amino acid sequence set forth in SEQ ID NO: 12, and two light chains having the amino acid sequence set forth in SEQ ID NO:11. [0066] This invention also provides a transformed host cell comprising one oτ more vectors, wherein the one or more vectors comprise (i) a nucleic acid sequence encoding heavy chains of an HCV neutralizing antibody, and/or (ii) a nucleic acid sequence encoding light chains of the HCV neutralizing antibody, wherein the HCV neutralizing antibody comprises two heavy chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO:2, and two light chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO: 1.

[0067] This invention also provides a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises the amino acid sequence set forth in SEQ ID NO: 12. [0068] This invention also provides a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises the amino acid sequence set forth in SEQ ID NO: 11.

[0069] This invention also provides a process for producing an HCV neutralizing antibody which comprises culturing the host cell as described above, so as to thereby produce the HCV neutralizing antibody.

[0070] This invention also provides a method of inhibiting infection of an HCV susceptible cell which comprises contacting the HCV susceptible cell with an antibody which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18 or SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, in an amount and under conditions such that HCV infection of the HCV susceptible cell is inhibited. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 15.

[0071] This invention also provides a method of treating a subject afflicted with HCV which comprises administering to the subject an effective HCV treating dosage of an HCV neutralizing antibody, which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18 or SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17, or a fragment of such antibody, which neutralizes HCV infection of susceptible cells, under conditions effective to treat the HCV-infected subject. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO:16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 15. [0072] This invention also provides a method of preventing a subject from contracting an HCV infection which comprises administering to the subject an effective HCV infection-preventing dosage amount of an HCV neutralizing antibody comprising (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18 or SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17, or a fragment of such antibody, which neutralizes HCV infection of susceptible cells, under conditions effective to prevent the HCV infection in the subject. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO:16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 15.

[0073] This invention also provides an HCV neutralizing antibody conjugate comprising an HCV neutralizing antibody which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18 or SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, conjugated to at least one polymer. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO:15.

[0074] This invention also provides an HCV neutralizing antibody conjugate comprising an HCV neutralizing antibody which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 11 , and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID

NO: 12, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, conjugated to at least one polymer.

[0075] This invention also provides a method of inhibiting infection of an HCV susceptible cell by HCV, comprising administering to a subject at risk of HCV infection the above-described conjugate in an amount and under conditions effective to inhibit HCV infection of HCV susceptible cells of the subject.

[0076] This invention also provides a method of treating an HCV infection in a subject comprising administering the above-described conjugate to an HCV-infected subject in an amount and under conditions effective to treat the subject's HCV infection. [0077] This invention also provides a transformed host cell comprising one or more vectors, wherein the one or more vectors comprise (i) a nucleic acid sequence encoding heavy chains of an HCV neutralizing antibody, and/or (ii) a nucleic acid sequence encoding light chains of the HCV neutralizing antibody, wherein the HCV neutralizing antibody comprises two heavy chains comprising variable regions having an amino acid sequence selected from the sequences set forth in SEQ ID NOS:15, 16, or 17, and two light chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 19. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID N0:16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 15.

[0078] This invention also provides a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises the amino acid sequence selected from the sequences as set forth in SEQ ID NOS: 15, 16, or 17. In one embodiment, the heavy chain comprises the amino acid sequence as set forth in SEQ ID NO: 15. In one embodiment, the heavy chain comprises the amino acid sequence as set forth in SEQ ID NO: 16. In one embodiment, the heavy chain comprises the amino acid sequence as set forth in SEQ ID NO:17.

[0079] This invention also provides a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises a variable region having the amino acid sequence as set forth in SEQ ID NO: 18 or SEQ ID NO: 19. In one embodiment, the light chain comprises the amino acid sequence as set forth in SEQ ID NO: 18. In one embodiment, the light chain comprises the amino acid sequence as set forth in SEQ ID NO: 19.

[0080] This invention also provides a process for producing an HCV neutralizing antibody which comprises culturing the host cell as described above, so as to thereby produce the HCV neutralizing antibody. [0081] This invention also provides a transformed host cell comprising one or more vectors, at least one vector comprising a nucleic acid sequence encoding heavy chains of an HCV neutralizing antibody, and at least one vector comprising a nucleic acid sequence encoding light chains of the HCV neutralizing antibody, wherein the HCV neutralizing antibody comprises two heavy chains comprising the amino acid sequence set forth in SEQ ID NO:2, and two light chains comprising the amino acid sequence set forth in SEQ ID NO:! . [0082] This invention also provides a vector comprising a nucleic acid sequence encoding a variable region of a heavy chain of an HCV neutralizing antibody, wherein the variable region of the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:2. [0083] This invention also provides a vector comprising a nucleic acid sequence encoding a variable region of a light chain of an HCV neutralizing antibody, wherein the variable region of the light chain comprises the amino acid sequence set forth in SEQ ID NO:1.

[0084] This invention also provides a kit for use in a process of producing an HCV neutralizing antibody. The kit comprises (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises an amino acid sequence as set forth in SEQ ID NO:1 and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises an amino acid sequence as set forth in SEQ ID NO:2.

[0085] The invention also provides a kit for use in a process of producing an HCV neutralizing antibody. The kit comprises (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises an amino acid sequence as set forth in SEQ ID NO: 11 and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises an amino acid sequence as set forth in SEQ ID NO:12.

[0086] This invention also provides a kit for use in a process of producing an HCV neutralizing antibody. The kit comprises (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises a variable region comprising an amino acid sequence as set forth in SEQ ID NO: 18 or SEQ ID NO: 19 and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises a variable region comprising an amino acid sequence as set forth in SEQ ID NOS: 15, 16, or 17. [0087] This invention further provides an HCV neutralizing antibody conjugate comprising an HCV neutralizing antibody of the invention conjugated to at least one polymer, wherein the antibody is a monoclonal antibody or portion thereof, which (i) inhibits entry of HCV of genotypes 1 and 2, and subtypes and combinations thereof, into cells susceptible to infection by HCV, as characterized by a median IC50 value of less than 0.1 ug/mL in a virus neutralization assay; and which (ii) does not bind soluble or independently-expressed HCV El or E2 envelope glycoprotein. In an embodiment, the monoclonal antibody or portion thereof inhibits entry of HCV of genotypes Ia, Ib, 2a, 2b, 2c, la/2b, 2a/2c, or combinations thereof, into cells susceptible to infection by HCV. In an embodiment, the monoclonal antibody is the PA-29 monoclonal antibody, a chimeric or humanized form thereof, or a portion of such antibody.

[0088] Further aspects and advantages afforded by the present invention will be apparent from the detailed description and exemplification herein below.

BRIEF DESCRIPTION OF THE DRAWINGS [0089] The appended drawings of the figures are presented to further describe the invention and to assist in its understanding through clarification of its various aspects.

[0090] FIG. 1 depicts vectors for generating pseudoparticles (HCV pseudovirion particles or HCV pseudovirions) for use in screening monoclonal antibodies in an HCV entry assay. The El E2 expression construct is inpcDNA3.1 (Invitrogen) and encodes amino acids 132-191 (aal32-191) of the capsid C-terminus (AQ as well as full-length El (aal 92-383), E2 (aa384-746) andp7 (aa747-809) when indicated. Constructs in which putative splice acceptor sites were removed by conservative mutagenesis are indicated by "*". The HIV-I based NL/uc+Δ299 vector encodes a packageable genome that expresses all structural and non-structural proteins, except for the envelope glycoproteins due to a 299 base pair deletion in env. Furthermore, this vector encodes luciferase instead of HIV-I nef. LTR=long terminal repeat; CMV=Cytomegalovirus promoter; SV40=Simian virus 40 early promoter; pA=poly A sequence; Ψ=packaging signal; /Mc=luciferase gene; black box indicates the 299 nucleotide deletion in HIV env gene.

[0091] FIG. 2 shows that monoclonal antibody PA-29 inhibits infection of cells by HCVpp of different genotypes. Purified PA-29 was serially diluted and added to Hep3B cells immediately prior to the addition of HCVpp derived from genotype Ia (strain H77) or genotype Ib (strain F7) virus as indicated. Plates were incubated for 48 hours prior to measurement of luciferase activity. IC50 values were calculated by fitting the data to a 4-parameter logistic equation in GraphPad PRISM (GraphPad Software, Inc., San Diego, CA). As observed in FIG. 2, the IC50 of PA-29 against HCVpp genotype Ia was 0.052 μg/ml and the IC50 of PA-29 against HCVpp genotype 1 b was 0.045 μg/ml

[0092] FIG. 3 demonstrates that cellular tropism of HCVpp complemented with HCV E1E2 from HCV genotypes 1 a and Ib. E1E2 sequences were cloned from patient sera as described in Example 3 and used to complement HCVpp. HCVpp were incubated with the indicated target cells for 48 hours and infectivity was measured by luciferase activity (relative light units or RLU). El E2 were isolated from one genotype 1 a virus (strain MA) and one genotype Ib virus (strain F7). Three quasi-species were tested for each isolate and are indicated as #1 , #2 and #3. RLU values of <1 ,000 represent background in this assay.

[0093] FIGS. 4A-4C show the pharmacokinetic analysis of the PA-29 monoclonal antibody. FIGS. 4A-4C show the serum concentrations of a mouse IgGl isotype- matched control antibody (4A), JS-81 (4B) and PA-29 (4C) following a single 0.25 mg and/or 1.0 mg intraperitoneal injection into mice. Data represent the mean values (± standard deviations) observed for 3 τeplicate animals.

[0094] FIG. 5 shows results of studies of binding of monoclonal antibodies to sE2 in ELISA. Antibodies were serially diluted and added to ELISA plates coated with lectin and soluble HCV E2 envelope glycoprotein (sE2). Absorbance was measured after sequential additions of goat anti-mouse IgG, ALP conjugated, and pNPP-DEA substrate. Monoclonal antibody PA-25 demonstrates binding to sE2 in a concentration dependent manner, while PA-29 shows no binding. [0095] FIGS. 6A and 6B Monoclonal antibody PA-29 was titrated to 4μg/ml (FIG. 6A) and 8μg/ml (FIG. 6B) and passed over immobilized sE2 and HIV-I gpl20. Resonance units (RU) were measured using a Biacore 3000 instrument. Both runs demonstrated the lack of PA-29 binding on either surface. PA-29 is designated as "6F12" in the graph shown in FIGS. 6A and 6B. [0096] FIGS. 7A and 7B In FIG. 7A, control anti-HIV-1 gpl20 monoclonal antibody 2Gl 2 was titrated to 2μg/ml and passed over immobilized sE2 and HIV-I gpl20. Resonance units (RU) were measured via BIAcore 3000. 2Gl 2 demonstrated specific binding to the HIV-I gpl20 surface. In FIG. 7B, contol monoclonal antibody PA-25 was titrated to 2μg/ml and passed over immobilized sE2 and HIV-I gpl20. Resonance unites (RU) were measured via BIAcore 3000. PA-25 demonstrated binding specifically to the sE2 surface but not to the gp 120 surface.

[0097] FIG. 8 shows the results of an assay to measure HCVpp entry during a time course of addition of monoclonal antibodies, PA-29, control JS-81 and isotype matched IgGl monoclonal antibody to cells that had been exposed to HCVpp. Cold HCVpp were incubated with Hep3B cells for two hours at 4°C. MAbs were diluted in warm medium and were added to the cells at time points from 0 to 2 hours. Luciferase activity was measured after 72 hours and was expressed relative to entry observed in the absence of inhibitors. Values are means of two independent experiments.

[0098] FIG. 9 shows the results of sucrose cushion experiments in which sucrose- purified HCVpp were incubated with lOμg/ml of mAb (PA-29 monoclonal antibody or anti-HCV E2 monoclonal antibody PA-25) for 2 hours at 37°C. The HCVpp and monoclonal antibody mixture was centrifuged over a 20% sucrose cushion to remove antibody, and the HCVpp pellet was tested for infectivity of Hep3b cells.

[0099] FIG. 1OA presents the amino acid sequence of the light chain (lambda (λ)) variable region (SEQ ID NO:1) of recombinant murine PA-29 (rmPA-29) antibody, which was molecularly produced as described in Examples 11 and 12 herein and which corresponds to the murine PA-29 monoclonal antibody (ATCC Accession No. PTA- 7632). The Framework (FR) (underlined) and complementarity determining regions (CDR), (italics) are shown, as is the N-terminal signal sequence (block letters) and a portion of the constant region of the light chain. FIG. 1OB presents the nucleic acid sequence (SEQ ID NO:3) encoding the light chain variable region amino acid sequence of the recombinant PA-29 antibody that is shown in FIG. 1OA.

[0100] FIG. 11 A presents the amino acid sequence of the heavy chain variable region (SEQ ID NO:2) of the molecularly cloned, recombinant form of the mouse PA-29 monoclonal antibody (rmPA-29 Ab), produced as described in Examples 11 and 12 herein. The Framework (FR) (underlined) and complementarity determining regions (CDR) (italics) are shown, as is the N-terminal signal sequence (blocked letters) and a portion of the constant region of the heavy chain. FIG. 11 B presents the nucleic acid sequence (SEQ ID NO:4) encoding the heavy chain variable region amino acid sequence of the recombinant PA-29 monoclonal antibody that is shown in FIG. HA.

[0101] FIG. 12 shows the purification of recombinant murine PA-29 antibody using Protein-A Sepharose fast flow. The recombinant murine PA-29 antibody was purified as described in Example 12. The purified recombinantly produced antibody (rmAb) is shown in relation to the PA-29 monoclonal antibody produced by the PA-29 hybridoma.

[0102] FIGS. 13A and 13B show the generation of stable CHO cell lines expressing a recombinant murine PA-29 antibody. Recombinant murine PA-29 was produced as described in Example 12. Transfected primary CHO cell clones (called trans fectomas or transfectants herein) were screened for the production of recombinant PA-29 antibody using a Dot Blot assay (BioRad) in 96-well format. FIG. 13 A shows the expression construct (Lonza) containing the PA-29 light and heavy chain-encoding polynucleotide sequences. FIG. 13B shows the high signal generated by stable transfectoma clones from which spent medium was analyzed by the dot blot assay. Clones with high signal (e.g., 12F5, 13H10, 15E3, 17F10, 18A8, 2C9) were expanded in 24-well tissue culture dishes. Antibody produced by the recombinant PA-29 clones that tested positive based on the dot blot assay was assessed by Western blot analysis. For SDS-PAGE gel electrophoresis (non-reduced 5-20% Tris-glycine SDS-PAGE) prior to Western blotting, 20 μl of transfectoma supernatant were used per well. When the supernatant samples from each cloned transfectant were run on the SDS-PAGE reducing gel, a heavy chain polypeptide band of about 55 kD and a light chain polypeptide band of about 25 kD were resolved as expected.

[0103] FIG. 14 shows the results of a neutralization assay using recombinantly produced PA-29 antibody against HCV pseudoparticles of genotype Ia. Supernatant containing rmPA-29 antibody from the recombinant clones 13H10 and 18E10 (CHO transfectants) was harvested and the concentration of the recombinant antibody was determined using Easy-Titer Human IgG (gamma chain) Assay Kit (23300 Pierce). Prior to assay, the CHO-derived antibody was normalized for concentration with PA-29 derived from hybridoma cells (PA-29). The recombinant and hybridoma-derived PA-29 antibodies were serially diluted and added to Hep 3b cells in 96 well plates immediately prior to the addition of HCVpp derived from genotype 1 a (strain H77) or genotype Ib (strain F7) in some cases, as described in the Examples. The plates were incubated for 48 hours prior to measurement of luciferase activity. IC50 values were calculated by fitting the data to a 4-parameter logistic equation in GraphPad Prism (GraphPad Software, Inc., San Diego, CA). The IC50 value for the 13H10 transfectant PA-29 antibody was 0.060 μg/ml and the IC50 value for the 18E10 transfectant PA-29 antibody was 0.078 μg/ml. Inhibition of HCV (genotype 1 a) infection in this assay was similar for the recombinant PA-29 transfectants and for the PA-29 monoclonal antibody.

[0104] FIG. 15 A depicts the amino acid sequence of the light chain of the chimeric PA-29 antibody (SEQ ID NO: 11 ). The light chain of chimeric PA-29 comprises the light chain variable region amino acid sequence of PA-29 as shown in FIG. 1OA adjoined to the constant region of a human lambda light chain immunoglobulin molecule. FIG. 15B shows the nucleic acid sequence encoding the chimeric PA-29 light chain amino acid sequence (SEQ ID NO:13) presented in FIG. 15A. [0105] FIG. 16A depicts the amino acid sequence of the heavy chain of the chimeric PA-29 antibody (SEQ ID NO: 12). The heavy chain of chimeric PA-29 comprises the heavy chain variable region amino acid sequence of PA-29 as shown in FIG. 11 A adjoined to the constant region of human IgGl immunoglobulin molecule. FIG. 16B shows the nucleic acid coding sequence encoding the chimeric PA-29 heavy chain amino acid sequence (SEQ ID NO: 14) presented in FIG. 16A.

[0106] FIG. 17 demonstrates the neutralization activity of chimeric PA-29 monoclonal antibody produced by representative recombinant clones compared with the activity of the PA-29 monoclonal antibody purified from ascites. The neutralization assay was the HCVpp entry inhibition assay performed as described above for FIG. 14. The IC50 values for ascites-purified murine PA-29 monoclonal antibody (two graphic representations) were 0.045 μg/ml and 0.045 μg/ml, respectively; the IC50 value for chimeric PA-29 antibody (Ch. PA-29, clone #10) was 0.068 μg/ml; and the IC50 value for chimeric PA-29 antibody (Ch. PA-29, clone #11) was 0.04 μg/ml.

[0107] FIGS. 18A and 18B. FIG. 18A shows the amino acid sequence of the signal peptide and part of the framework 1 of PA29 VH in single letter code (SEQ ID NO:20). Numbers directly above the sequence indicate the location according to Kabat. A signal peptide cleavage site predicted by SIG-Pred

(http://www(dot)bioinformatics(dot)leeds(dot)ac(dot)uk/prot_analysis/Signal(dot)html) (SEQ ID NO:21 ) is shown below the signal peptide sequence in FIG. 19A. A bar between two residues indicates the location of the cleavage site. FIG. 18B shows the amino acid sequence of the signal peptide and framework 1 of PA29 VL in single letter code (SEQ ID NO:22). Numbers directly above the sequence indicate the location according to Kabat Note that an amino acid residue is missing at position 10 in the Kabat numbering of Vλ. Signal peptide cleavage sites (SEQ ID NOS:23-27) predicted by SIG-Pred (http://www(dot)bioinformatics(dot)leeds(dot)ac(dot)uk/prot_analysis/Signal(dot)html) are shown below the signal peptide sequence in FIG. 18B. A bar between two residues indicates the location of the cleavage site.

[0108] FIG. 19 shows an alignment of the amino acid sequences of murine PA29 VH (SEQ ID NO:28) and three humanized PA29 VH regions (HuPA29VH#l, SEQ ID NO: 15); (HuPA29VH#2, SEQ ID NO:16); and HuPA29VH#3, SEQ ID NO:17). Amino acid residues are shown in single letter code. Numbers above the sequences indicate the locations according to Kabat et al. CDR sequences defined by Kabat et al. are underlined.

[0109] FIG. 20 shows an alignment of the amino acid sequences of PA29 VL (SEQ ID NO:29) and two versions of humanized PA29 VL: PA29 VL#1 (SEQ ID NO: 18) and PA29 VL#2 (SEQ ID NO: 19). Amino acid residues are shown in single letter code. Numbers above the sequences indicate the locations according to Kabat et al. Note that an amino acid residue is missing at position 10 in the Kabat numbering of Vλ. CDR sequences defined by Kabat et al. are underlined. [0110] FIG. 21 shows the results of a representative neutralization experiment showing neutralization of HCV (HCVpp of genotype Ia dC) entry by humanized PA-29 antibodies (IgGl , λ) comprising different humanized heavy chain variable regions (e.g., VH#1 , VH#2, VH#3) and the humanized light chain variable region, VL#2, designated as "LC2" in the figure. Neutralization activity of humanized antibodies is compared with that of JS-81 (anti-CD81 MAb) and the murine PA-29 monoclonal antibody purified from ascites. Median IC50 neutralization values for each of the antibodies are shown in (μg/ml).

DESCRIPTION OF THE DISCLOSURE AND EMBODIMENTS

[0111] The present invention is directed to anti-HCV monoclonal antibodies (MAbs) and to antibody-based compositions and therapies for the treatment of HCV infection. The invention particularly relates to monoclonal antibodies that neutralize HCV infection of susceptible cells, also called target cells herein. In general, a target cell refers to a cell that is capable of being infected by or fusing with HCV, or HCV infected cells. Blocking or inhibiting HCV entry into susceptible cells is an attractive objective for antiviral therapy because entry inhibitors do not need to cross the plasma membrane or to be modified intracellularly. In addition, viral entry is generally a rate-limiting step that is mediated by conserved structures on the viral envelope and cell membrane. Consequently, the neutralizing monoclonal antibodies of the present invention can serve as inhibitors of viral entry that provide potent and durable suppression of viral replication. Such antibodies also serve as antagonists of HCV infection of susceptible cells.

[0112] As described herein, the present invention encompasses neutralizing monoclonal antibodies, or a portion thereof. Illustratively, a portion of a monoclonal antibody that exhibits virus neutralizing function or activity may comprise a light chain of the antibody or a portion thereof, a heavy chain of the antibody or a portion thereof, a Fab portion of the antibody, an F(ab')₂ portion of the antibody, an Fd portion of the antibody, an Fc portion of the antibody, an Fv portion of the antibody, a variable domain of the antibody, or one or more CDR domains of the antibody.

[0113] In addition, a portion of a monoclonal antibody of the invention may include a bindable portion of the antibody. A bindable portion of a monoclonal antibody binds one or more epitopes of one or more regions of an antigen, i.e., HCV envelope glycoprotein, such as HCV El, E2, or E1E2 envelope glycoproteins. As used herein, "epitope" refers to a portion of a molecule or molecules that forms a surface for binding antibodies or other compounds. An epitope may comprise contiguous or noncontiguous amino acids, carbohydrate or other non-peptidyl moieties or oligomer-specific surfaces. Typically, an epitope comprises at least two oτmore amino acids. [0114] A portion of an antibody of this invention may exhibit binding function and/or may neutralize HCV infection, e.g., inhibit oτ block entry of the virus into a cell that is susceptible to HCV infection. In an embodiment, a monoclonal antibody or portion thereof of the present invention neutralizes HCV infection of a susceptible cell. In an embodiment, a monoclonal antibody or portion thereof binds the HCV E2 envelope glycoprotein, e.g., monoclonal antibody PA-25, which inhibits HCV from infecting a susceptible cell, and neutralizes virus infection of the cell. In another embodiment, a monoclonal antibody or portion thereof binds neither the HCV El nor E2 envelope glycoproteins, e.g., soluble El or E2, expressed separately. In another embodiment, a monoclonal antibody or portion thereof of the present invention binds one or more epitopes of the HCV E1E2 envelope glycoprotein heterodimer. In an embodiment, the E1E2 heterodimer is associated with the cell membrane. In an embodiment, the monoclonal antibody neutralizes infection by HCV, wherein HCV envelope glycoprotein may be complexed or associated with a soluble protein, e.g. , a serum protein. In an embodiment of the invention, the monoclonal antibody is PA-29 or aportion thereof. In an embodiment, the monoclonal antibody is chimeric or humanized PA-29 or aportion thereof In an embodiment, the PA-29 monoclonal antibody does not bind sE2 of HCV or the HCV E2 envelope glycoprotein expressed independently. In an embodiment, the PA-29 monoclonal antibody does not bind HCV El envelope glycoprotein expressed independently.

[0115] Monoclonal antibodies of the present invention neutralize infection of HCV susceptible cells by HCV of one or more genotypes of HCV. The genotypes of HCV include genotypes 1, 2 and 3-6, etc.; HCV subtypes include Ia, Ib, 2a, 2b and 2c, etc. and combinations of these genotypes and subtypes. The present invention encompasses a monoclonal antibody or portion thereof, which (i) inhibits entry of HCV of genotypes 1 and 2, and subtypes and combinations thereof, into cells susceptible to infection by HCV, as characterized by a median IC50 value of less than 0.1 μg/mL in a virus neutralization assay; and (ii) does not bind soluble or independently-expressed HCV El or E2 envelope glycoproteins. In an embodiment, the above-described monoclonal antibody or portion thereof inhibits entry of HCV of genotypes Ia, Ib, 2a, 2b, 2c, la/2b, 2a/2c, or combinations thereof, into cells susceptible to infection by HCV. [0116] One such monoclonal antibody according to the present invention is designated PA-29. A murine hybridoma cell line expressing monoclonal antibody PA-29 was deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard., P.O. Box 1549, Manassas, VA 20110-2209 USA on June 6, 2006, and was assigned ATCC Accession or Designation No. PTA-7632. The deposit was made pursuant to the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure (Budapest Treaty). Both the monoclonal antibody according to the present invention and the hybridoma cell line that produces the monoclonal antibody are referred to as PA-29 herein. Accordingly, the present invention provides monoclonal antibody PA-29 produced by a hybridoma cell line designated PA-29 (ATCC Accession No. PAT-7632), or a portion of the PA-29 monoclonal antibody.

[0117] In an embodiment, the PA-29 monoclonal antibody or portion thereof is characterized in that it potently neutralizes HCV of different genotypes. The neutralization activity of the PA-29 monoclonal antibody, or its chimeric and humanized forms, or a portion thereof, is represented by a median IC50 value of less than 1 μg/mL or less than 0.1 μg/mL in a virus neutralization assay. In an embodiment, the PA-29 monoclonal antibody a neutralizes infection of susceptible cells by HCV of genotypes 1 and 2, including subtypes thereof, e.g., Ia, Ib, 2a, 2b, 2c, etc. The PA-29 monoclonal antibody or portion thereof is characterized in that it potently neutralizes infection by HCV of genotypes Ia, Ib, 2b and la/2b. In an embodiment, the antibody potently neutralizes infection by HCV clonal isolates of genotypes 1 a, Ib and 2b as characterized by a median IC50 value of less than 0.075 μg/mL. In an embodiment, the PA-29 monoclonal antibody potently neutralizes infection by HCV clonal isolates of genotypes 1 a, Ib, 2b and 1 a/2b as characterized by a median IC50 value of less than 0.050 μg/mL.

[0118] The monoclonal antibodies according to the present invention are generated and screened by utilizing immunogenic, fusogenic HCV pseudoparticles (HCVpp), also called pseudovirions, as described herein. See, e.g., Example 1 and U.S. Patent Application No. 20050266400 to J. Dumonceaux et al, the contents of which are hereby incorporated by reference in their entirety. The HCVpp represent the major HCV genotypes, which can be used individually, as well as in combinations, as immunogens for priming and boosting animals for antibody production. In accordance with the present invention, neutralizing monoclonal antibodies are produced utilizing methods practiced by those having skill in the pertinent art and are selected for their specificity, potency in inhibiting HCV (HC Vpp) infection of susceptible cells and spectrum of anti- HCV activity. In an embodiment, the neutralizing monoclonal antibodies of this invention are of the IgG or IgM class. In another embodiment, the neutralizing monoclonal antibodies of the invention are of the IgGl, IgG2 (IgG2a, IgG2b), 3, or 4 subclasses. In an embodiment, the neutralizing monoclonal antibody is an immunoglobulin of the IgGl heavy chain and λ light chain isotypes.

[Ol 19] It will be understood that HCV neutralizing monoclonal antibodies according to the present invention may b e generated with or without the use of immunostimulatory adjuvants during the priming and boosting of animals with immunogen. Although pseudoviruses and virus-like particles are by their nature immunogenic, immunogenicity may be augmented by the use of adjuvants (Healey, C. J. et al., 1996; Lavillette, D. et al., 2005). Suitable adjuvants include, without limitation, alum (AIOH3; Pierce, Rockford, IL), Titermax block copolymer (Sigma, St. Louis, MO), CpG oligonucleotides optimized for mouse (Qiagen), saponen, Quil A saponen (Sigma) and combinations thereof, and are used at doses and administration schedules that maybe routinely ascertained by those skilled in the art in view of animal size and weight and monitored immune response.

[0120] Neutralizing monoclonal antibodies of the present invention exhibit a broad spectrum neutralizing activity against HCV. Antiviral specificity may be assessed using HC Vpp and HCVcc and related assays as described herein. In an embodiment, antiviral specificity is assessed using particles pseudotyped with envelope glycoproteins derived from HIV-I, HSV-2, VSV and murine leukemia virus (MLV) as specificity controls in determining levels of neutralization of HCV of diverse genotypes by monoclonal antibodies.

[0121[ F°^r pseudovirus testing, monoclonal antibodies generated according to this invention are screened against a battery of HCV and non-HCV pseudoviruses in assays to assess their specificity, potency and spectrum of anti-HCV activity. HCV of various genotypes and combinations of genotypes are used in the testing procedure. (See, e.g., Example 2). Illustratively, for specificity determinations, purified monoclonal antibodies are serially diluted and added in quadruplicate to cells in 384-well plates. Accordingly, large numbers of monoclonal antibodies may be screened at a given time. A fixed amount of pseudovirus (e.g., HCVpp, VSVpp, HIV-lpp, or MLVpp) is added to each well and the cells are cultured for 48 to 72 hours at 37⁰C. Plates are read for luciferase activity. Inhibition data are fitted to a4-parameter logistical equation to determine IC50 and IC90 values. Because of their broad cellular tropisms, VSVpp and MLVpp can be tested in conjunction with HCVpp on Hep3B and Huh-7 liver cells. HIV-lpp (JR-FL and SF162 strains) can be tested on U87-CD4-CCR5 cells according to their viral tropisms. Assay controls include virus-specific MAbs and azidothymidine, AZT (Sigma), an inhibitor of HIV-I reverse transcriptase that inhibits all pseudoviruses post- entry. The virus panel optimally contains greater than or equal to 50 HCVpp that represent genotypes Ia, Ib, 2a and 2b, with at least 10 viruses from each genotype. Activity of neutralizing monoclonal antibodies against HCV genotypes 1 and 2, as well as 3-6, increase the potential utility of such antibodies in areas in which such genotypes are prevalent. A monoclonal antibody having potent HCV neutralizing activity in a genotype independent manner, or against a diverse set of HCV genotypes, is highly desirable.

[0122] Other methods for testing the specificity of anti-HCV monoclonal antibodies include, without limitation, flow cytometry analysis, Western blot analysis, ELISA and inhibition of binding assays involving known receptors. These assays can be utilized both for testing supernatants from hybridomas producing neutralizing monoclonal antibodies and for testing purified neutralizing monoclonal antibodies. For specific binding of HCV E1E2 envelope glycoprotein via flow cytometry analysis, the binding specificity of monoclonal antibodies is assessed against E1E2 and apanel of human cell lines. For example, 293T cells can be transiently transfected with plasmid pcDNA3.1 (Invitrogen) encoding El , E2, E1E2 heterodimer, or irrelevant virus envelope from, for example, HIV-I gplβO or VSV-G. Neutralizing antibody is added to the cells and binding is detected by FACS analysis using FITC-conjugated goat anti-mouse IgG (Caltag, Burlingame, CA), for example, as described in Dumonceaux, J. et al., 2003. Further specificity testing includes binding assays using monoclonal antibody against a panel of human cells such as liver cell lines (Hep3B, Huh-7 and HepG2), embryonic kidney cells (293), fibroblasts (HeLa), B cells (Daudi and Ramos), T cells (Sup-Tl and Hut-78), monocytic cells (THP-I), astrocytic cells (U87) and prostate cells (LNCaP and PC-3). Such a flow cytometry analysis can reveal binding specificities of a monoclonal antibody for HCV envelope glycoproteins El , E2 or E1E2 heterodimer and assesses any unexpected cross reactivities with human cells.

[0123] For Western blot analysis, cells transfected with constructs encoding El , E2, E 1 E2, or irrelevant envelope glycoproteins are processed for Western blot analysis and probed with neutralizing monoclonal antibodies or appropriate control monoclonal antibodies. (See, e.g., Dumonceaux, J. et al., 2003). Taken together, the results of the flow cytometry and Western blot analyses allow the determination of the ability of a neutralizing monoclonal antibody of the invention to target linear or conformational epitopes on HCV El, El or E1E2.

[0124] In an embodiment of the present invention, neutralizing monoclonal antibodies are assessed for binding to rsE2 (Austral Biologicals), (Gardner, J. P. et al. , 2003), in a lectin capture ELISA. Briefly, assay plates are coated overnight with Galanthus nivalis (GNA) lectin, which avidly binds the high-mannose glycans present on E2. Plates are blocked in PBS/casein prior to addition of rsE2 for 2 hours, followed by the addition of serially diluted neutralizing monoclonal antibody. Bound neutralizing monoclonal antibody is detected using alkaline phosphatase-conjugated goat anti-mouse IgG.

[0125] In another embodiment of the invention, neutralizing monoclonal antibodies are assessed for inhibiting the binding of rsE2 to CD81 and L-SIGN. Such assays utilize the above-described flow cytometry method that employs rsE2 bound to fluorescent beads (Gardner, J. P. et al., 2003). HepG2/HepG2-CD81 cells (Cormier, E.G. et al., 2004) or HeLa/HeLa-L-SlGN cells (Id.) are reacted with rsE2 beads in the presence or absence of neutralizing monoclonal antibodies or control monoclonal antibodies and the level of rsE2 binding is determined by flow cytometry. The results of such analysis determine if a neutralizing monoclonal antibody abrogates E2 binding to known cellular receptors for HCV.

[0126] In an embodiment of the present invention, antibodies, either polyclonal or monoclonal, have a binding specificity and/or neutralizing activity which is the same as or highly similar to that of PA-29. In an embodiment, such antibodies are monoclonal antibodies. In an embodiment, such antibodies are polyclonal antibodies. In an embodiment, the neutralizing activity of the monoclonal antibody for HCV is characterized by a mean IC50 value of 0.1 μg/ml or less, 0.075 μg/ml or less, 0.050 μg/ml or less, 0.040 μg/ml or less, 0.35 μg/ml or less, or 0.30 μg/ml or less. Antibodies having a binding specificity which is the same as or highly similar to that of PA-29 can be identified by their ability to compete with the PA-29 monoclonal antibody for binding in conventional assays, for example, using transfected or infected cells bearing HCV envelope glycoproteins. Similarly, antibodies with an epitopic specificity which is the same as or highly similar to that of the PA-29 monoclonal antibody can be identified by their ability to compete with PA-29 monoclonal antibody for neutralizing HCV infection, for example, using HCV pseudoparticles or in a cell culture system (HCVcc). [0127] Furthermore, it is to be understood that methods described herein which utilize PA-29 can also utilize fragments or portions of PA-29 antibodies which have the same or highly similar activity or function as PA-29. Such competing antibodies may optionally be used in combination with PA-29 in the methods described herein.

[0128] Inhibition of viral entry into cells and specificity of the inhibition represent rigorous screening and selection criteria for the monoclonal antibodies of the present invention. (See, e.g., Examples 2 and 4 herein). For the initial testing of activity of hybridoma supernatants, those supernatants that exhibit greater than or equal to 50% (> 50%) inhibition of HCVpp and less than or equal to 15% (< 15%) inhibition of VSVpp, or another suitable unrelated virus, are subjected to at least two rounds of limiting dilution cloning according to standard protocols.

[0129] In accordance with the present invention, neutralizing monoclonal antibodies exhibit a median IC50 value of less than 5 μg/ml (< 5 μg/ml), or a median IC50 value of less than 1 μg/ml (< 1 μg/ml), or a median IC50 value of less than 0.5 μg/ml (< 0.5 μg/ml), or a median IC50 value of less than 0.1 μg/ml (< 0.1 μg/ml), against HCV of genotypes 1 and 2 as indicative of neutralizing potency. In an embodiment of the invention, the median IC50 value against at least one HCV genotype, and preferably against two or more different HCV genotypes, e.g., genotypes 1 and 2, is in the range of 0.01 -0.1 μg/ml. In another embodiment of the invention, the median IC50 value against at least one HCV genotype, and preferably against two or more different HCV genotypes, e.g., genotypes 1 and2, is in the range of 0.01-0.08 μg/ml. Byway of nonlimiting example, a suitable neutralizing monoclonal antibody according to the present invention exhibits a median IC50 of < 1 μg/ml or 0.1 μg/ml or less against HCV genotypes 1 and 2 (for example, as assayed against a panel of 10 or 20 HCVpp representing genotypes 1 and 2), an IC50 of < 1 μg/ml or 0.1 μg/ml or less against HCVcc (genotypes 2a, 2b and other strains as they become available), and no measurable activity against unrelated viruses, e.g., HIV-I , VSV and MLV pseudoviruses, wherein no measurable activity is represented by an IC50 of > 100 μg/ml. In an embodiment of the present invention, a neutralizing monoclonal antibody exhibits a median IC50 of < 0.1 μg/ml against HCV genotypes 1 and 2, an IC50 of < 1 μg/ml against HCVcc (genotypes 2a, 2b and other strains as theybecome available), and no measurable activity against unrelated viruses, As is common in this field of art, IC50 values provide meaningful and significant quantitative criteria, as IC50 values are in the dynamic range of the dose- response curve and maybe considered to be most reliable indicator of neutralizing activity. Additionally, at higher concentrations, e.g., 10 μg/ml or greater, the neutralizing monoclonal antibodies must mediate essentially complete inhibition of HCV entry into cells, as evaluated by HCVpp and HCVcc inhibition assays.

[0130] In an embodiment, a neutralizing monoclonal antibody of this invention neutralizes HCV genotypes 1 and 2, including subtypes thereof, which are responsible for 80-100% of all HCV infections in the United States, western Europe and Japan. In another embodiment, a neutralizing monoclonal antibody neutralizes HCV of diverse genotypes, including 1 , 2 and 3-6, subtypes thereof, and/or combinations thereof. A monoclonal antibody with such a neutralization spectrum profile may be widely used in these demographic areas without regard to the infecting strain of HCV. However, this invention encompasses the use of a combination of neutralizing monoclonal antibodies, e.g., two or more neutralizing monoclonal antibodies in combination, to achieve a broad antivirus spectrum against a number of HCV genotypes. For example, a combination of two or more neutralizing monoclonal antibodies may achieve an increased breadth of activity against genotypes 3-6, which are common in regions of the world outside of the United States, western Europe and Japan.

[0131] The present invention further encompasses one or more neutralizing monoclonal antibodies or a portion thereof of the invention in combination with other pharmaceuticals, pharmaceutically acceptable carriers, excipients, or diluents, therapeutics, drugs, or immune-enhancing or stimulating agents, including small organic molecules, antivirals, therapeutic DNA or RNA molecules, oligonucleotides, proteins, peptides, polypeptides, nucleosides, nucleoside analogs, for use in compositions, e g., pharmaceutically acceptable compositions, and in methods of treating, preventing, or treating and preventing HCV infection. The pharmaceutical compositions of the invention may comprise a therapeutically effective amount of one or more neutralizing monoclonal antibody of the invention, e.g., the PA-29 monoclonal antibody (ATCC Accession No. PTA-7632), or a portion thereof, in combination with at least one additional antiviral active ingredient selected from, without limitation, interferons, anti- HCV monoclonal antibodies, anti-HCV polyclonal antibodies, RNA polymerase inhibitors, protease inhibitors, IRES inhibitors, helicase inhibitors, antisense compounds, anti-viral small molecules and ribozymes.

[0132] In an embodiment, the PA-29 monoclonal antibody of the present invention, produced by the PA-29 hybridoma cell line (ATCC Accession No. PTA-7632) is an isotype IgGl , λ (lambda) immunoglobulin molecule. PA-29 was tested for its neutralizing activity against various genotypes of HCV and was demonstrated to potently neutralize the infectivity of HCV and to inhibit the ability of HCVpp of several different HCV genotypes, e.g., Ia, Ib, 2b, la/2b and 2a/2c, to infect liver cells as determined by means of a sensitive neutralization assay as described herein. (See Example 2). In an embodiment, the present invention encompasses a monoclonal antibody or a fragment or portion of such antibody that binds HCV in a manner that competes with the binding of monoclonal antibody PA-29 produced by the hybridoma cell line designated PA-29 (ATCC Accession No. PTA-7632).

[0133] The neutralization activity of the PA-29 monoclonal antibody is more potent, i.e., IC50 values of less than 0.1 μg/ml (< 0.1 μg/ml), particularly against a number of HCV isolates of different genotypes, compared with the neutralization activities of several otheτ reported anti-HCV monoclonal antibodies. By way of example, Schofϊeld et al. described a panel of three monoclonal antibodies having IC50 values of 1-10 μg/mL against HCV genotypes Ia and Ib HCVpp; however, these antibodies had limited activity (IC50 > 50 μg/mL) against other genotypes (Schofield, D. J. et al., 2005). Another neutralizing monoclonal antibody, AP33, was described as broadly neutralizing based on IC50 values of 1-30 μg/mL for HCV genotypes Ia and Ib, 20-30 μg/mL for genotype 2, and 50 μg/mL for genotype 3 (Owsianka, A., et al., 2005; Tarr, A. W. et al., 2006). Moreover, other reported monoclonal antibodies directed against El and E2 have shown comparable activities in limited testing (Bartosch, B. et al., 2003; Hsu, M., 2003; Keck, Z. Y. et al., 2004; Op De Beeck, A., 2004). Still other monoclonal antibodies, e.g., HCV-AB68 and HCV-AB65, (XTL Biopharmaceuticals, Rehovot, Israel), showed 60-70% neutralizing activity against a single HCV genotype Ib isolate at a concentration of 20 μg/mL (Borgia, G., 2004; Eren, R, 2006). Thus, the described antibodies of others have shown limited breadth and neutralizing potency against HCV infection. Based on the IC50 values of PA-29 against HCV genotypes Ia, Ib, 2a, 2b and 2c alone and in combination, and at significantly lower concentration, as described in Example 2 herein, the neutralization potency of the monoclonal antibodies according to the present invention, such as the PA-29 monoclonal antibody, against different genotypic isolates of HCV, e.g., Ia, Ib, 2b, surpasses that of previously reported anti-HCV monoclonal antibodies. [0134] Monoclonal antibodies may be produced by mammalian cell cultuτe in hybridoma cell lines, such as murine myeloma cell lines, e.g., SP2/0; NSl, in murine myeloma cell lines, or synthetically, in recombinant form, in mammalian cell lines typically used for recombinant protein production, such as Chinese hamster ovary (CHO) cells. Such methods are well-known to those skilled in the art (e.g., Kohler and Milstein, 1975). Bacterial, yeast, and insect cell lines can also be used to produce monoclonal antibodies or fragments thereof. In addition, methods exist to produce monoclonal antibodies in transgenic animals or plants (Pollock et al., 1999; Russell, 1999).

[0135] In an embodiment of the present invention, the anti-HCV neutralizing monoclonal antibodies are chimeric antibodies in which the carboxy terminus of the murine monoclonal immunoglobulin molecule is replaced with that of a human immunoglobulin molecule. In another embodiment, the antibody is humanized. In a further embodiment, the neutralizing monoclonal antibody is PA-29, which can be chimeric or humanized according to established procedures in the art. In another embodiment, the anti-HCV neutralizing antibodies of the invention are single chain antibodies, including chimeric, CDR-grafted, or single chain antibodies, which may be produced using techniques routinely practiced in the art. The chimeric, humanized, CDR-grafted, or single chain antibodies will have activity or function, e.g., binding and/or virus infection inhibitory activity or function, that is essentially the same as, equal to, or greater than that of the original murine monoclonal antibody, e.g. , the PA-29 monoclonal antibody. [0136] In the humanized form of the antibody, some, most, or all of the amino acid residues outside the CDR regions (i.e., in the framework region) are replaced with amino acid residues from human immunoglobulin molecules, while some, most, or all amino acid residues within one or more CDR regions are unchanged. Small additions, deletions, insertions, substitutions or modifications of amino acids are permissible so long as they do not abrogate the ability of the antibody to bind a given antigen. Suitable human immunoglobulin molecules include IgGl , IgG2, IgG2a, IgG2b, IgG3, IgG4, IgA and IgM molecules. A humanized antibody retains similar or highly similar antigenic specificity as the original antibody, as well as the ability to inhibit infection of cells by HCV, or entry of HCV into cells, so as to inhibit or prevent infection of susceptible cells by the virus. Accordingly, in an embodiment of the present invention, a chimeric form of the PA-29 immunoglobulin is provided. In another embodiment, a humanized form of the PA-29 immunoglobulin is provided. In another embodiment, the chimeric or humanized PA-29 antibody can compete with murine PA-29 monoclonal antibody for binding to antigen and for HCV neutralization activity. [0137] One skilled in the art would know how to make the humanized antibodies of the present invention. Various publications, several of which are hereby incorporated by reference into this application, also describe how to make humanized antibodies. For example, the methods described in U.S. Patent No. 4,816,567 enable the production of chimeric antibodies having a variable region of one antibody and a constant region of another antibody. U.S. Patent No. 5,225,539 describes another approach for the production of a humanized antibody. In this approach, recombinant DNA technology is used to produce a humanized antibody in which the CDRs of a variable region of one immunoglobulin are replaced with the CDRs from an immunoglobuhn with a different specificity, such that the humanized antibody would recognize the desired target, but would not be recognized in a significant way by a human subject's immune system.

Specifically, site directed mutagenesis is used to graft the CDRs of the heavy and light chain variable regions of the immunoglobulin molecule onto the framework region. [0138] Other approaches for humanizing an antibody are described, for example, in U.S. Patent Nos. 5,585,089, 5,693,761, 5,693,762, 7,022,500, 6, 180,370, 6,693,055, 6,407,213 and in WO 90/07861, which describe various methods for producing humanized immunoglobulins. The described immunoglobulins have one or more CDRs and possible additional amino acids from a donor immunoglobulin and a framework region from an accepting human immunoglobulin. The patents describe a method to increase the affinity of an antibody for the desired antigen. Some amino acids in the framework are chosen to be the same as the amino acids at those positions in the donor rather than in the acceptor. Specifically, these patents describe the preparation of a humanized antibody that binds to a receptor by combining the CDRs of a mouse monoclonal antibody with human immunoglobulin framework and constant regions. Human framework regions can be chosen to maximize homology / identity with the mouse sequence. A computer model can be used to identify those amino acids in the framework region that are likely to interact with the CDRs or the specific antigen. Thereafter, mouse amino acids can be used at these positions to create the humanized antibody.

[0139J The variable regions of the humanized antibody may be linked to at least a portion of an immunoglobulin constant region of a human immunoglobulin. In one embodiment, the humanized antibody contains both light chain and heavy chain constant regions. The heavy chain constant region usually includes the CHl , hinge, CH2, CH3 and sometimes the CH4 region.

[0140] Fully human monoclonal antibodies also can be prepared by immunizing mice transgenic for large portions of human immunoglobulin heavy and light chain loci (See, e.g., U.S. Patent Nos. 5,591,669; 5,598,369; 5,545,806; 5,545,807; 6,150,584 and references cited therein, the contents of which are incorporated herein by reference). The transgenic animals have been genetically modified such that there is a functional deletion in the production of endogenous (e.g., murine) antibodies. These animals are further modified to contain all or a portion of the human germ-line immunoglobulin gene locus such that immunization of these animals results in the production of folly human antibodies. Following immunization of these mice (e.g., XenoMouse®, Abgenix, Fremont, CA; HuMab-Mouse®, Medarex/GenPharm, Princeton, N. J.), monoclonal antibodies are prepared according to standard hybridoma technology. [0141] In vitro methods also exist for producing human antibodies. These include phage display technology (e.g., U.S. Patent Nos. 5,565,332 and 5,573,905, the contents of which are incorporated herein by reference) and in vitro stimulation of human B cells (U.S. Patent Nos. 5,229,275 and 5,567,610, the contents of which are incorporated herein by reference).

[0142] The cell lines of the present invention, e.g., the hybridoma cell line producing the PA-29 monoclonal antibody, have uses other than for the production of the monoclonal antibody. For example, the cell lines of the present invention can be fused with other cells (such as suitably drug-marked human myeloma, mouse myeloma, human-mouse heteromyeloma or human lymphoblastoid cells) to produce additional hybridomas, and thus provide for the transfer of the genes encoding the monoclonal antibodies. In addition, the cell lines can be used as a source of nucleic acids encoding the anti-HCV immunoglobulin chains, which can be isolated and expressed, such as upon transfer to other cells, using any suitable technique (See, e.g., U.S. Patent No. 4,816,567 to Cabilly et al.; U.S. Patent No. 5,225,539 to Winter). For instance, clones comprising a rearranged anti-HCV immunoglobulin light or heavy chain can be isolated (e.g., by PCR) or cDNA libraries can be prepared from mRNA isolated from the cell lines, and cDNA clones encoding an anti-HCV immunoglobulin heavy or light chain can be isolated. [0143] Thus, nucleic acids encoding the heavy and/or light chains of the antibodies or portions thereof can be obtained and used in accordance with recombinant DNA techniques for the production of the specific immunoglobulin, immunoglobulin chain, or variants thereof (e.g., humanized immunoglobulins) in a variety of host cells or in an in vitro translation system. For example, the nucleic acids, including cDNAs, or derivatives thereof encoding variants such as a humanized immunoglobulin or immunoglobulin chain, can be placed into suitable prokaryotic or eukaryotic vectors (e.g., expression vectors) and introduced into a suitable host cell by an appropriate method (e.g., transformation, transfection, electroporation, infection), such that the nucleic acid is operably linked to one or more expression control elements (e.g., in the vector or integrated into the host cell genome). For production, host cells can be maintained under conditions suitable for expression (e.g., in the presence of inducer, suitable media supplemented with appropriate salts, growth factors, antibiotic, nutritional supplements, etc.), whereby the encoded polypeptide is produced. If desired, the encoded protein can be recovered and/or isolated (e.g., from the host cells, medium, milk). The method of production may also encompass expression in a host cell of a transgenic animal (See e.g., WO 92/03918, published Mar. 19, 1992, GenPharm International).

[0144] The present invention additionally provides a nucleic acid molecule encoding a monoclonal antibody or fragment thereof that specifically binds HCV, or to a particular region or subregion of the virus, e.g., the envelope glycoprotein, oτ the El, E2, or E1E2 heteroduplex regions of the envelope glycoprotein. In an embodiment, the nucleic acid molecule encodes a monoclonal antibody or fragment thereof that specifically binds

HCV E2 envelope glycoprotein. In an embodiment, the nucleic acid molecule encodes a monoclonal antibody or fragment thereof that specifically binds HCV E1E2 envelope glycoprotein heterodimer on HCV pseudoparticles as determined in an in vitro HCVpp neutralization assay. In an embodiment, the encoded monoclonal antibody or fragment thereof is humanized. In another embodiment, the encoded monoclonal antibody or fragment thereof is fully human. In an embodiment, the nucleic acid molecule encodes all or a portion of the PA-29 monoclonal antibody, all or a portion of a chimeric PA-29 antibody, or all or a portion of a humanized PA-29 antibody.

[0145] The nucleic acid molecule can be RNA, DNA or cDNA. The nucleic acid molecule may encode the light chain or the heavy chain of an immunoglobulin molecule. Alternatively, the nucleic acid encodes both the heavy and light chains of an immunoglobulin. In an embodiment, one or more nucleic acid molecules encode the Fab portion. In an additional embodiment, one or more nucleic acid molecules encode CDR portions. In another embodiment, the nucleic acid molecule encodes the variable domain of the Ig light or heavy chain. In a further embodiment, the nucleic acid molecule encodes the variable domain and one or more constant domains of the immunoglobulin (Ig) light or heavy chain.

[0146] In accordance with the present invention, a recombinant murine PA-29 immunoglobulin (rmPA-29) was produced by cloning the genes encoding the heavy (H) and light (L) chains of the PA-29 immunoglobulin from the PA-29 hybridoma cell line, inserting the H and L chain genes into one or more suitable expression vector(s) and introducing the vector(s) into suitable cell lines which then express recombinant PA-29 antibody. (Examples 11 and 12). Accordingly, recombinant murine PA-29 monoclonal antibody is a molecularly engineered or recombinant PA-29 monoclonal antibody ("rPA- 29" or "rmPA-29") and reflects the nucleic acid and amino acid sequences of PA-29 produced by the PA-29 hybridoma (ATCC Accession No. PTA-7632). In one embodiment the rPA-29-expressing cell line is a stable CHO cell line. Recombinant PA- 29 antibody is comprised of a lambda light chain and a heavy chain of the IgGl isotype. In an embodiment of the invention, the rPA-29 antibody comprises a light chain variable amino acid sequence as set forth in SEQ ID NO: 1. (FIG. 1OA). In another embodiment, the rPA-29 antibody comprises a heavy chain variable amino acid sequence as set forth in SEQ ID NO:2. (FIG. 1 IA). Several primary, stable CHO transfectomas transfected with the H and L Ig chain-encoding nucleic acids of the cloned PA-29 monoclonal antibody were analyzed and found to express PA-29 H and L chains (FIG. 13A and B and Examples 11 and 12). The recombinant PA-29 antibodies showed a specificity of PA-29 and a functional activity by inhibiting HCV pseudoparticles in an HCV entry assay. (FIG. 14).

[0147J In one embodiment, rPA-29 antibody was isolated and purified from the CHO cell line as described in Example 12 to obtain a purified rPA-29 antibody (FIG. 12). The amino acid sequence of the light (L) chain of the rPA-29 antibody is shown in FIG. 1OA and its encoding nucleic acid sequence is shown in FIG. 1OB. In FIG. 1OA, the signal sequence, complementarity determining regions (CDRl, CDR2 and CDR3), framework regions (FRl, FR2. FR3 and FR4) of the L chain V region, and a portion of the L chain constant region ("Lambda 1 constant") of the rPA-29 antibody are depicted. The amino acid sequence of the variable region of the H chain (V_H) of the rPA-29 antibody is shown in FIG. 1 IA and its encoding nucleic acid sequence is shown in FIG. 11 B. In FIG. 1 IA, the signal sequence, complementarity determining regions (CDRl , CDR2 and CDR3), framework regions (FRl , FR2. FR3 and FR4) of the H chain V region, and a portion of the IgG constant region of the rPA-29 antibody are depicted. Table 1 presents the CDRs of the H and L chains of the rPA-29 antibody. In one embodiment, PA-29 comprising the CDRs of Table 1 is a humanized antibody. In another embodiment, PA-29 comprising the CDRs of Table 1 is a chimeric antibody. In another embodiment, PA-29 comprising the CDRs of Table 1 is a CDR-grafted antibody. It will be appreciated by those having skill in the art that the naturally-occurring N-terminal signal sequence of either or both of the H and L chains of the rPA-29 antibody maybe removed and replaced by another operable signal sequence, for example, from another antibody whose sequence is known, using conventional techniques. In an embodiment, a nucleic acid encoding a chimeric or humanized PA-29 antibody heavy or light chain polypeptide comprises a heterologous signal sequence-encoding nucleic acid, i.e., one that is other than the naturally occurring signal sequence-encoding nucleic acid of the PA-29 antibody.

Table 1

[0148] As used herein, the following standard abbreviations are used throughout the specification to indicate specific amino acids:

A=ala=alanme R=arg=arginine N=asn=asp aragine D=asp=aspartic acid C=cys=cysteine Q=gln=glutamine E=glu=glutamic acid G=gly=glycine H=his=histidine I=ile=isoleucine L=leu=leucine K=lys=lysine M=met=methionine F=phe=phenylalanine P=pro=proline S=ser=serine T=thr= threonine W=trp=tryptophan

Y=tyr=tyrosine V=val=valine

[0149] In an embodiment of the invention, the rPA-29 antibody is humanized to generate a humanized immunoglobulin using techniques described hereinabove and as known in the art. In one embodiment, the humanized immunoglobulin comprises an antigen binding region of non-human, i.e., murine, origin and at least aportion that is of human origin, i.e., a human framework region, a human constant region or portion thereof, or a combination thereof. As one example, the humanized antibody of the present invention may refer to a chimeric immunoglobulin in which the variable region, or portion thereof, of requisite binding specificity is of non-human (murine) origin and the constant region comprises immunoglobulin sequences of human origin, the variable and constant regions joined together chemically by conventional techniques (e.g., synthetic) or prepared as a contiguous polypeptide using genetic engineering techniques (e.g., DNA encoding the protein portions of the chimeric antibody can be molecularly cloned and expressed in a suitable expression system to produce a contiguous polypeptide chain).

[0150] Another example of a humanized antibody according to the present invention is an immunoglobulin containing one or more immunoglobulin chains comprising a CDR of non-human origin (e.g., one or more CDRs of the antibody are derived from an antibody of non-human origin, e.g., PA-29 CDRs as described herein), and a framework region derived from a light and/or heavy chain of human origin (e.g., CDR-grafted antibodies with or without framework changes), hi one embodiment, the humanized immunoglobulin molecule can compete with the PA-29 monoclonal antibody (or rPA- 29) for antigen binding. In another embodiment, the antigen-binding region of the humanized immunoglobulin is derived from PA-29 monoclonal antibody to produce a humanized immunoglobulin comprising CDRl , CDR2 and CDR3 of the PA-29 light chain and CDRl, CDR2 and CDR3 of the PA-29 heavy chain, as shown in Table 1 and in FIG. 19. Chimeric or CDR-grafted single chain antibodies are embraced by the term humanized immunoglobulin. The production of single chain antibodies is known and practiced in the art, for example, as described in U.S. Patent No. 4,946,778 to Ladner et al., U.S. Patent No. 5,476,786 to Huston and RE. Bird et al, 1988, Science, 242:423- 426.

[0151] Humanized antibodies of the present invention can be produced using synthetic and/or recombinant nucleic acids to prepare genes, e.g., cDNA, encoding the desired humanized immunoglobulin protein chain. For example, nucleic acid, e.g, DNA, sequences coding for humanized variable regions can be constructed using PCR mutagenesis methods to alter DNA sequences encoding a human or humanized immunoglobulin chain, such as a DNA template from a previously humanized variable region. See, for example, M. Kanunan et al., 1989, Nucl. Acids Res., 17:5404; K. Sato et al., 1993, Cancer Res., 53:851-856; B.L. Daugherty et al., 1991, Nucl. Acids Res., 19(9):2471-2476; A.P. Lewis and J.S. Crowe, 1991, Gene, 101 :297-302. Using these or other suitable techniques, variants can also be readily produced. In one embodiment, cloned variable regions can be mutagenized and sequences encoding variants with the desired binding specificity can be selected, for example, from a phage library. See, e.g., U.S. Patent No. 5,514,548 to Krebber et al.; WO 93/06213, Inventor Hoogenboom et al., published Apr. 1, 1993. [0152] In an embodiment of this invention, a chimeric PA-29 antibody was produced in which the cloned V_H and V_L region nucleic acid sequences were engineered to be expressed with a human constant region-encoding nucleic acid sequence. In an embodiment, nucleic acid encoding the murine PA-29 heavy chain variable region and a human IgGl heavy chain constant region was molecularly engineered to express a chimeric PA-29 antibody heavy chain (FIGS. 16A and 16B). In an embodiment, nucleic acid encoding the murine PA-29 light chain variable region (FIGS. 15A and 15B) and a human lambda light chain constant region was molecularly engineered to express a chimeric PA-29 antibody light chain. The nucleic acids encoding the heavy and light chains of chimeric PA-29 were cloned into plasmid constructs which were then used to express the chimeric PA-29 antibody molecule in CHO cells. The expressed PA-29 chimeric antibody was demonstrated to have neutralizing activity in HCV inhibition assays. (Example 13 and FIG. 17). The invention encompasses portions and fragments of chimeric PA-29 antibody, such as, for example, a light chain of the antibody, a heavy chain of the antibody, a Fab portion of the antibody, a F(ab')2 portion of the antibody, an Fd portion of the antibody, an Fv portion of the antib ody, a variable domain of the antibody, or one or more CDR domains of the antibody.

[0153] In an embodiment of the invention, the chimeric form of the antibody comprises a light chain amino acid sequence as set forth in SEQ ID NO: 11. In an embodiment, the chimeric antibody comprises the light chain variable region amino acid sequence as set forth in SEQ ID NO: 1 and the heavy chain variable region amino acid sequence as set forth in SEQ ID NO:2. In another embodiment , the chimeric antibody comprises a light chain variable region amino acid sequence as set forth in SEQ ID NO:1 and a light chain constant region amino acid sequence from a human lambda or kappa light chain constant region. In an embodiment the chimeric form of the antibody comprises a heavy chain as set forth in SEQ ID NO: 12. In another embodiment, the heavy chain variable region amino acid sequence of the chimeric antibody is as set forth in SEQ ID NO: 2 and the heavy chain constant region amino acid sequence is from a human constant region, e.g., IgM, IgG, IgA, IgE, IgD, or IgGl, IgG2a, IgG2b, IgG3, or IgG4 subtypes.

[0154] In an embodiment, the PA-29 monoclonal antibody is humanized (HuP A-29). The variable region of the humanized antibody may be linked to at least a portion of the constant region of a human immunoglobulin. In one embodiment, the humanized antibody contains both human light chain and heavy chain constant regions. The heavy chain constant region usually includes the CHl , hinge, CH2, CH3 and sometimes, the CH4 domains. In an embodiment, the constant region of the humanized antibody is all or a portion of the human IgGl, IgG2, IgG2a, IgG2b, IgG3, IgG4, IgM, IgE, IgD or IgA isotype. In one embodiment, the constant region of the humanized antibody is all or a portion of the human IgGl isotype. In one embodiment, the constant region of the humanized antibody is all or a portion of the human IgG3 isotype. In one embodiment, the constant region of the humanized antibody is all or a portion of the human IgG4 isotype. In an embodiment, humanized PA-29 possesses functional characteristics that are equal to, the same as, or superior to those of the non-humanized murine PA-29 monoclonal antibody.

[0155] The monoclonal antibodies in accordance with this invention, e.g., PA-29 in its purified, recombinant, chimeric and humanized forms, serve as HCV antagonists or inhibitors, i.e., agents that inhibit HCV infection of a cell or a target cell susceptible to infection by HCV. Cells susceptible to HCV infection include cells having or expressing receptor proteins, and/or accessory proteins or structures to which HCV binds. Susceptible cells may include, without limitation, primary cells, dendritic cells, placental cells, endometrial cells, lymph node cells, placenta cells, peripheral blood mononuclear cells, HeLa cells, liver cells or hepatic cells. Hepatic cells, i.e., liver cells, may include but are not limited to hepatocytes, liver sinusoidal cells, a HepG2 cell, SK-HEPl cell,

C3 A cell or an Huh-7 cell. In one embodiment, the hepatic cell is a primary hepatic cell. In another embodiment, the hepatic cell is a hepatoma or abnormal liver cell or hepatocyte.

[0156] As described herein, embodiments of the present invention encompass a monoclonal antibody, e.g., the PA-29 monoclonal antibody, and aportion thereof. Preferably, the portion of the antibody has functional activity. By functional activity is meant antigen or ligand binding activity, neutralizing or inhibiting activity to neutralize or inhibit HCV infection; all of the foregoing activities, or another activity characteristic of the antibody of the invention. Functional activity may also encompass downstream events that occur in an HCV-susceptible cell. Accordingly, both a complete monoclonal antibody and a portion thereof may exhibit similar activity or function.

[0157] In accordance with this invention, the monoclonal antibodies may be used in their native form, or they may be truncated (e.g., via enzymatic cleavage and the like) to provide immunoglobulin fragments or portions, in particular, fragments or portions that bind or that possess inhibiting or blocking activity against HCV. Illustratively, the antibody fragment or portion may be an Fab fragment or portion, an F(ab')2 fragment or portion, a variable domain or one or more CDR domains of the antibody. In an embodiment, the fragment or portion of the monoclonal antibody may derive from the carboxyl portion or terminus of antibody protein and may comprise an Fc fragment, an Fd fragment, or an Fv fragment. [0158] The neutralizing monoclonal antibodies or portion thereof of this invention maybe used in therapeutic and prophylactic methods to treat and prevent HCV infection and to treat and prevent a liver disease, or a pathological condition affecting susceptible cells, such as liver cells or hepatocytes. In one embodiment of the methods described herein, the susceptible cell is present in a subject and the monoclonal antibody or portion thereof according to the present invention is administered to a subject to treat the subject who has become afflicted with or infected by HCV. As used herein, "afflicted with or infected by HCV" means that the subject has at least one cell which has been infected by HCV. As used herein, "treating" means slowing, stopping or reversing the progression of an HCV disorder, or reversing the progression to the point of eliminating the disorder. Treating an HCV disorder also relates to the reduction of the number of viral infections, reduction of the number of infectious viral particles, reduction of the number of virally infected cells, or the amelioration of symptoms associated with HCV.

[0159] Another application of the present invention relates to preventing a subject from contracting HCV, such that a subject is prevented from becoming infected with HCV; thus, the genetic information of HCV cannot replicate in and/or incorporate into the host cells. Another application of the present invention is to treat a subject who has become infected with HCV. As used herein, "HCV infection" means the introduction of HCV genetic information into a target cell, such as by fusion of the target cell membrane with HCV or an HCV envelope glycoprotein-positive cell. Another application of the monoclonal antibodies of the present invention is to inhibit HCV infection. As used herein, "inhibiting HCV infection" means reducing the amount of HCV genetic information introduced into a target cell population as compared to the amount that would be introduced without the presence of the antibodies of the invention.

[0160] In accordance with this invention, a target cell or an HCV susceptible cell may be a body cell of a subject. An HCV susceptible or afflicted subject means any animal or artificially modified animal capable of becoming HCV- infected. Such subjects include but are not limited to a human being, a primate, an equine, an ovine, an avian, a bovine, a porcine, a canine, a feline or a mouse. Artificially modified animals include, but are not limited to, SCID mice with human immune systems. The animals include but are not limited to mice, rats, dogs, goats, guinea pigs, ferrets, rabbits, and chimpanzees. A subject, particularly a human subject, is also referred to as an individual or a patient herein.

[0161] The monoclonal antibodies of the present invention find use in compositions for prophylactic therapy and/or for treating HCV infection by reducing viral load, by inhibiting binding of the virus to its target protein(s), by inhibiting virus mediated fusion with a target cell and by interfering with conformational changes in the viral envelope proteins necessary for cell infectivity. The composition used can include a monoclonal antibody directed to linear epitopes, or to a conformational epitope, or a mixture of complementary monoclonal antibodies that recognize distinct conformational epitopes on one or more HCV viral envelope proteins, thereby simultaneously interfering with multiple mechanisms in the infectious process. [0162] The effectiveness of an anti-HCV therapy, or of a method of treating an HCV infection, can be determined by a reduction in viral load, a reduction in time to seroconversion (undetectable levels of virus in a subject's serum), a sustained viral response to antiviral therapy, an increase in the rate of a sustained viral response to therapy, a reduction of morbidity or mortality in clinical outcomes, or other disease response indicator. In general, an effective amount of a monoclonal antibody of the invention, alone or in combination with one or more additional antiviral agents, is an amount that is effective to reduce viral load or to achieve a sustained response to therapy. Illustrative ways in which to determine whether a therapy is effective in treating an HCV infection include measuring viral load, measuring a parameter associated with HCV infection, such as, but not limited to, liver fibrosis, elevation in serum transaminase levels and necroinflammatory activity in the liver. In an embodiment, the level of a serum marker of liver fibrosis indicates the degree of liver fibrosis. For example without limitation, levels of serum alanine aminotransferase (ALT) can be measured using standard assays. An ALT level of less than about 45 IU is generally considered to be normal. In an embodiment, an effective amount of a monoclonal antibody of the invention, e.g., PA-29, humanized PA-29, chimeric PA-29, or a portion thereof, optionally in combination with one or more additional antiviral agents, is an amount effective to reduce ALT levels to less than about 45 ILVmL serum. [0163] A therapeutically effective amount of amonoclonal antibody of the invention, e.g., PA-29, humanized PA-29, chimeric PA-29, or a portion thereof, optionally in combination with one or more additional antiviral agents, is an amount that is effective to reduce a serum level of a marker of liver fibrosis by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or more, compared with the level of such a marker in the serum of an untreated individual, or to a placebo-treated individual. Methods and procedures for measuring serum markers are practiced in the art and include enzyme linked immunosorbant assays (ELISAs), radioimmunoassays, fluorescent assays, chemiluminescent assays, and the like, using antibody specific for a given serum marker. (0164] A method of treating HCV infection in accordance with the invention involves administering to an individual an effective amount of a monoclonal antibody of the invention, optionally in combination with an effective amount of one or more additional antiviral agents, including other monoclonal antibodies. In an embodiment, the monoclonal antibody is the PA-29 monoclonal antibody or a competing antibody thereof. In an embodiment, the monoclonal antibody is humanized PA-29 monoclonal antibody. In an embodiment, the monoclonal antibody is chimeric PA-29. In some embodiments, an effective amount of the monoclonal antibody and optionally in combination with an effective amount of one or more additional antiviral agents, including other monoclonal antibodies, is an amount that is effective to reduce viral titers or viral load to undetectable levels, for example, to about 1000 to about 5000, or to about 500 to about 1000, or to about 100 to about 500, or to about 50 to about 400, or to about 50 to about 100 genome copies per mL serum In another embodiment, an effective amount of the monoclonal antibody and optionally in combination with an effective amount of one or more additional antiviral agents, including other monoclonal antibodies, is an amount that is effective to reduce viral titers or viral load to less than about 100 genome copies/mL serum.

[0165] In other embodiments, an effective amount of the monoclonal antibody of the invention, e.g., PA-29, humanized PA-29, chimeric PA-29, or a portion thereof, optionally in combination with an effective amount of one or more additional antiviral agents, including other monoclonal antibodies, is an amount that is effective to achieve a logio reduction in viral titer or viral load of 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, or 5.5 in the serum of an HCV-infected individual who is being treated. In other embodiments, an effective amount of the monoclonal antibody of the invention, e.g., PA-29, humanized PA-29, chimeric PA-29, or a portion thereof, optionally in combination with an effective amount of one or more additional antiviral agents, including other monoclonal antibodies, is an amount that is effective to achieve a sustained antiviral response in an individual who is undergoing treatment, e.g., no detectable HCV RNA, for example, less than about 500, less than about 400, less than about 200, less than about 100, or less than about 50 genome copies of virus RNA per mL serum for a period of at least about three weeks, at least about one month, at least about two months, at least about three months, at least about four months, at least about five months, at least about six months, or longer, following the cessation of the therapy or treatment method.

[0166] As referred to herein, a "composition" means a mixture. Compositions include, but are not limited to, those suitable for oral, rectal, intravaginal, topical, nasal, opthalmic, or parenteral administration to a subject. As used herein, "parenteral" includes but is not limited to subcutaneous, intravenous, intramuscular, or intrasternal injections or infusion techniques. In one embodiment of the compositions of the invention, at least one of the components comprises a light chain of an antibody. In another embodiment of the compositions, at least one of the components comprises a heavy chain of an antibody. In another embodiment of the compositions, at least one of the components comprises the Fab portion of an antibody. In another embodiment of the compositions, at least one of the components comprises the variable domain of an antibody. In another embodiment, the antibody is produced as a single polypeptide or "single chain" antibody which comprises the heavy and light chain variable domains genetically linked via an intervening sequence of amino acids. In another embodiment of the compositions, at least one of the components comprises one or more CDR portions o fan antibody.

[0167] In an embodiment, an effective amount of the monoclonal antibody of the invention, e.g., PA-29, humanized PA-29, chimeric PA-29, or a portion thereof, optionally in combination with an effective amount of one or more additional antiviral agents, including other monoclonal antibodies, is used in a method of treating liver fibrosis, e.g , a form associated with or resulting from HCV infection. The effectiveness of such treatment can be determined by any of a number of well established procedures for measuring liver fibrosis and liver function. Liver fibrosis reduction is determined, for example, by analyzing a liver biopsy sample. The analysis of a liver biopsy comprises the assessment of two primary components, necroinflammation (assessed by "grade" as a measure of the severity and ongoing disease activity) and the lesions of fibrosis and parenchymal or vascular remodeling (assessed by "stage" that reflects the length of disease progression), (e.g., Brunt, 2000, Hepatology, 31 :241 -246; METAVIR, 1994, Hepatology, 20:15-20; WO 2005/037214). [0168] Treatment of hepatitis C virus (HCV) infection may also be accomplished using pharmaceutical compositions comprising the HCV neutralizing monoclonal antibodies or a portion thereof of the present invention. The monoclonal antibody is present in the pharmaceutical composition in an effective amount or in a therapeutically effective amount. Suitable formulations for delivery of the antibodies are found in Remington's Pharmaceutical Sciences (1985). These pharmaceutical compositions are suitable for use in a variety of drug delivery systems (See, Langer, 1990). Neutralizing monoclonal antibodies in compositions are suitable for single administration or in a series of inoculations (e.g., an initial immunization followed by subsequent inoculations to boost the anti-HCV immune response). Pharmaceutical compositions or formulations comprising the monoclonal antibodies according to this invention may include other reagents, substances, excipients, carriers and diluents as described herein. The determination of a therapeutically or prophylactically effective amount of the antibodies and compositions can be made by the skilled practitioner in the art, typically based on animal data using routine computational methods. The effective amount is based upon, among other things, the size, form, biodegradability, bioactivity and bioavailability of the antibody as described below.

[0169] As guidance for the amount of the monoclonal antibody or portion thereof for administration to the subject, a dose or amount would be one in sufficient quantities to either inhibit HCV infection, treat HCV infection, treat the subject or prevent the subject from becoming infected with HCV. This amount may be considered an effective amount. The skilled practitioner in the art can perform simple titration experiments to determine what amount is required to treat the subject. The dose of the composition of the invention will vary depending on the subject and upon the particular route of administration used. In one embodiment, the dosage can range from about 0.1 to about 100,000 g/kg body weight of the subject. Based upon the composition, the dose can be delivered continuously, such as by continuous pump, or at periodic intervals, for example, on one or more separate occasions. Desired time intervals of multiple dosing of a monoclonal antibody or a particular composition thereof can be readily determined by the skilled practitioner in the art.

[0170] In one embodiment of the methods described herein, the effective amount, or dose, of the monoclonal antibody, a portion thereof, or an antibody-containing composition as described, is between about 0.5 mg and about 50 mg per kg of body weight of the subject. In other embodiments, the effective amount is between about 1 mg and about 50 mg per kg body weight of the subject; or between about 2 mg and about 40 mg per kg body weight of the subject; or between about 3 mg and about 30 mg per kg body weight of the subject; or between about 4 mg and about 20 mg per kg body weight ofthe subject; or between about 5 mg and about 10 mg per kg body weight of the subject. In other embodiments, the effective amount ofthe monoclonal antibody, a portion thereof, or an antibody-containing composition as described, may comprise from about 0.000001 mg/kg body weight to about 100 mg/kg body weight; or from about 0.001 mg/kg body weight to about 50 mg/kg body weight; or from about 0.01 mg/kg body weight to about 10 mg/kg body weight.

[0171] The effective amount may be based upon, among other things, the size, biodegradability, bioactivity and the bioavailability ofthe monoclonal antibody, a portion thereof, or an antibody-containing composition as described. If the active, i.e., the monoclonal antibody, or portion thereof, does not degrade quickly, is bioavailable and highly active, a smaller amount will be required to be effective. The effective amount will be known to one of skill in the art; it will also be dependent upon the form, the size and the bioactivity of the monoclonal antibody or a portion thereof. One of skill in the art could routinely perform empirical activity tests for a compound to determine the bioactivity in bioassays and thus determine the effective amount.

[0172] The skilled practitioner in the art can determine when to administer the monoclonal antibody or portion thereof, or antibody-containing composition in accordance with the present invention. The administration may be constant for a certain period of time or periodic and at specific intervals. The monoclonal antibody, a portion thereof, or composition thereof may be delivered hourly, daily, weekly, monthly, yearly (e.g., in a time release form) or as a one time delivery, e.g., single dose. Alternatively, the delivery may occur at multiple times during a given time period, e.g., two or more times per week; two or more times per month, and the like. The delivery may be continuous delivery for or over a period of time, e.g. intravenous delivery. In nonlimiting embodiments ofthe methods described herein, the monoclonal antibody, a portion thereof, or composition thereof is administered once per day, daily; every other day, every 6 to 8 days; or weekly. In other nonlimiting embodiments, the monoclonal antibody, a portion thereof, or composition thereof is administered once a week, twice a week, once every two weeks, once every three weeks, or once every six weeks.

[0173] Methods for treating a subject afflicted with HCV infection or an HCV- associated disorder, including liver disease, and methods for inhibiting in a subject the onset of HCV infection or an HCV-associated disorder, including liver disease, include the administration of at least one conventional antiviral agent in conjunction with at least one neutralizing monoclonal antibody according to the present invention. Such antiviral agents include, but are not limited to, interferons, e.g., interferon-alpha, interferon-alpha- 2B, and ribavirin (l-β-D-ribofuranosyl-lH-l,2,4-triazole-3-carboxamide; Merck Index 11^th Edition, Compound No. 8199), (ICN Pharmaceuticals, Inc., Costa Mesa, CA), or derivatives thereof. The antiviral agent may be administered to a patient in need thereof either before, at the same time as, or following administration of one or more neutralizing monoclonal antibodies of the present invention. In an embodiment, the neutralizing antibody is the PA-29 monoclonal antibody, a portion thereof, a chimeric or humanized form thereof.

[0174] A monoclonal antibody or portion thereof according to this invention, e.g., PA- 29, maybe used in combination with one or more additional antiviral agents, e.g., in compositions, which include, without limitation, a non-nucleoside HCV RNA-dependent RNA polymerase (RdRP) inhibitor, a nucleoside HCV RNA-dependent RNA polymerase (RdRP) inhibitor, a non-nucleoside HCV RNA protease inhibitor, a nucleoside HCV RNA protease inhibitor, non-nucleoside reverse transcriptase inhibitors (NNRTIs), a nucleoside reverse transcriptase inhibitor, a viral entry inhibitor, interferon, PEG-interferon, ribavirin and combinations thereof. It will be understood that the nucleoside and non-nucleoside inhibitors include analogs of nucleoside and non- nucleoside molecules. The polymerase inhibitors can target HCV NS5B and NS5A; the protease inhibitors can target HCV NS3 andNS4.

[0175] Illustrative, nonlimiting, nucleoside analog inhibitors of NS5B that may be used in combination therapies and in the compositions of the present invention include, without limitation, valopicitabine (NM283, Idenix/Novartis), a prodrug of nucleoside analog 2^>-C-methylcytosine; JTK103 (Japan Tobacco/AKROS); R04048

(Pharmasset/Roche); R-1479/R-1626 (Pharmasset/Roche), nucleoside analog of 4'- azidocytosine and prodrug thereof; and R-7128 (Pharmasset/Roche). Illustrative, non- limiting, non-nucleoside analog inhibitors (NNRTI) that maybe used in the compositions of the present invention include, without limitation, HCV-796 (ViroPharma/Wyeth), abenzofuran HCV polymerase inhibitor; GL60667 or "667" (Genelab Technologies, Inc./Gilead Sciences, Inc.); and XTL-2125 (XTL

Biopharmaceuticals, Inc.). Illustrative, non-limiting, serine protease inhibitors of NS3/4A of HCV that may be used in the compositions of the present invention include, without limitation, VX-950 (Vertex/Janssen-Tibotec); SCH-503034 (Schering-Plough); ACH-806/GS-9132 (Achillion/Gilead); and BILN-2061 (Boehringer Ingleheim) and ITMN-191 (InterMune, Inc.).

[0176] For a combination therapy in which the monoclonal antibody or portion thereof of the present invention, e.g., PA-29, is used in conjunction with one or more conventional antiviral compounds or HCV antagonist agents, the antibody maybe provided to the subject prior to, subsequent to, or concurrently with the one or more conventional antiviral compounds or agents.

[0177] The monoclonal antibodies or portion thereof, or pharmaceutical compositions comprising the monoclonal antibodies or portions thereof according to the present invention, maybe administered using any of the methods known to the skilled practitioner in the art. The antibodies and/or compositions may be administered by various routes including but not limited to aerosol, intravenous, oral, oτ topical τoute. The administration may comprise intralesional, intraperitoneal, subcutaneous, intramuscular or intravenous injection; infusion; liposome-mediated delivery; topical, intrathecal, gingival pocket, rectal, intrabronchial, nasal, transmucosal, intestinal, oral, ocular or otic delivery. Additionally, the administration includes intrabronchial administration, anal, intrathecal administration or transdermal delivery. The antibodies of the subject invention may be delivered locally via a capsule which allows sustained release of the antibodies over a period of time. Controlled or sustained release compositions include formulation in lipophilic depots (e.g., fatty acids, waxes, oils). Also embraced by the present invention are particulate compositions coated with polymers (e.g., poloxamers or poloxamines). Other modes of administration of the antibodies and compositions of this invention incorporate particulate forms protective coatings, protease inhibitors, and/or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral. Carriers included in the compositions may be a diluent, an aerosol, a topical carrier, an aqueous solution, a nonaqueous solution or a solid carrier.

[0178J Parenteral administration may be preferentially directed to the patient's liver, such as by catheterization to hepatic arteries or into a bile duct For parenteral administration, the compositions can include HCV neutralizing monoclonal antibody, a portion thereof, or combinations thereof suspended in a suitable sterile carrier such as water, aqueous buffer, 0.4% saline solution, 0.3% glycine, hyaluronic acid or emulsions of nontoxic nonionic surfactants as is well known in the art. The carrier maybe a pharmaceutically acceptable carrier. The compositions may further include substances to approximate physiological conditions, such as buffering agents and wetting agents, e.g., NaCl, KCl, CaCh, sodium acetate and sodium lactate. Aqueous suspensions of neutralizing monoclonal antibodies can be lyophilized for storage and can be suitably recombined with sterile water before administration. Solid compositions including HCV neutralizing monoclonal antibodies in conventional nontoxic solid carriers may be used. For oral administration of solid compositions, the neutralizing monoclonal antibodies may comprise 10% to 95%, and more preferably 25% to 75% of the composition.

[0179] Pharmaceutically acceptable carriers are well known to those skilled in the art. Such pharmaceutically acceptable carriers may include, but are not limited to, aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like

[0180] The present invention provides a method of treating or preventing a liver disease in a subject, which comprises administering to the subject an effective amount of one or more monoclonal antibodies, or a portion thereof, of the invention which inhibits binding of an HCV envelope glycoprotein to a subject's cells, so as to thereby treat or prevent the liver disease in the subject. In one embodiment of the methods described herein, the liver disease is hepatitis. In one embodiment of the methods described herein, the liver disease is cirrhosis. In an embodiment, the method involves the use of the PA- 29 monoclonal antibody, a portion thereof, or a chimeric or humanized form thereof.

[0181] The present invention provides a method of treating or preventing hepatocellular carcinoma in a subject which comprises administering to the subject an effective amount of one or more monoclonal antibodies, or aportion thereof, of the invention which inhibits binding of an HCV envelope glycoprotein to a subject's cells, so as to treat or prevent hepatocellular carcinoma in the subject. In an embodiment, the method involves the use of the PA-29 monoclonal antibody, a portion thereof, or a chimeric or humanized form thereof.

[0182] The monoclonal antibodies of the present invention also may be used for passive immunization therapies or other in vivo therapies. See, for example, Piazzi, et al, 1997; Farci, et al., 1996; al-Hemsi, et al., 1996; Krawczynski, et al., 1996). For such therapeutic uses, the monoclonal antibodies maybe formulated in any convenient way for injection or intravenous administration as described herein. Various media may be used such as phosphate buffered saline, saline or the like. The amount of the monoclonal antibodies may be varied depending on the level of infection, the affinity of the antibodies, the manner of administration, the frequency of administration, the response of the patient, the use of other therapeutics, and the like. In general, the amount of monoclonal antibody administered will be in the range of about 0.1 to 15 mg/kg. See, for example, Andrus et al., 1998; Kreil et al., 1998.

[0183] The chimpanzee is an accepted animal model for screening HCV vaccines and therapeutics. See, e.g., Farci, et al., 1996; Farci, et al., 1994; Farci, et al, 1992;

Krawczynski, et al., 1996; Bassett, et al., 1998. Other animal models are also available for testing anti-HCV monoclonal antibodies. See, e.g., WO2005/067709. hi chimpanzee studies, the effectiveness of the monoclonal antibodies can be determined by monitoring for the presence and titer of HCV RNA using quantitative PCR methods. A successful reduction of viral load, or prevention of infection in a test animal or subject, is reflected as a reduction or elimination of HCV RNA in serum. Enzymatic tests such as measurement of alanine aminotransferase and/or the use of sequential punch needle liver biopsies are further used to test effectiveness of a therapeutic or treatment, where improvement in the rating of either measurement indicates a reduction in viral-induced liver damage. [0184] In an embodiment for reducing viral load of a body component, particularly a body component of a patient infected with HCV, patient blood may be passed through a device in which one or more monoclonal antibody according to the present invention is bound to a surface for capturing the HCV. See, for example, U.S. Patent Nos. 5,698,390 and 4,692,411. Various other devices as known in the field can be used with the monoclonal antibodies according to this invention to achieve a similar result. A body component can be a biological fluid, a body fluid, a tissue, an organ, such as the liver, and the like. A body fluid is any fluid which is present in a subject's body and is capable of containing HCV in an HCV-infected subject. Body fluids include, but are not limited to, whole blood or derivatives thereof (e.g., red blood cell and platelet preparations), saliva, cerebrospinal fluid, tears, vaginal secretions, semen, urine, alveolar fluid, synovial fluid, pleural fluid and bone marrow. In addition, body fluid samples such as whole blood may further comprise exogenous substances added thereto for clinical or storage purposes. Such exogenous substances include, by way of example, anticoagulants (e.g., citrate) and preservatives (e.g., dextrose). [0185] The present invention further encompasses an aqueous-soluble monoclonal antibody or portion thereof which comprises a moiety capable of specifically forming a complex with a known binding member, which moiety permits the τemoval of the antibody or portion thereof from a sample via contact with an immobilized form of the known binding member. As used herein, "aqueous-soluble" means capable of existing in soluble form in water at 4°C at a concentration of at least 1 pM. The use of a moiety capable of specifically forming a complex with a known binding member is commonly referred to in the art as "molecular tagging." The moiety may be selected, for example, from the group consisting of a small molecule and a protein. The binding member includes, but is not limited to, for example, a metal ion, a small molecule, a peptide or a protein. Specific examples of moiety/binding member combinations include, but are not limited to, (a) oligohistidine/nickel ion, (b) glutathione S-transferase/glutathione, (c) biotin/streptavidin, and (d) the HA peptide YPYDVPDYA (SEQ ID NO:30) /anti-HA peptide antibody. The moiety may be attached by any means known to one skilled in the art, such as for example, chemically or genetically.

[0186] The present invention further encompasses a method of treating a body fluid sample so as to substantially reduce the likelihood of a subject's becoming infected with HCV as a result of contact with the sample. Such a method comprises contacting the sample with a suitable amount of an aqueous-soluble monoclonal antibody or a portion thereof according to the present invention, capable of forming a complex with a domain present, for example, on an HCV envelope glycoprotein or on HCV envelope glycoprotein in association with a soluble protein such as a serum protein, so as to form a complex between the antibody or portion thereof and HCV, etc. , if present in the sample. This complexation serves to remove from or significantly decrease the amount of HCV in the sample and thereby reduces the likelihood of a subject's becoming infected with HCV as a result of contact with the sample. In an embodiment, the method involves the use of the PA-29 monoclonal antibody, a portion thereof, or a chimeric or humanized form thereof.

[0187] The present invention further encompasses a method of substantially reducing the amount of HCV envelope glycoprotein in a body fluid sample, which comprises contacting the sample with a suitable amount of an aqueous-soluble monoclonal antibody or a portion thereof according to the present invention, capable of specifically forming a complex with a domain present on an HCV envelope glycoprotein or on HCV envelope glycoprotein in association with a soluble protein, such as a serum protein, so as to form a complex between the antibody or portion thereof and HCV, if present in the sample and thereby to reduce the amount of HCV envelope glycoprotein in the sample.

[0188] In an embodiment, the blood of HCV-infected individuals may be passed through filters on which one or more monoclonal antibodies or a portion thereof of the present invention have been immobilized. This would allow the removal of HCV virions and/or HCV envelope glycoprotein from the blood In this way, the blood would be depleted of pathogenic HCV, which can bind to cells susceptible to HCV infection and inhibit the immune response or initiate apoptosis of these cells. [0189] As used herein, substantially reducing the likelihood of the subject's becoming infected with HCV means reducing the likelihood of the subject's becoming infected with HCV by at least two-fold. For example, if a subject has a 1 % chance of becoming infected with HCV, a two-fold reduction in the likelihood of the subject's becoming infected with HCV would result in the subject's having a 0.5% chance of becoming infected with HCV. In one embodiment, substantially reducing the likelihood of the subject's becoming infected with HCV means reducing the likelihood by at least ten-fold. In another embodiment, substantially reducing the likelihood of a subject's becoming infected with HCV means reducing the likelihood by at least 100-fold. The amount of aqueous-soluble monoclonal antibody or portion thereof suitable to substantially reduce the likelihood of a subject's becoming infected with HCV may be determined according to methods known to those skilled in the art. In one embodiment, a suitable amount is an amount between about I pM and about 10 mM. In another embodiment, the suitable amount is an amount between about 1 pM and about 10 μM.

[0190] The present invention further provides a method of treating a body fluid sample so as to substantially reduce the likelihood of a subject's becoming infected with HCV as a result of contact with the sample, which comprises the steps of (a) contacting the sample with a suitable amount of an aqueous-soluble monoclonal antibody or a portion thereof according to the present invention capable of specifically forming a complex with a domain present on an HCV envelope glycoprotein or on HCV envelope glycoprotein in association with a soluble protein, such as a serum protein, thereby forming a complex between the monoclonal antibody and HCV if present in the sample; and (b) removing any complex so formed from the resulting sample, so as to thereby reduce the likelihood of a subject's becoming infected with HCV as a result of contact with the sample. Removing complex from the resulting sample may be accomplished according to methods well known to those skilled in the art, e.g., by affinity chromatography. As a further step, the method may further comprise removing uncomplexed monoclonal antibody or a portion thereof from the sample should such removal be desirable. In an embodiment, the method involves the use of the PA-29 monoclonal antibody, a portion thereof, or a chimeric or humanized form thereof.

[0191] The present invention further embraces a method of treating a body fluid sample so as to substantially reduce the likelihood of a subject's becoming infected with HCV as a result of contact with the sample, which comprises the steps of (a) contacting the sample with a suitable amount of an aqueous-soluble monoclonal antibody or a portion thereof according to the present invention, which (i) is capable of specifically forming a complex with a domain present on an HCV envelope glycoprotein or on HCV envelope glycoprotein in association with a soluble protein, such as a serum protein, and (ϋ) comprises a moiety capable of specifically forming a complex with a known ligand, which moiety permits the removal of the antibody or portion thereof from a sample via contact with an immobilized form of the known ligand, thereby forming a complex between the antibody or portion thereof and HCV if present in the sample; and (b) removing any complex so formed from the resulting sample by contacting the resulting sample with an immobilized form of the known ligand, so as to reduce the likelihood of a subject's becoming infected with HCV as a result of contact with the sample. Methods of immobilizing a ligand are well known to those skilled in the art. As is understood by those skilled in the art, a ligand in its immobilized form is capable of forming a complex with the moiety specifically recognized by the ligand in its free form. In various embodiments, the contacting step of the method may be performed at about 4⁰C, or at about 2O⁰C, or at about 37°C. In an embodiment, the method involves the use of the PA- 29 monoclonal antibody, a portion thereof, or a chimeric or humanized form thereof.

[0192] The methods described herein to capture the HCV virions may be used for any purpose known to one skilled in the art. In one embodiment, the method is employed so as to reduce the HCV present in a subject's sample, or to reduce the infectivity of the sample. In one embodiment, the method is employed for concentrating the HCV virions so as to enable a greater chance of HCV detection, such as in a PCR assay for HCV nucleic acid, such as HCV RNA. In an embodiment, the invention provides a method for detecting HCV infection, which involves (a) contacting a sample suspected of containing HCV with a monoclonal antibody or portion thereof according to the invention; and (b) detecting HCV infection by detecting the monoclonal antibody or portion thereof which binds or interacts with HCV.

[0193] The HCV neutralizing monoclonal antibodies of this invention can be used pTophylactically as a vaccine to prevent HCV infection or a liver disease. Accordingly, this invention also provides a method for preventing a hepatitis C virus (HCV) infection or liver disease in a subject, the prevention of which is effected by immunizing the subject, which method comprises: (a) injecting into the subject a pharmaceutical composition comprising one or more HCV neutralizing monoclonal antibodies of the invention; and (b) eliciting a protective HCV immune response in the subject. In an embodiment, the method involves the use of the PA-29 monoclonal antibody or portion thereof In an embodiment, the method involves the use of chimeric or humanized PA- 29 antibody.

[0194] This invention provides a method of treating a subject afflicted with HCV, which comprises administering to the subject an effective dose of a composition as described herein. The invention also encompasses a method of treating HCV infection in a subject which comprises inhibiting HCV infection of the subject's cells susceptible to HCV infection by a method described herein, wherein the contacting is effected by administering to the subject one or more neutralizing monoclonal antibodies or a portion thereof. The invention also encompasses a method of preventing HCV infection of a subject which comprises inhibiting HCV infection of the subject's cells susceptible to HCV infection by a method described herein, wherein the contacting is effected by administering to the subject one or more neutralizing monoclonal antibodies or active portion thereof. In an embodiment, the HCV neutralizing monoclonal antibody is PA- 29. In an embodiment, the neutralizing monoclonal antibody is chimeric or humanized PA-29 antibody.

[0195] The present invention also provides a method of inhibiting HCV infection of a cell, e.g., new infection or established infection, which involves contacting a cell susceptible of infection by HCV with an effective amount of the antibody, e.g., PA-29, or a portion thereof, which binds HCV so as to inhibit HCV infection of the cell.

[0196] This invention further encompasses a method of preventing a cell or cells of a subject from becoming infected with HCV, which method includes administering to the subject one or more neutralizing monoclonal antibodies or portion thereof according to the invention in an amount effective to inhibit binding of HCV to one or more receptors on the surface of the subject's cells so as to prevent the subject's cell or cells from becoming infected with HCV. The present invention provides a method of treating a subject whose cells are infected with HCV, which method comprises administering to the subject one or more neutralizing monoclonal antibodies or portion thereof according to the invention in an amount effective to inhibit binding of HCV to one or more receptors on the surface of the subject's cells so as to treat the subject. The subject may be a human or a SCID-BNX mouse (Galun et al., 1995). In an embodiment, the methods involve the use of the PA-29 monoclonal antibody or portion thereof. In an embodiment, the methods involve the use of a chimeric or humanized form of the PA-29 antibody. [0197] In one embodiment of the above methods, the subject is infected with HCV prior to administering the one or more neutralizing monoclonal antibodies or portion thereof to the subject. In another embodiment of the above methods, the subject is not infected with HCV prior to administering antibody to the subject. In another embodiment of the above methods, the subject is not infected with, but has been exposed to, HCV.

[0198] This invention further provides a method for inhibiting in a subject the onset of a hepatitis C virus (HCV)-associated disorder, the inhibition of which is effected by immunizing the subject, which method comprises injecting into the subject a pharmaceutical composition comprising one or more HCV neutralizing monoclonal antibodies of the invention, thereby eliciting a protective anti-HCV immune response in the subject. Such a method further embraces the co-administration of at least one conventional antiviral agent, including, but not limited to, interferon-alpha, interferon- alpha-2B and ribavirin. In an embodiment, the method involves the use of the PA-29 monoclonal antibody or portion thereof. In an embodiment, the method involves the use of a chimeric or humanized form of the PA-29 antibody or portion thereof.

[0199] In the methods according to this invention, an effective dose refers to a dose or an amount in sufficient quantities to either treat a subject or prevent the subject from becoming infected with HCV. A person of ordinary skill in the art can perform simple titration experiments to determine what amount is required to treat the subject. [0200] A vaccine containing one or more HCV neutralizing monoclonal antibodies of the invention contains an immunogenically effective amount of one or more of the monoclonal antibodies or a portion thereof of the present invention admixed with a pharmaceutically acceptable carrier such as those described above. In an embodiment, the HCV neutralizing antibody is PA-29 monoclonal antibody or portion thereof. In an embodiment, the HCV neutralizing antibody is a chimeric or humanized form of the PA- 29 antibody or portion thereof. The vaccine may further include other carriers known in the art such as, for example, thyroglobulin, albumin, tetanus toxoid, polyamino acids such as polymers of D-lysine and D-glutamate, inactivated influenza virus and hepatitis B recombinant protein(s). The vaccine may also include any well known adjuvants such as incomplete Freund's adjuvant, alum, aluminum phosphate, aluminum hydroxide, monophosphoryl lipid A (MPL, GlaxoSmithKline), saponins, CpG oligonucleotides. (Krieg et al., 1995), montanide, vitamin E and various water-in-oil emulsions prepared from biodegradable oils such as squalene and/or tocopherol, Quil A, Ribi Detox, CRL- 1005, L-121 and combinations thereof. As a result of administration of the HCV neutralizing monoclonal antibodies of the invention, HCV entry into cells is reduced or inhibited. A heightened immune response on the part of the patient may include generation of a cellular immune response (e.g., activation of cytotoxic T lymphocytes or CTL).

[0201 j A vaccine composition containing a neutralizing monoclonal antibody, or a portion thereof, according to the present invention is administered to a patient in an immunogenically effective amount to elicit a protective immune response against HCV. In an embodiment, the HCV neutralizing antibody is PA-29 monoclonal antibody or portion thereof. In an embodiment, the HCV neutralizing antibody is a chimeric or humanized form of the PA-29 antibody or portion thereof. The immunogenically effective amount will vary depending on the composition of the vaccine (e.g., whether or not it contains adjuvant), the manner of administration, the weight and general health of the patient and the judgment of the prescribing health care provider. For initial vaccination, the general range of antibody, or portion thereof, in the administered vaccine is about 100 μg to about 1 mgper 70 kg patient; subsequent inoculations to boost the immune response include antibody, or a portion thereof, in the range of 100 μg to about 1 mg per 70 kg patient. Single or multiple boosting immunizations are administered over a period of about two weeks to about six months from the initial vaccination The prescribing health care provider may determine the number and timing of booster immunizations based on well known immunization protocols and the individual patient's response to the immunizations (e.g., as monitored by assaying for viral load, infected cells and the like).

[0202] For treatment of apatient infected with HCV, the amount of neutralizing monoclonal antibody, or portion thereof, to be delivered will vary with the method of delivery, the number of administrations and the state of the person receiving the composition (e.g., age, weight, severity of HCV infection, active or chronic status of HCV infection and general health status). Before therapeutic administration, the patient will already have been diagnosed as HCV-infected and may or may not be symptomatic. Generally, a therapeutically effective amount of neutralizing monoclonal antibody or portion thereof will be in the range of about 1 mg to about 10 gm per day, or about 50 mg to about 5 gm per day, or about 100 mg to 1 gm per day for a 70 kg patient. The neutralizing monoclonal antibody or portion thereof may be administered as a prime and/oT boost, alone or in various prime/boost combinations with other agents as described herein.

[0203] In an embodiment, the HCV neutralizing monoclonal antibodies of the present invention may be used in diagnosis or in diagnostic assays. For diagnosis, the antibodies of the invention, or a portion thereof, maybe used in a variety of ways, for example, for capturing and/or identifying circulating HCV virions, El, E2, or E1E2 envelope glycoprotein or anti-El , E2, or E1E2 antibodies, or HCV in association with a soluble protein, such as a serum protein or molecule. The antibodies may be used for prophylactic or therapeutic immunotherapies as described further herein. In an embodiment, the diagnosis method or diagnostic assay involves the use of the PA-29 monoclonal antibody or portion thereof, or chimeric or humanized forms thereof. [0204] In an embodiment, the present invention encompasses a method of detecting HCV infection, in which the method comprises providing a sample suspected of containing HCV; contacting the sample with a neutralizing monoclonal antibody of the invention, or a portion thereof, and detecting HCV infection by detecting the monoclonal antibody or a portion thereof which binds or interacts with HCV. In an embodiment, the monoclonal antibody or portion thereof binds or interacts with HCV envelope glycoprotein. In an embodiment, the monoclonal antibody or portion thereof binds or interacts with the HCV E1E2 envelope glycoprotein. In an embodiment, HCV may be associated with a serum or cellular protein. Detection may involve a detectable label or a secondary detection molecule. In an embodiment, the monoclonal antibody is PA-29 (ATCC Accession No. PTA-7632). In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody. [0205] The present invention also provides a method of detecting HCV infection, in which the method comprises providing a sample suspected of containing HCV; contacting the sample with a neutralizing monoclonal antibody of the invention, or a portion thereof, which neutralizes infection by HCV of genotypes Ia, Ib, 2a, 2b, 2c, etc., or a combination thereof, e.g., la/2b, etc., and detecting HCV infection by detecting the neutralizing monoclonal antibody or a portion thereof which binds or interacts with HCV. In an embodiment, the neutralizing monoclonal antibody or portion thereof binds or interacts with HCV envelope glycoprotein In an embodiment, the neutralizing monoclonal antibody or portion thereof binds or interacts with the HCV E1E2 envelope glycoprotein. In an embodiment, HCV may be associated with a serum or cellular protein. Detection may involve a detectable label or a secondary detection molecule. In an embodiment, the monoclonal antibody is PA-29 (ATCC Accession No. PTA-7632). In an embodiment, the monoclonal antibody or portion thereof is chimeric or humanized PA-29 antibody. [0206] The present invention encompasses an article of manufacture comprising a solid support having operably affixed thereto a monoclonal antibody or a portion thereof that is capable of specifically forming a complex with HCV envelope glycoprotein or HCV in association with a serum component. In one embodiment of the above methods, the domain present on the HCV envelope glycoprotein is a conserved domain, which may be defined as an envelope glycoprotein domain that is present on, and whose structure is invariant among, at least 90% of all strains of HCV. In another embodiment, the domain present on the HCV envelope glycoprotein is a non-conserved domain. The solid support may be any solid support known in the art to which the antibody can be operably affixed. Operably affixed refers to the antibody (or other agent) being affixed in a manner permitting the formation of a complex between the affixed antibody (or agent) and a bindable domain or region present on an HCV envelope glycoprotein or an HCV and soluble protein, e.g., serum protein, complex.

[0207] Methods by which an antibody (or agent) may be operably affixed to a solid support are well known in the art. Solid supports include, by way of example, natural or synthetic polymers. Synthetic polymers include, by way of example, polystyrene, polyethylene and polypropylene. Natural polymers include, by way of example, latex. The solid support includes a bead, a receptacle, or a filter. Solid supports in the form of beads are widely used and readily available to those skilled in the art. Beads include, for example, latex and polystyrene beads. The receptacle can be any receptacle in which a body fluid is stored, or with which such fluid comes into contact. For example, the receptacle may be in the form of a bag or tubing. The receptacle can be a bag specifically intended for the collection and/or storage of blood or blood components. Solid supports in the form of filters are widely used and readily available to those skilled in the art. Filters include, for example, polyester filters (e.g., polyester leuko filtration devices) and cellulose acetate filters.

[0208] The present invention further provides an article of manufacture comprising a solid support having operably affixed thereto a plurality of monoclonal antibodies or a portion thereof according to the present invention, each capable of specifically forming a complex with a domain present on an HCV envelope glycoprotein, or on HCV in association with a soluble protein, such as a serum protein. In an embodiment, the plurality of agents includes antibodies and another agent, compound, molecule capable of binding HCV envelope glycoprotein or HCV in association with a soluble protein, such as a serum protein.

[0209) The present invention further encompasses a kit for treating a body fluid sample so as to substantially reduce the likelihood of a subject's becoming infected with HCV as a result of contact with a sample which comprises the above-described article of manufacture. In an embodiment, the kit comprises, in separate compartments: (a) an article of manufacture comprising a solid support having operably affixed thereto a monoclonal antibody or portion thereof of the present invention, wherein the antibody or portion thereof comprises a moiety capable of specifically forming a complex with a known ligand, which moiety permits the removal of the antibody or portion thereof from a sample via contact with an immobilized form of the known ligand.

[0210] The kits of the present invention may comprise suitable buffers and reduce the amount of HCV or HCV envelope glycoprotein present in a body fluid sample, e.g., blood. In an embodiment, the present invention provides a diagnostic kit comprising one or more neutralizing monoclonal antibodies, or portions thereof as described herein, e.g., PA-29, its chimeric or humanized forms, and a portion thereof, and instructions for using the antibody. The kit may include instructions which describe use of the antibody for an immunoassay. In an embodiment, the antibody is immobilized on a solid support. In another embodiment, the solid support may comprise, without limitation, polysaccharide polymers (See, e.g., U.S. Patent No. 3,642,852), filter paper, nitrocellulose membrane, polyethylene, polystyrene and polypropylene. [0211] The methods described herein to capture the HCV virions may be used foτ any purpose known to one skilled in the art. In one embodiment, the method is employed so as to reduce the infectivity of a subject's sample. In another embodiment, the method is employed for concentrating the HCV virions so as to enable a greater chance of HCV detection, such as in a PCR assay for HCV nucleic acid, such as HCV RNA. Obtaining a sample of HCV envelope glycoprotein-positive cells may b e performed according to methods well known to those skilled in the art. HCV envelope glycoprotein-positive cells or HCV virions may be obtained from blood or any other body fluid known to contain HCV envelope glycoprotein-positive cells or virions in HCV-infected subjects, using routine procedures in the art. [0212] In another embodiment, the present invention encompasses a method of producing a potently neutralizing monoclonal antibody, e.g., PA-29, which involves immunizing an animal, e.g., a mouse, with an immunogen comprising HCV pseudoparticles prepared as described herein, either with or without adjuvant, to induce a primary immune response in the animal. After administering at least one boosting injection of the immunogen, either with or without adjuvant, the antibody-producing B lymphocytes are harvested from a responder animal and single antibody-producing cells from the animal are fused with myeloma cells to generate hybridomas. Hybridoma supernatants are screened to identify at least one monoclonal antibody that specifically neutralizes HCV in an appropriate assay. [0213] In accordance with the above embodiment, the HCV pseudoparticles used as immunogen in making the monoclonal antibodies, i.e., PA-29, of the present invention express HCV E1E2 envelope glycoprotein on their surface; the majority of the glycoprotein is full length. In one embodiment greater than 70% of the glycoprotein is full length. In one embodiment greater than 80% of the glycoprotein is full length, hi one embodiment, greater than 90% of the glycoprotein is full length. The pseudoparticles are produced as described in Example 1. In general and in brief, host cells (293T cells) were co-transfected with an HIV-I -derived vector that provides virion packaging functions and expresses a luciferase reporter gene, and with a vector construct comprising a coding sequence of modified HCV El E2 envelope glycoprotein, wherein at least one alteration in the coding sequence has eliminated an RNA splice acceptor site from the modified E1E2 coding sequence so as to reduce the extent of excision of an intron from the modified E1E2 coding sequence. Viral supernatant containing pseudoparticles expressing the E1E2 envelope glycoproteins were collected from the transfected cells.

[0214] An embodiment of the present invention provides an HCV neutralizing antibody comprising two light chain polypeptides, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:1 , and two heavy chain polypeptides, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:2. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent.

[0215] Another embodiment of the invention provides an isolated nucleic acid SEQ ID NO:3 which encodes the variable region comprising the amino acid sequence which is set forth in SEQ ID NO: 1. In an embodiment, this nucleic acid is included in a composition together with a carrier, excipient, or diluent. [0216] Another embodiment of the invention provides an isolated nucleic acid SEQ DD NO:4 which encodes the variable region comprising the amino acid sequence which is set forth in SEQ ID NO:2. In an embodiment, this nucleic acid is included in a composition together with a carrier, excipient, or diluent.

[0217] In another embodiment, the present invention provides a light chain polypeptide of an HCV neutralizing antibody, wherein the light chain comprises consecutive amino acids and includes a variable region and a constant region. The variable region of the tight chain comprises three complementarity determining regions (CDRs) comprising consecutive amino acids, namely, CDRl (SEQ ID NO:5), CDR2 (SEQ ID NO:6), and CDR3 (SEQ ID NO:7). In an embodiment, the HCV neutralizing antibody contains two light chain polypeptides having the foregoing CDRs. [0218] In another embodiment, the present invention provides a heavy chain polypeptide of an HCV neutralizing antibody, wherein the heavy chain comprises consecutive amino acids and includes a variable region and a constant region. The variable region of the heavy chain comprises three complementarity determining regions (CDRs) comprising consecutive amino acids, namely, CDRl (SEQ ID NO:8), CDR2 (SEQ ID NO:9), and CDR3 (SEQ ID NO: 10). In an embodiment, the anti-HCV envelope glycoprotein antibody contains two heavy chain polypeptides having the foregoing CDRs.

[0219] In another embodiment, the present invention encompasses an HCV neutralizing antibody comprising two light chains, each chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:11, and two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent. [0220] In another embodiment, the present invention encompasses an isolated nucleic acid SEQ ID NO: 13 which encodes the polypeptide comprising the amino acid sequence which is set forth in SEQ ID NO:11. In an embodiment, this nucleic acid is included in a composition together with a carrier, excipient, or diluent.

[0221] In another embodiment, the present invention encompasses an isolated nucleic acid SEQ ID NO: 14 which encodes a polypeptide comprising the amino acid sequence which is set forth in SEQ ID NO: 12. In an embodiment, this nucleic acid is included in a composition together with a carrier, excipient, or diluent.

[0222] In another embodiment, the present invention encompasses an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 15 , and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:18. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent. [0223] In another embodiment, the present invention encompasses an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 16, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:18. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent.

[0224] In another embodiment, the present invention encompasses an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 17, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent.

[0225] In another embodiment, the present invention encompasses an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:15, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent. [0226] In another embodiment, the present invention encompasses an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 16, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent.

[0227] In another embodiment, the present invention encompasses an HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 17, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO.19. In an embodiment, this antibody is included in a composition together with a carrier, excipient, or diluent.

[0228] In another embodiment, the present invention encompasses a composition comprising at least one of the above-described HCV neutralizing antibodies, which comprise two light chains and two heavy chains comprising a variable region and a constant region , or a portion thereof, together with a carrier, diluent, or excipient. In various embodiments, the antibody light chain may be of the λ or the K isotype, and the heavy chain maybe one of the IgGl, IgG2, IgG2a, IgG2b, IgG3, IgG4, IgM, IgA, IgE, or IgD isotype or subtypes thereof. In an embodiment, the constant region of the light chain is the of the λ isotype. In an embodiment, the constant region of the light chain is of the K isotype. In an embodiment, the constant region of the heavy chain is of the IgGl isotype. In an embodiment, the constant region of the heavy chain is of the IgG4 isotype. In an embodiment, the one or more antibodies have attached thereto a material such as a radioisotope, a toxin, polyethylene glycol, a cytotoxic agent and/or a detectable label. [0229] In another embodiment, the present invention encompasses a method of inhibiting infection of an HCV susceptible cell which comprises contacting the HCV susceptible cell with an antibody which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 11 , and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, in an amount and under conditions such that HCV infection of the HCV susceptible cell is inhibited.

[0230] In another embodiment, the present invention encompasses a method of treating a subject afflicted with HCV which comprises administering to the subject an effective HCV treating dosage of an HCV neutralizing antibody, which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:11, and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO- 12, or a fragment of such antibody, which neutralizes HCV infection of susceptible cells, under conditions effective to treat the HCV-infected subject. [0231] In another embodiment, the present invention encompasses a method of preventing a subject from contracting an HCV infection which comprises administering to the subject an effective HCV infection-preventing dosage amount of an HCV neutralizing antibody comprising (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID

NO: 11 , and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:12, or a fragment of such antibody, which neutralizes HCV infection of susceptible cells, under conditions effective to prevent the HCV infection in the subject. [0232] In another embodiment, the present invention encompasses a transformed host cell comprising one or more vectors, wherein the one or more vectors comprise (i) a nucleic acid sequence encoding heavy chains of an HCV neutralizing antibody, and/or (ϋ) a nucleic acid sequence encoding light chains of the HCV neutralizing antibody, wherein the HCV neutralizing antibody comprises two heavy chains having the amino acid sequence set forth in SEQ ID NO: 12, and two light chains having the amino acid sequence set forth in SEQ ID NO: 11.

[0233] Another embodiment of the present invention encompasses a transformed host cell comprising one or more vectors, wherein the one or more vectors comprise (i) a nucleic acid sequence encoding heavy chains of an HCV neutralizing antibody, and/or (ii) a nucleic acid sequence encoding light chains of the HCV neutralizing antibody, wherein the HCV neutralizing antibody comprises two heavy chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO:2, and two light chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO: 1.

[0234] Another embodiment of the present invention encompasses a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises the amino acid sequence set forth in SEQ ID NO: 12.

[0235] Another embodiment of the present invention encompasses a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises the amino acid sequence set forth in SEQ ID

NO:11. [0236] Another embodiment of the present invention encompasses a process for producing an HCV neutralizing antibody which comprises culturing the host cell as described above, so as to thereby produce the HCV neutralizing antibody.

[0237] Another embodiment of the present invention encompasses a method of inhibiting infection of an HCV susceptible cell which comprises contacting the HCV susceptible cell with an antibody which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18 or SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, in an amount and under conditions such that HCV infection of the HCV susceptible cell is inhibited. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO:15.

[0238] Another embodiment of the present invention encompasses a method of treating a subject afflicted with HCV which comprises administering to the subject an effective HCV treating dosage of an HCV neutralizing antibody, which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18 or SEQ ID NO: 19, and (ϋ) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17, or a fragment of such antibody, which neutralizes HCV infection of susceptible cells, under conditions effective to treat the HCV-infected subject. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 15.

[0239] Another embodiment of the present invention encompasses a method of preventing a subject from contracting an HCV infection which comprises administering to the subject an effective HCV infection-preventing dosage amount of an HCV neutralizing antibody comprising (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:18 or SEQ ID NO:19, and (ii) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17, or a fragment of such antibody, which neutralizes HCV infection of susceptible cells, under conditions effective to prevent the HCV infection in the subject. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 15. [0240] Another embodiment of the present invention encompasses an HCV neutralizing antibody conjugate comprising an HCV neutralizing antibody which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 18 or SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, conjugated to at least one polymer. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 15.

[0241] Another embodiment of the present invention encompasses an HCV neutralizing antibody conjugate comprising an HCV neutralizing antibody which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:11, and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, conjugated to at least one polymer.

[0242] Another embodiment of the present invention encompasses a method of inhibiting infection of an HCV susceptible cell by HCV, comprising administering to a subject at risk of HCV infection the above-described conjugate in an amount and under conditions effective to inhibit HCV infection of HCV susceptible cells of the subject. [0243] In another embodiment, the present invention encompasses a method of treating an HCV infection in a subject comprising administering the above-described conjugate to an HCV-infected subject in an amount and under conditions effective to treat the subject's HCV infection.

[0244] In another embodiment, the present invention encompasses a transformed host cell comprising one or more vectors, wherein the one or more vectors comprise (i) a nucleic acid sequence encoding heavy chains of an HCV neutralizing antibody, and/or (ii) a nucleic acid sequence encoding light chains of the HCV neutralizing antibody, wherein the HCV neutralizing antibody comprises two heavy chains comprising variable regions having an amino acid sequence selected from the sequences set forth in SEQ ID NOS: 15, 16, or 17, and two light chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 19. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 18 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID NO: 16. In an embodiment, the antibody comprises two light chains comprising the amino acid sequence as set forth in SEQ ID NO: 19 and two heavy chains comprising the amino acid sequence as set forth in SEQ ID N0:15.

[0245] In another embodiment, the present invention also encompasses a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises the amino acid sequence selected from the sequences as set forth in SEQ ID NOS:15, 16, or 17. In one embodiment, the heavy chain comprises the amino acid sequence as set forth in SEQ ID NO: 15. In one embodiment, the heavy chain comprises the amino acid sequence as set forth in SEQ ID NO: 16. In one embodiment, the heavy chain comprises the amino acid sequence as set forthin SEQ ID NO:17.

[0246] In another embodiment, the present invention also encompasses a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises a variable region having the amino acid sequence as set forth in SEQ ID NO:18 or SEQ ID NO:19. In one embodiment, the light chain comprises the amino acid sequence as set forth in SEQ ID NO:18. In one embodiment, the light chain comprises the amino acid sequence as set forth in SEQ ID NO:19.

[0247] In another embodiment, the present invention also encompasses a process for producing an HCV neutralizing antibody which comprises culturing the host cell as described above, so as to thereby produce the HCV neutralizing antibody.

[0248] In another embodiment, the present invention further encompasses a transformed host cell comprising one or more vectors, at least one vector comprising a nucleic acid sequence encoding heavy chains of an HCV neutralizing antibody, and at least one vector comprising a nucleic acid sequence encoding light chains of the HCV neutralizing antibody, wherein the HCV neutralizing antibody comprises two heavy chains comprising the amino acid sequence set forth in SEQ ID N0:2, and two light chains comprising the amino acid sequence set forth in SEQ ID NO:1.

[0249] In another embodiment, the present invention encompasses a vector comprising a nucleic acid sequence encoding a variable region of a heavy chain of an HCV neutralizing antibody, wherein the variable region of the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:2.

[0250] In another embodiment, the present invention also encompasses a vector comprising a nucleic acid sequence encoding a variable region of a light chain of an HCV neutralizing antibody, wherein the variable region of the light chain comprises the amino acid sequence set forth in SEQ ID NO: 1.

[0251] In another embodiment, the present invention encompasses a kit for use in a process of producing an HCV neutralizing antibody. The kit comprises (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises an amino acid sequence as set forth in SEQ ID NO:2.

[0252] In another embodiment, the present invention also encompasses a kit for use in a process of producing an HCV neutralizing antibody. The kit comprises (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises an amino acid sequence as set forth in SEQ ID NO:1 1 and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises an amino acid sequence as set forth in SEQ ID NO: 12. [0253] In another embodiment, the present invention further encompasses a kit for use in a process of producing an HCV neutralizing antibody. The kit comprises (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises a variable region comprising an amino acid sequence as set forth in SEQ ID NO: 18 or SEQ ID NO: 19 and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises a variable region comprising an amino acid sequence as set forth in SEQ ID NOS:15, 16, or 17.

[0254] Another embodiment of the invention provides an isolated nucleic acid which encodes a peptide or polypeptide comprising the amino acid sequence which is set forth in one or more of SEQ ID NOS:5-10.

[0255] In an embodiment, the HCV neutralizing antibody of the present invention comprises a light chain variable region comprising consecutive amino acids having the sequence as set forth in SEQ ID NOS: 1 , 18 or 19. In another embodiment, the HCV neutralizing antibody of the invention may comprise an N-terminal light chain variable region amino acid sequence as set forth in SEQ ID NOS:22-27. In another embodiment, the HCV neutralizing antibody of the invention comprises a heavy chain variable region comprising consecutive amino acids having the sequence as set forth in SEQ ID NOS:2, 15, 16, or 17. In another embodiment, the HCV neutralizing antibody of the invention may comprise an N-terminal heavy chain variable region amino acid sequence as set forth in SEQ ID NO:20 or SEQ ID NO:21.

[0256] In another embodiment, the present invention encompasses analogs of humanized or chimeric HCV neutralizing antibodies. In an embodiment, analogs of humanized or chimeric HCV neutralizing antibodies differ from the humanized or chimeric HCV neutralizing antibodies comprising the sequences described herein by conservative amino acid substitutions. For purposes of classifying amino acid substitutions as conservative or non-conservative, amino acids may be grouped as follows: Group I (hydrophobic side chains): Met, Ala, VaI, Leu and He; Group II (neutral hydrophilic side chains): Cys, Ser and Thr; Group III (acidic side chains): Asp and GIu; Group IV (basic side chains): Asn, GIn, His, Lys and Arg; Group V (residues influencing chain orientation): GIy, Pro; and Group VI (aromatic side chains): Trp, Tyr and Phe. Conservative substitutions involve substitutions between amino acids in the same class. Non-conservative substitutions constitute exchanging a member of one of these classes for a member of another.

[0257] In another embodiment, analogs of humanized or chimeric HCV neutralizing antibodies show substantial amino acid sequence identity with humanized PA-29 HCV neutralizing antibody. Heavy and light chain variable regions of analogs are encoded by nucleic acid sequences that hybridize with the nucleic acids encoding the heavy or light chain variable regions of humanized or chimeric PA-29, or degenerate forms thereof, under stringent or moderately stringent conditions.

[0258] Due to the degeneracy of the genetic code, a variety of nucleic acid sequences encode the humanized or chimeric anti-HCV envelope glycoprotein antibody of the present invention. In certain embodiments, the antibody is encoded by a nucleic acid molecule that is highly homologous to the described nucleic acid molecules. The homologous nucleic acid molecule comprises a nucleotide sequence that is at least about 90% identical to the nucleotide sequence provided herein. Additionally, the nucleotide sequence is at least about 95% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to the nucleotide sequence provided herein. The homology can be calculated using various, publicly available software tools well known to one of ordinary skill in the art. Exemplary tools include the BLAST system available from the website of the National Center for Biotechnology Information (NCBI) at the National Institutes of Health.

[0259] One method of identifying highly homologous nucleotide sequences is via nucleic acid hybridization. Accordingly, the invention also includes humanized anti- HCV envelope glycoprotein antibodies having binding properties and other functional properties described herein, which are encoded by nucleic acid molecules that hybridize under high stringency conditions to the described nucleic acid molecules. Identification of related sequences can also be achieved using polymerase chain reaction (PCR) and other amplification techniques suitable for cloning related nucleic acid sequences. Based on the described nucleic acid sequence information, PCR primers can be selected to amplify portions of a nucleic acid sequence of interest, such as a CDR. [0260] The term "high stringency conditions" as used herein refers to parameters with which a practitioner skilled in the art is familiar. Nucleic acid hybridization parameters may be found in references that compile such methods, e.g., Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. One nonlimiting example of high stringency conditions is hybridization at 65°C in hybridization buffer (3.5X SSC, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% Bovine Serum Albumin, 2.5mM NaH₂PO₄ (pH7), 0.5% SDS, 2mM EDTA). SSC is 0.15M sodium chloride/0.015M sodium citrate, pH7; SDS is sodium dodecyl sulfate; and EDTA is ethylenediaminetetracetic acid. After hybridization, a membrane upon which the nucleic acid is transferred is washed, for example, in 2X SSC at room temperature and then at 0.1-0.5X SSC/0.1X SDS at temperatures up to 68°C.

[0261] The nucleic acid sequences are expressed in hosts after the sequences have been operably linked to (i.e., positioned to ensure the functioning of) an expression control sequence. These expression vectors are typically replicable in the host organisms, either as episomes or as an integral part of the host chromosomal DNA.

Expression vectors typically contain selection markers, e.g., tetracycline or neomycin, to permit detection of those cells transformed with the desired DNA sequences (see, e.g., U.S. Patent No. 4,704,362 which is incorporated herein by reference).

[0262] E. coli is but one prokaryotic host useful for cloning the DNA sequences of the present invention. Other microbial hosts suitable for use include bacilli, such as Bacillus subtilus, and other enterobacteriaccae, such as Salmonella, Serratia, and various Pseudomonas species. In these prokaryotic hosts, one can also make expression vectors, which will typically contain expression control sequences compatible with the host cell (e.g., an origin of replication). In addition, any number of a variety of well-known promoters are suitable for use in the expression vector, such as the lactose promoter system, a tryptophan (trp) promoter system, abeta-lactamase promoter system, or a promoter system from phage lambda The promoters typically control expression, optionally with an operator sequence, and have ribosome binding site sequences and the like, for initiating and completing transcription and translation of nucleic acid contained in the vector.

[0263] Other microbes, such as yeast, may also be useful for expression. Saccharomyces is a preferred host, with suitable vectors having expression control sequences, such as promoters, including 3-phosphoglycerate kinase (3-PGK), or other glycolytic enzymes and an origin of replication, termination sequences and the like, as desired. [0264] In addition to microorganisms, mammalian tissue cell culture may also be used to express and produce the polypeptides of the present invention (see, Winnacker, "From Genes to Clones", VCH Publishers, New York, New York (1987)). Eukaryotic cells are actually preferred, because a number of suitable host cell lines capable of secreting intact immunoglobulins have been developed in the art, and include the CHO cell lines, various COS cell lines, HeLa cells, myeloma cell lines, etc., as well as transformed B cells or hybridomas. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer (Queen, et al., Immunol. Rev., 89, 49-68 (1986) which is incorporated herein by reference), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites and transcriptional terminator sequences. Suitable expression control sequences are promoters derived from immunoglobulin genes, SV40, Adenovirus, cytomegalovirus, Bovine Papilloma Virus (BPV), and the like.

[0265] The vectors containing the DNA segments of interest (e.g., immunoglobulin heavy and light chain encoding sequences, portions thereof and expression control sequences) can be transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, while calcium phosphate treatment or electroporation maybe used for other cellular hosts (see generally, Maniatis et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1982) which is incorporated herein by reference).

[0266] Once expressed, the whole antibodies, their dimers, individual light and heavy chains, or other immunoglobulin forms of the present invention, can be purified according to standard procedures in the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (see, generally, R. Scopes, "Protein Purification", Springer- Verlag, New York (1982)). Substantially pure immunoglobulins of at least about 90 to 95% homogeneity, or 98 to 99% or more homogeneity, are suitable for pharmaceutical uses. Once partially purified, or purified to homogeneity as desired, the polypeptides may then be used therapeutically (including extracorporeally) or in developing and performing assay procedures, irnmunofluorescent stainings and the like (see generally, Immunological Methods, VoIs. I and II, Lefkovits and Pernis, eds., Academic Press, New York, New York (1979 and 1981)).

[0267] For diagnostic or detection purposes, the antibodies may either be labeled or unlabeled. Unlabeled antibodies can be used in combination with other labeled antibodies (second antibodies) that are reactive with the humanized (or non-humanized) antibody, such as antibodies specific for human immunoglobulin constant τegions. Alternatively, the antibodies can be directly labeled. Numerous types of labels can be employed, such as radionuclides, fluors, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, ligands (particularly haptens), etc. A variety of types of immunoassays are available and are well known to those skilled in the art for detection of HCV in infected cells or for detection of HCV envelope glycoprotein modulation on cells capable of expressing the glycoprotein.

[0268] The present invention also provides antibody- or antibody fragment-polymer conjugates having an effective size or molecular weight that confers an increase in serum half-life, an increase in mean residence time in circulation (MRT) and/or a decrease in serum clearance rate over underivatized antibody or fragments thereof. The antibody- or antibody-fragment-polymer conjugates of the invention can be made by derivatizing the desired antibody or antibody fragment with an inert polymer. It will be appreciated that any inert polymer which provides the conjugate with the desired apparent size, or which has the selected actual molecular weight, is suitable for use in constructing the antibody or antibody fragment-polymer conjugates of the invention.

[0269] Many inert polymers are suitable for use in pharmaceuticals. See, e.g., Davis et al, Biomedical Polymers: Polymeric Materials and Pharmaceuticals for Biomedical Use, pp. 441-451 (1980). In all embodiments of the invention, a non-proteinaceous polymer is used. The non-proteinaceous polymer ordinarily is a hydrophilic synthetic polymer, i.e., a polymer not otherwise found in nature. However, polymers which exist in nature and are produced by recombinant or in vitro methods are also useful, as are polymers which are isolated from native sources. Hydrophilic polyvinyl polymers fall within the scope of this invention, e.g., polyvinylalcohol and polyvinvypyrrolidone. Particularly useful are polyalkylene ethers such as polyethylene glycol (PEG); polyoxyalklyenes such as polyoxyethylene, polyoxypropylene and block copolymers of polyoxyethylene andpolyoxypropylene (Pluronics); polymethacrylates; carbomers; branched or unbranched polysaccharides which comprise the saccharide monomers D- mannose, D- and L-galactose, fucose, fructose, D-xylose, L-arabinose, D-glucuronic acid, sialic acid, D-galacturonic acid, D-mannuronic acid (e.g., polymannuronic acid, or alginic acid), D-glucosamine, D-galactosamine, D-glucose and neuraminic acid including homopolysaccharides and heteropolysaccharides such as lactose, amylopectin, starch, hydroxyethyl starch, amylose, dextran sulfate, dextran, dextrins, glycogen, or the polysaccharide subunit of acid mucopolysaccharides, e.g., hyaluronic acid, polymers of sugar alcohols such as polysorbitol and polymannitol, heparin or heparan. The polymer prior to cross-linking need not, but can be, water soluble, but the final conjugate must be water soluble. The conjugate exhibits a water solubility of at least about 0.01 mg/ml, or at least about 0.1 mg/ml, or at least about 1 mg/ml. In addition the polymer should not be highly immunogenic in the conjugate form, nor should it possess viscosity that is incompatible with intravenous infusion or injection if the conjugate is intended to be administered by such routes .

[0270] In one embodiment, the polymer contains only a single group that is reactive. This helps to avoid cross-linking of protein molecules. However, it is within the scope of the invention to maximize reaction conditions to reduce cross-linking, or to purify the reaction products through gel filtration oτ ion-exchange chromatography to recover substantially homogeneous derivatives. In other embodiments, the polymer contains two or more reactive groups for the purpose of linking multiple antibody fragments to the polymer backbone. Again, gel filtration or ion-exchange chromatography can be used to recover the desired derivative in substantially homogeneous form.

[0271] The molecular weight of the polymer can range up to about 500,000 Daltons (D) and can be at least about 20,000 D, or at least about 30,000 D, or at least about 40,000 D. The molecular weight chosen can depend upon the effective size of the conjugate to be achieved, the nature (e.g., structure such as linear or branched) of the polymer and the degree of derivitization, i.e., the number of polymer molecules per antibody fragment, and the polymer attachment site or sites on the antibody fragment. [0272] The polymer can be covalently linked to the antibody fragment through a multifunctional crosslinking agent, which reacts with the polymer and one or more amino acid residues of the antibody fragment to be linked. However, it is also within the scope of the invention to directly crosslink the polymer by reacting a derivatized polymer with the antibody fragment, or vice versa.

[0273] The covalent crosslinking site on the antibody fragment includes the N- terminal amino group and epsilon amino groups found on lysine residues, as well other amino, imino, carboxyl, sulfhydryl, hydroxyl, or other hydrophilic groups. The polymer may be covalently bonded directly to the antibody fragment without the use of a multifunctional (ordinarily bifunctional) crosslinking agent, as described, for example, in U.S. Patent No. 6,458,355. [0274] The degree of substitution with such a polymer will vary depending upon the number of reactive sites on the antibody fragment, the molecular weight, hydrophilicity and other characteristics of the polymer, and the particular antibody fragment derivitization sites chosen. In general, the conjugate contains from 1 to about 10 polymer molecules, but greater numbers of polymer molecules attached to the antibody fragments of the invention are also contemplated. The desired amount of derivitization is easily achieved by using an experimental matrix in which the time, temperature and other reaction conditions are varied to change the degree of substitution, after which the level of polymer substitution of the conjugates is determined by size exclusion . chromatography or other means known and practiced in the art. [0275] Functionalized polyethylene glycol (PEG) polymers to modify the antibody fragments of the invention are available from Shearwater Polymers, Inc. (Huntsville, Ala.). Such commercially available PEG derivatives include, but are not limited to, amino-PEG, PEG amino acid esters, PEG-hydrazide, PEG-thiol, PEG-succinate, carboxymethylated PEG, PEG-propionic acid, PEG amino acids, PEG succinimidyl succinate, PEG succinimidyl propionate, succinimidyl ester of carboxymethylated PEG, succinimidyl carbonate of PEG, succinimidyl esters of amino acid PEGs, PEG- oxycarbonylimidazole, PEG-nitrophenyl carbonate, PEG tresylate, PEG-glycidyl ether, PEG-aldehyde, PEG-vinylsulfone, PEG-maleimide, PEG-orthopyridyl-disulfide, hetero functional PEGs, PEG vinyl derivatives, PEG silanes and PEG phospholides. The reaction conditions for coupling these PEG derivatives will vary depending on the protein, the desired degree of PEGylation and the PEG derivative utilized. Some factors involved in the choice of PEG derivatives include: the desired point of attachment (such as lysine or cysteine R-groups), hydrolytic stability and reactivity of the derivatives, stability, toxicity and antigenicity of the linkage, suitability for analysis, etc. Specific instructions for the use of any particular derivative are available from the manufacturer. The conjugates of this invention are separated from the unreacted starting materials by gel filtration or ion exchange HPLC.

[0276] This invention will be better understood from the Examples which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.

EXAMPLES EXAMPLE 1 Materials and methods

A. Cell lines and antibodies [0277] The human hepatoma derived cell line, Hep3b, and the human embryonic kidney cell line, 293T, were purchased from the American Type Culture Collection, ATCC, (Manassas, VA). Cell lines were maintained in DMEM with 10% fetal bovine serum (FBS) and ImM L-glutamine. Cell culture reagents were purchased from Invitrogen (Carlsbad, CA), unless otherwise noted. Murine anti-human CD81 antibody, JS-81, and murine IgGl₅K isotype control antibody were purchased from BD Biosciences (San Diego, CA). Murine anti-HCV E2 (HCM-091b-5); anti-HCV El (HCM-081-5); and recombinant CHO derived HCV E2 protein (HCA-090-2) were purchased from Austral Biosciences (San Ramon, CA). Non-neutralizing mAb 303F76 was generated by immunizing mice with lysates from 293T transfected with HCV E1E2 construct. B. HCV Pseudoparticle (HCVpp) Immunogen

[0278] HCV pseudovirus particles (HCVpp), which accurately reproduce the essential biology of HCV entry into cells susceptible to infection by HCV, (See, e.g., E.G. Cormier et al., 2004), were used to as immunogen to elicit anti-HCV antibodies. HCVpp serve as an authentic source of native, fusogenic forms of HCV envelope glycoproteins for use in generating monoclonal antibodies directed against HCV envelope determinants. HCVpp also provide a means by which to assess HCV entry into cells and to screen monoclonal antibodies for potency and neutralizing activity. The findings obtained using HCVpp have been substantiated using authentic HCV (Lindenbach, B. D. et al., 2005; Tscherne, D. M. et al., 2006; Wakita, T. et al., 2005; Zhong, J., 2005). [0279] HCVpp entry into liver cells requires co-expression both El and E2; neither individual protein is sufficient for entry. Similar to authentic HCV and related viruses, HCVpp fusion does not occur at the cell surface but rather requires endocytosis of virus into mildly acidic endosomes, where fusion is triggered by exposure to low pH (Hsu, M. et al., 2003; Lavillette, D. et al., 2005). In addition, HCVpp are specifically inhibited by monoclonal antibodies directed against E2, as well as by HCV patient sera (Bartosch, B. et al., 2003; Hsu, M. et al., 2003; Logvinoff, C. et al., 2004; Meunier, J. C. et al., 2005). Studies with HCVpp have identified the presence of naturally-occurring, broad and cross-genotype neutralizing antibodies in sera from HCV-infected individuals (Lavillette, D., 2005; Logvinoff, C. et al., 2004; Meunier, J. C. et al., 2005). [0280] HCVpp infect CD81 -positive primary hepatocytes and liver cell lines, and monoclonal antibodies directed against CD81 inhibit HCVpp infection (Bartosch, B. et al., 2003; Cormier, E. et al., 2004; Hsu, M., 2003; McKeating, J. A. et al., 2004; Zhang, J., 2004). CD81-negative human hepatoma cells are resistant to HCVpp entry, but such cells become permissive when modified to express CD81. In contrast, non-hepatic cells are resistant to infection regardless of CD81 expression. Thus, CD81 expression is necessary but not sufficient for HCVpp to enter target cells. It has been demonstrated that CD81 functions as a post-attachment co-receptor for HCV as shown by the potent inhibitory activity of CD81 monoclonal antibodies added to HCVpp that was pre-bound to target cells (Cormier, E. et al. , 2004). In addition, certain mutations in E2 abolish binding to CD81 but not to target cells (Roccasecca, R. et al., 2003).

[0281] A number of other receptors have been implicated in HCVpp entry, however, none explain the restricted tropism of HCV, and none impart permissivity to otherwise refractory cells. The human scavenger receptor class B type 1 (SR-Bl) was shown to bind E2 and to enhance HCVpp infection, particularly in the presence of high-density lipoproteins (Bartosch, B. et al., 2005; Voisset, C. et al., 2005), but not all cells that coexpress SR-Bl and CD81 are permissive to infection by HCV pseudoviruses (Bartosch, B. et al., 2003; Hsu, M. et al, 2003). From these and other studies, it appears that HCV entry requires a second liver-specific receptor that acts in concert with CD81. HCVpp provide a means to reliably produce fusogenic forms of the HCV envelope glycoproteins in a manner that addresses the sequence diversity of the virus. C. Production of HCVpp immunogen:

[0282] Functional HCVpp were produced via co-transfection of optimized HCV El E2 expression constructs and a non-replicating HIV-1-based reporter vector as described. (See, e.g., J. Dumonceaux et al., 2003; E. Cormier et al., 2004; T. Dragic et al., 1996; U.S. Patent Application No. 20050266400 to J. Dumonceaux et al., the contents of which are hereby incorporated by reference in their entirety). HCVpp were generated in 293T cells by transient co-expression of an HIV-1-based NLluc+env- vector (R. I. Conner et al., 1995) and a construct encoding HCV-ΔC-E1E2 (HCV isolate WIl, genotype Ia), which lacks splice acceptors (Cormier, E.G. et al., 2004). The backbone NLluc+env- HIV-I genome contains a frameshift mutation in the HIV-I envelope glycoprotein gene (env), which has potential to revert. In order to generate vectors that could not yield wild-type HIV-I particles, a 299bp deletion in env was introduced by excision of the Nhel/BsaBl fragment. (FIG. 1). This construct, designated NLluc+Δ299, encodes a packageable HCV genome that expresses all structural and non-structural proteins, except for the envelope glycoproteins, due to the 229 base pair deletion in env. NLluc+Δ299 encodes luciferase instead of HIV-I nef and generates HCVpp that are indistinguishable from those generated with NLluc+env-.

[0283] The finding of a cryptic intron excision site within HCV E 1 aided in the development of HCVpp for use in generating and screening HCV-specific and neutralizing monoclonal antibodies. This excision site is not utilized during natural infection by HCV because RNA splicing occurs in the nucleus and HCV replicates exclusively in the cytoplasm. However, in plasmid-based expression systems such as those used to generate HCVpp, RNA splicing results in the expression of aberrant, non- fusogenic forms of El along with native El . When the putative splice acceptors were removed from El E2 by conservative mutagenesis, plasmid expression generated single El and E2 protein species that formed noncovalent heterodimers on the cell surface. HCVpp produced using splice-modified El was observed to mediate 5-10- fold higher levels of entry into cells (Dumonceaux, J., 2003; U.S. Patent Application No. 20050266400 to Dumonceaux et al., published on Dec. 1 , 2005). Accordingly, the described HCVpp used herein involved El E2 from the HCV genotype Ia isolate H77, modified by conservative mutagenesis to eliminate cryptic splice sites in El, which resulted in a more uniform expression of El (Dumonceaux, J. et al., 2003; U.S. Patent Application No. 20050266400 to Dumonceaux et al., published on Dec. 1 , 2005).

[0284] For HCVpp production, 293T cells were co-transfected with NLluc+Δ299 env reporter vector and E1E2 expression vector (El E2 pcDNA 3.1) in a 1 :2 or 1 :3 ratio using lipofectamine (Lipofectamine 2000) in serum-free OPTIMEM medium (Gibco BRL; Invitrogen) as described. (See, E.G. Cormier et al., 2004). Typically, 5 x 10⁶ 293T cells were cotransfected with 4 μg of the NLluc+Δ299 reporter vector and 8 μg of the E1E2 expression vector in a 10 cm² dish (BD Falcon, Bedford, MA), (Id.). Four hours post- transfection, medium (Gibco BRL; Invitrogen) supplemented to contain 10% FBS was added to the transfected cells. Cell culture supernatants were collected at 48 hours post- transfection and centrifuged at 1000 rpm for 5 minutes to pellet cell debris. Viral HCVpp-containing supernatants were sterile filtered and stored at -8O⁰C. HCVpp supernatants were quantified for HIV-I p24 protein content by ELISA, for protein content by BCA assay (Pierce, Rockford, IL) or for E2 content by Western blot assay. In the latter assay, purified HCVpp were heat-denatured at 100⁰C for 5 minutes and subjected to SDS-polyacrylamide gel electrophoresis using known quantities of purified recombinant soluble E2 (rsE2, Austral Biologicals, San Ramon, CA) as standard. Proteins were transferred to nitrocellulose membranes, blocked, and then probed with anti-E2 monoclonal antibody (MAb) (MAb 303F76) followed by detection with alkaline- phosphatase-conjugated goat anti-mouse IgG. D. Immunogen preparation:

[0285] HCVpp were prepared using E 1 E2 from the infectious H77 genotype 1 a clone (Yanagi, M. et al., 1997) as described above. For preparation of HCVpp as immunogen, cell culture supernatants from transfected 293T cells grown in medium (Gibco BRL; Invitrogen) supplemented to contain 10% FBS were clarified by 0.2 μm filtration and mid-speed (15,00Og) centrifugation. Clarified supernatants were then centrifuged at 20,00Og for 2.5 hours through a 20% sucrose cushion (20% sucrose in phosphate buffered saline) using a Sorvall Discovery 90SE ultracentrifuge (Thermo Electron Corp., Asheville, NC) to pellet HCVpp. The HCVpp pellet was suspended in PBS without cations and stored at 4⁰C until needed. Concentrated viral pseudoparticles were characterized and quantified (i) for infectivity via a virus entry assay using Hep3B cells (see Screening section below), (ii) for HCV E2 content by Western blotting, Alliance HIV-I P24 ANTIGEN ELISA (Perkin Elmer), and (iii) for total protein by bicinchoninic acid BCA assay (Pierce). HCVpp were typically used within 5 days of preparation.

E. Immunization and Fusion:

[0286] Nine Balb/c mice received five intraperitoneal injections at intervals of at least 3 weeks with HCVpp containing 80- 150 μg of total protein, or approximately 5x10⁶ RLU, in PBS in the absence of adjuvant. Sera of the immunized mice were serially diluted and tested for inhibition of HCVpp and unrelated pseudoparticles of vesicular stomatitis virus (VSVpp) after the final injection as described below. One animal having a high HCVpp-specific neutralizing serum titer was boosted with 18 μg of total protein three days before sacrificing for fusion. Splenocytes of the finally-boosted mouse were isolated and fused with cells of the Sp2/0.904 myeloma cell line (ATCC, Manassas, VA) at a 5:1 ratio by a 1-minute exposure to pre-warmed 50% PEG 1500 in 75 mM HEPES buffer.

[0287] The fused cells (hybridomas) were suspended in selection medium (RPMI- 1640 medium supplemented to contain 10% FBS, 10% Condimed-Hl (Roche Applied Science, Indianapolis, IN), Pen-Strep, 24μM beta-mercaptoethanol, 1 μg/ml azaserine, 100 μM hypoxanthine and 16 μM thymidine) and plated into 96 well, flat-bottom tissue culture plates (BD Biosciences). The plates were incubated at 37⁰C for 3 days, followed by addition of 120 μL of HT growth medium (selection medium lacking azaserine). Incubation was continued for an additional 7 days prior to screening the hybridoma supernatants for neutralizing activity.

[0288] From this fusion, approximately 800 hybridoma supernatants were screened concurrently for inhibition of HCVpp and VSVpp at a 1 :5 dilution. Approximately 40 supernatants demonstrated >50% inhibition of HCVpp and <10% inhibition of VSVpp in the primary screen and were subjected to confirmatory testing. Hybridoma supernatants that yielded the most potent activity following screening were then cloned twice by limiting dilution. Ascites fluid was preparedby Harlan Bioproducts for Science, Inc. (Indianapolis, Ind.) from BALB/c mice that were injected with cloned hybridoma cells.

[0289] One screened hybridoma line demonstrated stable, high-level and specific inhibition of HCVpp, and the cells were twice cloned by limiting dilution. This hybridoma line was designated PA-29 and was scaled up to generate preparative amounts for testing in purified form. The PA-29 antibody was isotyped using IsoStrip Mouse Monoclonal Antibody Isotyping Kit (Roche Applied Science). Ascites fluid was prepared at Harlan Bioproducts for Science, Inc. (Indianapolis, IN.) by injecting BALB/c mice with the PA-29 hybridoma cell line. The PA-29 monoclonal antibody was purified to homogeneity by precipitation with ammonium sulfate followed by Protein A chromatography. PA-29 was resuspended in PBS. Biotinylated PA-29 was prepared by Harlan Bioproducts for Science, Inc. The concentration of the MAb was determined by UV absorbance at 280 nm, and it was tested over a broad range of dilutions against a panel of HCVpp. F. Screening: Neutralization of HCVpp

[0290] Hybridoma supernatants were tested for the ability to inhibit HCV pseudoparticle entry into a hepatic cell line. HCVpp were generated as described above. HCVpp-containing supernatants were stored at -80⁰C and then thawed at 25⁰C for thirty minutes prior to use in the neutralization assay. Equal volumes (40 μl) of HCVpp and Hep3b cells (ATCC), (8000 cells/well), were plated in solid white 96 well plates (Perkin Elmer) in DMEM/10%FCS. PA-29 hybridoma supernatant (20μl) or control samples (20 μl) were added to the HCVpp and Hep3b cells. After incubating plates at 37°C for 3 days, medium was removed from the wells and equal volumes of PBS and Bright-Glo (Promega, Madison WI) (50 μl) were added. Luciferase activity (Relative Light Units, R.L.U.) was measured by a luminescence plate reader (Victor2, Perkin Elmer). Percent neutralization of entry was calculated from the R.L.U. values using the following formula: [(cells infected with virus without sample - cells infected with virus with sample) / (cells infected with virus without sample - cells incubated without virus and sample)] x 100. Neutralization curves and IC50 calculations were performed by non- linear regression in GraphPad PRISM software.

Formulas used for Data Analysis: 1. Maximum RLU = average RLU values from wells with HC Vpp and cells (no sample)

2. Minimum RLU = average RLU values from wells with cells only (no HCVpp or sample) 3. % Inhibition of entry = (Max RLU) - (RLU for specific well) *100

(Max RLU) - (Min RLU)

[0291] Purified PA-29 monoclonal antibody exhibited a broad and potent inhibition of HCVpp. As indicated in FIG. 2, similar IC50 values of -0.05 μg/mL were observed against the H77 genotype Ia HCVpp used for immunization, as well as against a genotype Ib HCVpp (clone F7). IC90 values were 0.3 μg/mL, and essentially complete neutralization was obtained as well. PA-29 monoclonal antibody showed no activity (IC50 > 100 μg/mL) against VS Vpp and showed no binding to a panel of liver and non- liver cell lines, consistent with its specificity for HCV envelope. The results of the neutralization analysis indicate that the PA-29 monoclonal antibody is significantly more potent than previously described monoclonal antibodies. (See Example 2).

G. VS Vpp counterscreen:

[0292] Hybridoma supernatants were screened in parallel for inhibition of HCVpp and VSVpp in order to eliminate from further consideration samples with non-specific activity. The VSV G protein has long been used to pseudotype retroviral particles. (Emi, N. et al., 1991). VSVpp used in screening hybridomas for specificity are well suited for this purposes because (1) VSV G is unrelated to HCV E1E2, (2) VSVpp possess a broad cellular tropism and efficiently infect Hep3B cells, and (3) VSVpp stocks can be produced at high titer and cryopreserved for later use in screening.

[0293] Hybridoma supernatant containing PA-29 was screened for inhibition of HCVpp and VSVpp to ensure specificity. Hybridoma cells producing the PA-29 monoclonal antibody (mAb) were prepared as ascites in order to obtain amounts suitable for purification. The PA-29 mAb was purified to >95% homogeneity by precipitation with ammonium sulfate followed by protein A chromatography. PA-29 was dialyzed against phosphate-buffered saline (PBS) and sterilized by 0.2 μM filtration PA-29 concentration was determined by UV absorbance at 280 nm. Results from this screening analysis revealed that PA-29 showed no activity (IC50 > 100 μg/ml) against unrelated VSVpp and showed no binding to a panel of liver and non-liver cell lines, thus indicating specificity of the PA-29 monoclonal antibody for HCV envelope glycoproteins.

H. Replication of authentic HCV in cell culture (HCVcc)

[0294] Early in vitro studies of HCV typically utilized patient sera to infect primary hepatocytes or hepatoma cell lines, which commonly resulted in low level and poorly reproducible viral replication More recently, the in vitro replication of an HCV clone, JFHl, derived from a patient with fulminant hepatitis was reported (Lindenbach, B. D., 2005; Wakita, T. et al., 2005; Zhong, J. et al., 2005). The subgenomic (replicon) clone of this genotype 2a isolate replicates efficiently in cell culture in the absence of adaptive mutations typically associated with HCV replicon sequences (Krieger, N. et al., 2001). Full-length clones containing either the complete JFHl consensus sequence or JFHl nonstructural proteins in association with the core-through-NS2 regions of the genotype 2a clone, J6, demonstrated robust replication in Huh-7-derived cell lines.

[0295] Cells transfected with the cloned viral genome secreted HCV particles that were infectious in vitro and in chimpanzees (Lindenbach, B. D. et al., 2006; Wakita, M. et al., 2005). These transfected cells harboring and secreting infectious HCV particles allow for authentic HCV particle replication and production in cell culture and are termed HCVcc. HCVcc could be inhibited with INF-α and by small-molecule inhibitors of the HCV serine protease NS3. HCVcc could be propagated in vitro, particularly on Huh-7 sublines that had been transfected with and then cured of HCV replicons. High- level production of HCVcc also has been obtained in Huh-7 cells that contain a stably integrated full-length HCV genome under transcriptional control of a minimal cytomegalovirus promoter (Cai, Z. et al., 2005).

[0296] HCVcc enabled study of entry by authentic HCV in vitro. The findings using HCVcc correlated highly with those obtained using HCVpp. Like HCVpp, HCVcc entry is pH dependent and restricted to CD81 -positive liver cells. CD81 -negative HepG2 cells become permissive to HCVcc infection when modified to express CD81. HCVcc infection is inhibited by monoclonal antibodies (MAbs) to CD81 and to recombinant forms of the large extracellular loop of CD81. HCVcc infection is inhibited by sera from HCV-infected individuals but not by normal human sera, and infection is inhibited by MAbs to El and E2. The findings corroborate those obtained using HCVpp and support the view that HCVpp accurately recapitulate the essential biology of HCV entry (Table 2). Table 2

Biological features of HCV entry as determined using HCV pseudovirus particles (HCVpp) and authentic HCV that replicates in cell culture (HCVcc).

HCVpp HCVcc

Form of HC V envelope Unmodified El E2 Unmodified E1E210

Cell tropism Liver cell lines Liver cell lines

CD81 expression Required for entry Required for entry

Exposure to low pH Required for entry Required for entry

CD81 MAbs Inhibit entry Inhibit entry

El and E2 MAbs Inhibit entry Inhibit entry

HCV+ sera Inhibit entry Inhibit entry

Normal human serum Does not inhibit entry Does not inhibit entijy_;

EXAMPLE 2

Inhibition of HCVpp by the PA-29 monoclonal antibody

|0297] The PA-29 monoclonal antibody was tested for its ability to inhibit infection of susceptible cells by various genotypes of HCV in a virus neutralization assay employing HCVpp as described. The assay involved a panel HCVpp representing genotypes 1 a, Ib, 2a and 2b. The anti-CD81 JS-81 monoclonal antibody (BD Biosciences, San Jose, CA) was used as a reference standard and was tested in parallel with PA-29 for inhibition of HCVpp (virus) entry into cells. As a reference standard, JS-81 acts at the same stage of virus replication as antibodies such as PA-29 tested in the assay. [0298] Purified PA-29 was serially diluted and added to Hep3B cells immediately prior to the addition of HCVpp derived from different genotype isolates, e.g., genotype 1 a (HCV strain H77) or genotype Ib (HCV strain F7), as described in Example 1. Plates were incubated for 48 hours prior to measurement of luciferase activity. IC50 values were calculated by fitting the data to a 4-parameter logistic equation in GraphPad Prism (GraphPad Software, Inc., San Diego, CA). As indicated in Table 3, PA-29 broadly and potently inhibited diverse genotypes of HCV. FIG. 2 demonstrates that the PA-29 neutralizing monoclonal antibody broadly and potently inhibited HCVpp of HCV genotypes Ia and Ib. As indicated in FIG. 2, PA-29 exhibited similar IC50 values of approximately 0.05 μg/ml against the H77 genotype Ia HCVpp used for immunization, as well as against a genotype Ib HCVpp clone F7 generated at Progenies. IC90 values were 0.3 μg/ml and essentially complete neutralization was also obtained. Table 3 shows that the PA-29 monoclonal antibody exhibited consistent neutralizing activity against all of the virus genotype isolates (Ia, Ib, 2b, la/2b, 2a/2c) with a median IC50 value of 0.047 μg/ml (range 0.015-0.075 μg/ml). The nomenclature of the human HCV genotype isolates in Table 3 include genotype (e.g., Ia, Ib, la/2b, 2a, etc.) and initials of the human individual source (e.g., MA, RR, MZ, JS, etc.). The letter/number designations following the initials indicate different quasi-species isolated from the source individuals.

Table 3

[0299] In another set of experiments, the neutralizing activities of the murine PA-29 monoclonal antibody and two humanized PA-29 antibodies (a huPA-29 antibody comprising VH#1/VL#2 H and L chain variable regions and a huPA-29 antibody comprising VH#2/VL#2 H and L chain variable regions), (FIGS. 19 and 20), were assessed. The anti-CD81 MAb JS-81 was included as a control. Table 4 presents the median IC50 neutralization values in μg/mL for this experiment. As shown in Table 4, the results of the experiment indicate that the humanized PA-29 antibodies exhibit neutralization activities similar to the activity of the parent murine PA-29 monoclonal antibody for the several HCV genotype isolates tested.

Table 4

EXAMPLE 3

Pharmacokinetic analysis using PA-29 [0300] Pharmacokinetic analysis was performed using the PA-29 neutralizing monoclonal antibody. To perform this analysis, SCID mice, ICR strain, (Charles River Labs) were injected intraperitoneally with 0.25 mg or 1 mg of purified monoclonal antibody. Within each cohort, three animals were injected with one of three monoclonal antibodies: IgGl (isotype control), JS-81, or PA-29. The monoclonal antibody concentration in animals' sera was determined via sandwich ELISA. Ninety-six well ELISA plates (Falcon) were coated overnight with goat anti-mouse IgGl (Caltag) at 4⁰C. Plates were washed three times with PBS/0.05% Tween-20 (PBST) and were blocked with 1 % casein in PBST for two hours at room temperature. The appropriate antibody reference standard was diluted in 0.1 % pooled mouse serum for preparation of a standard curve with a range of 400-6.25 ng/ml. Diluted test samples and standards were incubated for one hour at room temperature. Plates were washed (as above), and incubated for one houτ at room temperature with HRP-conjugated goat anti-mouse IgGl , Fc specific (Caltag) diluted in PBST. Plates were developed with ABTS substrate (KPL) for 30 minutes at room temperature, stopped with ABTS Peroxidase Stop Solution (KPL), and read on a Spectramax plate reader at 405 nm. Non-linear regression analysis was performed using GraphPad PRISM. Noncompartmental pharmacokinetic analysis was performed using WinNonLin, Version 4.0 (Pharsight Corp., Mountain View, CA). [0301] As indicated in FIGS. 4A-C and in Table 5 below, each of the antibodies demonstrated prolonged serum half-lives of approximately 2 weeks in the test animals. Table 5 presents the pharmacokinetic metrics for the PA-29 monoclonal antibody, and the JS-81 and mouse IgGl (mulgGl) isotype-control antibodies following a single 0.25 mg or 1.0 mg IP injection into SCID mice. AUC is the area under the concentration-time curve. Half-life is the terminal serum half-life (in days).

Table 5

EXAMPLE 4

Testing of neutralizing monoclonal antibodies against HCVcc [0302] Neutralizing monoclonal antibodies, e.g., PA-29, were tested for inhibition of authentic HCV replication in cell culture using the HCVcc as described in Example 1. Briefly, infectious HCVcc RNA was transcribed in vitro, purified, and electroporated into hepatoma cells according to published methods (Lindenbach, B. D. et al, 2005; Wakita, T. et al., 2005; Zhong, J. et al., 2005). Transfected cells were cultured at 37°C for 48-72 hours. Infectious HCVcc were secreted into the supernatant at titers exceeding 10⁴ tissue culture infectious doses per mL. The supernatants were clarified and stored at -7O⁰C prior to use in infecting fresh hepatoma cells.

[0303] Two HCVcc constructs provided different ways to quantify replication. The first HCVcc construct encodes an unmodified HCV genome, and replication is quantified by ELISA for NS3, NS5A, or core proteins using commercially available reagents (Lindenbach, B. D. et al., 2005; Wakita, T. et al., 2005; Zhong, J. et al., 2005). The second HCVcc construct encodes luciferase fused to the first 19 residues of the HCV core protein (Tscherne, D. M. et al., 2006). To allow removal of luciferase from the HCV polyprotein, a portion of the self-cleaving foot-and-mouth disease virus 2A and ubiquitin monomer were fused to the carboxy terminus of luciferase. This system uses luciferase activity as a readout and was reported to yield replication-dependent RLU values of 10⁶ with an approximately 500-fold signal-to-noise ratio following a 48 hour incubation (Tscherne, D. M. et al., 2006). Both the unmodified and luciferase-encoding constructs were suitable for testing the inhibitory activity of PA-29 against HCVcc.

[0304] For inhibition studies, cells were plated at 5,000 cells/well in 96-well plates and then combined with serially diluted neutralizing monoclonal antibody, including PA- 29. HCVcc were added and the cultures were maintained for 48-72 hours. Cultures were then analyzed for the level of HCVcc replication by ELISA as described above or by luciferase activity. IC50 and IC90 values were determined. The anti-CD81 JS-81 monoclonal antibody and IFN-α were used as reference inhibitors (Lindenbach, B. D. et al., 2005; Wakita, T. et al., 2005; Zhong, J. et al., 2005).

EXAMPLE 5

Method for cloning fusogenic HCV E1E2 genes from patient sera [0305] To produce broadly active antiviral therapies, e.g., monoclonal antibodies, against diverse genotypes of HCV, a high-throughput method was developed and employed to isolate large numbers of HCV E1E2 sequences from HCV-positive sera and test their fusogenicity in vitro. The method addresses the heterogeneity of the HCV E1E2 envelope glycoprotein and solves the problem of this heterogeneity as it pertains to the development of active inhibitory agents, such as monoclonal antibodies, that are able to broadly neutralize diverse types of HCV. Such a method was utilized to develop the ElE2-expressing HCVpp for generating and screening for the PA-29 monoclonal antibody in accordance with the present invention.

[0306] More specifically, an estimated 10¹² virions are produced daily in an individual with chronic HCV (Neumann, A. U. et al., 1998). The error-prone nature of HCV polymerase and selective immune pressure give rise to genetic variants such that each infected individual harbors a unique and diverse set of HCV variants or quasi-species. The method described herein is robust and is capable of cloning multiple infectious El E2 variants from a given HCV-positive serum. The method allowed novel quasi-species for genotype 1 a and Ib viruses to be successfully obtained. In addition, the methods can be easily adapted to other viral genotypes.

[0307] The strategy employed for El E2 cloning according to the method described herein is characterized by being high-throughput and miniaturized relative to previously described procedures, e.g., Lavillette, D. et al., 2005; McKeating, J. A., 2004. In the method according to the present invention, HCV El E2 envelope glycoprotein gene sequences representing amino acids 170 to 746 from different HCV genotypes were amplified by nested RT-PCR essentially as described (Lavillette, D. et al., 2005). Briefly, viral RNA was isolated from 150 μL of HCV-positive patient serum using the QIAamp Viral RNA mini kit (Qiagen). Viral RNA was then reverse transcribed using the Superscript™ III First-Strand Synthesis System (Invitrogen). The resulting DNA served as template for a first round of amplification with genotype-specific outer primers followed by a second round of amplification with genotype-specific inner primers as indicated in Table 6. Both rounds of amplification were performed with the High Fidelity Platinum Pfx DNA polymerase (Invitrogen). Table 6

Table 6: Nested PCR primers for amplification of HCV envelopes: The forward inner primer contains a 5' CACC sequence to facilitate directional cloning. M = A/C mixture; S = G/C mixture; Y = C/T mixture. [0308] A final 1.7 kb PCR product corresponding to amino acids 170 to 746 of HCV E1/E2 was detected pm a 1 % agarose gel. The 1.7 kb PCR product was gel purified using the QIAquick gel extraction kit (Qiagen) and ligated into the pcDNA3.1-TOPO expression vector (Invitrogen) using the Rapid DNA Ligation kit (Roche) after restriction enzyme digestion and topo-cloning. The ligated DNA was then transformed into competent One Shot Top 10 cells (Invitrogen). Individual bacterial clones were grown overnight in 96-deep-well plates in LB-ampicillin medium. Plasmid DNA was extracted using the QIAprep 96 Turbo Miniprep kit (Qiagen), quantified by UV absorbance and verified for size on an agarose gel. The production of HCVpp was carried out in a 96-well format, in which 200 μl of cleared supernatant containing HIV particles pseudotyped with E1/E2 from 95 independent clones of genotypes Ia, Ib, or 2b was incubated with Huh-7 target cells (5,000 cells/well) overnight, washed and then placed in fresh medium for another 36 hours. Cells were lysed 48 hours post-infection and luciferase activity (RLU) was measured in cell lysates with the Brite-Glo Luciferase Assay System (Promega). HCVpp were considered infectious when luciferase activity was above the 10⁴ RLU cutoff. E1/E2 from the infectious Ia H77 isolate was used as a positive control.

[0309] For both genotypes 1 a and Ib, fiisogenic El E2 clones were successfully isolated from several sera, and multiple quasi-species were identified within each serum. Typically, 5-10% of all E1E2 clones generated were fusogenic when expressed on HCVpp. Quasi-species were verified to be unique by sequencing and typically differed from one another at 5-10 residues within the 130-amino-acid HVRl region of E2. The cellular tropism of genotype 1 a and Ib quasi-species was examined on a panel of cell lines. Representative data for three quasi-species for each of the two genotypes are presented in FIG. 3. The cells included CD81 -positive liver cells (Huh-7 and Hep3b), CD81-negative liver cells (HepG2), and CD81-positive B and T cells (Daudi and MOLT-4). Each of the novel HCVpp was infectious for Hep3B and Huh-7 cells but not for the other cell lines tested, thereby paralleling the tropism results observed for the H77 genotype Ia sequence (Bartosch, B. et al., 2003; E.G. Cormier et al., 2004; Hsu, M. et al. , 2003). In addition, the novel HCVpp were efficiently inhibited by the anti-CD81 monoclonal antibody JS-81 , confirming their CD81 dependence as observed for H77 and other isolates.

EXAMPLE 6

Characterization of PA-29 Monoclonal Antibody Binding [0310] The experiments in this Example were performed to determine the binding characteristics of the PA-29 monoclonal antibody. The results showed that PA-29 recognizes neither recombinantly produced El or E2 expressed individually nor sE2.

A. Lectin E2 ELISA:

[0311] ELISA plates (Nunc, Rochester, NY) were coated with lμg/well oϊGalanthus nivalis lectin (Sigma, St. Louis, MO) overnight at 4°C. After washing plates with PBS-T (PBS without Calcium and Magnesium, 0.05% Tween 20), wells were blocked with 1 OOμl of Superblock (Pierce) for 10 minutes at room temperature. The wash step was repeated and 10 ng of soluble HCV E2 (sE2, Austral Biologies, San Ramon, CA) was added to each well in PBS-T for two hours at room temperature. Plates were washed and antibody was added in PBS-T at concentrations of 200-0.27 ng/ml for 2 hours at room temperature. Plates were washed and incubated for one hour at room temperature with goat anti-mouse IgG, ALP conjugated (Caltag) diluted in PBS-T. Plates were developed with pNPP-DEA substrate (Pierce) for 20 minutes at room temperature, stopped with 10OmM EDTA, and read on a Victor plate reader (Perkin Elmer) at 405nm. Background absorbance at 650nm was subtracted. As shown in FIG. 5, sE2 was bound by 303F76 and PA-25, two monoclonal antibodies having specificity for HCV E2 envelope glycoprotein in the ELISA, while the PA-29 monoclonal antibody did not demonstrate specific binding to sE2.

B. Surface plasmon resonance (SPR) binding assay:

[0312] Using a BIAcore-3000 (BIAcore, Piscataway, NJ), sE2 was immobilized to the dextran matrix of a CM5 sensor chip (BIAcore) according to the manufacturer's instructions, and a control flow cell was prepared by immobilizing purified HIV-I gpl 20. Purified mAbs were injected over the chips. The PA-29 monoclonal antibody (previously designated 6F12) showed no binding to sE2 or HIV-I gpl20 when injected at 4μg/ml and 8μg/ml (FIGS. 6A and 6B). Control mAb that binds gpl20 (designated 2Gl 2) demonstrated capture levels between 0 to 25 resonance units (RU) on the gpl 20 chip, but did not bind to the sE2 chip (FIG. 7A). An anti-E2 mAb (PA-25) bound specifically to the sE2 surface, but not Io the gpl 20 surface (FIG. 7B).

C. Flow Cytometry:

[0313] 293T, Hep3b, HepG2, Daudi, and Molt-4 (American Type Culture Collection, Manassas, VA) cells were harvested and washed twice with PBS/0.1 % azide. 5x10⁵ cells were incubated with lμg of mAb (mouse IgGl isotype control, JS-81 or PA-29) for 60 minutes at 4°C. After washing the cells with PBS/0.1 % azide, goat anti-mouse IgG conjugated to PE (Caltag) was added to the cells for 30 minutes at 4°C. Cells were washed, resuspended in PBS/0.1 % azide and analyzed by flow cytometry using a FACS Calibur instrument (BD Biosciences). JS-81 , an anti-CD81 monoclonal antibody, demonstrated specific binding to all cell lines except HepG2, which do not express CD81. PA-29 showed binding comparable to the background binding observed for the isotype control antibody on all cell lines as shown in Table 7.

Table 7

Table 7: Cell lines were tested for PA-29 or JS-81 binding via flow cytometry. After incubating with mAb and goat anti-mouse IgG conjugated to PE, cells were analyzed via FACS Calibur (BD Biosciences). Values represent Mean Fluorescence Intensity (MFI). EXAMPLE 7

A. PA-29 inhibits HCV infection of HCV susceptible cells

[0314J Experiments were conducted to assess the mechanism of action of the PA-29 monoclonal antibody. The time course of inhibition was measured according to published methods (Bertaux, C. and T. Dragic, 2006). Briefly, 2x10⁴ Hep3b cells were plated into 96 well assay plates and incubated at 37⁰C overnight. After removing culture medium, cold HCVpp were added and bound to the cells via centrifugation at 1000 rpm for one hour at 4°C. Plates were incubated for an additional hour at 4⁰C before washing the cells with cold PBS. MAbs (JS-81 , PA-29, or isotype control) were diluted to 1 μg/ml in medium warmed to 37⁰C and added to the cells at time points ranging from 0 to 2 hours. After mAb addition, cells were warmed to 37⁰C. After final mAb addition, plates were incubated at 37°C for 72 hours and luciferase activity measured. FIG. 8 illustrates the extent of inhibition observed as a function of time for the PA-29 monoclonal antibody and the control JS-81 monoclonal antibody. B. Sucrose cushion experiments

[03151 HCVpp were concentrated via centrifugation at 25,000 rpm for 2.5 hours over 20% sucrose in PBS, resuspended in PBS, and incubated with lOμg/ml of mAb (PA-29or PA-25) for 2 hours at 37⁰C. The HCVpp.mAb mixture was then centrifuged over a 20% sucrose cushion as above. HCVpp were resuspended in PBS and examined for infectivity of Hep3b cells as described above. FIG. 6 demonstrates that HCVpp were not neutralized by PA-29 under these conditions; however, HCVpp were neutralized by anti- E2 mAb PA-25. The results of this Example indicate that PA-29 may bind HCV via a conformational epitope that is exposed after HCV attaches to susceptible target cells.

EXAMPLE 8 [0316] Flow cytometry of binding to transiently expressed HCV envelope glycoproteins El, E2 and El E2. 293T cells were transiently transfected with 10 μg pcDNA3.1 expression vector (See Example 5) encoding E 1 , E2 or E 1 E2. Cells were then tested for reactivity with PA-29 monoclonal antibody and anti-E2 monoclonal antibody HCA-091b-5 (Austral Biologies) via flow cytometry. After incubating with the monoclonal antibodies and PE-conjugated goat anti-mouse IgG, cells were analyzed via FACS Calibur (BD Biosciences). Values represent Mean Fluorescence Intensity (MFI). The data obtained for El E2 are indicated in Table 8. As observed from this analysis, the PA-29 monoclonal antibody did not demonstrate measurable binding to El E2 transiently expressed on 293T cells under these conditions.

Table 8

Table 8: 293T cells were transiently transfected with pcDNA3.1 expression vector encoding El E2 and tested for monoclonal antibody (mAb) reactivity with 1 μg PA-29 and anti-E2 mAb HCA-091b-5 (Austral Biologies) via flow cytometry. After incubating with mAb and PE-conjugated goat anti-mouse IgG, cells were analyzed via FACS Calibur (BD Biosciences). Values represent Mean Fluorescence Intensity (MFI). Data were obtained using E1E2 derived from different patients. The HCV genotype is indicated as 1 a, Ib, 2a, or 2b. The MFI for mouse IgGl isotype-control antibody binding to cells transfected with Ia EG-D08 was 3.7.

EXAMPLE 9 [0317] Western blotting with soluble HCV E2 envelope glycoprotein (sE2). sE2

(25 ng, Austral Biologicals) is reduced with DTT in LDS sample buffer (Invitrogen) and separated via 4-12% Bis-Tris Novex gels (Invitrogen) with MES buffer (Invitrogen). After blotting onto nitrocellulose (Invitrogen), membranes are probed with anti-E2 antibodies and goat anti-mouse IgG, HRP conjugated (Jackson Labs, West Grove, PA). Proteins are detected with Western Lightning Chemihiminescence Reagent Plus (Perkin Elmer) and film (Kodak). EXAMPLE 10 HCV therapy and prophylaxis using an in vivo animal model

[0318) The HCV neutralizing monoclonal antibodies according to the present invention, e.g., the PA-29 monoclonal antibody, are employed as a therapeutic for treating animals as demonstrated via a mouse model of in vivo HCV infection and treatment. In this Example, the in vivo model of HCV infection uses SCID mice carrying a plasminogen activator transgene under control of the albumin promoter (Alb-uPA), (Kneteman, N.M. et al., 2003; Mercer, D. F. et al., 2001 ; Kneteman, N.M. et al., 2005; Meuleman, P. et al., 2005). SCID mice are homozygous for a mutation that impairs the recombination of gene segments (V, D and J) that code for the variable (antigen-binding) regions of antigen receptors (Ig molecules) in lymphocytes. Such mice lack mature, functional lymphocytes from both the T and B cell lineages. The transgene directs overproduction of urokinase in the liver resulting in accelerated death of hepatocytes. Engraftment of human liver cells into these mice rescues the animals from liver failure. The integrity of human liver tissue grafts is monitored by assessing human alpha-1 antitrypsin (hAAT). The human liver graft can be infected with HCV in vivo. SCID/ Alb-uPA mice engrafted with human liver tissue are infected by inoculation of HCV positive human serum. Following the establishment of infection, viral load in the animals ranges from 10⁴-10⁷ RNA copies/ml (based on Amplicor test, Roche) and infection can be maintained in these animals for up to 4 months. In this system, the animals are treated with a candidate molecule (e.g., an HCV inhibitor, such as an anti- HCV monoclonal antibody) before and/or after exposure to HCV in order to examine the prophylactic and therapeutic effectiveness of the inhibitor.

[0319] In a treatment study according to this invention, the liver engrafted SCID animals are infected with HCV-posilive human serum and then plasma HCV viral load is determined. Animals with viral loads of 10⁴-10⁷ RNA copies/ml are randomized by HCV RNA and treated intraperitoneally in groups of 3-6 with the PA-29 monoclonal antibody, with an isotype-matched control monoclonal antibody (JS-81), or with vehicle (PBS) weekly for 4 weeks. Typical dose levels are 0.25 mg and 1.0 mg per dose. Blood samples are collected from the mice prior to administration of test antibody, control antibody, or vehicle and then weekly (w) thereafter, (i.e., -Iw, Ow, Iw, 2w, 3w, 4w, 5w, 6w, 7w, 8w) and are analyzed for the presence and/or levels of HCV viral RNA and hAAT.

(0320| Viral load (VL) data are analyzed for individual mice. Changes in VL are assessed by the logl 0 change in HCV RNA from baseline, as a function of time post- treatment and of the number of animals that achieve undetectable levels of HCV RNA. Cohort means and medians are determined and compared using parametric (e.g., t-tests) and non-parametric (e.g., rank-sum) methods.

EXAMPLE It

Molecular cloning of the heavy and light immunoglobulin chains of the PA-29 antibody.

[0321] mRNA isolation: Ten ml of PA29 hybridoma cell culture supernatant (IxIO⁷ cells) was used as the starting material for RNA isolation. The total RNA isolation kit from Promega (Cat #Z511) was used to obtain the total cellular RNA according to the manufacturer's instructions. Subsequently, pure mRNA was isolated from total RNA using the mRNA isolation system III (Promega Cat # Z5200) according to the manufacturer's instructions.

[0322] First strand cDNA synthesis: The mRNA obtained as described above served as the general template to initiate first strand cDNA synthesis. However, instead of initiating the reaction with oligo-dT at the 3 'end, gene specific light or heavy chain constant region primers (IgGl reverse primer: 5' gggtcaccatggagttagtttgg 3' (SEQ ID NO:38) and light chain (λ) reverse primer: 5' gagctcctcaggggaaggtggaaa 3' (SEQ ID NO:39) were used to initiate the reaction (Post Script First Strand cDNA Synthesis Kit (New England Biolabs Cat # E65005) according to the manufacturer's instructions.

[0323] PCR amplification: The heavy and light chain specific genes present in the cDNA library were further amplified using a standard PCR reaction. Once again, the light and heavy chain-specific constant region primers (see above) were used as reverse primers in the PCR reaction while generic nested primers (i.e., a mixture of 10 bp oligonucleotides in all possible combinations, NEB) served as forward primer.

[0324] Clonine of heavy and light chain variable regions into plasmids: The PCR- enriched DNA was purified using QIAquick PCR purification kit (Cat # 28104 Qiagen) and directly cloned into an E. coll plasmid (pGEM-1 , Promega). Several individual E. coli clones were screened by mini-lysate analysis and clones with cDNA insert sizes of >400 bp were selected. DNA was obtained from the selected clones (MWG Biotech).

[0325] Assigning CDR and framework regions to the antibody genes: DNA sequence analysis was performed using Vector NTI soft ware (Invitrogen). Clones having DNA sequence that fit the Kabat assignment rules for light and heavy chain immunoglobulin genes were selected and delineated the CDR and framework motifs.

[0326] N-terminal sequence analysis was performed on the rm PA-29 light and heavy chain polypeptides. For this analysis, approximately 10 μg of rm PA-29 antibody was subjected to reducing conditions to separate the heavy and light chain immunoglobulin polypeptides using a loading buffer containing β-mercaptoethanol. The samples were then run on SDS-PAGE, stained with Coomassie Blue and transferred to a PVDF membrane. The area of the membrane containing the light and heavy chain immunoglobulin polypeptides were subjected to N-terminal sequence analysis (at least 5 cycles). The heavy chain polypeptide yielded an N-terminal sequence that coincided with an expected Kabat prediction (FIG. 18A). The light chain amino terminus yielded alternative sequence information (e.g., SEQ ID NOS:23-27) due to several predicted cleavages (FlG. 18B).

EXAMPLE 12 [0327] Generation of cloned, stable CHO cell lines expressing recombinant murine PA-29 antibody. CHO Kl SV cells (Lonza Biologies, Berkshire, UK) were used at passage #6. These cells were expanded in CD CHO cell culture medium (Invitrogen cat# 10743-029, Carlsbad, CA) supplemented with IX glutamine (Invitrogen cat# 25030-0814) and IX H/T Supplement (Invitrogen cat # 11067-030). 250 ml of the cell culture was shaken at 125 rpm in a 1000 ml Erlenmeyer flask (Corning cat # 431143) in an incubated in humidified atmosphere (8.0% CO₂) until the cell density reached approximately 3-4 x 10⁶ cells/ml at >95 % viability. Cell density and viability were determined using the ViCELL cell counter. A volume of culture corresponding tolO⁷ viable cells was centrifuged at 1000 rpm for 5 minutes. The cell pellet was resuspended in 700 μl of CD CHO medium (without additives) and transferred to a 4 mm electroporation cuvette (BioRad cat # 1652660). [0328] 40 μg of linearized plasmid DNA were resuspended in 100 μl of sterile TE buffer. The DNA was added to the cells in the cuvette and incubated on ice for approximately 5 minutes. The cells were electroporated at 290 V, infinite resistance, and 960 uF. The resulting time constant was approximately 25 msec. The cells were again placed in ice and incubated for approximately 5 minutes. The cells were then transferred to a T-150 flask containing 50 ml of complete CD CHO medium and incubated for approximately 48 hours at 37⁰C and 8.0% CO₂. The cells were then centrifuged again and resuspended to a final density of 3.3 x 10⁵ cells/ml in GS selection medium (CD CHO + IX GS Supplement (JRH Biosciences cat # 58672) + IX H/T Supplement) containing MSX (Sigma cat #M5379) at 100 μM. The cells were then plated out at 5000 viable cells /well in 96 well plates (Corning cat # 2004) and incubated for approximately 3-4 weeks until primary colonies (clones) began to appear.

[0329 J Approximately 24 of the largest cell colonies (clones) were sampled for recombinant antibody production by carefully removing 25 μl of supernatant and . performing a Dot Blot assay to screen for recombinant antibody produced by the cell clones. The Dot Blot assay was performed according to the manufacturer's instructions and involved the transfer of cloned cell supernatant to a blotting apparatus (Bio-Rad Laboratories, Hercules, CA, Bio-Rad Dot Blot) in a 96-well format. To this end, the supernatants from cloned transfectants (20 μl) were "spotted" onto a nitrocellulose membrane via vacuum filtering, along with both positive (purified, hybridoma-derived PA-29 monoclonal antibody) and negative (blank medium) controls. The protein, including immunoglobulin, in the supernatant irreversibly bind to the membrane, which was subsequently blocked with 5% milk in PBS-, ± 0.5 % Tween. The membrane was probed with affinity-purified, goat anti-human IgG-HRP, and clones expressing antibody were detected by observing a color in the spot (positive) on the nitrocellulose versus no color (negative) for those clones not producing antibody.

[0330] Purification of recombinant PA 29: 1.0 ml of recombinant Protein-A Sepharose fast flow (AP Biotech) was used to purify recombinant PA-29 antibody produced by transfected cells (transfectomas). Approximately 1.0 ml of resin (25-30 mg capacity) was equilibrated with high salt buffer (6OmM Glycine, 3M NaCl, pH 8.5). The cell culture supernatant previously equilibrated with high salt buffer was used as starting material and allowed to run through column at 5.0 ml/min. The column was washed with the loading buffer until the optical density (OD) of the column wash approached zero at 289nm. Finally, the bound antibody was eluted from the column using 5OmM Na-citτate (pH 5.5). The peak OD fractions were collected and dialyzed against phosphate buffer and prior to further analysis in an activity assay. The concentration of antibody was determined using the following formula: Concentration (mg/ml) =

(A280nm-A340nm)/1.4. Using this procedure, 80 mg of recombinant mouse PA29 was generated.

EXAMPLE 13

[0331J Generation of chimeric PA-29 antibody. Nucleic acid encoding the complete heavy and light immunoglobulin chains of PA-29 were cloned as described above. The nucleic acid encoding the variable regions of the PA-29 heavy and light chains (FIGS. 1OB and 1 IB, respectively) were then cloned from the complete heavy and light chain encoding polynucleotides. These isolated polynucleotides were engineered into expression vectors (Lonza Biologies, Berkshire, UK, pEE14.4) which expressed (i) the nucleic acid encoding the PA-29 immunoglobulin light chain variable region gene and nucleic acid encoding the constant region of the human lambda light chain and (ii) the nucleic acid encoding the PA-29 immunoglobulin heavy chain variable region gene and the nucleic acid encoding the constant region of the human IgGl heavy chain. 293T cells were transiently transfected with these expression vectors using the Effectene system (Qiagen, Valencia, CA). Cell supernatant containing secreted PA-29 chimeric antibody was collected three days following transfection and purified using Protein A chromatography. The purified chimeric antibody was tested for activity in the HCVpp pseudovirus inhibition assay as described hereinabove. (FIG. 17)

[0332] More particularly, the nucleic acid encoding the chimeric λ light chain (i.e., the chimeric λ light chain gene) was synthesized in its entirety and contained mouse light chain variable region and human light chain λ constant region. Convenient Hind III/Eco RI restriction sites were included in this synthesized chimeric light chain-encoding nucleic acid. This gene was later excised out of the vector provided by the vendor and cloned into the Lonza light chain vector pEE 14.4 (Lonza Biologies, Berkshire, UK). The construction of the chimeric heavy chain involved the synthesis of a partial mouse heavy chain variable region fragment containing Hind III/Apa I restriction sites. This fragment was later inserted into the pCONγl Lonza vector already containing the human IgGl constant region. This in-phase fusion of the mouse heavy chain variable region to human constant region created the fully functional mouse heavy chain gene with a CMV promoter at 5'end, the chimeric gene, and the bgh poly A termination signal at the 3' end of the chimeric gene.

[0333J The heavy chain-encoding nucleic acid (heavy chain gene) was excised out of the pCON γl vector as a Not I/Bam HI fragment (CMV-Ch.Hc-bgh) and cloned into the light chain vector previously cut with Not 1/Bam HI enzymes. This cloning generated a Two Gene Vector (TGV) with both a chimeric light chain gene and a heavy chain gene present on the same vector. The TGV vector was later used to transiently express the chimeric antibody in HEK 293 cells. A typical large scale transfection involved ten 150mm Petri-dishes, which contained a monolayer of HEK 293 cells, 20 ml of growth medium, 25 μg TGV DNA and appropriate amounts of lipofectamine-2000 (Invitrogen). At 48 hours post transfection, the spent medium was collected. The secreted antibody was purified from the medium (supernatant) on a Protein-A column, and then dialyzed back into PBS for use in in vitro HCVpp neutralization assays as described above.

EXAMPLE 14

Humanization of murine PA-29 monoclonal antibody

[0334] Humanization of the PA-29 monoclonal antibody variable regions was carried out essentially in accordance with methods known and practiced in the art (e.g., Queen et al., 1989, Proc. Natl. Acad. Sci. USA 86:10029-10033; U.S. Patent Nos. 5,530,101, 5,585,089, 5,693,762 and 7,022,500 to C. Queen et al.). First, a molecular model of the PA29 variable regions was constructed and the framework amino acid residues important for the CDR structure were identified. In parallel, human VH and VL sequences having high homology to PA29 VH and VL, respectively, were selected from among known human immunoglobulin sequences. CDR sequences from the murine PA-29 antibody, together with framework amino acid residues important for maintaining the structure of the CDRs, were grafted into the selected human framework sequences. In addition, human framework amino acid residues that were found to be atypical in the corresponding V region subgroup were substituted with the typical residues to reduce potential immunogenicity of the resulting humanized form of PA-29. [0335| FIGS. 19 and 20 show the murine PA29 VH and VL sequences, respectively, reformatted to indicate the position of each amino acid residue and the location of the complementarity determining regions (CDRs) based on the definition by Kabat et al. The PA-29 VH and VL sequences were aligned with their predicted ancestral germline V segments. The PA29 VH region belongs to the mouse VH subgroup II(c) (1). The analysis of the signal peptide of the PA29 VL gene using the SIG-Pred software (http://www.bioinformatics.leeds.ac.uk/prot_analysis/Signal.html) indicated the potential existence of five different cleavage sites (FIG. 18B). The same software predicted only one cleavage site just upstream of position 1 of PA29 VH (FlG. 18A). The murine PA- 29 light chain was found to exist in two forms, one starting with Ala-Ile-Ser at the N- terminus (Type A in FIG. 18B) and another with Gln-Ala-Gly (Type B), the latter has an N-terminal GIn residue that corresponds to position 1 of the Kabat sequence (FIG. 18B). The presence of two different N-termini of PA29 VL may not affect antigen binding of the humanized antibody, however, as will be appreciated by the skilled practitioner, a different signal peptide can readily be engineered via molecular cloning into the light chain nucleic acid sequence of huPA-29 to ensure a single cleavage just upstream of Kabat position 1 in the light chain. Substituting one suitable signal sequence for another can crrcumvent a mixture of two forms of the humanized PA29 light chain and will ensure homogeneity. [0336] For the humanization ofPA29 VH, human VH regions homologous to PA29 VH were searched in the GenBank database. The VH region encoded in the human AW405977 cDN A (GenBank accession number A W405977) or the human DA984308 cDNA (Kimura et al. 2006. Genome Res. 16: 55-65; GenBank accession number DA427180) were chosen as an acceptors for humanization. Mouse PA29 VH CDR sequences were transferred to the corresponding positions of the human sequences. Computer modeling was performed to determine the amino acid residues from mouse PA29 VH that were substituted for human framework residues. The amino acid sequences of the resulting humanized VH, HuPA29VH#l , VH#2 and VH#3 are shown in FlG. 19. [0337] Based on the homology search with PA29 VL, the Vλ region encoded in the human CD687562 cDNA (GenBank accession number CD687562) was chosen as an acceptor for humanization. Mouse PA29 VL CDR sequences were transferred to the corresponding positions of CD687562 Vλ. Computer modeling was performed to determine the amino acid residues from mouse PA29 VL that were substituted for human framework residues. The amino acid sequences of the resulting humanized VL, HuPA29VL#l and VL#2 are shown in FIG. 20. [0338] The humanized PA-29 light chain containing the VL#2 variable region (FIG. 20) was synthesized in its entirety as a Hind III and EcoR I fragment (DNA 2.0 Inc.). For convenience, the VL#2-containing light chain was designated "LC2". The LC2- encoding nucleic acid was excised out of the vector provided by the vendor and cloned into Lonza light chain vector as a Hind III/Eco RI fragment to generate a functional light chain gene. The humanized PA-29 heavy chain VH# 1 , VH#2 and VH#3 -encoding nucleic acids were initially synthesized as 400bp partial heavy chain variable regions (VH) with Hind III and Apa I restriction sites. These variable regions were subsequently individually cloned into a pCON γ I vector containing the rest of the IgGl constant region to create an in-phase fusion resulting in the functional heavy chain genes VH#1 , VH#2 and VH#3 respectively.

[0339] Several functional humanized antibodies, e.g. , VH#1 /LC2, VH#2/LC2 and VH#3/LC2 were generated by co-transfecting the respective light and heavy chain- encoding genes into HEK 293 cells and collecting spent media containing antibody 48 hours post transfection. A typical transfection involved transfecting 25 μg each of heavy and light chain plasmids into a 150mm petri dish containing adherent HEK 293 cells and 20ml of growth medium. At about 48 hours post- transfection, approximately 100 μg of antibody was obtained in the transfected cell culture medium This process was later expanded to include ten petri dishes, which generated approximately 200 ml of spent medium, or approximately 1 mg of antibody from each of the VH#1/LC2, VH#2/LC2 and VH#3/LC2 constructs. The antibodies from the spent medium were separately affinity purified on a mAb-select Protein-A column. Affinity purified antibody was dialyzed against PBS and normalized for protein concentration before testing in the HCVpp neutralization assay as described, (e.g., Examples 1 and 2). [0340] The contents of all patent applications and issued patents mentioned, referred to, or described herein are hereby incorporated by reference herein in their entireties. , The contents of all references, abstracts and publications mentioned, referred to, or described herein are hereby incorporated by reference herein in their entireties.

REFERENCES

U.S. Application No. 20050266400 to Dumonceaux et al., published on Dec. 1, 2005

U.S. Pat. No. 4,816,567 issued to Cab illy et al. on Mar. 28, 1989.

U.S. Pat. No. 6,639,055 issued to Carter et al. on Oct. 28, 2003.

U.S. Pat. No. 6,407,213 issued to Carter et al. on June 18, 2002. U.S. Pat. No. 5,225,539 issued to Winter on JuI. 6, 1993.

U.S. Pat. No. 5,545,806 issued to Lonberg et al. on Aug. 13, 1996.

U.S. Pat. No. 5,545,807 issued to Surani et al. on Aug. 13, 1996.

U.S. Pat. No. 5,530,101 issued to Queen et al. on June 25, 1996.

U.S. Pat. No. 5,585,089 issued to Queen et al. on Dec. 17, 1996. U.S. Pat. No. 5,591,669 issued to Krimpenfort et al. on Jan. 7, 1997. U.S. Pat. No. 5,598,369 issued to Chen et al. on Jan. 28, 1997.

U.S. Pat. No. 5,693,761 issued to Queen et al. on Dec. 2, 1997.

U.S. Pat. No. 5,693,762 issued on Queen et al. on Dec. 2, 1997.

U.S. Pat. No.6,180,370 issued to Queen et al. on Jan. 30, 2001. U.S. Pat. No. 7,022,500 issued to Queen et al. on Apr. 4, 2006.

U.S. Pat. No. 6,150,584 issued to Kucherlapati et al. on Nov. 21, 2000.

U.S. Pat. No. 5,565,332 issued to Hoogenboom et al. on Oct. 15, 1996.

U.S. Pat. No.5,573,905 issued to Lerner et al. on Nov. 12, 1996.

U.S. Pat. No. 5,565,332 issued to Goroff on July 20, 1993. U.S. Pat. No. 5,565,332 issued to Borrebaeck et al. on Oct. 22, 1996. U.S. Pat. No. 5,698,390 issued to Houghton et al. on Dec. 16, 1997.

U.S. Pat. No. 4,692,411 issued to Ghose on Sept. 8, 1987.

U.S. Pat. No. 5,514,548 issued to to Krebber et al. on May 7, 1996.

U.S. Pat. No. 4,946,778 issued to Ladner et al. on Aug. 7, 1990. U.S. Pat. No. 5,476,786 issued to Huston on Dec. 19, 1995. U.S. Pat. No. 7,022,323 issued to Olson et al. on Apr. 3, 2006.

WO 93/06213, Inventor Hoogenboom et al., published Apr. 1, 1993.

WO 2005/037214, Inventor Blatt et al., published Apr. 28, 2005.

PCT International Application No. PCT/US89/05857, filed Dec. 28, 1989, International Publication No. WO 90/07861, published JuI. 26, 1990.

PCT International Application No. PCT/EP2005/000546, filed Jan 7, 2005, International Publication No. WO 2005/067709, published July 28, 2005.

1994. Outbreak of hepatitis C associated with intravenous immunoglobulin administration-United States, October 1993-June 1994. MMWR Morb. Mortal. WkIy. Rep. 43:505-509.

Agnello, V. and F. G. De Rosa. 2004. Extrahepatic disease manifestations of HCV infection: some current issues. J Hepatol. 40:341-352.

Allander, T., A. Beyene, S. H. Jacobson, L. Grillner, and M. A. Persson. 1997. Patients infected with the same hepatitis C virus strain display different kinetics of the isolate- specific antibody response. J Infect Dis. 175:26-31. Alter, H. J. and L. B. Seef (1993) Transfusion-associated hepatitis. In "Viral Hepatitis" (Z. A. Thomas, ed.). Churchill Livingstone, Edinburgh.

Alter, M. J., D. Kruszon-Moran, O. V. Nainan, G. M. McQuillan, F. Gao, L. A. Mover, R. A Kaslow, and H. S. Margolis. 1999. The prevalence of hepatitis C virus infection in the United States, 1988 through 1994. N Engl J Med. 341 :556-562. al Hemsi et al. (1996). Clin. Transplant. 10:668-675. al Khaja, N., D. G. Roberts, A. Belboul, V. Lopere, P. Bergman, G. Radberg, S. . Hermodsson, and R. G. Olsson. 1991. Gamma globulin prophylaxis to reduce posttransfusion non-A, non-B hepatitis after cardiac surgery with cardiopulmonary bypass. Scand.J Thorac.Cardio vase. Surg. 25:7-12.

Andrus et al. (1998). J. Infect. Dis. 177:889-897.

Bartenschlager, R. and V. Lohmann (2000) Replication of hepatitis C virus. J. Gen. Virol. 81: 1631-1648.

Bartosch, B., A. Vitelli, C. Granier, C. Goujon, J. Dubuisson, S. Pascale, E. Scarselli, R. Cortese, A. Nicosia, and F. L. Cosset. 2003. Cell entry of hepatitis C virus requires a set of co-receptors that include the CD81 tetraspanin and the SR-Bl scavenger receptor. J Biol Chem. 278:41624-41630. Bartosch, B., J. Dubuisson and F. L. Cosset (2003). Infectious hepatitis c virus pseudo- particles containing functional E1-E2 envelope protein complexes. J. Exp. Med. 197: 633-642.

Bassett, S.E., K. M. Brasky and R. E. Lanford (1998). Analysis of hepatitis C virus- inoculated chimpanzees reveals unexpected clinical profiles. J. Virol., 72:2589-2599.

Bernard et al. 1978. Sequences of Mouse Immunoglobulin Light Chain Genes before and after Somatic Changes. Cell 15: 1133-1144; GenBank accession number V00811.

Bertaux, C. and T. Dragic. (2006). Different Domains of CD81 Mediate Distinct Stages of Hepatitis C Virus Pseudoparticle Entry. J Virol. 80:4940-4948. BertolM, L., S. Iacovacci, A. Ponzetto, G. Gorini, M. Battaglia, and G. Carloni. 1993. The human bone-marrow-derived B-cell line CE, susceptible to hepatitis C virus infection. Res. Virol. 144:281-285

Bird, R.E. et al., 1988, Science, 242:423-426.

Brunt, 2000, Hepatology, 31.241-246.

Boisvert, J., X. S. He, R. Cheung, E. B. Keeffe, T. Wright, and H. B. Greenberg. 2001. Quantitative analysis of hepatitis C virus in peripheral blood and liver: replication detected only in liver. J Infect Dis 184:827-35.

Borgia, G. 2004. Specific immunoglobulin against HCV: new perspectives. IDrugs. 7:570-574. Borgia, G. 2004. HepeX-C (XTL Biopharmaceuticals). Curr. Opm. Investig. Drugs. 5:892- 897.

Bresee, J. S., E. E. Mast, P. J. Coleman, M. J. Baron, L. B. Schonberger, M. J. Alter, M. M. Jonas, M. Y. Yu, P. M. Renzi, and L. C. Schneider. 1996. Hepatitis C virus infection associated with administration of intravenous immune globulin. A cohort study. JAMA. 276:1563-1567.

Buonocore, L., K. J. Blight, C. M. Rice and J. K. Rose. 2002. Characterization of vesicular stomatitis virus recombinants that express and incorporate high levels of hepatitis C virus glycoproteins. J. Virol. 76: 6865-6872.

Callens, N., Y. Ciczora, B. Bartosch, N. Vu-Dac, F. L. Cosset, J. M. Pawlotsky, F. Penin, and J. Dubuisson. 2005. Basic residues in hypervariable region 1 of hepatitis C virus envelope glycoprotein e2 contribute to virus entry. J Virol. 79:15331-15341 Cocquerel, L., S. Duvet, J. C. Meunier, A. Pillez, R. Cacan, C. Wychowski and J.

Dubuisson (1999) The transmembrane domain of hepatitis C vims glycoprotein E1 is a signal for static retention in the endoplasmic reticulum. J. Virol. 73: 2641-2649. Chothia et al. 1987. Canonical structures for the hypervariable regions of immunoglobulins. J. MoI. Biol. 196: 901-917.

Cocquerel, L., S. Duvet, J. C. Meunier, A. Pillez, R. Cacan, C. Wychowski and J. Dubuisson (1999) The transmembrane domain of hepatitis C virus glycoprotein El is a signal for static retention in the endoplasmic reticulum. J. Virol. 73: 2641-2649.

Cocquerel, L., J. C. Meunier, A. Pillez, C. Wychowski and J. Dubuisson (1998) A retention signal necessary and sufficient for endoplasmic reticulum localization maps to the transmembrane domain of hepatitis C virus glycoprotein E2. J. Virol. 72: 2183-2191.

Cocquerel, L., C. Wychowski, F. Minner, F. Penin and J. Dubuisson (2000) Charged residues in the transmembrane domains of hepatitis C virus glycoproteins play a major role in the processing, subcellular localization, and assembly of these envelope proteins. J. Virol. 74: 3623-3633.

Conner, R. I. et al., (1995), Virology, 206:935-944.

Conrad, M. E. and S. M. Lemon. 1987. Prevention of endemic icteric viral hepatitis by administration of immune serum gamma globulin. J Infect Dis 156:56-63.

CormieT, E. G., F. Tsamis, F. Kajumo, R. J. Durso, J. P. Gardner, and T. Dragic. 2004. CD81 is an entry coreceplor for hepatitis C virus. Proc Natl Acad Sci U S A. 101 :7270- 7274. Dash, S., A. B. Halim, H. Tsuji, N. Hiramatsu and M. A. Gerber (1997) Transfection of HepG2 cells with infectious hepatitis C virus genome. Am. J. Pathol. 151: 363-373.

Daugherty, B.L. et al., 1991 , Nucl. Acids Res., 19 (9): 2471-2476. Deleersnyder, V., A. Pillez, C. Wychowski, K. Blight, J. Xu, Y. S. Hahn, C. M. Rice and J. Dubuisson (1997) Formation of native hepatitis C virus glycoprotein complexes. J. Virol. 71 : 697-704.

DeVos, R., C. Verslype, E. Depla, J. Fevery, B. Van Damme, V. Desmet and T. Roskams, (2002), Ultrastructural visualization of hepatitis C virus components in human and primate liver biopsies. J. Hepatol. 37:370.

Dieterich, D. T. 2002. Treatment of hepatitis C and anemia in human immunodeficiency virus-infected patients. J Infect Dis 185 Suppl 2:S128-S137.

Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Nagashima, C.

Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore and W. A. Paxton, (1996), HIV-I entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5, Nature, 381 :667-

673.

Dubuisson, J., H. H. Hsu, R. C. Cheung, H. B. Greenberg, D. G. Russell and C. M. Rice

(1994) Formation and intracellular localization of hepatitis C virus envelope glycoprotein complexes expressed by recombinant vaccinia and Sindbis viruses. J. Virol. 68: 6147-6160.

Dumonceaux, J., E. G. Cormier, F. Kajumo, G. P. Donovan, J. Roy-Chowdhury, I. J. Fox, J. P. Gardner, and T. Dragic. 2003. Expression of unmodified hepatitis C virus envelope glycoprotein-coding sequences leads to cryptic intron excision and cell surface expression of E1/E2 heterodimers comprising full-length and partially deleted EI . J Virol. 77:13418-13424. Duvet, S., L. Cocquerel, A. Pillez, R. Cacan, A. Verbert, D. Moradpour, C. Wychowski and J. Dubuisson (1998) Hepatitis C virus glycoprotein complex localization in the endoplasmic reticulum involves a determinant for retention and not retrieval. J. Biol. Chem. 273: 32088-32095. Egger, D., B. WoIk, R. Gosert, L. Bianchi, H. E. Blum, D. Moradpour and K. Bienz (2002) Expression of hepatitis C virus proteins induces distinct membrane alterations including a candidate viral replication complex. J. Virol. 76: 5974-5984.

Emi, N., T. Friedmann, and J. K. Yee. 1991. Pseudotype formation of murine leukemia virus with the G protein of vesicular stomatitis virus. J Virol. 65: 1202-1207.

Eren, R., D. Landstein, D. Terkieltaub, O. Nussbaum, A. Zauberman, J. Ben Porath, J. Gopher, R. Buchnick, R. Kovjazin, Z. Rosenthal-Galili, S. Aviel, E. Ilan, Y. Shoshany, L. Neville, T. Waisman, O. Ben Moshe, A. Kischitsky, S. K. Foung, Z. Y. Keck, O. Pappo, A. Eid, O. Jurim, G. Zamir, E. Galun, and S. Dagan. (2006). Preclinical evaluation of two neutralizing human monoclonal antibodies against hepatitis C virus (HCV): a potential treatment to prevent HCV reinfection in liver transplant patients. J Virol. 80:2654-2664 Farci, P., A. Shimoda, A. Coiana, G. Diaz, G. Peddis, J. C. Melpolder, A. Strazzera, D. Y. Chien, S. J. Munoz, A. Balestrieri, R. H. Purcell, and H. J. Alter. (2000). The outcome of acute hepatitis C predicted by the evolution of the viral quasispecies. Science. 288:339-344. Farci et al. (1996). Proc. Natl. Acad Sci. USA, 93:15394-15399. Farci et al. (1994). Proc. Natl. Acad. Sci. USA, 91 :7792-7796.

Farci et al. (1992). Science, 258.135-140.

Feray, C, M. Gigou, D. Samuel, B. Ducot, P. Maisonneuve, M. Reynes, A. Bismuth, and H. Bismuth. (1998). Incidence of hepatitis C in patients receiving different preparations of hepatitis B immunoglobulins after liver transplantation. Ann. Intern. Med 128:810- 816.

Flint, M. and J. A. McKeating (1999) The C-terminal region of the hepatitis C virus El glycoprotein confers localization within the endoplasmic reticulum. J. Gen. Virol. 80: 1943-1947. Flint, M., J. M. Thomas, C. M. Maidens, C. Shotton, S. Levy, W. S. Barclay and J. A. McKeating (1999) Functional analysis of cell surface-expressed hepatitis C virus E2 glycoprotein. J. Virol. 73: 6782-6790. Flora, K., M. Schiele, K. Benner, A. Montanaro, W. Johnston, R. Whitham, and R. Press. 1996. An outbreak of acute hepatitis C among recipients of intravenous immunoglobulin. Ann.AUergy Asthma Immunol. 76:160-162.

Frank, C, M. K. Mohamed, G. T. Strickland, D. Lavanchy, R. R. Arthur, L. S. Magder, T. El Khoby, Y. Abdel-Wahab, E. S. AIy Ohn, W. Anwar, and I. Sallam. 2000. The role of parenteral antischistosomal therapy in the spread of hepatitis C virus in Egypt. Lancet. 355:887-891.

Fry, D. E. and L. M. Flint (1997) Hepatitis: an overview of important issues. Bull. Am. Coll. Surg. 82: 8-13.

Galun, E , T. Burakova, M. Ketzinel, I. Lubin, E. Shezen, Y. Kahana, A. Eid, Y. Ilan, A. Rivkind and G. Pizov, (1995). Hepatitis C virus viremia in SCDD->BNX mouse chimera. J. Infect. Dis. 172:25-30.

Garry, R. F. and S. Dash. 2003. Proteomics computational analyses suggest that hepatitis C virus El and pestivirus E2 envelope glycoproteins are truncated class II fusion proteins. Virology 307:255-65. Gardner, J. P., R J. Durso, R R. Arrigale, G. P. Donovan, P. J. Maddon, T. Dragic and W. C. Olson (2003) L-SIGN (CD209L) is a liver-specific capture receptor for hepatitis C virus. Proc. Natl. Acad. Sci. USA 100: 4498-4503.

Gomperts, E. D. 1996. Gammagard and reported hepatitis C virus episodes. Clin Ther. 18 Suppl B:3-8.:3-8

Grakoui, A., C. Wychowski, C. Lin, S. M. Feinstone and C. M. Rice (1993) Expression and identification of hepatitis C virus polyprotein cleavage products. J. Virol. 67: 1385- 1395.

Greive, S. J., R I. Webb, J. M. Mackenzie and E. J. Gowans (2002) Expression of the hepatitis C virus structural proteins in mammalian cells induces morphology similar to that in natural infection. J. Viral Hepat. 9: 9-17. Healey, C. J., N. K. Sabharwal, J. Daub, F. Davidson, P. L. Yap, K. A. Fleming, R. W. Chapman, P. Simmonds, and H. Chapel. 1996. Outbreak of acute hepatitis C following the use of anti-hepatitis C virus-screened intravenous immunoglobulin therapy. Gastroenterology. 110:1120-1126. Hemsi et al. (1996). Clin. Transplant. 10:668-675.

Hsu, E. C , B. Hsi, M. Hirota-Tsuchihara, J. Ruland, C. Iorio, F. Sarangi, J. Diao, G. Migliaccio, D. L. Tyrrell, N. Kneteman and C. D. Richardson, 2003 Modified apoptotic molecule (BID) reduces hepatitis C virus infection in mice with chimeric human livers. Nat Biotechnol. 21:519-525.

Hsu, M., J. Zhang, M. Flint, C. Logvinoff, C. Cheng-Mayer, C. M. Rice and J. A. McKeating (2003) Hepatitis C virus glycoproteins mediate pH-dependent cell entry of pseudotyped retroviral particles. Proc. Natl. Acad. Sci. USA 100: 7271-7276.

Iacovacci, S., A. Manzin, S. Barca, M. Sargiacomo, A. Serafino, M. B. Valli, G. Macioce, H. J. Hassan, A. Ponzetto, M. Clementi, C. Peschle and G. Carloni (1997) Molecular characterization and dynamics of hepatitis C virus replication in human fetal hepatocytes infected in vitro. Hepatology 26: 1328-1337.

Isaguliants, M. G., A. Widell, S. M. Zhang, A. Sidorchuk, M. Levi, V. D. Smirnov, T. Santantonio, H. M. Diepolder, G. R. Pape, and E. Nordenfelt. 2002. Antibody responses against B-cell epitopes of the hypervariable region 1 of hepatitis C virus in self-limiting and chronic human hepatitis C followed-up using consensus peptides. J Med Virol. 66:204-217.

Ishii, K., D. Rosa, Y. Watanabe, T. Katayama, H. Harada, C. Wyatt, K. Kiyosawa, H. Aizaki, Y. Matsuura, M. Houghton, S. Abrignani, and T. Miyamura. 1998. High titers of antibodies inhibiting the binding of envelope to human cells correlate with natural resolution of chronic hepatitis C. Hepatology 28:1 117-1120.

Johnston et al. 2006. Complete Sequence Assembly and Characterization of the C57BL/6 Mouse Ig Heavy Chain V Region. J. Immunol. 176: 4221-4234; GenBank accession number BN000872.

Kabat et al. 1991. Sequences of Proteins of Immunological Interests, Fifth edition, NIH Publication No. 91-3242, U.S. Department of Health and Human Services.

Kanunan, M. et al., 1989, Nucl. Acids Res., 17:5404.

Keck, Z. Y., V. M. Sung, S. Perkins, J. Rowe, S. Paul, T. J. Liang, M. M. Lai, and S. K. Foung. 2004. Human monoclonal antibody to hepatitis C virus El glycoprotein that blocks virus attachment and viral infectivity. J Virol. 78:7257-7263

Kimura et al. 2006. Diversification of Transcriptional Modulation: Large-scale Identification and Characterization of Putative Alternative Promoters of Human Genes. Genome Res. 16: 55-65; GenBank accession number DA427180.

Kneteman, N M. , T.J. Gao, B. His, D. Schiller, D. Douglas, B. Addison and D.L.J. Tyrrell, (2003). Evaluation and Validation of the KMT Mouse Model for Testing Anti- Viral Hepatitis Therapies, 10^ώ HCV Meeting, Dec. 2-6, Kyoto, Japan. Kneteman N.M., Mercer, D.F. (2005). Mice with chimeric human livers: Who says supermodels have to be tall? Hepatology. 2005 Apr;41(4):703-6. Knodell, R. G., M. E. Conrad, and K. G. Ishak. 1977. Development of chronic liver disease after acute non-A, non-B post-transfusion hepatitis. Role of gamma-globulin prophylaxis in its prevention. Gastroenterology 72:902-909 Knodell, R. G., M. E. Conrad, A. L. Ginsberg, and C. J. Bell. 1976. Efficacy of prophylactic gamma-globulin in preventing non-A, non-B post-transfusion hepatitis. Lancet 1 :557-561.

Kohler, G. and C. Milstein (1975) Continuous cultures of fused cells secreting antibody ofpredefmed specificity. Nature 256: 495-497.

Krawczynski et al., (1996). J. Infect. Dis. 173:822-828.

Kreil et al., (1998). J. Virol. 72:3076-3081.

Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky and D. M. Klinman (1995) CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374: 546-549. Krieger, N., V. Lohmann, and R. Bartenschlager. 2001. Enhancement of hepatitis C virus RNA replication by cell culture- adaptive mutations. J Virol 75:4614-24.

Kuhmann, S. E., P. Pugach, K. J. Kunstman, J. Taylor, R. L. Stanfield, A. Snyder, J. M. Strizki, J. Riley, B. M. Baroudy, I. A. Wilson, B. T. Korber, S. M. Wolinsky, and J. P. Moore, 2004, Genetic and phenotypic analyses of human immunodeficiency virus type 1 escape from a small-molecule CCR5 inhibitor. J. Virol. 78:2790-2807.

Kuhns, W. J., A. M. Prince, B. Brotman, C. Hazzi, and G. F. Grady. 1976. A clinical and laboratory evaluation of immune serum globulin from donors with a history of hepatitis: attempted prevention of post-transfusion hepatitis. Am J Med Sci 272:255-261

Lagging, L. M., K. Meyer, R. J. Owens and R. Ray (1998) Functional role of hepatitis C virus chimeric glycoproteins in the infectivity of pseudotyped virus. J. Virol. 72: 3539- 3546.

Lagging, L. M., K. Meyer, J. Westin, R. Wejstal, G. Norkrans, M. Lindh and R. Ray (2002) Neutralization of pseudotyped vesicular stomatitis virus expressing hepatitis C virus envelope glycoprotein 1 or 2 by serum from patients. J. Infect. Dis. 185: 1165- 1169.

Langer R. (1990) New methods of drug delivery. Science 249: 1527-1533.

Lauer, G. M. and B. D. Walker (2001) Hepatitis C virus infection. New Engl. J. Med. 345: 41-52.

Lavillette, D., A. W. Tarr, C. Voisset, P. Donot, B. Bartosch, C. Bain, A. H. Patel, J. Dubuisson, J. K. Ball, and F. L. Cosset. 2005. Characterization of host-range and cell entry properties of the major genotypes and subtypes of hepatitis C virus. Hepatology 41 :265-274.

Lerat, H., S. Rumin, F. Habersetzer, F. Berby, M. A. Trabaud, C. Trepo, and G. 5 Inchauspe. 1998. In vivo tropism of hepatitis C virus genomic sequences in hematopoietic cells: influence of viral load, viral genotype, and cell phenotype. Blood 91:3841-3849.

Lewis, A.P. and J.S. Crowe, 1991, Gene, 101 :297-302. (T

Lindenbach, B. D., P. Meuleman, A. Ploss, T. Vanwolleghem, A. J. Syder, J. A.

McKeating, R. E. Lanford, S. M. Feinstone, M. E. Major, G. Leroux-Roels and C. M.

Rice. (2006). Cell culture-grown hepatitis C virus is infectious in vivo and can be recultured in vitro. Proc. Natl. Acad. Sci. USA. 1O3(1O):38O5-38O9. 5

Lindenbach, B. D., M. J. Evans, A. J. Syder, B. WoIk, T. L. Tellinghuisen, C. C. Liu, T.

Maruyama, R. O. Hynes, D. R. Burton, J. A. McKeating, and C. M. Rice. 2005.

Complete replication of hepatitis C virus in cell culture. Science. 309:623-626. 0 Logvinoff, C, M. E. Major, D. Oldach, S Heyward, A. Talal, P. Balfe, S. M. Feinstone, H Alter, C. M. Rice, and J. A. McKeating. 2004. Neutralizing antibody response during acute and chronic hepatitis C virus infection. Proc Natl Acad Sci U S A. 101 : 10149- 10154 5 Martire, G., A. Viola, L. lodice, L. V. Lotti, R. Gradini and S. Bonatti (2001) Hepatitis C virus structural proteins reside in the endoplasmic reticulum as well as in the intermediate compartment/cis-Golgi complex region of stably transfected cells. Virology 280: 176-182. 0 Manns, M. P., J. G. McHutchison, S. C. Gordon, V. K. Rustgi, M. Shiftman, R.

Reindollar, Z. D. Goodman, K Koury, M. Ling, and J. K. Albrecht. 2001. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 358:958-965. 5 Matsuura, Y., H. Tani, K. Suzuki, T. Kimura-Someya, R Suzuki, H. Aizaki, K. Ishii, K. Moriishi, C. S. Robison, M. A. Whitt and T. Miyamura (2001) Characterization of pseudotype VSV possessing HC V envelope proteins. Virology 286: 263-275.

Matsuura, Y., T. Suzuki, R. Suzuki, M. Sato, H. Aizaki, I. Saito and T. Miyamura (1994) 0 Processing of El and E2 glycoproteins of hepatitis C virus expressed in mammalian and insect cells. Virology 205: 141-150.

McHutchison, J. G., S. C. Gordon, E. R. Schiff, M. L. Shiffman.JW. M. Lee et al. (1998)

Interferon alpha-2b alone or in combination with ribavirin as initial treatment for chronic 5 hepatitis C. Hepatitis Interventional Therapy Group. New Engl. J. Med. 339: 1485-1492.

McKeating, J. A., L. Q. Zhang, C Logvinoff, M. Flint, J. Zhang, J. Yu, D. Butera, D. D. Ho, L. B. Dustin, C. M. Rice, and P. Balfe. (2004). Diverse hepatitis C virus glycoproteins mediate viral infection in a CD81 -dependent manner. J.Virol. 78:8496- 8505

Mercer, D. F., D. E. Schiller, J. F. Elliott, D. N. Douglas, C. Hao, A. Rinfret, W. R. Addison, K. P. Fischer, T. A. Churchill, J. R. Lakey, D. L. Tyrrell, and N. M. Kneteman, (2001), Hepatitic C virus replication in mice with chimeric human livers. Nat. Med. 7(8):927-933

METAVIR, 1994, Hepatology, 20:15-20.

Meuleman P, Libbrecht L, De Vos R, de Hemptinne B, Gevaert K, Vandekerckhove J, Roskams T, Leroux-Roels G. (2005). Morphological and biochemical characterization of a human liver in a uP A-SCID mouse chimera Hepatology. Apr;41(4):847-56. Meunier, J. C, R. E. Engle, K. Faulk, M. Zhao, B. Bartosch, H. Alter, S. U. Emerson, F. L. Cosset, R. H. Purcell, and J. Bukh. (2005). Evidence for cross-genotype neutralization of hepatitis C virus pseudo-particles and enhancement of infectivity by apolipoprolein Cl . Proc Natl Acad Sci U S A 102:4560-4565. Meyer, K., A. Basu and R. Ray (2000) Functional features of hepatitis C virus glycoproteins forpseudotype virus entry into mammalian cells. Virology 276: 214-226.

Michalak, J. P., C. Wychowski, A. Choukhi, J. C. Meunier, S. Ung, C. M. Rice and J. Dubuisson (1997) Characterization of truncated forms of hepatitis C virus glycoproteins. J. Gen. Virol. 78: 2299-2306.

Navas, M. C, A. Fuchs, E. Schvoerer, A. Bohbot, A. M. Aubertin, and F. Stoll-Keller. 2002. Dendritic cell susceptibility to hepatitis C virus genotype 1 infection. J.Med. Virol. 67:152-161.

Neumann, A. U., N. P. Lam, H. Dahari, D. R. Gretch, T. E. Wiley, T. J. Layden, and A. S. Perelson. 1998. Hepatitis C viral dynamics in vivo and the antiviral efficacy of interferon-alpha therapy. Science. 282:103-107. Op De Beeck, A., C. Voisset, B. Bartosch, Y. Ciczora, L. Cocquerel, Z. Keck, S. Foung, FL. Cosset, and J. Dubuisson. 2004. Characterization of functional hepatitis C virus envelope glycoproteins. J.Virol. 78:2994-3002

Op De Beeck, A., L. Cocquerel and J. Dubuisson (2001) Biogenesis of hepatitis C virus envelope glycoproteins. J. Gen. Virol. 82: 2589-2595.

Op De Beeck, A., R. Montserret, S. Duvet, L. Cocquerel, R. Cacan, B. Barberot, M. Le Maire, F. Penin and J. Dubuisson (2000) The transmembrane domains of hepatitis C virus envelope glycoproteins El and E2 play a major role in heterodimerization. J. Biol. Chem. 275: 31428-31437. Owsianka, A., A. W. Tarr, V. S. Juttla, D. Lavilletle, B. Bartosch, F. L. Cosset, J. K. Ball, and A. H. Patel. 2005. Monoclonal antibody AP33 defines a broadly neutralizing epitope on the hepatitis C virus E2 envelope glycoprotein. J Virol. 79: 11095-11 104. Pal, S., M. C. Shuhart, L. Thomassen, S. S. Emerson, T. Su, N. Feuerborn, J. Kae, and D. R. Gretch. 2006. Intrahepatic hepatitis C virus replication correlates with chronic hepatitis C disease severity in vivo. The Journal of Virology 80:2280-2290.

Patel, J., A. H. Patel and J. McLauchlan (1999) Covalent interactions are not required to permit or stabilize the non-covalent association of hepatitis C virus glycoproteins El and E2. J. Gen. Virol. 80: 1681-1690.

Patel, J., A. H. Patel and J. McLauchlan (2001) The transmembrane domain of the hepatitis C virus E2 glycoprotein is required for correct folding of the El glycoprotein and native complex formation. Virology 279: 58-68.

Pettersson, R. F. (1991) Protein localization and virus assembly at intracellular membranes. Curr. Top. Microbiol. Immunol. 170: 67-106. Piazza, M., L. Sagliocca, G. Tosone, V. Guadagnino, M. A. Stazi, R. Orlando, G. Borgia, D. Rosa, S. Abrignani, F. Palumbo, A. Manzin, and M. Clementi. 1998. Sexual transmission of hepatitis C virus and prevention with intramuscular immunoglobulin. AIDS Patient. Care STDS. 12:611-618. Piazzi et al. (1997). Arch. Intern. Med, 157:1537-1544.

Pietschmann, T., V. Lohmann, A. Kaul, N. Krieger, G. Rinck, G. Rutter, D. Strand and R. Bartenschlager (2002) Persistent and transient replication of full-length hepatitis C virus genomes in cell culture. J. Virol. 76: 4008-4021.

Poles, M. A. and D. T. Dieterich. 2000. Hepatitis C virus/human immunodeficiency virus coinfection: clinical management issues. Clin Infect Dis 31 :154-161.

Pollock et al., 1999. J. Immunol. Methods, 231 :147.

Queen et al. 1989. A Humanized Antibody that Binds to the Interleukin 2 Receptor. Proc. Natl. Acad. Sci. USA 86:10029-10033.

Ralston, R., K. Thudium, K. Berger, C. Kuo, B. Gervase, J. Hall, M. Selby, G. Kuo, M. Houghton and Q. L. Choo. 1993. Characterization of hepatitis C virus envelope glycoprotein complexes expressed by recombinant vaccinia viruses. J. Virol. 0.67: 6753- 6761.

Reed, K. E. and C. M. Rice. 2000. Overview of hepatitis C virus genome structure, polyprotein processing, and protein properties. Curr. Top. Microbiol. Immunol. 242: 55- 84. Remington's Pharmaceutical Sciences (1985) 17th ed., Mack Publishing Co., Philadelphia, Pa.

Rice, C. M. (1996) Flaviviridiae: The viruses and their replication 3rd ed. In "Fields Virology" (B. N. Fields, Ed.) pp. 931 -1034. Lippincott-Raven Publishers, Philadelphia.

Roccasecca, R., H. Ansuini, A. Vitelli, A. Meola, E. Scarselli, S. Acali, M. Pezzanera, B. B. Eτcole, J. McKeating, A. Yagnik, A. Lahm, A. Tramontano, R. Cortese, and A. Nicosia. 2003. Binding of the hepatitis C virus E2 glycoprotein to CD81 is strain specific and is modulated by a complex interplay between hypervariable regions 1 and 2. J Virol 77:1856-67.

Russell, 1999. Curr. Top. Microbiol. Immunol. 240:119. Sanchez-Quijano, A., J. A. Pineda, E. Lissen, M. Leal, M. A. Diaz-Torres, D. P. Garcia, F. Rivera, R. Castro, and J. Munoz. 1988. Prevention of post-transfusion non-A, non-B hepatitis by non-specific immunoglobulin in heart surgery patients. Lancet 1 : 1245-1249.

Sato, K. et al., 1993, Cancer Res., 53:851-856.

Scarselli, E., H. Ansuini, R. Cerino, R. M. Roccasecca, S. Acali, G. Filocamo, C.

Traboni, A. Nicosia, R. Cortese, and A Vitelli. 2002. The human scavenger receptor class B type I is a novel candidate receptor for the hepatitis C virus. EMBO J 21 :5017-

5025.

Schofield, D. J., B. Bartosch, Y. K. Shimizu, T. Allander, H. J. Alter, S. U. Emerson, F.

L. Cosset, and R. H. Purcell. 2005. Human monoclonal antibodies that react with the E2 glycoprotein of hepatitis C virus and possess neutralizing activity. Hepatology. 42:1055-

1062.

Seeff, L. B., H. J. Zimmerman, E. C. Wright, J. D. Finkelstein, P. Garcia-Pont, H. B.

Greenlee, A. A. Dietz, C. M. Leevy, C. H. Tamburro, E. R. Schiff, E. M. Schimmel, R.

Zemel, D. S. Zimmon, and R. W. McCollum 1977. A randomized, double blind controlled trial of the efficacy of immune serum globulin for the prevention of post- transfusion hepatitis. A Veterans Administration cooperative study. Gastroenterology

72: 111 -121.

SeIb y, M. J., E. Glazer, F. Masiarz and M. Houghton (1994) Complex processing and protein:protein interactions in the E2:NS2 region of HCV. Virology 204: 114-122.

Serafϊno, A., M. B. Valli, A. Alessandrini, A. Ponzetto, G. Carloni and L. Bertolini. (1997) Ultrastructural observations of viral particles within hepatitis C virus-infected human B lymphoblastoid cell line. Res. Virol. 148: 153-159. Shimizu, Y. K., S. M. Feinstone, M. Kohara, R. H. Purcell and H. Yoshikura. (1996) Hepatitis C virus: detection of intracellular virus particles by electron microscopy. Hepatology 23: 205-209. Simon, N. 1984. Prevention of non-A, non-B hepatitis in haemodialysis patients by hepatitis B immunoglobulin. Lancet 2:1047.

Spaete, R. R., D. Alexander, M. E. Rugroden, Q. L. Choo, K. Berger et al. (1992) Characterization of the hepatitis C virus E2/NS1 gene product expressed in mammalian cells. Virology 188: 819-830.

Sugg, U., W. Schneider, H. E. Hoffineister, C. Huth, W. Stephan, R. Lissner, and W. Haase. 1985. Hepatitis B immune globulin to prevent non-A, non-B post-transfusion hepatitis. Lancet 1:405-406.

Szepanski, S., M. Veit, S. Pleschka, H. D. Klenk, M. F. Schmidt and G. Herrler (1994) Post-translational folding of the influenza C virus glycoprotein HEF: defective processing in cells expressing the cloned gene. J. Gen. Virol. 75: 1023-1030. Tarr, A. W., A. M. Owsianka, J. M. Timms, C. P. McClure, R. J. Brown, T. P. Hickling, T. Pietschmann, R. Bartenschlager, A. H. Patel, and J. K. Ball. 2006. Characterization of the hepatitis C virus E2 epitope defined by the broadly neutralizing monoclonal antibody AP33. Hepatology. 43:592-601. Tscherne, D. M., C. T. Jones, M. J. Evans, B. D. Lindenbach, J. A. McKeating, and C. M. Rice. 2006. Time- and temperature-dependent activation of hepatitis C virus for low- pH-triggered entry. J Virol. 80:1734-1741.

Voisset, C, N. Callens, E. Blanchard, A. Op De Beeck, J. Dubuisson, and N. Vu-Dac. 2005. High density lipoproteins facilitate hepatitis C virus entry through the scavenger receptor class B type I. J. Bio l.Chem.M411600200.

Voisset, C. and J. Dubuisson. 2004. Functional hepatitis C virus envelope glycoproteins.

Biol Cell. 96:413-420.

Wakita, T., T. Pietschmann, T. Kato, T. Date, M. Miyamoto, Z. Zhao, K. Murthy, A.

Habermann, H. G. Krausslich, M. Mizokami, R. Bartenschlager, and T. J. Liang. 2005.

Production of infectious hepatitis C virus in tissue culture from a cloned viral genome.

Nat Med 11 :791-796.

Yanagi, M., R. H. Purcell, S. U. Emerson and J. Bukh (1997) Transcripts from a single full-length cDNA clone of hepatitis C virus are infectious when directly transfecled into the liver of a chimpanzee. Proc. Natl. Acad. Sci. USA 94: 8738-8743. Zein, N. N. 2000. Clinical significance of hepatitis C virus genotypes. Clin Microbiol Rev 13:223-235.

Zhang, J., G. Randall, A. Higginbottom, P. Monk, C. M. Rice, and J. A. McKeating. 2004. CD81 is required for hepatitis C virus glycoprotein-mediated viral infection. J Virol 78:1448-1455. Zhong, J., P. Gastaminza, G. Cheng, S. Kapadia, T. Kato, D. R. Burton, S. F. Wieland, S. L. Uprichard, T. Wakita, and F. V. Chisari. 2005. Robust hepatitis C virus infection in vitro. Proc Natl Acad Sci U S A 102:9294-9299. Zibert, A., H. Meisel, W. Kraas, A. Schulz, G. Jung, and M. Roggendorf. 1997. Early antibody response against hypervariable region 1 is associated with acute self- limiting infections of hepatitis C virus. Hepatology. 25:1245-1249.

Claims

WHAT IS CLAIMED IS:

1. A monoclonal antibody or portion thereo f, which (i) inhibits entry of HCV of genotypes 1 and 2, and subtypes and combinations thereof, into cells susceptible to infection by HCV, as characterized by a median IC50 value of less than 0.1 μg/mL in a virus neutralization assay; and which (ii) does not bind soluble or independently- expressed HCV El or E2 envelope glycoprotein.

2. The monoclonal antibody or portion thereof according to claim 1 , wherein the antibody inhibits entry of HCV of genotypes Ia, Ib, 2a, 2b, 2c, la/2b, 2a/2c, or combinations thereof, into cells susceptible to infection by HCV.

3. The monoclonal antibody or portion thereof according to claim 1 or claim 2, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotype Ia.

4. The monoclonal antibody or portion thereof according to claim 1 or claim 2, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotype Ib.

5. The monoclonal antibody or portion thereof according to claim 1 or claim 2, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotype 2a.

6. The monoclonal antibody or portion thereof according to claim 1 or claim 2, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotype 2b.

7. The monoclonal antibody or portion thereof according to claim 1 or claim 2, wherein the monoclonal antibody orportion thereof neutralizes HCV of genotype 2c.

8. The monoclonal antibody orportion thereof according to claim 1 or claim 2, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotypes 1 a/2b.

9. The monoclonal antibody orportion thereof according to claim 1 or claim 2, wherein the monoclonal antibody orportion thereof neutralizes HCV of genotypes 2a/2c.

10. The monoclonal antibody or portion thereof according to claim 1 , further wherein the monoclonal antibody or portion thereof has a half-life in serum of approximately two weeks.

11. The monoclonal antibody or portion thereof according to claim 1 , wherein the monoclonal antibody is a chimeric antibody or portion thereof.

12. The monoclonal antibody or portion thereof according to claim 1 , wherein the monoclonal antibody is a humanized antibody or portion thereof

13. A monoclonal antibody produced by a hybridoma cell line designated PA-29 (ATCC Accession No. PTA-7632), or a portion of antibody PA-29 which inhibits HCV infection of a cell susceptible to infection by HCV.

14. The monoclonal antibody according to claim 13, wherein the monoclonal antibody or portion thereof inhibits HCV entry into a cell susceptible to infection by HCV.

15. The monoclonal antibody according to claim 13, wherein the monoclonal antibody or portion thereof inhibits infection by HCV of genotype 1, genotype 2, or a combination thereof.

16. The monoclonal antibody according to claim 13, wherein the monoclonal antibody or portion thereof inhibits infection by HCV of genotypes Ia, Ib, 2a, 2b, 2c, la/2b, 2a/2c, or a combination thereof

17. The monoclonal antibody or portion thereof according to claim 13 , wherein the monoclonal antibody or portion thereof neutralizes HCV of genotype Ia

18. The monoclonal antibody orportion thereof according to claim 13, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotype Ib.

19. The monoclonal antibody orportion thereof according to claim 13, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotype 2a

20. The monoclonal antibody or portion thereof according to claim 13, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotype 2b.

21. The monoclonal antibody orportion thereof according to claim 13 wherein the monoclonal antibody or portion thereof neutralizes HCV of genotypes la/2b.

22. The monoclonal antibody or portion thereof according to claim 13, wherein the monoclonal antibody or portion thereof neutralizes HCV of genotypes 2a/2c.

23. The monoclonal antibody or portion thereof according to claim 13, wherein the monoclonal antibody or portion thereof is a chimeric antibody or portion thereof.

24. The monoclonal antibody or portion thereof according to claim 13, wherein the monoclonal antibody or portion thereof is a humanized antibody or portion thereof

25. A hybridoma cell line designated PA-29 (ATCC Accession No. PTA-7632) which produces a monoclonal antibody designated PA-29.

26. A cell which expresses a monoclonal antibody designated PA-29 (ATCC Accession No. PTA-7632).

27. A monoclonal antibody produced by a hybridoma cell line designated PA-29 (ATCC Accession No. PTA-7632).

28. An antibody which competes with monoclonal antibody PA-29 (ATCC Accession No. PTA-7632) for inhibiting HCV infection of a cell susceptible to HCV infection as characterized by a median IC50 value of 0.075 μg/mL in a virus neutralization assay, wherein HCV is of a genotype selected from one or more of Ia, Ib, 2a, 2b, 2c, la/2b, or 2a/2c, and combinations thereof.

29. A method for detecting HCV infection, comprising:

(a) contacting a sample suspected of containing HCV with a monoclonal antibody or portion thereof according to claim 1 or claim 13; and

(b) detecting HCV infection by detecting the monoclonal antibody or portion thereof which binds or interacts with HCV.

30. A method of inhibiting HCV infection of a cell susceptible to HCV infection, comprising: contacting the cell with the monoclonal antibody according to claim 1, in an amount and under conditions that inhibit HCV infection of the susceptible cell.

31. A method of inhibiting HCV infection of a cell susceptible to HCV infection, comprising: contacting the cell with a monoclonal antibody produced by a hybridoma cell line designated PA-29 (ATCC Accession No. PTA-7632), or a portion thereof, in an amount and under conditions that inhibit HCV infection of the susceptible cell.

32. A method for treating HCV infection, comprising administering to an individual in need thereof the monoclonal antibody or portion thereof according to claim 1 in an amount effective to inhibit HCV infection of susceptible cells so as to thereby treat the infection.

33. A method for treating HCV infection, comprising administering to an individual in need thereof the monoclonal antibody or portion thereof according to claim 13 in an amount effective to inhibit HCV infection of susceptible cells so as to thereby treat the infection.

34. A method of reducing the occurrence of HCV infection in a population of individuals, comprising administering to the population of individuals in need thereof the antibody according to claim 1 in an amount effective to reduce the occurrence of HCV infection in the population.

35. A method of reducing the occurrence of HCV infection in a population of individuals, comprising administering to the population of individuals in need thereof a therapeutically effective amount of the antibody according to claim 13 in an amount effective to reduce the occurrence of HCV infection in the population.

36. A composition which comprises the monoclonal antibody or portion thereof according to claim 1 and a pharmaceutically acceptable carrier.

37. A composition which comprises a monoclonal antibody designated as PA-29 (ATCC Accession No. PTA-7632) or a portion thereof and a pharmaceutically acceptable carrier.

38. The composition according to claim 36 or claim 37, wherein the monoclonal antibody or portion thereof is labeled with a detectable marker.

39. The composition according to claim 38, wherein the detectable marker is a radioactive marker, a chemiluminescent marker, a luminescent, a calorimetric, or a fluorescent marker.

40. The composition according to claim 36 or claim 37, wherein the composition further comprises at least one additive selected from the group consisting of antimicrobials, antioxidants, chelating agents and inert gases.

41. A pharmaceutical composition comprising a therapeutically effective amount of the monoclonal antibody or portion thereof according to claim 1 in combination with at least one additional anti-viral active ingredient selected from the group consisting of interferons, anti-HCV monoclonal antibodies, anti-HCV polyclonal antibodies, RNA polymerase inhibitors, protease inhibitors, IRES inhibitors, helicase inhibitors, antisense compounds, anti-viral small molecules and ribozymes.

42. A pharmaceutical composition comprising a therapeutically effective amount of the monoclonal antibody or portion thereof according to claim 13 in combination with at least one additional anti-viral active ingredient selected from the group consisting of interferons, anti-HCV monoclonal antibodies, anti-HCV polyclonal antibodies, RNA polymerase inhibitors, protease inhibitors, IRES inhibitors, helicase inhibitors, antisense compounds, anti-viral small molecules and ribozymes.

43. The method according to claim 30 or claim 31 , wherein the cell is present in a subject and the contacting is effected by administering the monoclonal antibody or portion thereof in an amount effective to inhibit HCV infection in the subject.

44. The method according to claim 43, wherein the cell is a liver cell or hepatocyte.

45. The method according to claim 43, wherein the subject a human being, a primate, an equine, an ovine, an avian, a bovine, a porcine, a canine, a feline, or a murine subject.

46. The method according to claim 43 , wherein the monoclonal antibody or portion thereof is administered orally, intravenously, subcutaneously, intramuscularly, topically or by liposome-mediated delivery.

47. The method according to claim 43 , wherein the effective amount of the monoclonal antibody oτ portion thereof is between 1 mg and 50 mg per kg body weight of the subject.

48. The method according to claim 43, wherein the effective amount of the monoclonal antibody or portion thereof is between 2 mg and 40 mg per kg body weight of the subject.

49. The method according to claim 43, wherein the effective amount of the monoclonal antibody or portion thereof is between 3 mg and 30 mg per kg body weight of the subject.

50. The method according to claim 43 , wherein the effective amount of the monoclonal antibody or portion thereof is between 4 mg and 20 mg per kg body weight of the subject.

51. The method according to claim 43 , wherein the effective amount of the monoclonal antibody or portion thereof is between 5 mg and 10 mg per kg body weight of the subject.

52. The method according to claim 43, wherein the monoclonal antibody or portion thereof is administered at least once per day.

53. The method according to claim 43, wherein the monoclonal antibody or portion thereof is administered daily.

54. The method according to claim 43, wherein the monoclonal antibody or portion thereof is administered every other day.

55. The method according to claim 43, wherein the monoclonal antibody or portion thereof is administered every 6 to 8 days.

56. The method according to claim 55, wherein the monoclonal antibody or portion thereof is administered weekly.

57. The method according to claim 43 , wherein the monoclonal antib ody or portion thereof is administered twice per week.

58. The method according to claim 43 , wherein the monoclonal antibody or portion thereof is administered every two weeks, every three weeks, or once a month.

59. A method of treating a liver disease in a subject, comprising administering to the subject an effective amount of a monoclonal antibody or a portion thereof, wherein the monoclonal antibody or portion thereof (i) inhibits entry of HCV of genotypes Ia, Ib, 2a, 2b, 2c, 1 a/2b, 2a/2c, or a combination thereof, into cells susceptible to infection by HCV, as determined by a median IC50 value of less than 0.1 μg/mL in a virus neutralization assay; and (ii) does not bind soluble or independently-expressed HCV El or E2 envelope glycoproteins, so as to thereby treat the liver disease in the subject.

60. The method according to claim 59, wherein the monoclonal antibody is PA-29 (ATCC Accession No. PTA-7632) or a portion thereof.

61. A method of treating an HCV-associated disorder in a subject which comprises administering to the subject an effective amount of a monoclonal antibody or a portion thereof, wherein the monoclonal antibody or portion thereof (i) inhibits entry of HCV of genotypes Ia, Ib, 2a, 2b, 2c, 1 a/2b, 2a/2c, or a combination thereof, into cells susceptible to infection by HCV. as determined by a median 1C50 value of less than 0.1 μg/mL in a virus neutralization assay; and (ii) does not bind soluble or independently- expressed HCV El or E2 envelope glycoproteins, so as to thereby treat the HCV associated disorder in the subject.

62. The method according to claim 61 , wherein the monoclonal antibody is PA-29 (ATCC Accession No. PTA-7632) or a portion thereof.

63. A method of preventing HCV infection in a subject, wherein prevention is effected by inhibiting HCV entry into a target cell infectable by HCV, comprising: administering to the subject a monoclonal antibody or portion thereof according to claim 1 in an amount effective to inhibit HCV infection of the target cell so as to thereby prevent HCV infection.

64. The method according to claim 63, wherein the monoclonal antibody or portion thereof is PA-29 monoclonal antibody or a portion thereof, or a chimeric or humanized form thereof

65. The method according to claim 63 or claim 64, wherein the target cell is a liver cell or hepatocyte.

66. An HCV neutralizing antibody comprising two light chain polypeptides, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:1 , and two heavy chain polypeptides, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:2.

67. A composition comprising the antibody according to claim 66 together with a carrier, excipient, or diluent.

68. An isolated nucleic acid which encodes an HCV neutralizing antibody light chain variable region polypeptide comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:1.

69. The nucleic acid according to claim 68, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO: 3.

70. The nucleic acid according to claim 68 or claim 69 wherein the nucleic acid is RNA, DNA or cDNA.

71. A composition comprising the nucleic acid according to claim 68 or claim 69, together with a carrier, diluent, or excipient.

72. An isolated nucleic acid which encodes an HCV neutralizing antibody heavy chain variable region polypeptide comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:2.

73. The nucleic acid according to claim 72, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO:4.

74. The nucleic acid according to claim 72 or claim 73, wherein the nucleic acid is RNA, DNA or cDNA.

75. A composition comprising the nucleic acid according to claim 72 or claim 73, together with a carrier, diluent, or excipient.

76. An isolated nucleic acid encoding a polypeptide comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:1 1.

77. The nucleic acid according to claim 76, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO: 13.

78. The nucleic acid according to claim 76 or claim 77 wherein the nucleic acid is RNA, DNA or cDNA.

79. A composition comprising the nucleic acid according to claim 76 or claim 77, together with a carrier, diluent, or excipient.

80. An isolated nucleic acid encoding a polypeptide comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:12.

81. The nucleic acid according to claim 80, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO: 14.

82. The nucleic acid according to claim 80 or claim 81 , wherein the nucleic acid is RNA, DNA or cDNA.

83. A composition comprising the nucleic acid according to claim 80 or claim 81, together with a carrier, diluent, or excipient.

84. An HCV neutralizing antibody comprising (i) two light chains, each light chain comprising variable region and a constant region, wherein the light chain variable region comprises complementarity determining region CDRl , complementarity determining region CDR2 and complementarity determining region CDR3 which comprise consecutive amino acids, wherein CDRl comprises the sequence as set forth in SEQ ID NO:5, CDR2 comprises the sequence as set forth in SEQ ID NO:6 and CDR3 comprises the sequence as set forth in SEQ ID NO: 7; and (ii) two heavy chains, each heavy chain comprising a variable region and a constant region, wherein the heavy chain variable region comprises complementarity determining region CDRl, complementarity determining region CDR2 and complementarity determining region CDR3 which comprise consecutive amino acids comprising, wherein CDRl comprises the sequence as set forth in SEQ ID NO:8, CDR2 comprises the sequence as set forth in SEQ ID NO:9 and CDR3 comprises the sequence as set forth in SEQ ID NO: 10.

85. An HCV neutralizing antibody comprising two light chains, each chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 11 , and two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12.

86. An HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 15, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19.

87. An HCV neutralizing antibody comprising two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 16, and two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19.

88. A composition comprising the HCV neutralizing antibody according to any of claims 84 to 87, together with a carrier, diluent, or excipient.

89. The HCV neutralizing antibody according to any of claims 66, or 84 to 87, wherein the antibody light chain is of the λ isotype.

90. The HCV neutralizing antibody according to any of claims 66, or 84 to 87, wherein the antibody light chain is of the K isotype.

91. The HCV neutralizing antibody according to any one of claims 66, or 84 to 87, wherein the heavy chain is of the IgGl, IgG2, IgG2a, IgG2b, IgG3 or IgG4 isotype.

92. The HCV neutralizing antibody according to claim 91 , wherein the heavy chain is of the IgGl isotype.

93. The HCV neutralizing antibody according to claim 91 , wherein the heavy chain is of the IgG4 isotype.

94. The HCV neutralizing antibody according to any of claims 66, or 84 to 87, wherein the antibody has attached thereto one or more of a radioisotope, a toxin, polyethylene glycol, a cytotoxic agent or a detectable label.

95. A method of inhibiting infection of an HCV susceptible cell, comprising: contacting the HCV susceptible cell with an antibody which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:1 1, and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, in an amount and under conditions to inhibit HCV infection of the HCV susceptible cell.

96. A method of treating a subject afflicted with HCV, comprising: administering to the subject an effective HCV treating dosage of an HCV neutralizing antibody, which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:1 1, and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12, or a fragment of such antibody which neutralizes HCV infection of susceptible cells, under conditions effective to treat the HCV-infected subject.

97. A method of preventing a subject from contracting an HCV infection, comprising: administering to the subject an effective HCV infection-preventing dosage amount of an HCV neutralizing antibody comprising (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 11 , and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 12, or a fragment of such antibody which neutralizes HCV infection of susceptible cells, under conditions effective to prevent the HCV infection in the subject.

98. A method of inhibiting infection of an HCV susceptible cell, which comprises: contacting the HCV susceptible cell with an antibody which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which comprises the sequence set forth in SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which comprises a sequence set forth in SEQ ID NO: 15 or SEQ ID NO: 16, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, in an amount and under conditions to inhibit HCV infection of the HCV susceptible cell.

99. A method of treating a subject afflicted with HCV, which comprises: administering to the subject an effective HCV treating dosage of an HCV neutralizing antibody, which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID N0:15 or SEQ ID N0:16, or a fragment of such antibody which neutralizes HCV infection of susceptible cells, under conditions effective to treat the HCV-infected subject.

100. A method of preventing a subject from contracting an HCV infection, which comprises: administering to the subject an effective HCV infection-preventing dosage amount of an HCV neutralizing antibody comprising (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NO: 15 or SEQ ID NO: 17, or a fragment of such antibody which neutralizes HCV infection of susceptible cells, under conditions effective to prevent the HCV infection in the subject.

101. An HCV neutralizing antibody conjugate comprising an HCV neutralizing antibody which comprises (i) two light chains, each light chain comprising a variable region comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO: 19, and (ii) two heavy chains, each heavy chain comprising a variable region consecutive amino acids, the amino acid sequence of which is selected from the sequences as set forth in SEQ ID NO: 15 or SEQ ID NO: 17, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, conjugated to at least one polymer.

102. An HCV neutralizing antibody conjugate comprising an HCV neutralizing antibody which comprises (i) two light chains, each light chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:11 , and (ii) two heavy chains, each heavy chain comprising consecutive amino acids, the amino acid sequence of which is set forth in SEQ ID NO:12, or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, conjugated to at least one polymer.

103. An HCV neutralizing antibody conjugate comprising an antibody according to any one of claims 1 , 2, 13, or 28 or a fragment of such antibody which neutralizes HCV infection of a susceptible cell, conjugated to at least one polymer.

104. A method of inhibiting infection of an HCV susceptible cell by HCV, comprising administering to a subject at risk of HCV infection the conjugate according to claim 101 or claim 102, in an amount and under conditions effective to inhibit HCV infection of HCV susceptible cells of the subject.

105. A method of inhibiting infection of an HCV susceptible cell by HCV, comprising administering to a subject at risk of HCV infection the conjugate according to claim 103, in an amount and under conditions effective to inhibit HCV infection of HCV susceptible cells of the subject.

106. The HCV neutralizing antibody conjugate according to claim 101 or claim 102, wherein the polymer is selected from the group consisting of hydrophilic polyvinyl polymers, polyalkylene ethers, polyoxyalkylenes, polymethacrylates, carbomers, branched polysaccharides, unbranched polysaccharides, polymers of sugar alcohols, heparin and heparan.

107. The HCV neutralizing antibody conjugate according to claim 103, wherein the polymer is selected from the group consisting of hydrophilic polyvinyl polymers, polyalkylene ethers, polyoxyalkylenes, polymethacrylates, carbomers, branched polysaccharides, unbranched polysaccharides, polymers of sugar alcohols, heparin and heparon

108. The HCV neutralizing antibody conjugate according to claim 106, wherein the polyalkylene ether is polyethylene glycol (PEG) or a derivative thereof.

109. The HCV neutralizing antibody conjugate according to claim 107, wherein the polyalkylene ether is polyethylene glycol (PEG) or a derivative thereof.

110. The HCV neutralizing antibody conjugate according to claim 108, wherein at least one PEG has an average molecular weight of at least 20 kD.

111. The HCV neutralizing antibody conjugate according to claim 109, wherein at least one PEG has an average molecular weight of at least 20 kD.

112. The HCV neutralizing antibody conjugate according to claim 106, wherein the conjugate has at least one of an increase in serum half-life, an increase in mean residence time in the circulation and a decrease in serum clearance rate, compared to an unconjugated HCV neutralizing antibody or fragment thereof.

113. The HCV neutralizing antibody conjugate according to claim 107, wherein the conjugate has at least one of an increase in serum half-life, an increase in mean residence time in the circulation and a decrease in serum clearance rate, compared to an unconjugated anti HCV neutralizing antibody or fragment thereof

114. The method according to any of claims 32 to 35, 59 to 64, or 95 to 100, wherein the HCV neutralizing antibody is administered to the subject by a route of administration selected from intravenous, intramuscular, subcutaneous, or oral routes.

115. The method according to claim 114, wherein the HCV neutralizing antibody is administered continuously to the subject.

116. The method according to claim 114, wherein the HCV neutralizing antibody is administered at predetermined periodic intervals to the subject.

117. The method according to claim 1 14, which further comprises labeling the HCV neutralizing antibody with a detectable marker.

118. The method according to claim 117, wherein the detectable marker is a radioactive or a fluorescent marker.

119. The method according to claim 114, wherein the dosage of the HCV neutralizing antibody ranges from about 0.1 to about 100,000 μg/kg body weight of the subject.

120. The method according to any of claims 32 to 35, 59 to 64, or 95 to 100, wherein the amount of the antibody is effective in reducing a viral load in the subject.

121. The method according to claim 104, wherein the amount of the conjugate is effective in reducing a viral load in the subject.

122. The method according to claim 105, wherein the amount of the conjugate is effective in reducing a viral load in the subject.

123. The method according to any of claims 32 to 35, 59 to 64, or 95 to 100, which further comprises administering to the subject at least one conventional antiviral agent.

124. The method according to claim 104, which further comprises administering to the subject at least one conventional antiviral agent.

125. The method according to claim 105, which further comprises administering to the subject at least one conventional antiviral agent.

126. The method according to claim 104, wherein the conjugate is administered to the subject by a route selected from intravenous, intramuscular, subcutaneous, or oral routes.

127. The method according to claim 105, wherein the conjugate is administered to the subject by a route selected from intravenous, intramuscular, subcutaneous, or oral routes.

128. The method according to claim 126, wherein the conjugate is administered continuously to the subject.

129. The method according to claim 126, wherein the conjugate is administered at predetermined periodic intervals to the subject.

130. The method according to claim 127, wherein the conjugate is administered continuously to the subject.

131. The method according to claim 127, wherein the conjugate is administered at predetermined periodic intervals to the subject.

132. A vector comprising the nucleic acid according to claim 68 or claim 69.

133. A transformed host cell comprising the vector according to claim 132.

134. A vector comprising the nucleic acid according to claim 72 or claim 73.

135. A transformed host cell comprising the vector according to claim 134.

136. A vector comprising the nucleic acid according to claim 76 or claim 77.

137. A transformed host cell comprising the vector according to claim 136.

138. A vector comprising the nucleic acid according to claim 80 or claim 81.

139. A transformed host cell comprising the vector according to claim 138.

140. A vector comprising a nucleic acid sequence encoding a heavy chain polypeptide of an HCV neutralizing antibody, wherein the heavy chain polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 12.

141. A vector comprising a nucleic acid sequence encoding a light chain polypeptide of an HCV neutralizing antibody, wherein the light chain polypeptide comprises the amino acid sequence set forth in SEQ ID NO:11.

142. A vector comprising a nucleic acid sequence encoding a variable region of a heavy chain of an HCV neutralizing antibody, wherein the variable region of the heavy chain comprises the amino acid sequence set forth in SEQ ID NO:2.

143. A transformed host cell comprising the vector according to claim 142.

144. A vector comprising a nucleic acid sequence encoding a variable region of a light chain of an HCV neutralizing antibody, wherein the variable region of the light chain comprises the amino acid sequence set forth in SEQ ID NO: 1.

145. A transformed host cell comprising the vector according to claim 144.

146. A vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises the amino acid sequence selected from the sequences set forth in SEQ ID NOS: 15, 16, or 17

147. The vector according to claim 146, wherein the nucleic acid sequence encodes a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 15.

148. The vector according to claim 146, wherein the nucleic acid sequence encodes a heavy chain comprising the amino acid sequence set forth in SEQ ID NO: 16.

149. A transformed host cell comprising the vector according to claim 146.

150. A transformed host cell comprising the vector according to claim 147.

151. A transformed host cell comprising the vector according to claim 148.

152. A vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises a variable region having the amino acid sequence as set forth in SEQ ID NO: 18 or SEQ ID NO: 19.

153. The vector according to claim 152, wherein the nucleic acid sequence encodes a light chain comprising the amino acid sequence set forth in SEQ ID NO: 19.

154. A transformed host cell comprising the vector according to claim 152.

155. A transformed host cell comprising the vector according to claim 153.

156. A transformed host cell comprising one or more vectors, wherein (i) the one or more vectors comprise a nucleic acid sequence encoding two light chains of an HCV neutralizing antibody, wherein the light chains comprise the amino acid sequence set forth in SEQ ID NO: 11 , and wherein (ii) the one or more vectors comprise a nucleic acid sequence encoding two heavy chains of an HCV neutralizing antibody, wherein the heavy chains comprise the amino acid sequence set forth in SEQ ID NO: 12.

157. The transformed host cell according to claim 156, wherein the nucleic acid encoding the light chains of the HCV neutralizing antibody comprises the sequence set forth in SEQ ID NO: 13.

158. The transformed host cell according to claim 156, wherein the nucleic acid encoding the heavy chains of the HCV neutralizing antibody comprises the sequence set forth in SEQ ID NO: 14.

159. A transformed host cell comprising one or more vectors, wherein (i) the one or moτe vectors comprise a nucleic acid sequence encoding two light chains of an HCV neutralizing antibody, wherein the light chains comprise variable regions having the amino acid sequence set forth in SEQ ID NO:1, and wherein (ii) the one or more vectors comprise a nucleic acid sequence encoding two heavy chains of an HCV neutralizing antibody, wherein the heavy chains comprise variable regions having the amino acid sequence set forth in SEQ ID NO:2.

160. The transformed host cell according to claim 159, wherein the nucleic acid encoding the light chains of the HCV neutralizing antibody comprises the sequence set forth in SEQ ID NO:3.

161. The transformed host cell according to claim 159, wherein the nucleic acid encoding the heavy chains of the HCV neutralizing antibody comprises the sequence set forth in SEQ ID NO:4.

162. A transformed host cell comprising one or more vectors, wherein (i) the one or more vectors comprise a nucleic acid sequence encoding two heavy chains of an HCV neutralizing aniibody, wherein the heavy chains comprise variable regions having an amino acid sequence set forth in SEQ ID NO: 15 or SEQ ID NO: 16, and (ii) the one or more vectors comprise a nucleic acid sequence encoding two light chains of the HCV neutralizing antibody, wherein the light chains comprise variable regions having an amino acid sequence set forth in SEQ ID NO: 19.

163. The transformed host cell according to claim 162, wherein (i) the one or more vectors comprise a nucleic acid sequence encoding heavy chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO: 15, and (ii) the one or more vectors comprise a nucleic acid sequence encoding light chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO: 19.

164. The transformed host cell according to claim 162, wherein (i) the one or more vectors comprise a nucleic acid sequence encoding heavy chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO: 16, and (ii) the one or more vectors comprise a nucleic acid sequence encoding light chains comprising variable regions having the amino acid sequence set forth in SEQ ID NO:19.

165. The transformed host cell according to any of claims 133, 135, 137, 143, 145, 149 to 151, 154, 155, or 157 to 164, wherein the cell is a mammalian cell.

166. The transformed host cell according to claiml 65, wherein the cell is a COS cell, a CHO cell or a myeloma cell.

167. The transformed host cell according to claim 165, wherein the cell secretes the HCV neutralizing antibody.

168. A process for producing an HCV neutralizing antibody which comprises culturing a host cell containing therein a vector according to any of claims 132, 134, 136, 138, 140 to 142, 144, 146 to 148, 152, or 153 under conditions permitting the production of the HCV neutralizing antibody.

169. A process for producing an HCV neutralizing antibody which comprises: transforming a host cell with a vector according to any of claims 132, 134, 136, 138, 140 to 142, 144, 146 to 148, 152, or 153; and culturing the transformed host cell under conditions permitting production of the HCV neutralizing antibody.

170. The process according to claim 168, which further comprises recovering the HCV neutralizing antibody so produced in isolated form.

171. The process according to claim 169, which further comprises recovering the HCV neutralizing antibody so produced in isolated form.

172. The process according to claim 168, wherein the host cell is a mammalian cell.

173. The process according to claim 169, wherein the host cell is a mammalian cell.

174. The process according to claim 168, wherein the mammalian host cell is a COS cell, a CHO cell or a myeloma cell.

175. The process according to claim 169, wherein the mammalian host cell is a COS cell, a CHO cell or a myeloma cell.

176. A kit for use in a process of producing an HCV neutralizing antibody, comprising: (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises the variable region amino acid sequence set forth in SEQ ID NO:1 , and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises the variable region amino acid sequence set forth in SEQ ID NO:2.

177. A kit for use in a process of producing an HCV neutralizing antibody, comprising: (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises the amino acid sequence set forth in SEQ ID NO:11 , and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises the amino acid sequence as set forth in SEQ ID NO: 12.

178. A kit for use in a process of producing an HCV neutralizing antibody, comprising: (a) a vector comprising a nucleic acid sequence encoding a light chain of an HCV neutralizing antibody, wherein the light chain comprises the variable region amino acid sequence set forth in SEQ ID NO: 19, and (b) a vector comprising a nucleic acid sequence encoding a heavy chain of an HCV neutralizing antibody, wherein the heavy chain comprises the variable region amino acid sequence set forth in SEQ ID NO: 15 or SEQ ID NO: 16.

179. The kit according to claim 178, wherein (a) the vector comprises a nucleic acid sequence encoding the light chain variable region amino acid sequence set forth in SEQ ID NO: 19, and (b) the vector comprises a nucleic acid sequence encoding the heavy chain variable region amino acid sequence set forth in SEQ ID NO:15.

180. The kit according to claim 178, wherein (a) the vector comprises a nucleic acid sequence encoding the light chain variable region amino acid sequence set forth in SEQ ID NO:19, and (b) the vector comprises a nucleic acid sequence encoding the heavy chain variable region amino acid sequence set forth in SEQ ID NO:16.

181. An HCV neutralizing antibody conjugate comprising an HCV neutralizing antibody according to claim 1 or claim 13, conjugated to at least one polymer.

182. The HCV neutralizing antibody conjugate according to claim 181, wherein the polymer is selected from the group consisting of hydrophilic polyvinyl polymers, polyalkylene ethers, polyoxyalkylenes, polymethacrylates, carbomers, branched polysaccharides, unbranched polysaccharides, polymers of sugar alcohols, heparin and heparan.

183. The HCV neutralizing antibody conjugate according to claim 182, wherein the polyalkylene ether is polyethylene glycol (PEG) or a derivative thereof.