WO2007141316A2

WO2007141316A2 - Glycolic acid production by fermentation from renewable resources

Info

Publication number: WO2007141316A2
Application number: PCT/EP2007/055625
Authority: WO
Inventors: Philippe Soucaille
Original assignee: Metabolic Explorer
Priority date: 2006-06-09
Filing date: 2007-06-07
Publication date: 2007-12-13
Also published as: CA2654182A1; BRPI0712876A2; RU2008152832A; CN101466841A; JP2009539361A; US9034615B2; ES2691206T3; JP2014014364A; ZA200809973B; BRPI0712876B1; US20090155867A1; WO2007141316A3; KR20090029256A; MX2008015737A; AU2007255339A1; CN101466841B; WO2007140816A1; AR061304A1; KR101519670B1; IL195380A0

Abstract

The present invention provides a method for the biological production of glyco lic acid from a fermentable carbon source in a microorganism. In one aspect of the present invention, a process for the conversion of glucose to glycolic acid is achieved by the use of a recombinant organism comprising a host E. coli transformed i) to attenuate the glyoxylate consuming pathways to other compounds than glycolate ii) to use an NADPH glyoxylate reductase to convert glyoxylate to glycolate iii) to attenuate the level o f all the glycolate metabolizing enzymes and iv) increase the flux in the glyoxylate pathway. In another aspect of the present invention, the process for the production of glycolic acid from a fermentable carbon source, using a recombinant E. coli, is improved by increasing the NADPH availability in the cells. Optionally the glycolic acid produced can be purified through a step of polymerization to at least glycolic acid dimers and recovered by depolymerisation from glycolic acid dimers, oligomers and/or polymers.

Description

Glycolic acid production by fermentation from renewable resources

FIELD OF INVENTION

The invention comprises a process for the bioconversion of a fermentable carbon source to glycolic acid by an aerobically-grown microorganism.

BACKGROUND OF THE INVENTION

Glycolic acid (HOCH₂COOH) is the first member of the alpha-hydroxy acid family of carboxylic acids. Glycolic acid has dual functionality with both alcohol and moderately strong acid functional groups on a very small molecule. This results in unique chemical attributes as well as typical acid and alcohol chemistry.

Glycolic acid uses both the hydroxyl and carboxylic acid groups to form five- member ring complexes (chelates) with polyvalent metals. This metal ion complexing ability is useful in dissolution of hard water scale and prevention of deposition, especially in acid cleaning applications where good rinsibility is a key factor. Glycolic acid undergoes reactions with organic alcohols and acids to form esters. Low molecular weight alkyl glycolic esters have unusual solvency properties and may be used as a substitute for n- and iso-propanol, ethylenediamine, phenol, m-cresol, 2-ethoxyethyl acetate, and ethyl and methyl lactate. Higher molecular weight alkyl esters can be used in personal care product formulations. Glycolic acid can react with itself to form dimeric glycolide, head-to-tail polyester oligomers, and long-chain polymers. Copolymers can be made with other alpha hydroxy acids like lactic acid. The polyester polymers gradually hydro lyze in aqueous environments at controllable rates. This property makes them useful in biomedical applications such as dissolvable sutures and in applications where a controlled release of acid is needed to reduce pH. Currently more than 15,000 tons of glycolic acid are consumed annually in the United states.

The biological production of glycolic acid, presented in figure 1, requires the formation of glyoxylate as an intermediate which is reduced to glycolate by a NADPH dependent oxidoreductase encoded by the gene ycdW (Nunez et al, (2001) Biochemistry,

354, 707-715). Glyoxylate is an intermediate of the glyoxylate cycle (Tricarboxylic acid cycle and glyoxylate bypass, reviewed in Neidhardt, F. C. (Ed. in Chief), R. Curtiss III, J.

L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (eds). 1996. Escherichia coli and Salmonella: Cellular and Molecular Biology. American Society for Microbiology). In this cycle isocitrate is cleaved into succinate and glyoxylate, a reaction that is catalyzed by isocitrate lyase, encoded by the aceA gene. Succinate directly enters the citric acid cycle and is converted into oxaloacetate. Glyoxylate is converted into malate by incorporating a molecule of acetyl-CoA derived from acetate a reaction catalyzed by the two malate synthase isoenzymes encoded by aceB and gclB. The entry of carbon into the glyoxylate shunt is regulated on the transcriptional and posttranscriptional level. Transcriptional regulation is exerted on the aceBAK operon by the IcIR repressor. AceBAK encode malate synthase, isocitrate lyase and isocitrate kinase/phosphatase, respectively. The iclR gene is negatively autoregulated and activated by the FadR protein. The activity of isocitrate dehydrogenase, encoded by the icd gene, is regulated posttranscriptionally. Isocitrate dehydrogenase and isocitrate lyase compete for the common substrate isocitrate. Since the K_m value for isocitrate is significantly higher for the isocitrate lyase reaction, the entry into the glyoxylate pathway depends in part on the regulation of the isocitrate dehydrogenase enzyme. Isocitrate dehydrogenase activity is modulated by its phosphorylation or dephosphorylation catalyzed by AceK. Phosphorylation reduces the activity of led and dephosphorylation reactivates the led enzyme. If AceK acts as kinase or phosphatase depends on the presence of several metabolites. Depletion of isocitrate and 3- phosphoglycerate stimulates kinase activity; the presence of pyruvate and AMP inhibits the kinase function thus favoring the phosphatase activity (see also Neidhard). Glyoxylate can be converted to tartronate semialdehyde by a glyoxylate carboligase encoded by gel and to 2-keto-4-hydroxy glutarate by a 2-keto-3-deoxygluconate 6-phosphate aldolase encoded by eda while glycolate can be reduced to glycoaldehyde by a NAD⁺ dependent glycoaldehyde dehydrogenase encoded by aldA or oxidized to glyoxylate by a NAD⁺ dependent glycolate oxidase encoded by g/cDEF.

The problem to be solved by the present invention is the biological production of glycolic acid from an inexpensive carbon substrate such as glucose or other sugars. The number of biochemical steps and the complexity of the metabolic pathways necessitate, for an industrial feasible process of glycolic acid production, the use of a metabolically engineered whole cell catalyst.

SUMMARY OF THE INVENTION

Applicants have solved the stated problem and the present invention provides a method for bioconverting a fermentable carbon source directly to glycolic acid. Glucose is used as a model substrate and recombinant E. coli is used as the model host. In one aspect of this invention, recombinant E. coli unable to metabolize glyoxylate to other compounds than glycolate are constructed by inactivating the genes coding for the malate synthases {aceB and glcB), the glyoxylate carboligase (gel) and the 2-keto-3-deoxygluconate 6- phosphate aldolase (eda). In another aspect of this invention, an NADPH dependant glyoxylate reductase activity is used to reduce the toxic glyoxylate into glycolate by using endogenous encoding genes like ycdW or yiaE. In a further aspect of this invention the gene encoding the glycolate metabolizing enzymes, glycolate oxidase (g/cDEF) and glycoaldehyde dehydrogenase (aldA) are deleted. Futhermore, the flux in the glyoxylate pathway is increased by i) increasing the level of aceA by inactivating the iclR gene or directly increasing the expression of aceA, ii) decreasing the expression level or inactivating the gene encoding the isocitrate dehydrogenase (icd) and iii) inactivating the genes encoding the pyruvate oxidase (poxB) and the acetate pathway (ack, pta). In a final aspect of this invention, a better yield of glycolate production is obtained by increasing NADPH availability by inactivating the genes encoding the glucose-6-phosphate isomerase ipgϊ), the 6-phosphogluconate dehydratase (edd) and the soluble transhydrogenase (udhA). The present invention may be generally applied to include any carbon substrate that is readily converted to acetyl-coA.

Accordingly it is an object of the present invention to provide a recombinant organism, useful for the production of glycolic acid comprising: (a) at least inactivation of all the malate synthases, glyoxylate carboligases and 2-keto-3-deoxygluconate 6-phosphate aldolase encoding genes; (b) at least one gene encoding a polypeptide having NADPH dependent glyoxylate reductase activity and (c) at least inactivation of the genes encoding NAD⁺ dependant glycolate oxidation to glyoxylate. Optionally the recombinant organism may comprise i) inactivating mutations in endogenous genes selected from the group consisting of: (a) a gene encoding a repressor of the glyoxylate pathway (b) a gene encoding a polypeptide having glucose-6-phosphate isomerase activity, (c) a gene encoding a polypeptide having soluble transhydrogenase activity, (d) a gene encoding a polypeptide having 6-phosphogluconate dehydratase activity (e) genes encoding polypeptides having phospho-transacetylase and acetate kinase activities, (f) a gene encoding pyruvate oxidase activity (g) a gene encoding glycoaldehyde dehydrogenase activity ii) increase level of a gene encoding isocitrate lyase and iii) decrease level or inactivation of a gene encoding polypeptide having isocitrate dehydrogenase activity.

In another embodiment the invention provides a process for the production of glycolic acid from a recombinant organism comprising: (a) contacting the recombinant organism of the present invention with at least one carbon source selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and single-carbon substrates whereby glycolate is produced; optionally (b) recovering the glycolic acid produced in (a) through a step of polymerization to at least glycolic acid dimers and (c) recovery of glycolic acid by depolymerisation from glycolic acid dimmers, oligomers and/or polymers. BRIEF DESCRIPTION OF THE DRAWINGS

The accompanying drawings which are incorporated in and constitute a part of this specification exemplify the invention and together with the description, serve to explain the principles of this invention.

Figure 1 depicts the genetic engineering of glycolysis, TCA cycle and glyoxylate pathway in the development of glycolic acid production system from carbohydrates. Figure 2 is a diagram showing the construction of the vector pMElOl- ycdW.

DETAILED DESCRIPTION OF THE INVENTION

As used herein the following terms may be used for interpretation of the claims and specification. The term "mutant strain" refers to a non-wild type strain.

The term "microorganism" refers to all kind of unicellular organisms, including procaryotic organisms like bacteria, and eucaryotic organisms like yeasts. Bacteria include in particular : Enterobacteriaceae, Bacillaceae, Streptomycetaceae and Corynebacteriaceae. Enterobacteriaceae comprise in particular but not exclusively the genera Escherichia, Klebsiella, Salmonella and Pantoea.

The term "transformation" or "transfection" refers to the acquisition of new genes in a cell after the incorporation of exogenous nucleic acid. The term "transformant" refers to the product of a transformation. The term "genetically altered" refers to the process of changing hereditary material by transformation or mutation.

The term "attenuation" refers to a decreased expression of a gene or a decreased activity of the protein, product of the gene. The man skilled in the art knows numerous means to obtain this result, and for example:

Introduction of a mutation into the gene, decreasing the expression level of this gene, or the level of activity of the encoded protein.

Replacement of the natural promoter of the gene by a low strength promoter, resulting in a lower expression.

Use of elements destabilizing the corresponding messenger RNA or the protein

Deletion of the gene if no expression is needed. The term "expression" refers to the transcription and translation from a gene to the protein, product of the gene. The term "plasmid" or "vector" as used herein refers to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules.

The term "carbon substrate" or "carbon source" means any carbon source capable of being metabolized by a microorganism wherein the substrate contains at least one carbon atom. Authors refer particularly to renewable, inexpensive and fermentable carbon sources such as monosaccharides, oligosaccharides, polysaccharides, single-carbon substrates, and polyols such as glycerol. Single carbon substrate are defined as carbon molecules that contain only one carbon atom such as methanol. Monosaccharides of the formula (CH₂O)_n are also called oses or "simple sugars"; monosaccharides include saccharose, fructose, glucose, galactose and mannose. Other carbon sources comprising more than one monosaccharide are called disaccharides, trisaccharides, oligosaccharides and polysaccharides. Disaccharides include saccharose (sucrose), lactose and maltose. Starch and hemicellulose are polysaccharides, also known as "complex sugars". Therefore the term "carbon source" means any product as cited above, and mixtures thereof.

The term "ATCC" will stand for the American Type Culture Collection, 12301 Parklawn

Drive, Rockville, Md. 20852, U.S.A. The terms "glyoxylate" and "glyoxylic acid" are used interchangeably.

The terms "glycolate" and "glycolic acid" are used interchangeably.

In the description of the present invention, enzymes are identified by their specific activities. This definition thus includes all polypeptides that have the defined specific activity also present in other organisms, more particularly in other microorganisms. Often enzymes with similar activities can be identified by their grouping to certain families defined as PFAM or COG.

PFAM (protein families database of alignments and hidden Markov models; http ://www. Sanger . ac.uk/Software/Pfam/) represents a large collection of protein sequence alignments. Each PFAM makes it possible to visualize multiple alignments, see protein domains, evaluate distribution among organisms, gain access to other databases, and visualize known protein structures.

COGs (clusters of orthologous groups of proteins; http://www.ncbi.nlm.nih.gov/COG/) are obtained by comparing protein sequences from 43 fully sequenced genomes representing 30 major phylogenic lines. Each COG is defined from at least three lines, which permits the identification of former conserved domains.

The means of identifying homologous sequences and their percentage homologies are well known to those skilled in the art, and include in particular the BLAST programs, which can be used from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that website. The sequences obtained can then be exploited (e.g., aligned) using, for example, the programs CLUSTALW (http://www.ebi.ac.uk/clustalw/) or MULTALIN (http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl), with the default parameters indicated on those websites. Using the references given on GenBank for known genes, those skilled in the art are able to determine the equivalent genes in other organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. This routine work is advantageously done using consensus sequences that can be determined by carrying out sequence alignments with genes derived from other microorganisms, and designing degenerate probes to clone the corresponding gene in another organism. These routine methods of molecular biology are well known to those skilled in the art, and are described, for example, in Sambrook et al. (1989 Molecular Cloning: a Laboratory Manual. 2^nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, New York.). The present invention provides a method for the fermentative production of gly colic acid, its derivatives or precursors, by culturing a microorganism in an appropriate culture medium comprising a carbon source and the recovery of glycolic acid from the culture medium.

A further embodiment of the invention provides a method wherein the microorganism is modified to have a low capacity of glyoxylate conversion, except to produce glycolate, due to the attenuation of genes encoding for enzymes consuming glyoxylate, a key precursor of glycolate: aceB and gclB genes encoding malate synthases, gel encoding glyoxylate carboligase and eda encoding 2-keto-3-deoxygluconate 6- phosphate aldolase.

In another embodiment of the invention, the microorganism contains at least one gene encoding a polypeptide catalyzing the conversion of glyoxylate to glycolate.

In particular, a gene encoding a NADPH dependent glyoxylate reductase enzyme is present to convert, under aerobic conditions, the toxic glyoxylate intermediate to the low toxicity final product glycolate. The gene can be exogenous or endogenous and can be expressed chromosomally or extrachromosomally. An NADPH-dependant glyoxylate reductase encoding gene can be taken among the ycdW or yiaE genes from the genome of E. coli MG1655. In a preferred embodiment, the expression of at least one of said genes is increased. If needed a high level of NADPH-dependant glyoxylate reductase activity can be obtained from chromosomally located genes by using one or several copies on the genome that can be introduced by methods of recombination known to the expert in the field. For extrachromosomal genes, different types of plasmids that differ with respect to their origin of replication and thus their copy number in the cell can be used. They may be present as 1-5 copies, ca 20 or up to 500 copies corresponding to low copy number plasmids with tight replication (pSClOl, RK2), low copy number plasmids (pACYC, pRSFlOlO) or high copy number plasmids (pSK bluescript II). The ycdW or yiaE genes may be expressed using promoters with different strength that need or need not to be induced by inducer molecules. Examples are the promoters Ptrc, Ptac, Plac, the lambda promoter cl or other promoters known to the expert in the field. Expression of the genes may also be boosted by elements stabilizing the corresponding messenger RNA (Carrier and Keasling (1998) Biotechnol. Prog. 15, 58-64) or the protein (e.g. GST tags, Amersham Biosciences).

In a further embodiment of the invention, the microorganism is modified in such a way that it is unable to substantially metabolize glycolate. This result can be achieved by the attenuation of at least one of the genes encoding for enzymes consuming glycolate

(glcDEF encoding glycolate oxidase and aldA encoding glycoaldehyde dehydrogenase).

Attenuation of genes can be done by replacing the natural promoter by a low strength promoter or by element destabilizing the corresponding messenger RNA or the protein. If needed, complete attenuation of the gene can also be achieved by a deletion of the corresponding DNA sequence.

In another embodiment, the microorganism used in the method of the invention is transformed to increase the glyoxylate pathway flux.

The flux in the glyoxylate pathway may be increased by different means, and in particular: i) decreasing the activity of the enzyme isocitrate dehydrogenase (led), ii) decreasing the activity of at least one of the following enzymes:

• phospho-transacetylase, encoded by the pta gene

• acetate kinase, encoded by the ack gene

• pyruvate oxidase, encoded by the/wxB gene by attenuation of the genes, iii) increasing the activity of the enzyme isocitrate lyase, encoded by the aceA gene.

Decreasing the level of isocitrate dehydrogenase can be accomplished by introducing artificial promoters that drive the expression of the icd gene, coding for the isocitrate dehydrogenase, or by introducing mutations into the icd gene that reduce the enzymatic activity of the protein.

Since the activity of the protein led is reduced by phosphorylation, it may also be controlled by introducing mutant aceK genes that have increased kinase activity or reduced phosphatase activity compared to the wild type AceK enzyme. Increasing the activity of the isocitrate lyase can be accomplished either by attenuating the level oϊiclR orfadR genes, coding for glyoxylate pathway repressors, either by stimulating the expression of the aceA gene, for example by introducing artificial promoters that drive the expression of the gene, or by introducing mutations into the aceA gene that increase the activity the encoded protein.

An embodiment of the invention provides a better yield of glycolate production by increasing NADPH availability to the NADPH-dependant glyoxylate reductase. This modification of the microorganism characteristics can be obtained through the attenuation of at least one of the genes selected among the following : pgi encoding the glucose-6- phosphate isomerase, udhA encoding the soluble transhydrogenase and edd encoding the 6- phosphogluconate dehydratase activity. With such genetic modifications, all the glucose-6- phosphate will have to enter glycolysis through the pentose phosphate pathway and 2

NADPH will be produced per glucose-6-phosphate metabolized.

In another embodiment the invention provides a process for the fermentative production of glycolic acid from a recombinant organism comprising: (a) contacting the recombinant organism of the present invention with at least one carbon source selected from the group consisting of glucose, sucrose, monosaccharides, oligosaccharides, polysaccharides, starch or its derivatives, glycerol and single-carbon substrates whereby glyoxylic acid is produced. Optionaly the process comprises a step of concentration of glycolate in the bacteria or in the medium and isolation of glycolic acid from the fermentation broth and/or the biomass optionally remaining in portions or in the total amount (0-100%) in the end product. Optionally the process comprises a step of recovery of the glycolic acid produced in step (a) through a step of polymerization to at least glycolic acid dimers and (b) recovery of glycolic acid by depolymerisation from glycolic acid dimers, oligomers and/or polymers. Those skilled in the art are able to define the culture conditions for the microorganisms according to the invention. In particular the bacteria are fermented at a temperature between 20⁰C and 55°C, preferentially between 25°C and 40⁰C, and more specifically about 30⁰C for C. glutamicum and about 37°C for E. coli. The fermentation is generally conducted in fermenters with an inorganic culture medium of known defined composition adapted to the bacteria used, containing at least one simple carbon source, and if necessary a co-substrate necessary for the production of the metabolite.

The invention is also related to the microorganism as described previously. Preferably, this microorganism is selected among the group consisting of E. coli, C. glutamicum or S. cerevisiae. EXAMPLE 1

Construction of strains unable to metabolize glyoxylate except to reduce it to glycolate : MGl 655 AaceB Agcl AgIcB

To delete the aceB gene the homologous recombination strategy described by Datsenko & Wanner (2000) is used. This strategy allows the insertion of a chloramphenicol or a kanamycin resistance cassette, while deleting most of the genes concerned. For this purpose the following oligonucleotides are used: DaceBF (SEQ ID NO 1) ggcaacaacaaccgatgaactggctttcacaaggccgtatggcgagcaggagaagcaaattcttactgccgaagcggtagCA TATGAATATCCTCCTTAG with

- a region (lower case) homologous to the sequence (4213068-4213147) of the gene aceB (reference sequence on the website http ://genolist.pasteur. fr/Co libri/),

- a region (upper case) for the amplification of the chloramphenicol resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),

DaceBR (SEQ ID NO 2)) ggcggtagcctggcagggtcaggaaatcaattaactcatcggaagtggtgatctgttccatcaagcgtgcggcatcgtcTGTAG

GCTGGAGCTGCTTCG with - a region (lower case) homologous to the sequence (4214647-4214569) of the gene aceB (reference sequence on the website http ://genolist.pasteur. fr/Co libri/),

- a region (upper case) for the amplification of the chloramphenicol resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645).

The oligonucleotides DaceBF and DaceBR are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3. The PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46), in which the Red recombinase enzyme expressed permits the homologous recombination. The chloramphenicol resistant transformants are then selected and the insertion of the resistance cassette is verified by a

PCR analysis with the oligonucleotides aceBF and aceBR defined below. The strain retained is designated MG 1655 ΔαceB::Cm aceBF (SEQ ID NO 3) : cgttaagcgattcagcaccttacc (homologous to the sequence from

4212807 to 4212830). aceBR (SEQ ID NO 4) : ccagtttctgaatagcttcc (homologous to the sequence from 4215327 to 4215308). Then, the gel gene is deleted in the MG1655 ΔαceB::Cm strain by transduction.

The MG1655 Δgc/::Km strain is first constructed using the same method as previously described with the following oligonucleotides : DgclF (SEQ ID NO 5) ggcaaaaatgagagccgttgacgcggcaatgtatgtgctggagaaagaaggtatcactaccgccttcggtgttccgggagcTG

TAGGCTGGAGCTGCTTCG with - a region (lower case) homologous to the sequence (533142-533224) of the region of the gene gel (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

- a region (upper case) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),

DgipR (SEQ ID NO 6) gcgttacgttttaacggtacggatccatccagcgtaaaccggcttccgtggtggtttggggtttatattcacacccaacccCATAT GAATATCCTCCTTAG with

- a region (lower case) homologous to the sequence (535720-535640) of the region of the gene gel (reference sequence on the website http://genolist.pasteur.fr/Colibri/), - a region (upper case) for the amplification of the kanamycin resistance cassette

(reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645).

The oligonucleotides DgclF and DgipR are used to amplify the kanamycin resistance cassette from the plasmid pKD4. The PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46). The kanamycin resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides gclF and gipR defined below. The strain retained is designated MG1655 Δgc/::Km. gclF (SEQ ID NO 7) : ggatatgcccaccttgctgaagg (homologous to the sequence from 532795 to 532817). gipR (SEQ ID NO 8) : cgcttagtttcaatcggggaaatgg (homologous to the sequence from 536114 to 536090).

To transfer the deletion Agcl: :Km, the method of phage Pl transduction is used. The protocol followed is implemented in 2 steps with the preparation of the phage lysate of the strain MG1655 Δgc/::Km and then transduction into strain MG1655 ΔαceB::Cm. The construction of the strain is described above. Preparation of phage lvsate Pl:

Inoculation with 100 μl of an overnight culture of the strain MG1655 Δgc/::Km of 10 ml of LB + Km 50 μg/ml + glucose 0.2% + CaCl₂ 5 mM. - Incubation for 30 min at 37°C with shaking.

Addition of 100 μl of phage lysate Pl prepared on the strain MG1655 (about 1.10⁹ phage/ml).

Shaking at 37°C for 3 hours until all the cells were lysed. Addition of 200 μl chloroform and vortexing.

Centrifugation for 10 min at 4500 g to eliminate cell debris.

Transfer of supernatant to a sterile tube and addition of 200 μl chloroform.

- Storage of lysate at 4°C. Transduction

Centrifuging for 10 min at 1500 g of 5 ml of an overnight culture of the strain MG1655

ΔαceB::Cm in LB medium.

Suspension of the cell pellet in 2.5 ml of 10 mM MgSO₄, 5 mM CaCl₂

- Control tubes: 100 μl cells 100 μl phages Pl of strain MG1655 Δgc/::Km

- Test tube: 100 μl of cells + 100 μl of phages Pl of the strain MG1655 Δgc/::Km. Incubation for 30 min at 30⁰C without shaking.

Addition of 100 μl of 1 M sodium citrate in each tube and vortexing.

- Addition of 1 ml of LB. - Incubation for 1 hour at 37°C with shaking.

Spreading on dishes LB + Km 50 μg/ml after centrifuging of tubes for 3 min at 7000 rpm.

Incubation at 37°C overnight. Verification of the strain The kanamycin resistant transformants are then selected and the deletion of the gene Agcl: :Km is verified by a PCR analysis with the oligonucleotides gclF and gipR previously described. The strain retained is designated MG 1655 ΔαceB::Cm Agcl: :Km.

The kanamycin and chloramphenicol resistance cassettes can then be eliminated. The plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the kanamycin and the chloramphenicol resistance cassettes is then introduced into the recombinant sites by electroporation. After a series of cultures at 42°C, the loss of the kanamycin and chloramphenicol resistance cassettes is verified by a PCR analysis with the same oligonucleotides as used previously (aceBF / aceBR and gclF / gipR). The strain retained is designated MG 1655 AaceB Agcl. Then, the glcB gene is deleted in the MG1655 AaceB Agcl strain by transduction.

The MG1655 Δg/cB::Km is first constructed using the same method as previously described with the following oligonucleotides : DgIcBR (SEQ ID NO 9) cccagagccgtttacgcattgacgccaattttaaacgttttgtggatgaagaagttttaccgggaacagggctggacgcCATAT GAATATCCTCCTTAG with

- a region (lower case) homologous to the sequence (3121805-3121727) of the region of the gene glcB (reference sequence on the website http://genolist.pasteur.fr/Colibri/), - a region (upper case) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),

DgIcBF (SEQ ID NO 10) cgcgtaaacgccaggcgtgtaataacggttcggtatagccgtttggctgtttcacgccgaggaagattaaatcgctggcTGTAG GCTGGAGCTGCTTCG with

- a region (lower case) homologous to the sequence (3119667-3119745) of the region of the gene g/cB (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

- a region (upper case) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645).

The oligonucleotides DgIcBF and DgIcBR are used to amplify the kanamycin resistance cassette from the plasmid pKD4. The PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46). The kanamycin resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides glcBF and glcBR defined below. The strain retained is designated MG1655 Δg/cB::Km. glcBR (SEQ ID NO 11) : gccagcaaatggcgagtgc (homologous to the sequence from

3122225 to 3122207). glcBF (SEQ ID NO 12) : cgcagagtatcgttaagatgtcc (homologous to the sequence from 3119475 to 3119497).

To transfer the deletion Δg/cB::Km, the method of phage Pl transduction is used. The preparation of the phage lysate of the strain MG1655 Δg/cB::Km is used for the transduction into strain MG 1655 AaceB Agcl.

The kanamycin resistant transformants are then selected and the deletion of the gene Δg/cB::Km is verified by a PCR analysis with the previously defined oligonucleotides glcBF and glcBR. The strain retained is designated MG 1655 AaceB Agcl

Δg/cB::Km.

The kanamycin resistance cassette can then be eliminated. The plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the kanamycin resistance cassette is then introduced into the recombinant sites by electroporation. After a series of cultures at

42°C, the loss of the kanamycin resistance cassette is verified by a PCR analysis with the same oligonucleotides as used previously (glcBF and glcBR). The strain retained is designated MG 1655 AaceB Agcl AgIcB. EXAMPLE 2

Construction of strains with increased level of NADPH dependent glyoxylate reductase : MG1655 AaceB Jgcl JgIcS (pME101-ycdW)

To boost the level of NADPH dependant glyoxylate reductase the ycdW gene is expressed from the plasmid pCL1920 (Lerner & Inouye, 1990, NAR 18, 15 p 4631) using the promoter Ptrc. For the expression from a low copy vector the plasmid pMElOl is constructed as follows. The plasmid pCL1920 is PCR amplified using the oligonucleotides PMElOlF and PMElOlR and the BstZ17I-XmnI fragment from the vector PTRC99A harboring the lad gene and the

promoter is inserted into the amplified vector. PMElOlF (SEQ ID NO 13) : Ccgacagtaagacgggtaagcctg PMElOlR (SEQ ID NO 14) : Agcttagtaaagccctcgctag

The ycdW gene is PCR amplified from genomic DNA using the following oligonucleotides:

Bspϊϊl ycdW (SEQ ID NO 15): agctagctctcatgagaataaatttcgcacaacgcttttcggg Smal ycdW (SEQ ID NO 16): gcatgcatcccgggtctctcctgtattcaattcccgcc

The PCR fragment is digested with BspYΑ and Smal and cloned into the vector pMElOl cut by the Ncol and Smal restriction enzymes resulting in plasmid pMElOl- ycdW. The pME101-ycdW plasmid is then introduced in the strain MG1655 AaceB Agcl AgIcB.

EXAMPLE 3

Construction of strains with decreased consumption of ^' glycolate : MGl 655 AaceB Agcl AgIcDEFGB AaIdA (pME101-ycdW)

The g/cDEFGB genes are deleted in the MG 1655 AaceB Agcl strain by transduction.

The MG1655 Δg/cDEFGB::Km is first constructed using the same method as previously described with the following oligonucleotides : DgIcDR (SEQ ID NO 17) gcgtcttgatggcgctttacccgatgtcgaccgcacatcggtactgatggcactgcgtgagcatgtccctggacttgagatccCA TATGAATATCCTCCTTAG with

- a region (lower case) homologous to the sequence (3126016-3125934) of the gene glcD (reference sequence on the website http ://genolist.pasteur. fr/Co libri/). - a region (upper case) for the amplification of the chloramphenicol resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),

DgIcBF (SEQ ID NO 18) cgcgtaaacgccaggcgtgtaataacggttcggtatagccgtttggctgtttcacgccgaggaagattaaatcgctggcTGTAG GCTGGAGCTGCTTCG with

The oligonucleotides DgIcDR and DgIcBF are used to amplify the kanamycin resistance cassette from the plasmid pKD4. The PCR product obtained is then introduced by electroporation into the strain MG 1655 (pKD46), in which the Red recombinase enzyme expressed permits the homologous recombination. The chloramphenicol resistant transformants are then selected and the insertion of the resistance cassette is verified by a

PCR analysis with the oligonucleotides glcDR and glcBF defined below. The strain retained is designated MG 1655 Δg/cDEFGB::Km glcDR (SEQ ID NO 19) : ccaagacaaggtcacagagc (homologous to the sequence from

3126183 to 3126164). glcBF (SEQ ID NO 20) : cgcagagtatcgttaagatgtcc (homologous to the sequence from

3119475 to 3119497).

To transfer the deletion Δg/cDEFGB::Km, the method of phage Pl transduction is used.

The preparation of the phage lysate of the strain MG 1655 Δg/cDEFGB::Km is used for the transduction into strain MG 1655 AaceB Agcl. The kanamycin resistant transformants are then selected and the deletion of the gene Δg/cDEFGB::Km is verified by a PCR analysis with the previously defined oligonucleotides glcBF and glcDR. The strain retained is designated MG 1655 AaceB Agcl

Δg/cDEFGB::Km.

Then, the aldh gene is deleted in the MG1655 AaceB Agcl Δg/cDEFGB::Km strain by transduction. The MG 1655 aid A::Cm is first constructed using the same method as previously described with the following oligonucleotides :

AIdA D r (SEQ ID NO 21) ttaagactgtaaataaaccacctgggtctgcagatattcatgcaagccatgtttaccatctgcgccgccaataccggatttCATAT

GAATATCCTCCTTAG with

- a region (lower case) homologous to the sequence (1487615 to 1487695) of the gene aldA (reference sequence on the website http ://genolist.pasteur. fr/Co libri/). - a region (upper case) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),

AIdA D f (SEQ ID NO 22) atgtcagtacccgttcaacatcctatgtatatcgatggacagtttgttacctggcgtggagacgcatggattgatgtggtaGTGTA GGCTGGAGCTGCTTCG with

- a region (lower case) homologous to the sequence (1486256 to 1486336) of the gene aldA (reference sequence on the website http ://genolist.pasteur. fr/Co libri/),

The oligonucleotides aldAF and aldAR are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3. The PCR product obtained is then introduced by electroporation into the strain MG 1655 (pKD46), in which the Red recombinase enzyme expressed permits the homologous recombination. The kanamycin resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides YdcFCf and gapCCR defined below. The strain retained is designated MG 1655 AaldAv.Cm.

YdcFCf (SEQ ID NO 23) : tgcagcggcgcacgatggcgacgttccgccg (homologous to the sequence from 1485722 to 1485752). gapCCR (SEQ ID NO 24) : cacgatgacgaccattcatgcctatactggc (homologous to the sequence from 1488195 to 1488225).

To transfer the deletion AaldAv.Cm., the method of phage Pl transduction is used. The preparation of the phage lysate of the strain MG1655 AaIdAwCm is used for the transduction into strain MG1655 AaceB Agcl Δg/cDEFGB: :Km.

The kanamycin resistant transformants are then selected and the deletion of the gene AaldAv.Cm is verified by a PCR analysis with the previously defined oligonucleotides YdcFCf and gapCCR. The strain retained is designated MG1655 AaceB Agcl Δg/cDEFGB: :Km ΔαWA::Cm. The kanamycin and chloramphenicol resistance cassettes can then be eliminated.

The plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the kanamycin and the chloramphenicol resistance cassettes is then introduced into the recombinant sites by electroporation. After a series of cultures at 42°C, the loss of the kanamycin and chloramphenicol resistance cassettes is verified by a PCR analysis with the same oligonucleotides as used previously (glcBF / glcDR and YdcFCf / gapCCR). The strain retained is designated MG 1655 AaceB Agcl Δg/cDEFGB AaIdA.

The pME101-ycdW plasmid is then introduced in the strain MG 1655 AaceB Agcl Δg/cDEFGB AaIdA. EXAMPLE 4

Construction of strains with increased flux in the glyoxylate pathway : MGl 655 AaceB Jgcl AgIcDEFGB AaIdA Aic\R (pME101-ycdW)

The z^'c/R gene deletion is introduced in the MG 1655 AαceB Agcl Δg/cDEFGB AαldA using the same strategy as previously described with the following oligonucleotides : DiclF (SEQ ID NO 25)

CgcacccattcccgcgaaacgcggcagaaaacccgccgttgccaccgcaccagcgactggacaggttcagtctttaacgcgT GTAGGCTGGAGCTGCTTCG with

- a region (lower case) homologous to the sequence (4221202-4221120) of the gene z^'c/R (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

DiclR (SEQ ID NO 26) gcgcattccaccgtacgccagcgtcacttccttcgccgctttaatcaccatcgcgccaaactcggtcacgcggtcatcggCATA

TGAATATCCTCCTTAG with - a region (lower case) homologous to the sequence (4220386-4220465) of the gene z^'c/R (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

The oligonucleotides DiclF and DiclR are used to amplify the kanamycin resistance cassette from the plasmid pKD4. The PCR product obtained is then introduced by electroporation into the strain MG 1655 AαceB Agcl Δg/cDEFGB AαldA (pKD46). The kanamycin resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides iclF and iclR defined below. The strain retained is designated MG 1655 AαceB Agcl Δg/cDEFGB AαldA Δzc/R::Km

IcIF (SEQ ID NO 27) : cctttgaggtcgcatggccagtcggc (homologous to the sequence from 4221558 to 4221533). iclR (SEQ ID NO 28) : gctttttaatagaggcgtcgccagctccttgcc (homologous to the sequence from 4219917 to 4219949). The kanamycin resistance cassette can then be eliminated. The plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the kanamycin resistance cassette is then introduced into the recombinant sites by electroporation. After a series of cultures at 42°C, the loss of the kanamycin resistance cassette is verified by a PCR analysis with the same oligonucleotides as used previously (iclF and iclR). The strain retained is designated MG1655 AaceB Agcl Δg/cDEFGB AaIdA AiclR.

The pME101-ycdW plasmid is then introduced in the strain MG 1655 AaceB Agcl Δg/cDEFGB AaIdA AiclR.

EXAMPLE 5

CONSTRUCTION OF STRAINS WITH INCREASED NADPH AVAILABILITY : MG1655 ΔaceB Δgcl ΔiclR ΔglcDEFGB ΔaldA Δedd-eda (pMElOl-ycdW)

The edd-eda genes are deleted in the MG 1655 AaceB Agcl AgIcB Δg/cDEF AaIdA AiclR strain by transduction.

The strain MG 1655 Aedd-eda::Cm is first constructed using the same method as previously described with the following oligonucleotides :

DeddF (SEQ ID NO 29)

CgcgcgagactcgctctgcttatctcgcccggatagaacaagcgaaaacttcgaccgttcatcgttcgcagttggcatgcggTG TAGGCTGGAGCTGCTTCG with

- a region (lower case) homologous to the sequence (1932582-1932500) of the region of the genes edd-eda (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

DedaR (SEQ ID NO 30) gcttagcgccttctacagcttcacgcgccagcttagtaatgcggtcgtaatcgcccgcttccagcgcatctgccggaaccCATA TGAATATCCTCCTTAG with

- a region (lower case) homologous to the sequence (1930144-1930223) of the region of the genes edd-eda (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

- a region (upper case) for the amplification of the chloramphenicol resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645), The oligonucleotides DeddF and DedaR are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3. The PCR product obtained is then introduced by electroporation into the strain MG1655 (pKD46). The chloramphenicol resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides eddF and edaR defined below. The strain retained is designated MG1655 Aedd-eda::Cm.

eddF (SEQ ID NO 31) : Gggtagactccattactgaggcgtgggcg (homologous to the sequence from 1932996 to 1932968). edaR (SEQ ID NO 32) : ccacatgataccgggatggtgacg (homologous to the sequence from 1929754 to 1929777).

To transfer the deletion Aedd-eda::Cm, the method of phage Pl transduction as previously described is used. The preparation of the phage lysate of the strain MG 1655 Aedd-eda::Cm was used for the transduction into strain MG 1655 AaceB Agcl AgIcOEFGB AaIdA AiclR.

The chloramphenicol resistant transformants are then selected and the deletion of the gene Aedd-eda::Cm is verified by a PCR analysis with the oligonucleotides eddF and edaR. The strain retained is designated MG 1655 AaceB Agcl AgIcB AgIcOEF AaIdA Δz^'c/R Aedd- eda::Cm.

The chloramphenicol resistance cassette can then be eliminated. The plasmid pCP20 carrying FLP recombinase acting at the FRT sites of the chloramphenicol resistance cassette is then introduced into the recombinant sites by electroporation. After a series of cultures at 42°C, the loss of the chloramphenicol resistance cassette is verified by a PCR analysis with the same oligonucleotides as used previously (eddF and edaR). The strain retained is designated MG 1655 AaceB Agcl AgIcOEFGB AaIdA Δz^'c/R Aedd-eda.

The pME101-ycdW plasmid is then introduced in the strain MG 1655 AaceB Agcl AgIcOEFGB AaIdA AiclR Aedd-eda.

EXAMPLE 6

CONSTRUCTION OF STRAINS WITH INCREASED NADPH AVAILABILITY : MG1655 ΔaceB Δgcl ΔiclR ΔglcDEFGB ΔaldA Δpgi::Cm Δedd-eda (pMElOl-ycdW)

The pgi gene deletion is introduced in the MG 1655 AaceB Agcl AgIcB AgIcOEF AaIdA AiclR Aedd-eda using the same strategy as previously described with the following oligonucleotides:

DpgiF (SEQ ID NO 33) ccaacgcagaccgctgcctggcaggcactacagaaacacttcgatgaaatgaaagacgttacgatcgccgatctttttgcTGTA

GGCTGGAGCTGCTTCG with

- a region (lower case) homologous to the sequence (4231352-4231432) of the gene pgi (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

DpgiR (SEQ ID NO 34) gcgccacgctttatagcggttaatcagaccattggtcgagctatcgtggctgctgatttctttatcatctttcagctctgCATATG AATATCCTCCTTAG with

- a region (lower case) homologous to the sequence (4232980-4232901) of the gem pgi (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

The oligonucleotides DpgiF and DpgiR are used to amplify the chloramphenicol resistance cassette from the plasmid pKD3. The PCR product obtained is then introduced by electroporation into the strain MG 1655 AaceB Agcl AgIcB Δg/cDEF AaIdA AiclR Aedd- eda (pKD46). The chloramphenicol resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides pgiF and pgiR defined below. The strain retained is designated MG 1655 AaceB Agcl AgIcB Δg/cDEF AaIdA AiclR Aedd-eda Apgiy.Cm

pgiF (SEQ ID NO 35) : gcggggcggttgtcaacgatggggtcatgc (homologous to the sequence from 4231138 to 4231167). pgiR (SEQ ID NO 36) : cggtatgatttccgttaaattacagacaag (homologous to the sequence from 4233220 to 4233191).

The pME101-ycdW plasmid is then introduced in the strain MG 1655 AaceB Agcl Δg/cDEFGB AaIdA AiclR Aedd-eda Apgiy.Cm. EXAMPLE 7

CONSTRUCTION OF STRAINS WITH INCREASED NADPH AVAILABILITY :

MGl 655 ΔaceB Δgcl ΔiclR ΔglcDEFGB ΔaldA Δpgi Δedd-eda::Cm ΔudhA::Km

(pMElOl-ycdW)

The udhA gene deletion is introduced in the MG 1655 AaceB Agcl AgIcOEFGB AaIdA Δz^'c/R Apgi::Cm Aedd-eda using the same strategy as previously described with the following oligonucleotides :

DudhAF (SEQ ID NO 37)

CCCAGAATCTCTTTTGTTTCCCGATGGAACAAAATTTTCAGCGTGCCCACGTTC ATGCCGACGATTTGTGCGCGTGCCAGTGTAGGCTGGAGCTGCTTCG with

- a region (boldface letters) homologous to the sequence (4157588-4157667) of the gene udhA (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

- a region (underlined letters) for the amplification of the kanamycin resistance cassette (reference sequence in Datsenko, K.A. & Wanner, B.L., 2000, PNAS, 97: 6640-6645),

DudhAR (SEQ ID NO 38) GGTGCGCGCGTCGCAGTTATCGAGCGTTATCAAAATGTTGGCGGCGGTTGCAC CCACTGGGGCACCATCCCGTCGAAAGCCATATGAATATCCTCCTTAG

with

- a region (boldface letters) homologous to the sequence (4158729-4158650) of the gene udhA (reference sequence on the website http://genolist.pasteur.fr/Colibri/),

The oligonucleotides DudhAF and DudhAR are used to amplify the kanamycin resistance cassette from the plasmid pKD4. The PCR product obtained is then introduced by electroporation into the strain MG 1655 AaceB Agcl AgIcOEFGB AaIdA Δz^'c/R Apgi:: Cm

Aedd-eda (pKD46). The kanamycin resistant transformants are then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides udhAF and udhAR defined below. The strain retained is designated MG1655 AaceB Agcl AgIcOEFGB AaIdA AiclR Apgiy.Cm Aedd-eda AudhAv.Km

udhAF (SEQ ID NO 39) : (homologous to the sequence from 4157088 to 4157108). GATGCTGGAAGATGGTCACT udhAR (SEQ ID NO 40) : (homologous to the sequence from 4159070 to 4159052). gtgaatgaacggtaacgc

The pME101-ycdW plasmid is then introduced in the strain MG 1655 AaceB Agcl Δg/cDEFGB AaIdA AiclR Apgi::Cm Aedd-eda AudhAv.Km.

EXAMPLE 8

FERMENTATION OF GLYCOLIC ACID PRODUCING STRAINS IN

ERLENMEYER FLASKS

Performances of strains were initially assessed in 250 ml baffled Erlenmeyer flask cultures using modified M9 medium (Anderson, 1946, Proc. Natl. Acad. Sci. USA 32:120- 128) that was supplemented with 40 g/1 MOPS and 10 g/1 glucose and adjusted at pH 6.8. Spectinomycin was added if necessary at a concentration of 50 mg/1 and 100 μm IPTG was also added for induction of the expression vector, if present. An overnight preculture was used to inoculate a 50 ml culture to an OD_OOO m of about 0.3. The cultures were kept on a shaker at 30⁰C and 400 rpm until the glucose in the culture medium was exhausted. At the end of the culture, glucose and glycolic acid were analyzed by HPLC using a Biorad HPX 97H column for the separation and a refractometer for the detection.

Comparison of the performances of the different strains is given in table below (each value is the mean of n repetitions). The strain described in example 1 did not show any production of glycolic acid.

Strains described in example 6 and example 7 are the best producers of glycolic acid with titers higher than 2 g/1 and yields higher than 0.2 g/g. EXAMPLE 9

FERMENTATION OF GLYCOLIC ACID PRODUCING STRAINS IN FED

BATCH FERMENTOR

The strains described in example 6 and in example 7 were assessed under production conditions in a 600 ml fermentor using a fed batch protocol.

A first preculture in tubes was carried out in LB medium supplemented with 2,5 g/1 of glucose at 30⁰C followed by a second preculture in 500 ml Erlenmeyer flask filled with 50 ml of synthetic medium supplemented with 40 g/1 of MOPS and 10 g/1 of glucose (the same medium used for flask cultures) at 30⁰C. This second preculture was used for inoculation of the fermentor.

The fermentor filled with 200 ml of synthetic medium supplemented with 40 g/1 of glucose, 50 mg/1 of spectinomycin and 100 μM IPTG was inoculated at an initial optical density of about 2. The culture was carried out at 30⁰C with agitation and aeration adjusted to maintain the dissolved oxygen above 30% saturation. The pH was adjusted at 6.8 with base addition. The culture was conducted in a batch mode until exhaustion of glucose. At that time, a solution of 500 g/1 glucose supplemented with magnesium sulfate, oligo- elements, spectinomycin and IPTG was added to restore a concentration of 40 g/1 of glucose in the medium. Other additions were done each time glucose became exhausted again.

Routinely, strain described in example 7 gave better production performance than strain described in example 6 in fermentors (yield from glucose 0.22 g/g versus 0.15 g/g ).

A representative time-course of fermentation for production of glycolic acid using strain of example 7 is given below.

The final titre obtained was 31 g/1 glycolic acid with a yield on glucose of 0.22 g/g.

Claims

1) A method for the fermentative production of glycolic acid, its derivatives or precursors, by culturing a microorganism in an appropriate culture medium comprising a source of carbon and recovery of glycolic acid from the culture medium.

2) A method as claimed in claim 1 wherein the microorganism is modified to attenuate the conversion of glyoxylate to products other than glycolate.

3) A method as claimed in claim 2 in which the expression of at least one gene, selected among the following involved in glyoxylate metabolism, is attenuated. • aceB encoding malate synthase

• glcB encoding the second malate synthase

• gel encoding glyoxylate carboligase

• eda encoding 2-keto-3-deoxygluconate 6-phosphate aldolase.

4) A method as claimed in claims 1 to 3 wherein the microorganism contains at least one gene encoding a polypeptide catalyzing the conversion of glyoxylate to glycolate.

5) A method as claimed in claim 4 wherein the gene encodes a NADPH dependent glyoxylate reductase.

6) A method as claimed in any one of claims 4 to 5 in which the gene encoding a polypeptide with NADPH dependent glyoxylate reductase activity is endogenous. 7) A method as claimed in any one of claims 4 to 6 wherein the expression of said gene is increased.

8) A method as claimed in any one of claims 4 to 7, wherein the gene encoding a polypeptide with NADPH dependent glyoxylate reductase activity is selected among ycdW and yiaE. 9) A method as claimed in any one of claims 1 to 8 wherein the microorganism is modified in such a way that it is unable to substantially metabolize glycolate.

1O)A method as claimed in claim 9 wherein the expression of at least one gene, selected among the following involved in glycolate metabolism, is attenuated.

• g/cDEF encoding glycolate oxidase • aldA encoding glycoaldehyde dehydrogenase.

H)A method as claimed in any one of claims 1 to 10 wherein the microorganism is transformed to increase the glyoxylate pathway flux.

12) A method as claimed in claim 11 wherein the activity of the enzyme isocitrate dehydrogenase is attenuated. 13) A method as claimed in claim 11 wherein the expression of at least one of the following genes:

• pta encoding phospho-transacetylase

• ack encoding acetate kinase • poxB encoding pyruvate oxidase is attenuated.

14) A method as claimed in claim 11 wherein the flux in the glyoxylate pathway is increased by increasing the activity of ace A.

15) A method as claimed in claim 14 wherein the expression of aceA is increased by the attenuation of the expression of the genes z^'c/R orfadR.

16) A method as claimed in claim 14 wherein the expression of aceA is increased by introducing an artificial promoter upstream of the gene aceA

17) A method as claimed in any one of claims 1 to 16 wherein the availability of NADPH is increased. 18) A method as claimed in claim 17 wherein the expression of at least one gene, selected among the following:

• pgi encoding the glucose-6-phosphate isomerase

• udhA encoding the soluble transhydrogenase

• edd encoding phosphogluconate dehydratase is attenuated.

19) A method as claimed in any one of claims 1 to 18, wherein the carbon source is at least one of the following: glucose, sucrose, mono- or oligosaccharides, starch or its derivatives or glycerol.

20) A method for the fermentative preparation of glycolate as claimed in any one of claims 1 to 19 comprising the following steps: a) Fermentation of the microorganism producing glycolate b) Concentration of glycolate in the bacteria or in the medium and c) Isolation of glycolic acid from the fermentation broth and/or the biomass optionally remaining in portions or in the total amount (0-100%) in the end product. 2I)A method as claimed in claim 20 wherein glycolate is isolated through a step of polymerization to at least glycolate dimers.

22) A method as claimed in claim 21 wherein glycolate is recovered by depolymerization from glycolate dimers, oligomers and/or polymers.

23) A microorganism as defined in any one of claims 1 to 22. 24) A microorganism as claimed in claim 23 that is selected among the group consisting of E. coli, C. glutamicum or S. cerevisiae.