WO2007140618A1 - Modified protein toxins targeting cytokine -receptor bearing cells and use thereof for treating disease - Google Patents

Modified protein toxins targeting cytokine -receptor bearing cells and use thereof for treating disease Download PDF

Info

Publication number
WO2007140618A1
WO2007140618A1 PCT/CA2007/001018 CA2007001018W WO2007140618A1 WO 2007140618 A1 WO2007140618 A1 WO 2007140618A1 CA 2007001018 W CA2007001018 W CA 2007001018W WO 2007140618 A1 WO2007140618 A1 WO 2007140618A1
Authority
WO
WIPO (PCT)
Prior art keywords
cytokine
pore
cells
mppt
forming protein
Prior art date
Application number
PCT/CA2007/001018
Other languages
French (fr)
Inventor
James Thomas Buckley
Original Assignee
Protox Therapeutics Incorporated
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Protox Therapeutics Incorporated filed Critical Protox Therapeutics Incorporated
Priority to CA002657946A priority Critical patent/CA2657946A1/en
Publication of WO2007140618A1 publication Critical patent/WO2007140618A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/642—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a cytokine, e.g. IL2, chemokine, growth factors or interferons being the inactive part of the conjugate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6817—Toxins
    • A61K47/6829—Bacterial toxins, e.g. diphteria toxins or Pseudomonas exotoxin A
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6845—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a cytokine, e.g. growth factors, VEGF, TNF, a lymphokine or an interferon
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035—Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor

Definitions

  • the present invention relates to the field of modified protein toxins, and in particular to modified protein toxins that include a cytokine-receptor targeting unit, and their use to treat disease.
  • cytolytic proteins have been described (Lesieur et al. MoI. Membr. Biol. 14:45064, 1997), These naturally occurring cytotoxic proteins include mammalian proteins such as perforin, and bacterial proteins such as aerolysin (produced by Aeromonas hydrophila), ⁇ -hemolysin (produced by Staphylococcus aureus), alpha toxin (produced by Clostridium septicum), and ⁇ -toxin (produced by Bacillus thuringiensis), anthrax protective antigen, Vibrio cholerae VCC toxin, Staphylococcus leucocidins, LSL toxin from Laetiporus sulphureus, epsilon toxin from Clostridium perfringens, and hydralysins produced by Cnidaria spp.
  • mammalian proteins such as perforin
  • bacterial proteins such as aerolysin (produced by Aeromonas hydrophila), ⁇
  • cytotoxic proteins are synthesized as inactive protoxins, for example proaerolysin and alpha toxin.
  • protoxins contain discrete functionalities including a binding domain, which allows binding of the protoxin to a cell, a toxin domain, and either an N-terminal or a C-terminal inhibitory peptide domain that contains a protease cleavage site. Cleavage of the inhibitory peptide domain at the protease cleavage site results in activation of the protoxin, leading to oligomerization of the cytotoxin and insertion into the plasma membrane, producing pores that lead to rapid cytolytic cell death (Rossjohn et al. J. Struct. Biol.
  • Pore formation physically disrupts the cell membranes, and results in death of cells in all phases of the cell cycle, including non-proliferating cells (i.e. Go arrested).
  • cytotoxins are not specific in the type of cells they are able to kill, as their binding domains target molecules that are found on most cells, and they are generally activated by proteases that are not cell -specific.
  • Cytolytic poie-forming proteins or modified versions of these proteins have been proposed as potential therapeutics foi the treatment of disease, particularly cancer
  • cytolytic proteins have been modified in various ways to control target cell specificity and/or toxicity to cancer cells
  • U S Patent No 5,777,078 describes pore- forming agents that are activated at the surface of a cell by a number of conditions, including proteolysis, to lyse the cell
  • These pore-forming agents can be used generally to destroy unwanted cells associated with a pathological condition in an animal
  • WO 98/020135 describes methods and compositions relating to Pseudomonas exotoxin proproteins modified for selective toxicity
  • the exotoxin is modified to be activated by a desired protease by insertion of a protease activatable sequence m the propiotem
  • the exotoxin is modified to insert a prostate specific antigen (PSA) cleavage site for the purpose of targeting and killing prostate cancer cells
  • PSA prostate
  • An object of the present invention is to provide modified protein toxins targeting cytokine-receptor bearing cells and use thereof for treating disease.
  • an isolated pore-forming protein toxin derived from a naturally occurring aerolysin-related pore-forming protein and comprising one or more cytokine-receptor targeting units capable of specifically binding to a cytokine receptor, wherein said pore-forming protein toxin is capable of binding to and killing cells expressing said cytokine receptor.
  • an isolated polynucleotide encoding the isolated pore-forming protein toxin according to the invention.
  • a vector comprising a polynucleotide according to the invention, operatively linked to one or more expression control sequences.
  • a host cell comprising a vector according to the invention.
  • an isolated pore- forming protein toxin derived from proaerolysin comprising one or more cytokine- receptor targeting units capable of specifically binding to a cytokine receptoi, said pore forming protein toxin comprising an amino acid sequence substantially identical to the sequence as set foi th in SEQ ID NO 35, or SEQ ID NO 37
  • a pharmaceutical composition comprising a pore-formmg piotem toxm according to the invention
  • composition comprising an isolated polynucleotide according to the invention
  • an isolated pore- fo ⁇ ning piotein toxm according to the invention foi use in decreasing the number of cytokine-receptor bearing cells in a subject
  • an isolated pore- forming protein toxm according to the invention for use m the treatment of a T-cell dependent autoimmune disease in a subject
  • an isolated pore forming protein toxin according to the invention for use in the treatment of cancer in a subject
  • a use of an isolated poie-forming piotein toxin accoiding to the invention for use m the preparation of a medicament
  • a method of decreasing the number of cytokine ieceptor bearing cells in a subject comprising administering to the subject having cancer an effective amount of a pore-formmg protein toxin accoiding to the invention
  • a method of tieating a T-cell dependent autoimmune disease in a subject comprising administering to the subject an effective amount of a pore forming protein toxm according to the invention
  • a method of treating cancer in a subject comprising administering to the subject having cancer an effective amount of a pore-forming protein toxin according to the invention.
  • a method of preparing a modified pore-forming protein toxin comprising: providing a native pore forming protein toxin wherein said native pore forming protein toxin is proaerolysin or Clostridium septicum alpha toxin; and attaching to said native pore- forming protein toxin, one or more cytokine-receptor targeting units capable of specifically binding to a cytokine receptor, wherein said modified pore-forming protein toxin is capable of killing cells expressing said cytokine.
  • kits comprising one or more pore-forming protein toxins according to the invention and optionally instructions for use.
  • Figure 1 depicts the nucleotide sequence of proaerolysin from Aeromonas hydrophila (SEQ ID NO: 1).
  • Figure 2 depicts the amino acid sequence of proaerolysin from Aeromonas hydrophila (SEQ ID NO:2).
  • Figure 3 depicts the nucleotide sequence of alpha toxin from Clostridium septicum (SEQ ID NO:3).
  • Figure 4 depicts the amino acid sequence of alpha toxin from Clostridium septicum (SEQ ID NO:4).
  • Figure 5 illustrates a schematic drawing of an IL-2-uPA-PA MPPT according to one embodiment of the invention.
  • Figure 6 illustrates the IL-2-uPA-R336A-PA MPPT according to an embodiment of the invention.
  • Figure 7 depicts an SDS-PAGE gel showing the results of digestion of IL-2 MPPTs by trypsin, furm, and uPA
  • Figure 8 presents a graph illustrating the toxicity of IL-2 MPPTs against EL 4 cells
  • Figure 9 presents a graph illustrating the toxicity of IL-2 MPPTs against HuT 78 cells
  • Figuie 10 piesents a giaph illustrating the toxicity of IL-2 MPPTs against CTLL-2 cells
  • Figuie 12 presents a graph illustrating IL 2 competition cell killing of IL-2 MPPTs against CTLL-2 cells
  • Figuie 13 depicts binding of IL-2 MPPTs to EL-4 cells as assessed by flow cytometry
  • Figure 14 depicts binding of IL-2 MPPTs to CTLL-2 cells as assessed by flow cytometry
  • Figuie 15 depicts an SDS-PAGE gel showing evidence of oligome ⁇ zation of PA and R336A-PA
  • Figuie 16 depicts an SDS-PAGE gel showing evidence of ohgome ⁇ zation of IL-2 MPPTs
  • Figure 17 depicts the nucleotide sequence of proaerolysin from Aeromonas hydrophda, including the signal sequence (SEQ ID NO 19)
  • Figuie 18 depicts the amino acid sequence of pioaerolysm from Aeromonas hydrophda, including the signal sequence (SEQ ID NO 20)
  • Figuie 19 depicts the nucleotide sequence of alpha toxin from Clostridium sepucum, including the signal sequence (SEQ ID NO 21)
  • Figure 20 depicts the amino acid sequence of alpha toxin from Clostridium sepncum, including the signal sequence (SEQ ED NO 22)
  • Figure 21 depicts the nucleotide sequence of IL 2-uPA-PA (SEQ ID NO 34)
  • Figure 22 depicts the ammo acid sequence of II -2-uPA-PA (SEQ ID NO 35)
  • Figure 23 depicts the nucleotide sequence of IL 2-uPA R336A-PA (SEQ ID NO 36)
  • Figure 24 depicts the amino acid sequence of IL-2-uPA-R336A-PA (SEQ ID NO 37), with the R336A mutation indicated in bold and underlined text
  • Figure 25 depicts an SDS PAGE gel of purified IL-2 MPPTs, R336A-PA and PA piotems
  • the present invention piovides pore- forming protein toxins that have been modified to include a cytokme-receptor targeting unit
  • the modified pore-forming protein toxins (MPPTs) of the present invention aie capable of selectively binding and killing cytokine receptor beating cells
  • the MPPTs aie derived from naturally-occurring protein toxins (nPPTs) such as aeiolysin and aerolysin-related toxins that have been modified to comp ⁇ se one or more cytokine-receptor targeting units
  • nPPTs naturally-occurring protein toxins
  • nPPTs naturally-occurring protein toxins
  • aerolysin-related toxins that have been modified to comp ⁇ se one or more cytokine-receptor targeting units
  • Addition of the cytokine-receptor targeting unit enables the MPPTs to specifically bind to one or moie taiget cell displaying the co ⁇ esponding cytokine iecept
  • the MPPTs according to the present invention can optionally further comprise one or moie additional modifications which may further enhance target cell specificity
  • modifications include, but are not limited to, modifications to the cell binding domain(s) of the MPPTs to decrease or eliminate non-selective binding of the MPPTs to cells other than cytokine-receptoi bearing cells, modifications to the activation sequence to selectively activate the protein toxin at the target cell, as well as the addition of other artificial regulatoiy domain(s) capable of either targeting the MPPT to a specific type of cell, and/or inhibiting the activity of the MPPT in such a way that inhibition of the MPPT is released at a target cell
  • Binding pair' refeis to two moieties that have an affinity for one another
  • binding pairs include homo-dimers, hetero- dimeis, antigen/antibodies, lectm/avidm, target polynucleoiide/probe, oligonucleotide, antifaody/a ⁇ ti-antibody, receptor/ligand, enzyme/hgand and the like '
  • One member of a binding pair iefers to one moiety of the pair, such as an antigen or ligand
  • isolated polynucleotide refers to a polynucleotide of genomic cDNA, or synthetic origin or some combination thereof, which (1) is not associated with the cell in which the "isolated polynucleotide” is found in natuie, or (2) is operably linked to a polynucleotide which it is not linked to in nature
  • control sequence "operably linked" to a coding sequence is hgated in such a way that exptession of the coding sequence is achieved undei conditions compatible with the contiol sequence
  • Control sequence iefers to a polynucleotide sequence which is necerney to effect the expression of coding and non-coding sequences to which it is ligated
  • control sequences gencially include one or more of piomotei , ⁇ bosomal btnding site, and transciiption termination sequence, in eukaryotes, generally, such control sequences include one or more of promoters and transcription termination sequences
  • control sequences is intended to include, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences
  • Polynucleotide refers to a polymeric form of nucleotides of at least 10 nucleotides in length, either ribonucleotides or deoxynucleotides or a modified form or forms of either type of nucleotide The term includes single and double stianded foims of DNA oi RNA
  • Polypeptide fragment ' refers to a polypeptide that has an amino-terminal and/or carboxy-terminal deletion, in which the remaining amino acid sequence is usually identical to the corresponding positions in the naturally-occurring sequence Fragments can be, for example, are at least 5, 6, 8 or 10 amino acids long, at least 14 amino acids long, at least 20 amino acids long, at least 50 ammo acids long, or at least 70 amino acids long
  • the terms ' label" or "labeled” refei to incorporation of a detectable marker, e g foi a polypeptide by incorporation of a iadiolabeled amino acid or attachment to a polypeptide of biotinyl moieties that can be detected by marked avidin (e g , streptavidin containing a fluorescent maiker or enzymatic activity that can be detected by optical or colo ⁇ met ⁇ c methods)
  • Various methods of labeling polypeptides, polynucleotides, antibodies and the like are known in the art and may be used
  • TATAC corresponds to a reference sequence “TATAC” and is complementary to a reference sequence “GTATA.”
  • the following terms are used herein to describe the sequence relationships between two or more polynucleotides or two or more polypeptides: "reference sequence,” “window of comparison,” “sequence identity,” “percent sequence identity,” and “substantial identity.”
  • a “reference sequence” is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA, gene or protein sequence, or may comprise a complete cDNA, gene or protein sequence.
  • a reference polynucleotide sequence is at least 20 nucleotides in length, and often at least 50 nucleotides in length.
  • a reference polypeptide sequence is generally at least 7 amino acids in length and often at least 17 amino acids in length.
  • a "window of comparison”, as used herein, refers to a conceptual segment of the reference sequence of at least 15 contiguous nucleotide positions or at least 5 contiguous amino acid positions over which a candidate sequence may be compared to the reference sequence and wherein the portion of the candidate sequence in the window of comparison may comprise additions or deletions (i.e. gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the present invention contemplates various lengths for the window of comparison, up to and including the full length of either the reference or candidate sequence.
  • Optima! alignment of sequences for aligning a comparison window may be conducted using the local homology algorithm of Smith and Waterman ⁇ Adv. Appl. Math. ⁇ 1981) 2:482), the homology alignment algorithm of Needleman and Wunsch (/. MoI. Biol. (1970) 48:443), the search for similarity method of Pearson and Lipman (Proc. Natl. Acad.
  • sequence identity means that two polynucleotide or polypeptide sequences are identical ( ⁇ e on a ⁇ ucleotide-by-nucleotide or amino acid-by-amino acid basis) over the window of comparison
  • percent (%) sequence identity as used herein with respect to a reference sequence is defined as the peicentage of nucleotide or ammo acid residues m a candidate sequence that are identical with the residues in the reference polypeptide sequence ovei the window of comparison after optimal alignment of the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, without considering any conservative substitutions as part of the sequence identity
  • substantially identity denotes a chatacte ⁇ stic of a polynucleotide or polypeptide sequence, wherein the polynucleotide or polypeptide comprises a sequence that has at least 50% sequence identity as compaied to a reference sequence over the window of comparison
  • Polynucleotide and polypeptide sequences with at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, and at least 90% sequence identity as compared to a reference sequence over the window of comparison are also considered to have substantial identity with the ieference sequence
  • the term “antibody” refers to an isolated or recombinant binding agent that comprises the necessary variable iegion sequences to specifically bind to a target antigenic epitope
  • the term thus encompasses va ⁇ ous forms of antibody and antibody fragments known in the art that are capable of specifically binding the target antigen including, but not limited to, monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, human antibodies, humanized antibodies, chimeric antibodies, camehsed antibodies, nanobodies, diabodies, multispecific antibodies (e g , bispccific antibodies), and antibody fiagments including but not limited to scFv, Fab, and Fab 2
  • the terms "therapy” and “treatment,” as used inteichangeably herein, refer to an intervention performed with the intention of improving a subject's status The improvement can be subjective oi objective and is related to amehoi ating the symptoms associated with, preventing the development of, or altering the pathology of a disease or disorder being treated Thus, the terms therapy
  • the leim "subject” oi "patient” as used herein refers to an animal in need of treatment.
  • the teim "animal,” as used herein, refers to both human and non-human animals, including, but not limited to, mammals, biids and fish.
  • Administration of the compounds of the invention "in combination with" one or more further therapeutic agents is intended to include simultaneous (concurrent) administration and consecutive administiation Consecutive administration is intended to encompass administration of the therapeutic agent(s) and the compound(s) of the invention to the subject in vanous oiders and via various routes
  • inhibitor means to decrease, reduce, slow-down or prevent
  • polypeptide is used herein as a generic term to refer to an ammo acid sequence of at least 20 amino acids in length that can be a wild-type (naturally- occurring) protein sequence, a fragment of a wild-type protein sequence, a variant of a wild-type protein sequence, a derivative of a wild-type protein sequence, or an analogue of a wild-type piotein sequence
  • native protein sequences and fragments, variants, derivatives and analogues of native protein sequences as defined heiein, aie consideied to be species of the polypeptide genus. 1416-107PCI
  • isolated polypeptide refers to d polypeptide which by vu tue of its origin is not associated with other polypeptides with which it is normally associated with in nature, and/or is isolated from the cell in which it normally occurs and/or is free of other polypeptides from the same cellular source and/or is expressed by a cell from a different species, and/or does not occur in nature
  • Naturally occurring or “native” as used hetein, as applied to an object, refers to the fact that an object can be found in naUi ⁇ e
  • a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated fiom a souice in natuie and which has not been intentionally modified by man in the laboratory is natui ally-occurring
  • activity refers to the ability of a naturally occu ⁇ ing pore-forming piotem toxin or a modified pore-forming protein toxin to exhibit one or mote of the ability to bind to a cell, the ability to be activated by protease cleavage, or the ability to foim pores in a cell membiane
  • mutation refeis to a deletion, insertion, substitution, inversion, oi combinations thereof, of one or more nucleotides in a polynucleotide sequence oi one or more amino acids in a polypeptide sequence when compared to the co ⁇ esponding naturally occurring polynucleotide or polypeptide sequence
  • activation sequence refers to an ammo acid sequence in a poie-forming protein toxin that can be cleaved by an appropriate protease, iesultmg in activation of the pore foi mmg ability of the protein toxin
  • amino acid residue encompasses both naturally-occu ⁇ ing amino acids and non-natuially-occurrmg amino acids
  • non-natural Iy occurring ammo acids include, but aie not limited to, D-amino acids (i e an ammo acid of an opposite chirahty to the natuially-occur ⁇ ng form), N- ⁇ -meth>l amino acids, C ⁇ methyl amino acids, ⁇ -methyl ammo acids and D- or L ⁇ amino acids
  • Othei non-naturally occurring ammo acids include, for example, ⁇ -alanine ( ⁇ Ala), noileucine (NIe), norvahne (Nva), homoarginine (Har), 4-dminobuty ⁇ c acid ( ⁇ -Abu), 2 aminoisobuty ⁇ c acid (Aib), 6-aminohexanoic acid ( ⁇ -Ahx), ornithine (orn), sarcosine,
  • peptide bond can be a naturally occurring peptide bond or a non- naturally occurring ( ⁇ e modified) peptide bond
  • Spatola Vega Data VoI 1, Issue 3, (1983
  • Spatola in Chemistry and Biochemistry of Amino Ac tds Peptides and Proteins Weinstein, ed , Marcel Dekker, New Yoik, p 267 (1983), Morley, J S , Trends Pharm Sci pp 463-468 (1980), Hudson et al , Int J Pept Prot
  • Naturally-occurring amino acids are identified throughout by the conventional three- letter or one-letter abbieviations indicated below, which are as generally accepted in the peptide art and aie iecommended by the IUPAC IUB commission in biochemical nomenclature
  • alkyl refers to a straight chain or branched hydrocarbon of one to ten caibon atoms or a cyclic hydrocarbon group of three to ten carbon atoms
  • Said alkyl gioup is optionally substituted with one or more substHuents independently selected from the group of alkyl, alkenyl, alkynyl, aryl, heteioalkyl, aialkyl, hydroxy, alkoxy, aralkyloxy, aryloxy, carboxy, acyl, aioyl, halo, nitro, t ⁇ halomethyl, cyano, dlkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl, acylamino, aroylamino, dialkylamino, carbamoyl, alkylcarbamoyl, dialkjlcarbamoyl, alkylthio, aralky
  • alkenyl refers to a straight chain or branched hydrocarbon of two to ten carbon atoms having at least one carbon to carbon double bond Said alkenyl group can be optionally substituted with one or more substituents as defined above.
  • alkenyl groups include allyl and vinyl
  • alkynyl refers to a straight chain or branched hydrocarbon of two to ten carbon atoms having at least one carbon to carbon triple bond Said alkynyl group can be optionally substituted with one or more substituents as defined above Exemplary groups include ethynyl and piopaigyl.
  • heteroalkyl refers to an alkyl group of 2 to 10 carbon atoms, wherein at least one carbon is replaced with a hetero atom, such as N, O or S
  • aryl or “Ar”
  • iefe is to an aromatic carbocyclic group containing about 6 to about 10 caibon atoms or multiple condensed rings in which at least one ring is an aromatic carbocyclic group containing 6 to about 10 caibon atoms
  • Said aryl or Ar group can be optionally substituted with one oi more substituents as defined above.
  • aryl groups include phenyl, tolyl, xylyl, b ⁇ henyl, naphthy], 1,2,3,4-tetrahydronaphthyl, anthryl, phenanthryl, 9-fluorenyl, and the like
  • aralkyl refers to a stiaight or branched chain alkyl, alkenyl or alkynyl group, wherein at least one of the hydrogen atoms is replaced with an aryl gioup, wherein the aryl group can be optionally substituted with one or more substituents as defined above
  • exemplary aralkyl groups include benzyl, 4- phenylbutyl, 3,3-diphenylpropyl and the like
  • alkoxy refers to RO , wherein R is alkyl, alkenyl or alkynyl in which the alkyl, alkenyl and alkynyl groups are as previously described.
  • alkoxy groups include methoxy, ethoxy, n-propoxy, I-piopoxy, n-butoxy, and heptoxy
  • aryloxy refers to an "ary]-O-" group in which the aryl group is as previously described
  • Exemplary aryloxy gioups include phenoxy and naphthoxy
  • alkylthio refers to RS-, wherein R is alkyl, alkenyl or alkynyl in which the alkyl, alkenyl and alkynyl groups are as previously described.
  • alkylthio groups include methylthio, ethylthio, I-propylthio and hepthylthio.
  • aiylthio refers to an "aryl-S-” group in which the aiyl group is as pieviously desc ⁇ bed Exemplaiy arylthio groups include phenylthio and naphlhylthio.
  • aralkyloxy as used herein, iefers to an "aialkyl-O-" gioup in which the aralkyl group is as previously desciibed
  • Exemplary aialkyloxy groups include benzyloxy
  • aralkylthio refers to an "aralkyl-S-" group m which the aralkyl group is as previously described
  • exemplary aralkylthio groups include benzylthio
  • dialkylamino refers to an -NZ1Z2 gioup wherein Z
  • alkoxycarbonyl refers to R-O-CO-, wherein R is dlkyl, alkenyl or alkynyl, wherein alkyl, alkenyl and alkynyl are as previously described Exemplary alkoxycaibony) gioups include methoxy-carbonyl and ethoxy carbonyl
  • aryloxycarbonyl refeis to an "aiyl-O-CO-", wherein aryl is as defined pieviously Exemplary aryloxycarbonyl groups include phenoxy- carbonyl and naphtoxy-carbonyl
  • acyl refers to RC(O)-, wherein R is alkyl, alkenyl , alkynyl, heteroalkyl, a heterocyclic ring, 01 a heteroaromatic ring, wherein alkyl, alkenyl, alkynyl, heteroalkyl, heteiocychc, and heteroaromatic are as defined previously
  • aroyl as used heiem, iefers to an ArC(O)- group, wherein Ar is as defined pieviously
  • carboxy as used herein, iefers to ROC(O) , wherein R is H, alkyl, alkenyl 01 alkynyl, and wherein alkyl > alkenyl or alkynyl are as defined previously
  • alkylcaibamoyl refers to an "Z ⁇ N-CO-" group wherein one of the Z
  • dialkylcarbamoyl refers to a "Z 1 Z2N-CO-" group wherein Zi and Z 2 are independently selected from alkyl, alkenyl or alkynyl and wherein alkyl, alkenyl and alkynyl are as defined pieviously
  • acylamino refers to an "acyl-NH-" group, wherein acyl is as defined pteviously
  • halo refers to fluoro, chloio, bioino or iodo
  • halo refeis to fluoio, chloro 01 bromo
  • the modified pore-formmg piotein toxins (MPPTs) according to the piesent invention are derived from naturally occurring pore-forming protein toxins (nPPTs) such as aerolysin or aerolysin-i elated polypeptides Suitable aerolysin-related nPPTs have the following features a pore-forming activity that is activated by removal of an inhibitory domain via protease cleavage, and the ability to bind to receptors that are piesent on cell membianes through one or more binding domains Examples include, but are not limited to, preproaeiolysin and proaeiolysin from Aei omonas hydroph ⁇ a, Aeromonas trota and Aeromonas salmomcida, alpha toxin from Clostridium septicum, anthrax protective antigen, Vibrio cholerae VCC toxin, epsilon toxin from Clostridium perfringens,
  • Pioaeiolysin (PA) polypeptides from the Aeromonas species noted above have been charactei ized These polypeptides exhibit greater than 80% pan wise sequence identity between them (Parker et al , Progress m Biophysics & Molecular Biology 88 (2005) 91-142).
  • Each of these PA polypeptides is an appioximately 52 kDd protoxm with approximately 470 amino acid residues
  • a cDNA sequence for wild-type PA from A hydrophila is shown in SEQ ID NO 1 ( Figure 1) and the corresponding amino acid sequence of this wild-type PA is shown in SEQ ID NO 2 ( Figure 2)
  • MPPTs can be designed based on the sequence of the nPPT with or without a signal sequence
  • MPPTs can be designed based on the nucleotide sequence for preproaeiolysin as shown in Figure 17 (SEQ ED KO 19) oi based on the amino acid sequence for preptoaeiolysin as shown in Figure 18 (SEQ ID NO 20)
  • the nucleotide and protein sequences for numerous natuially occurring nPPTs ate known in the art and non- limiting examples die listed in the following Table
  • the A hydrophila PA protein includes a binding domain (approximately ammo acids 1-83 of SEQ ID NO 2) in what is known as the small lobe of the polypeptide and is referred to herein as the small lobe binding domain (SBD), and a C-terminal inhibitoiy peptide (CIP) domain (approximately amino acids 427-470 of SEQ ID NO 2) that is lemoved by protease cleavage at an activation sequence to activate PA Cleavage at the activation sequence to remove the ClP domain can be carried out by a number of ubiquitous proteases including fu ⁇ n and trypsin
  • the amino acid residues fi om approximately 84-426 of SEQ ID NO 2 are known as the large lobe of the PA polypeptide, and contain a toxin domain and other functional domains, including a second binding domain, referred to herein as the large lobe binding domain (LBD)
  • Alpha toxin from C septicum is considered to be a homologue of proaeiolysin based on significant sequence identity and other similarities (Parker et al , supra)
  • Alpha toxin is secreted as a 46,450 Da piotoxm (approximately 443 amino acids) that is activated by protease cleavage to remove a C-terminal inhibitory peptide (CIP) domain, and it also binds to glycosyl-phosphatidylinositol (GPI)-anchored proteins
  • CIP C-terminal inhibitory peptide
  • GPI glycosyl-phosphatidylinositol
  • Alpha toxin does not have a iegion corresponding to the small lobe of PA
  • An example of a Clostridium septicum alpha toxin nucleic acid sequence is provided in GenBankTM Accession No S75954
  • the MPPTs accoiding to the present invention comprise modified proaerolysm polypeptides
  • the MPPTs comprise modified proaerolysm polypeptides fiom ⁇ hydrophda
  • the MPPTs comprise modified proaeiolysin polypeptides from A salmomcida
  • the MPPTs comprise modified alpha toxin polypeptides
  • the present invention further includes MPPTs that are derived ftom fragments of nPPTs Suitable fragments include those that are capable of being activated to form pores m target cells by removal of the CIP domain Foi example, in the case of PA, a suitable fragment would be one that comprised the large lobe of the protein as well as 1436-107PCr
  • the MPPT is derived from a fragment of proaerolysm that includes the large iobe, the CIP domain and the activation sequence.
  • the MPPT is derived from a fragment of pioaeioiysm that comprises the small lobe, the large lobe, the activation sequence, but only part of a CIP domain Othei functional fragments could be readily deteimined by the skilled technician using standard techniques known in the art
  • MPPTs according to the piesent invention comprise a cytokine receptor targeting unit that permits specific binding to cytokine receptor bearing cells
  • the MPPTs of the present invention comprise one or more cytokine-receptor targeting units that can be attached to a variety of legions of the MPPT
  • the one or more cytokine-receptor targeting units are attached at or proximal to the C- terminus of the MPPT
  • the one or moie cytokine-receptor targeting units are attached at or proximal to the N-terminus of the MPPT
  • proximal in this context is defined as within 100 amino acid of the C-termmus, or withm 100 amino acids of the N-termmus
  • one or more further modifications may be made to the MPPTs of the present invention
  • These optional modifications can enhance the selectivity of the MPPT by reducing or eliminating non-selective binding to non-target cells and/or allow the MPPT to be selectively activated to kill specific types of cytokine-receptor beaimg cells.
  • These modifications include but are not limited to one or more modifications to the native small lobe binding domain (SBD), one or more modifications to the native large lobe binding domain (LBD), one or more modifications to the activation sequence, and addition of one or more artificial iegulatory domains (ARD).
  • the MPPT comprises one or moie cytokine- receptor targeting units but no further modifications. In another embodiment of the invention, the MPPT compiises one or more cytokine-receptor targeting units and a modified binding domain In yet another embodiment, the MPPT comprises one or more cytokine-receptor targeting units and a modified activation sequence In still another embodiment, the MPPT comprises one or moie cytokine-receptor targeting units and one or more ARD In a further embodiment, the MPPT comprises one or more cytokine-receptoi targeting units, a modified SBD, and a modified LBD In a still fuither embodiment, the MPPT comprises one or more cytokine-receptor targeting units, one or more modified binding domains and a modified activation sequence In another embodiment, the MPPT comprises one or more cytokme- ieceptor targeting units, one or moie modified binding domains, and one or more ARD In yet another embodiment, the MPPT comprises one or more cytokine- receptor targeting units
  • MPPTs accoiding to the piesent invention comprise one or more cytokme-ieceptor targeting units
  • the cytokine-receptor tai geting units function to provide binding specificity to the MPPT Specifically, the cytokine-receptor taigeting unit allows the MPPT to bind to the target cell (i e , a cell displaying the corresponding cytokine leceptor) where the MPPT can be activated and subsequently kill the target cell
  • the cytokme-receptor targeting unit may be added, for example, to the N- oi C-terrmnus of the protein toxin, or to both Altei natively, the cytokine-receptor targeting unit may be added to a different region of the protein toxm, as long as it does not interfere with the poie-forming activity of the final MPPT
  • the cytokine-receptor targeting unit may also replace a functional domain of the nPPT, for example a binding domain Determination of
  • the MPPT comprises a cytokine-receptor targeting unit at its N- terminus
  • an MPPT based on proaerolysin that comprises a cytokine-receptor targeting unit is added at the N-terminus of proaerolysin is provided.
  • an MPPT based on alpha toxin that comprises a cytokine-receptor targeting unit at the N terminus of alpha toxin is provided in a further embodiment, the MPPT comprises a cytokine-receptor targeting unit at its C terminus In yet another embodiment, an MPPT based on proaerolysm that comprises a cytokme-receptoi targeting unit is added at the C-terminus of proaeroiysin is provided In still another embodiment, an MPPT based on alpha toxm that comprises a cytokine-receptor targeting unit at the C terminus of alpha toxin is provided in a further embodiment, the MPPT compiising a cytokine-receptor targeting unit is prepared using recombinant DNA methods
  • the cytokine-receptor targeting unit according to the present invention can be a molecule or hgand that recognizes or is capable of specific binding to a cytokine ieceptor
  • suitable cytokine-receptor targeting units include a cytokine or d cytokine fragment, analogue or derivative that is capable of specifically binding to a cytokine ieceptoi
  • Othei suitable cytokine ieceptor taigeting units contemplated by the present imention include, but are not limited to, antibodies and cytokine receptor inhibitors or antagonists that specifically bind to their target receptor
  • the cytokine-receptor targeting unit is a cytokine
  • Cytokines contemplated by the instant invention can be selected from a variety of cytokine molecules including, foi example, cytokines that are involved m the proliferation or differentiation of cells of the hematopoietic lineage, and cytokines that participate in the immune and inflammatoiy response mechanisms of the body
  • the cytokine can be an interleukin, such as IL-2 and IL-4, a lyrnphokine, a monokine, such as GM-CSF and IL-I, an interferon, such as IFN alpha and IFN-beta, a colony stimulating factor, such as M-CSF and G-CSF, a chemokine, a peptide regulatory factoi (PRF), macrophage inflammatoiy proteins such as MIP l ⁇ , MIP l ⁇ , c kit hgand, tumor necrosis factors such as lymphot
  • cytokines can also be classified according to the sequence homology of the ieceptor to which they bind Cytokine receptors can be divided into five general families based on sequence simila ⁇ ties the Class I cytokine receptor family (also known as Type I cytokine receptor, or haematopoietic growth factor, family) ⁇ v hich includes receptors for GM-CSF, IL-6, IL-2, Class II cytokine receptor family (also known as Type II cytokine receptor, or inteiferon, family) which includes ieceptors for IFN- ⁇ , ⁇ , and ⁇ , Immunoglobulin Superfamily which includes teceptors for IL-I and M-CSF, TNF receptor family which includes receptors for various TNFs, and the Seven transmembrane helix family which includes receptors for various chemokines
  • the cytokine-receptor targeting unit comprised by the MPPT is a cytokine that binds to a membei of theType 1 cytokine receptor family
  • the cytokine-receptor targeting unit comprised by the MPPT is a cytokine that binds to a member of the Type 2 cytokine receptor family
  • the cytokine-receptor targeting unit comprised by lhe MPPT is a cytokine that binds to a membei of the cytokine receptor family from the Immunoglobulin Superfaroily
  • the cytokine-receptor taigeting unit comprised by the MPPT is a cytokine that binds to a cytokine ieceptor from the Seven transmembrane helix Family of receptors
  • the cytokine-receptor taigeting unit comprised by the MPPT is a cytokine that binds to a membei of theType 1 cytokine
  • the present invention furthei includes MPPTs comprising cytokine-receptor targeting units that are fidgments of a cytokine molecule Suitable fragments include
  • the MPPT comprises one or more cytokine receptor targeting units that include a functional fragment of a cytokine molecule
  • the MPPT comprises one or more cytokine-receptor targeting units that include a fragment of an interleukin
  • the MPPT comprises one or moie cytokine-receptor targeting units that include a fiagment of IL-2 Suitable ftagments of IL-2 include, but are not limited to N-termmal ammo acid residues 1 to 20, C-terminal amino acid residues 121-133, oi the internal amino acid iesidues 30 to 60 as described in Ju G, et al , (1987) Journal of Biological Chemistry, 262 5723-5731 (herein incorporated by reference)
  • the present invention furthei includes MPPTs comprising cytokine-receptor targeting units that are derived from a cytokine molecule
  • cytokine-receptor targeting units that are derived from a cytokine molecule
  • These mutant cytokines can be derived frequently from cloned genes that have been subjected to site-directed 01 random mutagenesis, or from completely synthetic genes using methods well known in the art and can carry single ot multiple ammo acid substitutions
  • the cytokine may be a truncated form of a cytokine molecule ot a circularly permuted form of the cytokine
  • the MPPT of the instant invention comprises one or more cytokine-receptor taigeting units that include a cytokine derivative
  • the MPPT comprises one or more cytokine-receptor taigeting units that include a circularly permuted foim of a cytokine
  • the cytokine-receptor taigeting unit is an antibody to a cytokine receptor, capable of specifically binding to a cytokine receptor bearing cell
  • Antibodies contemplated by the instant invention are desc ⁇ bed above and include full-length (i e , naturally occurring or formed by not ma) immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecules (for example, an IgG antibody) and immunologically active (i e , specifically binding) poitions of an immunoglobulin molecule, and may or may not be humanized
  • Suitable antibodies can be polyclonal or monoclonal antibodies Alternatively, the antibody may be a single chain antibody as known in the art and described in Bird et al Science 242 423-6, 1988, and Huston et al , Proc Natl Acad Sci 85 5879 83, 1988, or an antibody fragment
  • an antibody includes camehzed antibodies (foi example see Tanha et al , J Biol
  • a receptor can be expressed in various forms, for example, the IL-2 receptor which can be expressed in differentially spliced forms and as a single (alpha) chain (i.e. CD25), an antibody that recognises one, or multiple, forms of the receptor can be used.
  • Methods of preparing antibodies are known in the art (see, for example, Current Protocols in Immunology, ed. J. E. Coligan, et al, Wiley & Sons, New York, NY).
  • the MPPT comprises a targeting unit that is an antibody that selectively binds to a Type I cytokine receptor. In another embodiment, the MPPT comprises a targeting unit that is an antibody that binds selectively to a Type 2 cytokine receptor. In a further embodiment, the MPPT comprises a targeting unit that is an antibody that binds selectively to a cytokine receptor from the Immunoglobulin Superfamily. In another embodiment, the MPPT comprises a targeting unit that is an antibody that binds selectively to a cytokine receptor from the Seven transmembrane helix family of receptors. In yet another embodiment, the MPPT comprises a targeting unit that is an antibody that binds selectively to a cytokine receptor from the Tumor Necrosis Factor Family of receptors.
  • the cytokine-receptor targeting unit may be directly attached to the polypeptide, or it may be attached via an appropriate linker. Appropriate linkers and methods of adding them are described below. 1.1.1. Optional Linker
  • a cytokine-receptor targeting unit may be covalently attached to the protein toxin through an appropriate linker or spacer.
  • the linker acts as a molecular bridge to link the cytokine-receptor targeting unit to the protein toxin.
  • the linker can serve, for example, simply as a convenient way to link the two entities, as a means to spatially separate the two entities, to provide an additional functionality to the MPPT, or a combination thereof.
  • the linker can also be used to provide, for example, lability to the connection between the cytokine-receptor taigeting unit and the protein toxin moiety, an enzyme cleavage site (for example a cleavage site for a piotease), a stability sequence, a molecular tag, a detectable label, 01 various combinations thereof
  • the selected linker can be bifunctional or polyfunctional, i e contains at least a first reactive functionality at, or proximal to, a first end of the linker that is capable of bonding to, or being modified to bond to, the cytokine-receptor targeting unit and a second leactive functionality at, or proximal to, the opposite end of the hnket that is capable of bonding to, or being modified to bond to, the protein toxm being modified
  • the two oi more reactive functionalities can be the same (i e the linker is homobifunctional) or they can be diffeient (i e the linker is heterobifunctional)
  • a variety of bifunctional or polyfunctional cross-linking agents aie known m the art that are suitable for use as linkers (foi example, those commercially available fiom Pierce Chemical Co , Rockford, IL ) Alternatively, these reagents can be used to add the hnkei to the cytokine-receptor targeting unit and/or MP
  • Linkers suitable for use according to the present invention may be bianched, unbranched, satuiated, or unsatuialed hydrocarbon chains, including peptides as noted above Furthermore, if the linker is a peptide, the linker can be attached to the protein toxm moiety and/or the cytokme-receptor targeting unit using recombinant DNA technology Such methods are well-known in the art and details of this technology can be found, for example, in Sambrook et at , supra
  • linkeis examples include, but are not limited to peptides having a chain length of 1 to 100 atoms, and linkers derived from groups such as ethanolamine, ethylene glycol, polyethylene with a chain length of 6 to 100 carbon atoms, polyethylene glycol with 3 to 30 repeating units, phenoxyethanol, propanolamide, butylene glycol, butyleneglycolamide, propyl phenyl, and ethyl, propyl, hexyl, steryl, cetyl, and palrmtoyl alkyl chains
  • the MPPT comprises a linker that is a peptide having a length of between about 1 and about 30 amino acids In another embodiment, the MPPT comprises a linker that is a peptide having a length of between about 5 and about 20 amino acids In one embodiment, the MPPT comprises a peptide linker that is at least thiee amino acids in length In one embodiment, the MPPT comprises a peptide linker that is at least four amino acids in length In one embodiment, the MPPT comprises d peptide linker that is at least five amino acids m length In one embodiment, the MPPT comprises a peptide linker that is at least ten ammo acids in length In one embodiment, the MPPT comprises a peptide linker that is at least fifteen amino acids in length Peptide linkers that aie susceptible to cleavage by enzymes of the complement system, uiokinase, tissue plasminogen activator, trypsin, plasmin, or another enzyme having piote
  • the MPPT comprises a cytokine-receptor targeting unit linked by a cleavable linker region
  • the MPPT comprises a cleavable linker region that is a protease-cleavable linker
  • Other linkers, cleavable foi example by small molecules, may also be used Examples of protease cleavage sites are those cleaved by factor Xa, thrombin and collagenase
  • the MPPT comprises a linker having a protease cleavage site that is cleaved by a protease that is associated with a disease
  • the piotease cleavage site is one that is cleaved by a protease that is up regulated or associated with cancers in general Examples of such proteases die uPA, the matrix metalloproteinase (MMP) family, the caspases, elastase, and the plasminogen
  • a protease cleavage region targeted by Factor Xa is I E G R (SEQ ID NO:23).
  • a protease cleavage region targeted by Enterokinase is D D D D K (SEQ ID NO:24).
  • a protease cleavage region targeted by Thrombin is L V P R G (SEQ ID NO:25).
  • the MPPT comprises a cleavable linker region which is targeted by endocellular proteases.
  • Table 3 identifies additional non-limiting examples of selected cleavage sites recognized by the proteases described above.
  • the attachment of a linker to the protein toxin moiety need not be a particular mode of attachment or reaction. Any reaction providing a product of suitable stability and biological compatibility is acceptable.
  • MPPTs accoiding to the present invention are derived fiom nPPTs that comprise one or more binding domains, as known in the art
  • MPPTs according to the present invention may optionally comprise modifications to one or moie binding domains, as applicable
  • native proaerolysin from Aeromonas species comprises two binding domains, a small lobe binding domain, and a large lobe binding domain
  • native alpha toxin from Clostridium septicum comprises only a large lobe binding domain
  • modifications of the binding domains include functional deletion of a binding domain
  • a functionally deleted binding domain in an MPPT results in an MPPT that has an attenuated ability to bind to its cell surface receptor, yet still retains pore forming ability
  • a functional deletion can
  • MPPTs with functional deletions in the binding domain may be prepared using methods known m the art These methods include the use of recombinant DNA technology as described in Sambrook et al , supra Alternatively, functional deletions of the binding domain may also be achieved by duect modification of the protein itself accoiding to methods known in the art, such as pioteolysis to generate fragments of the MPPT, which can then be chemically linked together (See Section 2 2)
  • the MPPT comprises functional deletion of its small lobe binding domain (SBD)
  • SBD small lobe binding domain
  • Examples of functional deletions of the SBD that may be made in the A hydrophda proaerolysm polypeptide include, but are to limited to deletion of the ent ⁇ e SBD, corresponding to amino acid 1-83 of SEQ ID NO- 2, or portions of this region, for example amino acids 45-66 of SEQ ID NO 2
  • one or more point mutations can be made in the SBD, for example, at one oi more of the following positions W45, 147, M57, Y61 , K66 (amino acid numbeis refer to SEQ ID NO 2)
  • Exemplary mutations at these positions include, but aie not limited to W45A, I47E, M57A,Y61A, Y61C, K66Q (amino acid numbers refei to SEQ ID NO 2) and those described in Mackenzie et al J Biol Chem 274 22604-22609, 1999 (herein incoiporated by refeience)
  • the MPPT comprises functional deletion of its large lobe binding domain (LBD)
  • LBD large lobe binding domain
  • Exemplaiy functional deletions of the LBD of MPPTs lhat aie based on pioaerolysm include, but are not limited to, deletion of the entire LBD (contained m approximately ammo acid residues 84-426 of SEQ ID NO T) or portions thereof, or intioduction of comp ⁇ ses one or more point mutations into the LBD, foi example at one or more of amino acid residues Y 162, W324, R323, R336, and/oi W 127
  • an MPPT based on proaerolysm is provided that comprises a point mutation at W127 and/or R336
  • an MPPT based on proaerolysm is provided that comprises the point mutations Y162A and/or W324A.
  • an MPPT based on proaerolysm is piovided that comprises the point mutations R336A or R336C, and/or W127T.
  • MPPTs based on proaeiolysin may also comprise mutations to other residues that interact directly with the GPI-protein ligand resulting in functional deletion of the LBD
  • MPPTs derived fiom alpha toxin include at least one substituted ammo acid in the receptor binding domains of the alpha toxin, for example at one or moie of amino acid residues 53, 54, 62, 84-102, 259-274 and 309-315 of the sequence of the native alpha toxm as shown in SEQ ID NO 4
  • MPPTs derived from alpha toxin include mutations at one or moie of the following residues W85, Y128, R292, Y293, and R305 1.2.2. Modification of Activation Sequence
  • MPPTs according to the piesent invention may optionally comprise modifications of the naturally occurring activation sequence of the nPPT to permit selective activation of the MPPT
  • the activation sequence may be modified so as to permit activation of the MPPT in a specific sub-group of cytokine-receptor bearing cells or m certain types of diseased cells, such as cancer cells
  • the MPPTs may be modified with a single cleavage site modification ( ⁇ e the native activation sequence is modified to piovide a single cleavage site that is diffeient to the native cleavage site(s)), or with a plurality of cleavage site modifications ( ⁇ e the native activation sequence is mnodified to provide a plurality of different cleavage sites, which may or may not include the native cleavage site(s))
  • MPPTs with a plurality of cleavage site modifications may include different types of cleavage sites that are recognized by diffeient enzymes
  • the naturally occurring activation sequence may be modified
  • the MPPT comprises ⁇ modified activiation sequence in which the native activation sequence of the nPPT has been functionally deleted by insertion of one or more cleavage site modifications
  • the MPPT comprises a modified activation sequence in which the naturally occurring activation sequence is functionally deleted via mutations of one oi more ammo acid residues in the native activation sequence to produce one or more cleavage site modifications
  • the MPPT comprises a modified activation sequence in which the native activation sequence of the nPPT has been functionally deleted by replacing the natuially occurring activation sequence with one or more cleavage site modifications
  • the MPPT comprises a modified activation sequence having one or more cleavage
  • the MPPT comprises a modified activation sequence that includes one or more cleavage sites that are recognized by uPA.
  • the MPPT comprises a modified activation sequence that includes a uPA cleavage site.
  • An example of a uPA cleavage site is: SGRSAQ (SEQ ID NO:31).
  • the MPPT comprises a modified activation sequence comprising a cleavage site for the protease PSA.
  • An example of a PSA-specific cleavage site is: HSSKLQ (SEQ ID NO:33). 1.2.3. Addition of an Artificial Regulatory Domain (ARD)
  • the MPPTs according to the invention may optionally be further modified by the addition of one or more artificial regulatory domains (ARDs) other than the cytokine- receptor targeting unit(s).
  • ARDs that can be added to MPPTs include secondary targeting units that are capable of improving the selective targeting of the MPPT to a cytokine-receptor bearing target cell, or that are capable of further refining the selective targeting of the MPPT, for example, to a specific sub-group or type of cytokine-receptor bearing cells such as those associated with a particular organ, tissue or disease.
  • Inhibitory units that are capable of inhibiting the activity of the MPPT are also contemplated as suitable ARDs.
  • an MPPT comprises one or more ARD that is a secondary targeting unit.
  • the MPPT comprises one or more ARD that is an inhibitory unit.
  • the MPPT comprises an ARD that can function as both a secondary targeting unit and an inhibitory unit.
  • the MPPT comprises an ARD that is capable of functioning to inhibit binding to normal cells, yet able to direct binding to diseased cells, such as cancer cells.
  • ARDs according to the present invention may be proteins, peptides, antibodies, Hgands, or other moieties.
  • the ARD may be covalently attached directly to the nPPT, or it may be attached via an appropriate linker. Appropriate linkers and methods of adding them are as described in relation to the attachment of cytokine-receptor targeting units, in Section 1.1.1.
  • the ARD may be added to the N- or C-terminus of the MPPT, or both. Alternatively, the ARD may be added to a different region of the MPPT.
  • the MPPT comprises an ARD added at or proximal to the N-terminus of the nPPT.
  • the MPPT comprises an ARD added at or proximal to the N-terminus of proaerolysin.
  • the MPPT comprises an ARD added at or proximal to the N-terminus of alpha toxin. In a further embodiment the MPPT comprises an ARD added at or proximal to the C-terminus of the nPPT. In another embodiment, the ARD is added to the C-terminus of proaerolysin. In yet another embodiment, the ARD is added to the C-terminus of alpha toxin. In still another embodiment, the ARD is added to proaerolysin using recombinant DNA methods, such as those described in Section 2.
  • the MPPTs of the present invention comprise secondary targeting units that may be used to provide additional target selectivity to the MPPT.
  • the secondary targeting molecule may act as an inactivator of the MPPT.
  • the secondary targeting molecule may charge neutralize or sterically inhibit the MPPT from pore formation.
  • the secondary targeting unit can be a ligand which binds selectively to the target cell.
  • the MPPT comprises a secondary targeting molecule that is an antibody.
  • Antibodies contemplated by the instant invention can be a full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecule (for example, an IgG antibody) or an immunologically active (i.e., specifically binding) portion of an immunoglobulin molecule, and may or may not be humanized.
  • Suitable antibodies can be polyclonal or monoclonal antibodies.
  • the antibody may be a single chain antibody as known in the art and described in Bird et al. Science 242:423-6, 1988; and Huston et al., Proc. Natl. Acad. Sci. 85:5879-83, 1988 or an antibody fragment, such as a Fab fragment.
  • the MPPT comprises a secondary targeting unit that is an antibody that selectively binds a specific type of diseased cell
  • the MPPT comprises a secondary targeting unit that is a monoclonal Oi single chain antibody that binds to prostate specific membrane antigen that can be expiessed at high levels on prostate cells
  • the MPPT comprises a secondaiy targeting unit that is a monoclonal antibody or single chain antibody against CD4 or CD8 that can be expressed on T-cells
  • the MPPT comprises a secondary targeting unit that is an antibody that selectively binds a cancer cell
  • the secondary targeting unit is an antibody that recognizes one of CA-15-3 (for example, catalog number RDI- CAl 53-AG from Research Diagnostics, recognizes breast cancer cells), thyroid transcription factor 1 (TTFl, foi example,
  • the MPPT comp ⁇ ses a secondaiy targeting unit that is the antibody Rituxan, which taigets CD20 and B-cell non-Hodgkin's lymphoma cells
  • Suitable antibodies for use as secondaiy targeting units include, but arc not limited to, Heiceptin® (Genentech) which recognizes some breast cancers, and lymphomas, Alemtuzumab (MabCampath®) which binds to CD52, a molecule found on white blood cells and recognizes chronic lymphocytic leukemia cells, Lym-1 (Oncolym®, Sche ⁇ ng), which binds to the HLA-DR-encoded histocompatibility antigen that can be expressed at high levels on lymphoma cells, Beva ⁇ zumab (Avastin®, Avastm), which binds to vascular endothelial growth factor (VEGF) thus blocking its action and dep ⁇ ving the tumor of its blood supply, and Cetuximab (Eibitux®, Merck) which binds to colorectal cancers
  • the MPPT comp ⁇ ses a secondary targeting unit that is a molecule or hgand that recognizes or is capable of specific
  • the MPPT compiises a secondaiy targeting unit that selectively duects the MPPT to diseased cells
  • the MPPT comprises a secondary targeting unit that selectively directs the MPPT to a specific tissue or organ
  • the MPPT composes a secondaiy targeting unit that is additionally capable of acting as an inhibitory unit
  • the AFAI antibody fiagment is capable of reducing the activity of the MPPT, as well as selectively targeting the MPPT to a lung cancer cell
  • other proteins of similar size are capable of acting as an inhibitory unit
  • an inhibitory unit may inactivate the MPPT by, for example, charge neutralization, and/or by ste ⁇ cally inhibiting eithei the ability of the MPPT to bind to its ieceptor on the cell membrane, or the ability of the MPPT to form pores in the cell membrane
  • suitable inhibitory units include antibodies, enzymes, carbohydrates, peptides, ubiquitin, a phage (via phage engineering) or a strcptavidin microbead via peptide biotinylation
  • the MPPT comprises an inhibitoty unit that is an antibody
  • the MPPT comp ⁇ ses an inhibitory unit that is an AFAI antibody fragment
  • the inhibitoiy unit can also be capable of functioning as a secondary targeting unit
  • the MPPTs may further comprise additional modifications provided that the modifications do not affect the ability of the MPPTs to selectively target cancer cells
  • modifications include ammo acid substitutions, insertions or deletions, and modifications, for example, to reduce antigenicity of the MPPT, to enhance the stability of the MPPT and/or to improve the pharmacokinetics of the MPPTs
  • furthei modifications to MPPTs involve only a small number of ammo acids and include deletions (for example of 1-3 or more amino acids), insertions (for example of 1-3 or more residues), or substitutions that do not interfere with the ability of the MPPTs to selectively target and kill cancer cells
  • the MPPT comp ⁇ ses further modifications that involve less than 30%, 20%, 15%, 10%, 5%, or 2% of the total number of amino acids and maintains the ability to selectively target and kill cancer cells
  • the modification can be a substitution whereby at least one residue in the amino acid sequence has been removed and a different residue inserted in its place
  • the MPPT comp ⁇ ses as a furthei modification a substitution that is a conservative substitution
  • a conservative substitution is one in which one or more amino acids are substituted with amino acid residues having similar biochemical properties Typically, conservative substitutions have little to no impact on the activity of a resulting polypeptide
  • Examples of amino acids which may be substituted for an original ammo acid in a protein and which are regarded as conservative substitutions include Ser for Ala, Lys for Arg, GIn or His for Asn, GIu for Asp, Sei for Cys, Asn for GIn, Asp foi GIu, Pro foi GIy, Asn or Gin foi His, Leu oi VaI for He, He or VaI for Leu, Arg or GIn for Lys, Leu or He for Met, Met, Leu or Tyi foi Phe, Thi for Ser, Ser for Thi , Tyr for Tip, Tr
  • the MPPT compi ises as a further modification a substitution that is a permissive substitution
  • Permissive substitutions are non-conservative ammo acid substitutions, but also do not significantly alter MPP activity
  • An example is substitution of Cys for AIa at position 300 of SEQ ID NO 2 in a proaerolysin polypeptide Othei non-conservative substitutions that do not affect the activity of the MPPT can be readily determined by the skilled technician
  • substitutions can be introduced by manipulating the nucleotide sequence that encodes the MPPT polypeptide using, for example, standard procedures such as site-directed mutagenesis or PCR Further information about substitutions can be found m, among other locations, Ben-Bassat et al , (J Bacterid 169 751 7, 1987), O'Regan et al , (Gene 77 237-51, 1989), Sahin-Toth et al , (Protein Sci 3 240-7, 1994), Hochuh et al , (Bio/Technology 6 1321-5, 1988), WO 00/67796 (Curd et al ) and in standard textbooks of genetics and molecular biology
  • the MPPTs include as a further modification, 1 or more amino acid substitutions of single residues In another embodiment, the MPPTs include as a fuither modification 1 amino acid substitution In another embodiment, the MPPTs include as a furthei modification from about 2 to about 10 amino acid substitutions In another embodiment, the MPPTs include as a further modification about 3 to about 5 amino acid substitutions
  • Non-hmiting examples of further modifications that may be made to MPPTs derived fiom proaerolysin in various embodiments of the invention include substitutions at one or more of positions 22, 107, 1 14, 121, 127, 135, 159, 164, 171, 186, 198, 201, 202, 203, 216, 220, 238, 248, 249, 250, 252, 253, 254, 256, 258, 259, 263, 284, 285, 293, 294, 296, 299, 300, 309, 332, 341, 349, 361, 369, 371, 372, 373, 416, 417, 418, 445 and 449 Specific non limiting examples of substitutions at these positions are listed in Table 4
  • Pcptidomimetic and organomimetic embodiments are also contemplated, whereby the three-dimensional arrangement of the chemical constituents of such peptido- and oiganomimetics mimic the three-dimensional arrangement of the polypeptide backbone and component ammo acid side chains in the polypeptide, iesulting in such peptido- and organomimetics of an MPPT which have the ability to lyse target cells
  • a pharmacophore is an idealized, three- dimensional definition of the structural requiiements for biological activity
  • Peptido- and organomimetics can be designed to fit each pharmacophore with current computer modeling software (usmg computer assisted drug design or CADD) See Walters, Computer-Assisted Modeling of Drugs", in Klegerman & Groves, eds , 1993, Phaimaceutical Biotechnology, Interpharm Press Buffalo Grove, 111 , pp 165- 174 and Principles of Pharmacology (ed Munson, 1995), chapter 102 tor
  • Othei modifications include conveision of hydioxyl groups of the polypeptide side chain to Ci-Ci 6 alkoxy or to a Q-C K ; ester using well-recognized techniques Phenyl and phenolic rings of the polypeptide side chain can be substituted with one or moie halogen atoms such as F, Cl, Br or !, 01 with Ci-Qg alkyl, Q-Q ⁇ alkoxy, carboxylic acids and esters thereof, or amides of such carboxyhc acids Methylene groups of the polypeptide side chains can be extended to homologous C 2 -C4 alkylenes Thiols can be protected with any one of a numbei of well-iecognized protecting groups, such as acetamide groups Those skilled in the art will also recognize methods foi introducing cyclic structures into the polypeptides described herein to select and provide conformational constraints to the structure that result in enhanced stability For example, a caiboxyl-teimin
  • Modified Pore-forming Protein Toxins Modified pore-forming piolem toxins (MPPTs) according to the present invention can be prepaied by many methods, as known in the art Addition of the cytokine receptor targeting unit and othei optional modifications to the nPPT polypeptide in ordei to provide an MPPT can be acheived, for example, by engineering the nucleic acid encoding the nPPT using recombinant DNA technology Alternatively, the cytokine- receptor targeting unit can be added and other optional modifications made to the nPPT polypeptide itself, using chemical techniques and/oi limited proteolysis Combinations of these methods may also be used to prepate the MPPTs according to the present invention, as is also known in the art
  • the cytokine-receptoi targeting unit(s) and optional ARD(s) can be d ⁇ ectly attached to the nPPT polypeptide or can be indirectly attached via an approp ⁇ ate linker Appiopi iate linkers are desci ibed in Section 1 1 1
  • the MPPTs can be prepared entiiely by recombinant techniques, or eithei the nPFF or the cytokine targeting unit, or both, can be prepared by recombinant techniques and subsequently joined by chemical techniques MPPTs comprising ARD(s) may likewise be prepared entirely or partially by recombinant methods
  • nucleic acid sequence can be obtained directly from a suitable organism, such as Aeromonas hyclrophila, by extracting the mRNA by standard techniques and then synthesizing cDNA from the mRNA template (for example, by RT-PCR)
  • genomic DNA can be isolated and the sequence encoding the nPPT amplified by PCR or the nucleic acid sequence encoding the nPPT can be obtained from an appropriate cDNA or genomic DNA libiary by standard procedures The nucleic acid sequence encoding the nPPT is then inserted directly or after one
  • the nucleic acid sequence encoding the nPPT can be further engineered to include a nucleic acid sequence encoding the cytokine targeting unit and/or to introduce mutations into the binding do ⁇ nam(s) and/or activation sequence and/or to include an ARD
  • Nucleic acid sequences encoding various cytokines are known in the art and are available fiom the GenBankTM database For example, interleukins such as interleukin-2 (IL 2) (GenBank Ace No S77834), IL-3 (GenBank Ace No M 14743), IL-4 (GenBank Ace No M23442), IL-5 (GenBank Ace No J03478), IL-6 (GenBank Ace No M14584), IL-7 (GenBank Ace No NMJ)00880), IL-10 (GenBank Ace No NM_000572), IL- 12 (GenBank Ace No AF180562 and GenBank Ace No AF180563), IL- 13 (IL-2 (IL 2) (GenBank Ace No S77834),
  • IL- 17 (GenBank Ace No NM_002190) and IL- 18 (GenBank Ace No NM_001562)
  • hematopoietic factors such as granulocyte macrophage colony stimulating factor (GM-CSF) (GenBank Ace No X03021), granulocyte colony stimulating factor (G-CSF) (GenBank Ace No X03656), platelet activating factor (GenBank Ace No NM_000437) and erythropoeitm (GenBank Ace No X02158), tumor necrosis factors (TNF) such as TNF alpha (GenBank Ace No X02910), lymphokines such as lymphotoxm alpha (GenBank Ace No X02911), lymphotoxm- beta (GenBank Ace No Ll 1016), leukoteguhn, macrophage migration inhibitory factor (GenBank Ace No M25639), and neuroleukin (GenBank Ace No K03515), regulators of metabolic processes such as leptin (GM-CSF)
  • Mutations in either the nPPT or cytokine targeting unit can be introduced at specific, pie-selected locations in the nucleic acid sequence by in vitto site-directed mutagenesis techniques well-known in the ait Mutations can be intioduced by deletion, inseition, substitution, inversion, or a combination theicof, of one or more of the appropriate nucleotides making up the coding sequence This can be achieved, for example, by PCR based techniques for which primers are designed that incorporate one or more nucleotide mismatches, insertions or deletions The presence of the mutation can be verified by a number of standard techniques, foi example by rest ⁇ ction analysis or by DNA sequencing
  • the MPPTs according to the present invention can be prepaied as fusion proteins
  • such fusion proteins may include nPPTs that have been modified to include an ARD with or without a linker
  • Linker regions can be used to space the two portions of the protein from each othei and to provide flexibility between them as described above
  • Linker regions that can be added to the MPPTs using recombinant DNA technology are generally peptides of between 1 and 30 amino acids in length, foi example less than 20 ammo acids in length
  • DNA sequences encoding a fusion protein can be inserted into a suitable expression vector which is used to transform prokaryotic or eukaryotic cells, for example bacteria, yeast, insect cells oi mammalian cells
  • DNA can be altered in numeious ways without affecting the biological activity of the encoded protein
  • PCR can be used to pioduce variations in the DNA sequence which encodes an MPPT
  • variations in DNA sequence may be used to optimize for codon preference in a host cell used to express the protein, or may contain other sequence changes that facilitate expression
  • the expression vector may further include regulatory elements, such as transcriptional elements, required for efficient tiansc ⁇ ption of the MPPT-encodtng sequences
  • regulatory elements such as transcriptional elements
  • Examples of regulatory elements that can be incorporated into the vector include, but are not limited to, promoters, enhancei s, terminatots, and polyadenylation signals
  • the present invention therefore, provides vectors comp ⁇ sing a iegulatory element operatively linked to a nucleic acid sequence encoding a genetically engineered MPPT
  • selection of suitable iegulatory elements is dependent on the host cell chosen for expression of the genetically engineered MPPT and that such regulatory elements may be det ived from a variety of sources, including bacterial, fungal, viral, mammalian or insect genes
  • the expression vector may additionally contain heterologous nucleic acid sequences that facilitate the purification of the expressed MPPT. Examples of such heterologous nucleic acid sequences include, but are not limited to, affinity tags
  • amino acids corresponding to expression of the nucleic acids can be removed fiom the exptessed MPFT p ⁇ oi to use accoiding to methods known in the art Alternatively, the amino acids co ⁇ esponding to expression of heteiologous nucleic acid sequences can be ietained on the MPPT, providing that they
  • the MPPT is prepared and expressed as a histidine tagged protein
  • the histidme tag can be located at the carboxyl terminus or the amino terminus of the MPPT
  • the expression vectors can be introduced into a suitable host cell or tissue by one of a variety of methods known m the an Such methods can be found generally described in Ausubel et al , Current Protocols in Molecular Biology, Wiley & Sons, NY (1997 and updates), Sambrook et al , Molecular Cloning- A Ix ⁇ oiatory Manual, CoId- Sp ⁇ ng Harbor Press, NY (2001) and include, for example, stable or transient
  • transfection, lipofection, electropoiation, and infection with recombinant vital vectors One skilled in the art will understand that selection of the appropriate host cell for expression of the MPP will be dependent upon the vector chosen Examples of host cells include, but are not limited to, bacterial, yeast, insect, plant and mammalian cells
  • a host cell may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product m a specific, desired fashion Such modifications (e g , glycosylation) and processing (e g , cleavage) of piotein pioducts may be important foi the function of the protein
  • modifications e g , glycosylation
  • processing e g , cleavage
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and
  • Appiop ⁇ ate cell lines oi host systems can be chosen to ensure the correct modification and processing of the foreign protein
  • eukaryotic host cells hatch possess the cellular macnineiy for pioper processing of the p ⁇ maiy transcript, and for post translational modifications such as glycosylation and phosphoi ylation of the gene product can be used
  • mammalian host cells include, but aie not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38
  • the MPPTs can be produced vn a piokaryotic host (e g , E coh, A salmonicida or B subtilis) oi in a eukaryotsc host (e g , Saccharomycei oi Pichia, mammalian cells, e g , COS, NIH 3T3, CHO, BHK, 293, or HeLa cells, or msect cells)
  • the MPPTs can be purified from the host cells by standard techniques known in the ait If desired, the changes in amino acid sequence engineered into the protein can be determined by standard peptide sequencing techniques using either the intact protein or proteolytic fragments thereof As an alternative to a directed appioach to introducing mutations into naturally occurring pore-forming proteins, a cloned gene expressing a pore-forming protein can be subjected to random mutagenesis by techniques known in the art Subsequent expiession and screening of the mutant forms of the protein thus generated would allow the identification and isolation of MPPTs according to the piesent invention
  • cytokine receptoi targeting unit and/or additional ARDs, and/oi linkers may be added to the nPPTs of the present invention via a covalent or non-covalent bond, or both Non-covalent intei actions can be ionic, hydrophobic, or hydrophihc, such as interactions involved in a leucme-z ⁇ per or antibody-Piotein G interaction (Derrick et al , Nature 359 752, 1992)
  • Attachment of a cytokme-ieceptor targeting unit oi ARD to a nPPT may be achieved using methods known in the art Such methods include, for example, covalent linkage of the cytokine-receptoi targeting unit or ARD to the nPPT
  • cytokme- receptor taigeting units may be added to the nPPT via covalent crosshnking (see Woo et al , Arch Pharm Res 22(5) 459-63, 1999 and Debmski and Pastan, Chn Cancer Res 1(9) 1015-22, 1995)
  • Crosshnkmg can be non-specific, for example by using d homobifunctional-lysine-reactive crosshnking agent, or it can be specific, for example by using a crosshnking agent that ieacts with amino gioups on the cytokine-receptot targeting unit or ARD and with a cysteine residue located in the nPPT
  • a crosshnking agent that ieacts
  • Proteins can be chemically modified by standard techniques to add a sulfhydryl gioup
  • Traut's reagent (2-ii ⁇ nnothiolane-HCl) (Pierce Chemicals, Rockford 111 ) can be used to introduce a sulfhydryl group on primary amines, such as lysine residues or N-terminal amines
  • a protein or peptide modified with Traut's reagent can then react with a protein or peptide which has been modified with reagents such as N-succinimidyl 3 (2 py ⁇ dyldithio) propionate (SPDP) or succmirmdyl 4-(N-male ⁇ rnidomethyl)cyclohexane-l-carboxylate (SMCC) (Pierce Chemicals, Rockford, III )
  • the cysteine residue of one of the components can be activated ptior to addition to the reaction mixture with 5,5 -dithiobis(2-nitiobenzoic) acid (DTNB) or 2,2' duhiopy ⁇ dme, using methods known in the art
  • DTNB 5,5 -dithiobis(2-nitiobenzoic) acid
  • 2,2' duhiopy ⁇ dme 1,5 -dithiobis(2-nitiobenzoic) acid
  • the mixture is dialyzed against phosphate buffered saline to remove unconjugated molecules
  • Sephadex chiomatogiaphy or the like is then carried out to sepaiate the compound of the invention from its constituent parts on the basis of size MBS-medidted coupling can also be utilised to join the cytokine receptor targeting unit and the nPPT through a c>steme thiol group in
  • the components can also be joined using the pol ymer, monomethoxy-polyethylene glycol (mPEG), as desci ibed in Maiti et al , Int J Cancer Suppl 3 17-22, 1988
  • mPEG monomethoxy-polyethylene glycol
  • cytokine targeting unit can also be conjugated through the use of standard conjugation chemist.
  • binding pairs one membei of which is attached to or pait of the cytokine targeting unit and the other member of which is attached to or part of the nPPT
  • suitable binding pairs include antigen or hapten with antibody, antibody with anti antibody, receptor with ligand, enzyme or enzyme fragment with substrate, substrate analogue or ligand, biotin oi lectin with avidin or streptavidin, lectin with cai bohydrate, digoxin with anti-digoxin, His-tags with Ni 2+ ions, pans of leucine zipper motifs (see, for example, U S Patent No 5,643,731), bacitracin with undecaphosphopi eyl pyiophosphate as well as various homodimers and heterodimers known in the art
  • the cytokine receptor targeting unit and the nPPT can also be conjugated through the use of standard conjugation chemist
  • the prepaiation of the MPPTs can also be conducted on a large scale, for example for manufacturing purposes, using standard techniques known in the art such as large scale fermentation processes for production of recombinant proteins, and ultrafiltration, ion exchange chromatography, immobilized metal ion affinity chromatography for purification of iecombmant proteins
  • the MPPTs accoiding to the piesent invention retain their pore-forming activity and specifically bind to target cytokine receptor bearing cells
  • the ability of the MPPTs according to the piesent invention to selectively target cells can be tested using standaid techniques known m the art Exemplary methods of testing candidate MPPTs are provided below and in the Examples included herein One skilled in the art will undei stand that other methods of testing the compounds are known in the art and are also suitable for testing candidate MPPTs
  • MPPTs accoiding to the present invention that comprise one or moie cytokme- ieceptor targeting units can be tested for their ability to specifically bind to target c> tokine receptor bearing cells according to methods known m the art
  • the ability of the candidate MPPTs to specifically bind to the target cytokine receptor bearing cell can be measured in vitro using flow cytometric methods as is known in the art.
  • MPPTs of the present invention can be tested for the ability to specifically bind a target cell by incubating the candidate MPPT with a suitable cell line bearing the targeted cytokine receptor and determining binding by flow cytometry.
  • the binding ability of the candidate MPPT can be quantitated by surface plasmon resonance using standard protocols.
  • the MPPT can be reacted with the appropriate ⁇ rotease(s) and the reaction products can be tested in a hemolysis assay as is known in the art.
  • a hemolysis assay as is known in the art.
  • An example of a suitable assay is described in Howard, S. P., and Buckley, J.T. (1985). Activation of the hole-forming toxin aerolysin by extracellular processing. J. Bacterid. 163:336-340 (herein incoiporated by reference).
  • MPPTs of the present invention can be tested for their ability to oligomerize using methods known in the art. For example, MPPTs of the present invention can be incubated with a suitable cell-line and the incubation products can be electrophoresed on SDS-PAGE gels. Oligomerization can be assessed by examining the size of the polypeptide on the gel for cell-associated oligomers.
  • MPPTs according to the present invention can be tested for their ability to kill the targeted cytokine receptor bearing cell, using techniques known in the art.
  • the ability of the MPPTs to kill cells can be assayed in vitro using a suitable cell-line bearing the targeted cytokine receptor.
  • cells of the selected test cell line are grown to an appropriate density and the candidate MPPT is added. After an appropriate incubation time (for example, about 48 to 72 hours), cell survival is assessed.
  • Methods of determining cell survival are well known in the art and include, but are not limited to, the resazurin reduction test (see Fields & Lancaster (1993) Am. Biotechnol. Lab, 11:48-50; O'Brien et al., (2000) Eur. J.
  • Cytotoxicity is determined by comparison of cell survival in the treated culture with cell survival in one or more control cultuies, for example, untreated cultuies and/or cultuies comprising a cell line that does not express the targeted cytokine receptor, or other apptop ⁇ ate control
  • the cell-line selected for testing the candidate MPPT will depend on the particular cytokine-receptor targeting unit attached to the MPPT
  • the suitable cell-line will display the targeted cytokine teceptor
  • a variety of cell-lines suitable for testing the candidate MPPTs are known m the art and many are commercially available (for example, fiom the American Type Cultuie Collection, Manassas, VA)
  • suitable cell-lines for in vitro testing include, but are not limited to, the mouse CTLL- 2 and human Hut 78 cell-lines displaying IL-2 receptors, mouse Ba/F3 peripheral blood pio-B cells and human TF/H-Ras acute myeloid leukemia cells displaying IL-3 receptors, head and neck cell line SCC-25, breast carcinoma MDA-MB231, pancreatic cells PANC 1, ovarian cell line PA-I displaying IL-4 receptors, mouse WEHl fibroblast cells displaying TNF- ⁇ receptors, human ACC-LC-80 small cell lung cancer
  • the ability of the MPPTs to treat T-cell dependent autoimmune diseases such as rheumatoid a ⁇ th ⁇ tis (RA), multiple sclerosis, (MS) or msulin-dependent diabetes can be tested by administering the MPPT to a suitable animal model
  • suitable animal models include, foi example, adjuvant-induced arthritis m rats (see Colpdert, F C et al , (1982) Further evidence validating adjuvant arthritis as an experimental model of chronic pain in the rat Life Sci 31 67-75, and Enna et al , supra), experimental allergic encephalttis in guinea pigs (see D ⁇ scoll B F et al , (1976) Protection against experimental allergic encephalomyelitis with pepetides derived from myelin basic protein plinnce of intact encephalitogenic site is essential, J Immunol 117 110-114) or othei rodents and the non-obese diabetic (NOD) mouse (see Tochino
  • Cuirent animal models for screening anti-tumor compounds include xenograft models, in which a human tumor has been implanted into an animal
  • xenogi aft models of human cancer include, but are not limited to, human solid tumor xenografts, implanted by sub cutaneous injection or implantation and used in tumoi growth assays, human solid tumor isogiafts, implanted by fat pad injection and used in tumor giowth assays, human solid tumor orthotopic xenogiafts, implanted directly into the relevant tissue and used in tumor growth assays, experimental models of lymphoma and leukemia in neste, used in bossval assays, and experimental models of lung metastasis in mice
  • the xenograft models can furthei comprise transplanted human peripheral blood leukocytes, which allow for evaluation of the anti-cancer immune iesponse
  • murine cancer models can be used for screening anti-tumor compounds
  • appropriate murine cancer models include, but are not limited to, implantation models in which murine cancer cells are implanted by intravenous, subcutaneous, fat pad or orthotopic injection, murine metastasis models, transgenic mouse models, and knockout mouse models
  • the MPl 1 Ts can be tested in vivo on solid tumors using mice that are subcutaneously grafted bilaterally with 30 to 60 mg of a tumor fragment, or implanted with an appropriate number of cancer cells, on day 0
  • the animals bearing tumors are mixed before being subjected to the various treatments and controls
  • tumors are allowed to develop to the desired size, animals having insufficiently developed tumors being eliminated
  • the selected animals are distributed at random to undergo the treatments and controls
  • Animals not bearing tumors may also be subjected to the same treatments as the tumor-bearing animals in order to be able to dissociate the toxic effect fiom the specific effect on the tumor Chemotherapy generally begins from 3 to 22 days after grafting, depending on the type of tumor, and the animals ate obsei ved every day
  • the MPPTs of the present invention can be administered to the animals, for example, by i p injection, intravenous injection, direct injection into the tumor, or bolus infusion
  • the different animal gioups are weighed
  • the tumors are measured after a pre-determined time period, or they can be monitored continuously by measuring about 2 or 3 times a week until the tumor reaches a predetermined size and / or weight, or until the animal dies if this occurs before the tumor reaches the pre-determined size / weight.
  • the animals are then sacrificed and the tissue histology, size and / or proliferation of the tumor assessed
  • Orthotopic xenograft models are an alternative to subcutaneous models and may more accurately reflect the cancel development process
  • tumor cells are implanted at the site of the organ of o ⁇ gm and develop internally Daily evaluation of the size of the tumors is thus more difficult than in a subcutaneous model
  • a recently developed technique using green fluorescent protein (GFP) exptessing tumois in noninvasive whole body imaging can help to address this issue (Yang et al , Pi oc Nat Aca Sa, (2000), pp 1206 1211)
  • GFP green fluorescent protein
  • This technique utilizes human or murine tumors that stably express very high levels of the Aqueora vitoria green fluorescent protein
  • the GFP expressing tumors can be visualized by means of externally placed video detectors, allowing for monitoring of details of tumor growth, angiogenesis and metastatic spread Angiogenesis can be measured over time by monitoring the blood vessel density within the tumor(s)
  • the use of this model thus allows for simultaneous monitoring of several features associated with tumor progression and has high preclin
  • the animals are grafted with a particular number of cells, and the anti-tumor activity is determined by the increase in the survival time of the treated mice relative to the controls.
  • tumor cells are typically treated with the composition ex vivo and then injected into a suitable test animal. The spread of the tumor cells from the site of injection is then monitored over a suitable period of time.
  • In vivo toxic effects of the MPPTs can be evaluated by measuring their effect on animal body weight during treatment and by performing hematological profiles and liver enzyme analysis after the animal has been sacrificed.
  • the general toxicity of the MPPTs according to the present invention can be tested according to methods known m the art Foi example, the overall systemic toxicity of the MPPTs can be tested by determining the dose that kills 100% of mice (i e LDioo) following a single intravenous injection
  • Theiapeutic pioteins may elicit some level of antibody response when adminstered to a subject, which in some cases may lead to undesirable side effects Therefore, if necessary, the antigenicity of the MPFFs can be assessed as known m the art and described below In addition, methods to reduce potential antigenicity aie described
  • the kinetics and magnitude of the antibody response to the MPPTs described herein can be determined, for example, in immunocompetent mice and can be used to facilitate the development of a dosing regimen that can be used in a immunocompetent human.
  • Immunocompetent mice such as the strain C57-BL6 are administered intravenous doses of MPPT. The mice are sacrificed at varying intervals (e.g. following single dose, following multiple doses).
  • the native binding domain of the MPPT can be functionally deleted and replaced, for example with an ARD as described above.
  • the antigenicity of such MPPTs can be determined following exposure to varying schedules of the MPPT which lack portions of the native binding domain using the methods described above.
  • Another method that can be used to allow continued treatment with MPPTs is to use sequentially administered alternative MPPTs derived from other nPPTs with non-overlapping antigenicity.
  • an MPPT derived from proaerolysin can be used alternately with an MPPT derived from Clostridium septicum alpha toxin or Bacillus thuringiensis delta-toxin. All of these MPPTs would target cancer cells, but would not be recognized or neutralized by the same antibodies.
  • Serum samples from these mice can be assessed for the presence of anti-MPPT antibodies as known in the art.
  • epitope mapping can also be used to determine antigenicity of proteins as described in Marcia M. Stickler, David A. Estell and Fiona A. Harding. CD+ T cell epitope prediction using unexposed human donor peripheral blood mononuclear cells. J. Immunotherapy, 23(6):654-660, 20(X). Briefly, immune cells known as dendritic cells and CD4+ T cells are isolated from the blood of community donors who have not been exposed to the protein of interest. Small synthetic peptides spanning the length of the protein are then added to the cells in culture. Proliferation in response to the presence of a particular peptide suggests that a T cell epitope is encompassed in the sequence. This peptide sequence can subsequently be deleted or modified in the MPPT thereby reducing its antigenicity.
  • compositions comprising one or more MPPTs and one oi more non-toxic pharmaceutically acceptable carriers, diluents, excipients and/or adjuvants If desired, other active ingiedients may be included in the compositions As indicated above, such compositions aie suitable for use in the treatment of cancer
  • pharmaceutically acceptable carrier refers to a ca ⁇ iei medium which does not interfere with the effectiveness of the biological activity of the active ingredients and which is not toxic to the host or patient Representative examples are provided below
  • the pharmaceutical compositions may comprise, for example, from about 1% to about 95% of a MPPT of the invention
  • Compositions formulated for administration in a single dose form may comprise, for example, about 20% to about 90% of the MPPTs of the invention, whereas compositions that aie not in a single dose fotm may comprise, foi example, from about 5% to about 20% of the MPPTs of the invention Concentration of the MPPT in the final formulation can be as low as 001 ⁇ g
  • the composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder
  • conventional non toxic solid earners can include, for example, pharmaceutical grades of mannitol, lactose, starch, sodium saccharine, cellulose, magnesium caibonate, or magnesium stearate
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglyce ⁇ des
  • the pharmaceutical compositions can be formulated for administration by a variety of routes
  • the compositions can be formulated for oial, topical, rectal or paienteial administration or for administration by inhalation or spray
  • parenteral as used herein includes subcutaneous injections, intravenous, intramuscular, intrathecal, intiasternal injection or infusion techniques Direct injection or infusion into a tumor is also contemplated Convection enhanced delivery, a standard administration technique for piotein toxins, is also contemplated by the present invention
  • the MPPTs can be delivered along with a pharmaceutically acceptable vehicle
  • the vehicle may enhance the stability and/or delivery propeities
  • the present invention also provides for formulation of the MPPT with a suitable vehicle, such as an artificial membrane vesicle (including a liposome, noisome, nanosome and the like), microparticle or microcapsule, or as a colloidal formulation that compiises a pharmaceutically acceptable polymer
  • a suitable vehicle such as an artificial membrane vesicle (including a liposome, noisome, nanosome and the like), microparticle or microcapsule, or as a colloidal formulation that compiises a pharmaceutically acceptable polymer
  • the MPPT formulations can include additives to stabilise the protein in vivo, such as human serum albumin, or other stabilisers foi protein therapeutics known in the art
  • MPPT formulations can also include one or tnoie viscosity enhancing agents which act to pi event backflow of the formulation when it is administered, foi example by injection or via catheter
  • compositions foi oral use can be formulated, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion hard or soft capsules, or syrups or elixirs
  • Such compositions can be prepaied according to standard methods known to the art for the manufacture of pharmaceutical compositions and may contain one or more agents selected from the group of sweetening agents, flavoring agents, colouring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations
  • Tablets contain the active ingredient in admixtuie with suitable non-toxic pharmaceutically acceptable excipients including, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate, gi anulating and disintegrating agents, such as corn starch, or alginic acid; binding agents, such as starch, gelatine or acacia, and lubricating agents, such as magnesium stearate,
  • compositions for oial use can also be presented as haid gelatine capsules wheiein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatine capsules wheiein the active ingredient is mixed with water 01 an oil medium such as peanut oil, liquid paraffin 01 olive oil
  • compositions formulated as aqueous suspensions contain the active com ⁇ ound(s) in admixtuie with one oi more suitable excipients, foi example, with suspending agents, such as sodium carboxymethylcellulose, methyl cellulose, hydropi opylmethylcellulose, sodium alginate, polyvinylpyirohdone, hydroxypropyl- ⁇ -cyclodext ⁇ n, gum tiagacanth and gum acacia, dispersing or wetting agents such as a naturally occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example, polyoxyethyene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example, hepta-decaethjleneoxycetanol, or condensation products of ethylene oxide with paitial esters derived fiom fatty acids and a hexitol for example, polyoxyethylene sorbitol
  • compositions of the invention can also be formulated as oil-in-water emulsions
  • the oil phase can be a vegetable oil, for example, olive oil or arachis oil, or a mineral oil, for example, liquid paraffin, or it may be a mixture of these oils
  • Suitable emulsifying agents for inclusion m these compositions include naturally- occurring gums, for example, gum acacia oi gum tragacanth, naturally-occurring phosphatides, for example, soy bean, lecithin, or esters ot partial esteis derived from fatty acids and hexitol, anhydrides, for example, sorbitan monoleate, and condensation products of the said paitial esters with ethylene oxide, for example, polyoxyethylene sorbitan monoleate
  • the emulsions can also optionally contain sweetening and flavoring agents
  • compositions can be formulated as a syiup or elixir by combining the active ingredient(s) with one oi mote sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose
  • oi mote sweetening agents for example glycerol, propylene glycol, sorbitol or sucrose
  • Such formulations can also optionally contain one or more demulcents, preservatives, flavoring agents and/or coloring agents
  • the pharmaceutical compositions can be formulated as a sterile injectable aqueous or oleaginous suspension according to methods known in the art and using suitable one or more dispeising or wetting agents and/or suspending agents, such as those mentioned above
  • the sterile injectable preparation can be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol Acceptable vehicles and solvents that can be employed include, but aie not limited to, water, Ringer's solution, lactated Ringer's solution and isotonic sodium chloride solution
  • Other examples include, sterile, fixed oils, which are conventionally employed as a solvent or suspending medium, and a vanety of bland fixed oils including, for example, synthetic mono- or diglyce ⁇ des Fatty acids such as oleic acid can also be used in the preparation of i ⁇ jectables
  • the MPPT is conjugated to a water-soluble polymer, e g , to increase stability or c ⁇ culating half life oi reduce immunogenicity
  • water-soluble polymeis include, but are not limited to, polyethylene glycol (PEG), polyethylene glycol propionaldehyde, carboxymethylcellulose, dextran, polyvinyl alcohol (PVA), polyvinylpyi rohdone (PVP), polypropylene glycol homopolymers (PPG), polyoxyethylated polyols (POG) (e g , glycerol) and other polyoxyethylated polyols, polyoxyethylated sorbitol, or polyoxyethylated glucose, and othei caibohydrate polymers
  • PEG polyethylene glycol
  • PVA polyvinyl alcohol
  • PVP polyvinylpyi rohdone
  • PPG polypropylene glycol homopolymers
  • POG polyoxye
  • compositions and methods of preparing pharmaceutical compositions are known in the art and are described, for example, in "Remington The Science and Practice of Pharmacy” (formerly “Remingtons Pharmaceutical Sciences”), Gennaro, A , L ⁇ pincott, Williams & Wilkms, Philidelphia, PA (2000)
  • compositions of the present invention described above include one or more MPPTs of the invention m an amount effective to achieve the intended purpose
  • therapeutically effective dose refers to the amount of the MPPT that amehoiates the symptoms of cancel Determination of a therapeutically effective dose of a compound is well within the capability of those skilled in the art
  • the therapeutically effective dose can be estimated initially either in cell culture assays, or in animal models, such as those desc ⁇ bed herein Animal models can also be used to determine the appropriate concentration range and route of administration Such information can then be used to determine useful doses and routes for administration m other animals, including humans, using standard methods known m those of ordinary skill in the ait
  • Theiapeutic efficacy and toxicity can also be determined by standard pharmaceutical proceduies such as, for example, by determination of the median effective dose, oi ED 5 O 0 e the dose therapeutically effective in 50% of the population) and the median lethal dose, or LD 50 0 e the dose lethal to 50% of the population)
  • the dose ratio between therapeutic and toxic effects is known as the "therapeutic index," which can be expressed as the ratio, LD 50 /ED 50 .
  • the data obtained from cell culture assays and animal studies can be used to formulate a range of dosage for human or animal use.
  • the dosage contained in such compositions is usually within a range of concentrations that include the ED 50 and demonstrate little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the subject, and the route of administration and the like.
  • the exact dosage to be administered to a subject can be determined by the practitioner, in light of factors related to the subject requiring treatment. Dosage and administration are adjusted to provide sufficient levels of the MPPT and/or to maintain the desired effect. Factors which may be taken into account when determining an appropriate dosage include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Dosing regimens can be designed by the practitioner depending on the above factors as well as factors such as the half-life and clearance rate of the particular formulation.
  • the MPPTs of the present invention can be used to treat, stabilize or prevent a disease or disorder, or other conditions characterized by the presence of a class of unwanted cells bearing a cytokine receptor and/or by proliferation of cytokine receptor bearing cells.
  • the invention thus provides a method of lysing unwanted cells in a mammal, which cells have on their surfaces a receptor for a cytokine, by administering to the mammal an effective amount of a MPPT.
  • the unwanted cells can be, for example, lymphocytes, i.e., T-lym ⁇ hocytes or B-lymphocytes, or cancer cells.
  • the invention provides for the use of the MPPTs to lyse T- lymphocytes, which are the cell type primarily responsible for causing rejection of allografts (e.g., transplanted organs such as the heart).
  • T- lymphocytes killer and helper
  • T- lymphocytes respond to allografts by undergoing a proliferative but st characterized by the transitory presence on the T-iymphocyte sui faces of IL-2 receptors Killing these cells by the administiation, during the proliferative burst, of a MPPT thus attenuates allograft rejection, and also advantageously fails to adversely affect other cells (including resting or long-term memory T-lymphocytes needed for fighting infections), since these othei cells do not bear IL 2 receptors
  • MPPTs targeted to other cytokine ieceptors on T-lymphocytes such as IL- 7 (see Plum, J , et al , (1996) Interleukin-7 is a critical growth factor in early T-cell development Blood 88 4239-4245), IL 4 (Dokter, W H .
  • Interleukin-4 see IL-4
  • IL-4 ieceptoi expression on human T-cells is affected by intracellular signalling pathways and at IL-4 transcriptional and post-transc ⁇ ptional level Blood 80 2721- 2728), and IL-21
  • Interleukin 21 see Nutt, S L , Brady, J , Hayakawa, Y , and Smyth, M J (2004) Interleukin 21 is a key player in lymphocyte maturation C ⁇ t Rev Immunol 24 239- 250
  • T- cell-associated diseases include, for example, arthntis, T-cell lymphoma, skin cancers, pso ⁇ asis, multiple sclerosis, Type II diabetes melhtus, and diseases resulting from HIV infection
  • T cell dependent autoimmune diseases such as, rheumatoid arthritis, multiple sclerosis, and insulin-dependent diabetes melhtus
  • the MPPTs can also be used for selective elimination of unwanted cells such as regulatory T-lymphocytes, or plu ⁇ potent hematopoetic stem cells and lineage committed progenitors prior to bone ma ⁇ ow grafting
  • treatment with the MPPTs may result m, for example, a reduction in the size of a tumor, the slowing or prevention of an increase in the size of a tumor, an increase in the disease free survival time between the disappearance or removal of a tumor and its reappearance, prevention of an initial or subsequent occuirence of a tumor (e g metastasis), an inciease in the time to progression, reduction of one or moie adverse symptom associated with a tumor, or an inciease in the oveiall survival time of a subject having cancer
  • cancers which may be tieated or stabilized in accordance with the present invention include, but are not limited to, leukemia, lymphoma, solid human tumors, head and neck cancer, pancreatic cancer, ovarian cancer, glioblastoma, non small cell lung cancer, renal cell carcinoma, ovarian cancer, acute myeloid leukemia, andiogen dependent prostate cancer, and small cell lung cancel
  • leukemia refers broadly to progressive, malignant diseases of the blood- forming organs
  • Leukemia is typically characterized by a distorted proliferation and development of leukocytes and their precursois in the blood and bone marrow but can also refer to malignant diseases of other blood cells such as erythroleukemia, which affects immature red blood cells
  • Leukemia is generally clinically classified on the basis of (1) the duration and chaiacter of the disease - acute or chronic, (2) the type of cell involved - myeloid (myelogenous), lymphoid (lymphogenous) or monocytic, and (3) the increase or non-increase in the number of abnormal cells m the blood - leukdemic or aleukaemic (subleukaemic)
  • Leukemia includes, foi example, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocyte leukemia,
  • lymphoma geneially refers to a malignant neoplasm of the lymphatic system, including cancer of the lymphatic system
  • the two main types of lymphoma are Hodgkin's disease (HD or HL) and non-Hodgkin's lymphoma (NHL)
  • HD or HL Hodgkin's disease
  • NHL non-Hodgkin's lymphoma
  • Abnormal cells appeal as congregations which enlarge the lymph nodes, form solid tumors in the body, or more larely, like leukemia, circulate in the blood Hodgkin's disease lymphomas, include nodular lymphocyte predominance Hodgkin's lymphoma, classical Hodgkin's lymphoma, nodular scleiosis Hodgkin's lymphoma, lymphocyte rich classical Hodgkin's lymphoma, mixed cellulaiity Hodgkin's lymphoma, lymphocyte depletion Hodgkin's lymphom
  • the MPPTs can be used to treat various stages and grades of cancer development and progression
  • the present invention contemplates the use of the MPPTs in the treatment of early stage cancers including eaily neoplasias that may be small, slow growing, localized and/or nonaggressive, for example, with the intent of curing the disease or causing regression of the cancer, as well as in the treatment of intermediate stage and in the treatment of late stage cancers including advanced and/or metastatic and/or aggressive neoplasms, for example, to slow the progression of the disease, to reduce metastasis or to increase the survival of the patient
  • the MPPTs may be used in the treatment of low grade cancers, intermediate grade cancers and oi high grade cancers
  • the MPPTs can be used in the tteatment of indolent cancers, recurrent cancers including locally recurrent, distantly recurrent and/or refractory cancers (i.e. cancers that have not responded to treatment), metastatic cancers, locally advanced cancers and aggressive cancers.
  • an "advanced" cancer includes locally advanced cancel and metastatic cancer and refers to overt disease in a patient, wherein such overt disease is not amenable to cure by local modalities of treatment, such as surgery or radiotherapy.
  • metal cancer refeis to cancer that has spread from one part of the body to another Advanced cancers may also be unresectable, that is, they have spread to surrounding tissue and cannot be surgically removed.
  • Aggressive cancer refers to a rapidly growing cancer.
  • aggressive cancer will refer to an advanced cancer that has relapsed within approximately the eailier two-thirds of the spectrum of relapse times for a given cancer, whereas for other types of cancel, such as small cell lung carcinoma (SCLC) nearly all cases present rapidly growing canceis which are considered to be aggressive.
  • SCLC small cell lung carcinoma
  • the MPPTs may also be used to treat diug iesistant cancers, including multidrug resistant tumors.
  • diug iesistant cancers including multidrug resistant tumors.
  • the resistance of cancer cells to chemotherapy is one of the central problems m the management of cancer.
  • Certain cancers such as prostate and breast cancer, can be treated by hormone therapy, i e. with hormones or anti-hormone drugs that slow or stop the growth of certain cancels by blocking the body's natural hormones. Such cancers may develop resistance, or be intrinsically resistant, to hormone therapy.
  • hormone therapy i e. with hormones or anti-hormone drugs that slow or stop the growth of certain cancels by blocking the body's natural hormones.
  • Such cancers may develop resistance, or be intrinsically resistant, to hormone therapy.
  • the present invention further contemplates the use of the MPPTs in the treatment of such "hormone- resistant " or "hormone-refractory" cancers
  • the present invention contemplates the administration to a subject of a theiapeuticdlly effective amount of one or more MPPTs together with one or more anti-cancer therapeutics
  • the compound(s) can be administered before, during or after treatment with the anti-cancer theiapeutic
  • An "anti cancer therapeutic” is a compound, composition or treatment that prevents or delays the growth and/or metastasis of cancer cells
  • Such anti cancer therapeutics include, but are not limited to, chemotherapeutic drug treatment, radiation, gene therapy, hormonal manipulation, immunotheiapy and antisense oligonucleotide theiapy
  • useful chemotherapeutic drugs include, but are not limited to, hydroxyuiea, busulphan, cisplatin, caiboplatin, chlorambucil, meiphalan, cyclophosphamide, Ifosphamide, danorubicin, doxorubicin, epirubicin, mitoxantrone, vincristine
  • the MPPTs can be administered systemically to patients, foi example, by bolus injection oi continuous infusion into a patient's bloodstream, or they can be administered locally, foi example at the site of a tumor (intratumorally)
  • the compounds can be administered p ⁇ oi to, or after, administration of the therapeutic agents, or they can be administered concomitantly
  • the one or more therapeutics may be administered systemically, foi example, by bolus injection or continuous infusion, or they may be administered orally
  • immunosuppressive therapies can be administered m combination with the MPPTs.
  • immunosuppressive theiapies include, but are not limited to, systemic or topical corticosteioids (Suga et al , Ann Thorac Surg 73 1092-7, 2002), cyclosporin A (Fang et al , Hum Gene Ther 6 1039-44, 1995), cyclophosphamide (Smith et al , Gene Ther 3 496-502, 1996), deoxyspergualm (Kaplan et al , Hum Gene Ther
  • T and/ot B cells e g anti-CD40 hgand, anti CD4 antibodies, anti-CD20 antibody (Rituximab)] (Manning et al , Hum Gene Ther
  • Such agents can be administered before, dunng, or subsequent to administration of MPPTs according to the present invention.
  • the MPPTs may be used as part of a neo-adjuvant therapy (to primary theiapy), as part of an adjuvant theiapy regimen, where the intention is to cure the cancer in a subject
  • the piesent invention contemplates the use of the MPPTs at various stages in tumoi development and piogression, including m the tieatment of advanced and/or aggressive neoplasias ( ⁇ e overt disease in a subject that is not amenable to cure by local modalities of treatment, such as surgery or radiotheiapy), metastatic disease, locally advanced disease and/or iefractory tumors ( ⁇ e a cancer or tumor that has not responded to treatment)
  • Primary therapy refers to a first line of treatment upon the initial diagnosis of cancer in a subject
  • Primary theiapies may involve surgeiy, a wide range of chemotherapies and radiotherapy
  • Adjuvant therapy refers to a therapy that follows a primary therapy and that is administered to subjects at risk of relapsing
  • Adjuvant systemic therapy is begun soon after primary therapy to delay recurrence, prolong smvival oi cure a subject
  • the compounds of the invention can be used alone oi in combination with one or more other chemotherapeutic agents as part of an adjuvant therapy Combinations of the MPPTs and standard chemotherapeutics may act to improve the efficacy of the chemotherapeutic and, theiefore, can be used to improve standaid cancer therapies
  • This application is particularly important in the treatment of diug resistant cancers which are not responsive to standard treatment
  • Drug-resistant cancels can arise, for example, from heterogeneity of tumor cell populations, alterations in response to chemotherapy and increased malignant potential Such changes are often more pronounced at advanced stages of disease and have, in part, as an underlying cause, changes in genome/message stability.
  • the dosage to be administered is not subject Io defined limits, but it will usually be an effective amount. It will usually be the equivalent, on a molar basis of the pharmacologically active free form produced from a dosage formulation upon the metabolic release of the active free drug to achieve its desired pharmacological and physiological effects.
  • the compositions may be formulated in a unit dosage form.
  • unit dosage form refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient.
  • the unit dosage forms may be administered once or multiple unit dosages may be administered, for example, throughout an organ, or solid tumor. Examples of ranges for the compound(s) in each dosage unit are from about 0.005 to about 100 mg, or more usually, from about 1.0 to about 30 mg.
  • Daily dosages of the compounds of the present invention will typically fall within the range of about 0.01 to about 100 mg/kg of body weight, in single or divided dose.
  • the actual amount of the compound(s) to be administered will be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound administered, the age, weight, and response of the individual patient, and the severity of the patient's symptoms.
  • the above dosage range is given by way of example only and is not intended to limit the scope of the invention in any way. In some instances dosage levels below the lower limit of the aforesaid range may be more than adequate, while in other cases still larger doses may be employed without causing harmful side effects, for example, by first dividing the larger dose into several smaller doses for administration throughout the day.
  • the MPPT can be labeled with one or mo:e detectable labels
  • a "detectable label” is a molecule or moiety a propeity or characteristic of which can be detected diiectly or indirectly
  • detectable labels include, but are not limited to, radioisotopes (e g , 3 H, 14 C, 1 ⁇ S, 125 I, 131 I), fluorescent labels (e g , FITC, rhodanune, lanthanide phosphois, fluorescein isothiocyanate, phycoerythe ⁇ n, phycocyanm, allophycocyanin, o-phthaldehyde, fluoiescamsne, and commeicially avalailable fluorophores such as Alexa Fluor 350, Alex
  • the MPPTs according to the present invention may also be employed in accordance with the present invention by expression of such proteins in vivo, which is often referred to as "gene therapy"
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding an MPPT ex vivo, with the engineeied cells then being provided to a patient to be treated with the polypeptide
  • a polynucleotide DNA or RNA
  • cells may be engineered by procedures known in the art by use of a tetroviral particle containing RNA encoding an MPPT or a biologically active fragment thereof
  • cells may be engineered in vivo for expression of a polypeptide in vivo using pioceduies known in the art
  • a pioducer cell for producing a retroviral particle containing RNA encoding an MPPT, or a biologically active fragment thereof may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo
  • the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable dehveiy vehicle
  • Retroviruses fioin which the retroviral plasmid vectors hereinabove mentioned, may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenov ⁇ us, Myeloproliferative Sarcoma Virus, and mammary tumor virus
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • the vector includes one or more promoters.
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ⁇ -actin promoters).
  • CMV cytomegalovirus
  • Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase
  • TK TK promoters
  • B 19 parvovirus promoters B 19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • the nucleic acid sequence encoding the MPPTs of the present invention is under the control of a suitable promoter.
  • suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; o ⁇ heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; vi ⁇ al thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described); the ⁇ -actin promoter; and human growth hormone promoters.
  • the promoter also may be the native promoter which controls the genes
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ⁇ -2, ⁇ -AM, PA12, T19-14X, VT-19-17-H2, ⁇ CRE, ⁇ CRIP, GP+E-86, GP+envAm l2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art.
  • retroviral plasmid vector may be encapsulated into a liposome, or PTH to a lipid, and then administered to a host
  • the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides
  • retroviral vector panicles then may be employed, to transduce eukaryotic cells, eithei in vitro or in vivo
  • the transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide
  • Eukaiyotic cells which may be transduced include, but aie not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hep ⁇ tocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bionchial epithelial cells
  • Phase I trials are used to determine the best mode of administration (for example, by pill or by injection), the frequency of administration, and the toxicity foi the compounds
  • Phase I studies fiequently include laboratory tests, such as blood tests and biopsies, to evaluate the effects of a compound in the body of the patient
  • a small group of patients JS tieated with a specific dose of MPPTs During the trial, the dose is typically inci eased gioup by group in Older to determine the maximum tolerated dose (MTD) and the dose-limiting toxicities (DLT) associated with the compound This piocess determines an appropriate dose to use in a subsequent Phase II trial
  • Phase II trial can be conducted to further evaluate the effectiveness and safety of MPPTs.
  • an MPPT is administered to groups of patients using the dosage found to be effective in Phase I t ⁇ ais.
  • Phase III trials focus on determining how a compound compares to the standard, or most widely accepted, treatment.
  • patients are randomJy assigned to one of two or more "arms".
  • one arm will receive the standard treatment (control group) and the other arm will receive MPPT treatment (investigational group).
  • Phase IV trials are used to further evaluate the long-term safety and effectiveness of a compound. Phase IV trials are less common than Phase I, II and III trials and will take place after the MPPT has been approved for standard use.
  • Participant eligibility criteria can range from general (for example, age, sex, type of disease) to specific (for example, type and number of prior treatments, disease characteristics, blood cell counts, organ function). Eligibility criteria may also vary with trial phase. For example, in Phase I and II trials, the criteria often exclude patients who may be at risk from the investigational treatment because of abnormal organ function or other factors. In Phase II and III trials additional criteria are often included regarding disease type and stage, and number and type of prior treatments.
  • Phase I trials usually comprise 15 to 30 participants for whom other treatment options have not been effective.
  • Phase II trials typically comprise up to 100 participants who have already received treatment, but for whom the treatment has not been effective. Participation in Phase II trials is often restricted based on the previous treatment received.
  • Phase HI trials usually comprise hundreds to thousands of participants. This large number of participants is necessary in order to determine whether there are true differences between the effectiveness of MPPTs and the standard treatment.
  • Phase III may comprise patients ianging from those newly diagnosed with the disease to those with extensive disease in order to covet the disease continuum
  • ECOG PS Eastern Cooperative Oncology Gtoup
  • PS Performance Status
  • ECOG PS is a widely accepted standard for the assessment of the progression of a patient's disease as measured by functional impairment in the patient, with ECOG PS 0 indicating no functional impairment, ECOG PS 1 and 2 indicating that the patients have progressively gieatei functional impairment but are still ambulatory and ECOG PS 3 and 4 indicating progressive disablement and lack of mobility
  • MQOL McGiIl Quality of Life Questionnaire
  • SDS Symptom Distress Scale
  • Patients can also be classified according to the type and/or stage of their disease
  • MPPTs are typtcally administeted to the trial participants parenterally
  • MPPTs are administered by intravenous infusion
  • MPPTs aie administered intratumorally Methods of administering drugs by intiavenous infusion are known in the ait Usually intravenous infusion takes place over a certain time period, for example, ovei the comse of 60 minutes
  • An exemplary dose range for MPPT treatment includes dosages in the range 2 5 mg/m 2 to 30 mg/m
  • samples such as blood or urine
  • samples can be taken at regular intervals up to until about 72 hours after the start of infusion
  • samples are taken at 0, 0 33, 0 67, 1, 1 25, 1 5, 2, 4, 6, 8, 12, 24, 48 and 72 hours after the start of each infusion of MPPTs
  • samples can be placed on dry ice after collection and subsequently transported to a freezer to be stored at -70 0 C until analysis can be conducted Samples can be prepared for analysis using standard techniques known in the art and the amount of MPPTs piesent can be determined, for example by high-performance liquid chiomatography (HPLC)
  • Pharmacokinetic data can be generated and analyzed in collaboration with an expert chnical pharmacologist and used to determine, for example, clearance, half life and maximum plasma concentration
  • the endpoint of a clinical t ⁇ al is a measurable outcome that indicates the effectiveness of a compound under evaluation
  • the endpoint is established prior to the commencement of the trial and will vary depending on the type and phase of the clinical trial
  • Examples of endpoints include, fot example, tumor response rate - the proportion of trial participants whose tumor was reduced in size by a specific amount, usually described as a percentage; disease-free survival - the amount of time a participant survives without cancer occurring or recurring, usually measured in months; overall survival - the amount of time a participant lives, typically measured from the beginning of the clinical trial until the time of death.
  • disease stabilization the proportion of trial participants whose disease has stabilized, for example, whose tumor(s) has ceased to grow and/or metastasize, can be used as an endpoint.
  • Other endpoints include toxicity and quality of life.
  • Tumor response rate is a typical endpoint in Phase II trials in the case of cancer.
  • a treatment reduces the size of a participant's tumor and lengthens the period of disease-free survival, it may not lengthen overall survival. In such a case, side effects and failure to extend overall survival might outweigh the benefit of longer disease-free survival. Alternatively, the participant's improved quality of life during the tumor-free interval might outweigh other factors.
  • response rate is a reasonable measure of a treatment's effectiveness in a Phase II trial, whereas participant survival and quality of life are typically used as endpoints in a Phase IH trial.
  • the present invention additionally provides for therapeutic kits or packs containing one or more of the MPPTs or a pharmaceutical composition comprising one or more of the MPPTs for use in the treatment of a disease.
  • Individual components of the kit can be packaged in separate containers, associated with which, when applicable, can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human or animal administration.
  • the kit can optionally further contain one or more other therapeutic agents for use in combination with the MPPTs of the invention.
  • the kit may optionally contain instructions or directions outlining the method of use or dosing regimen for the MPPTs and/oi additional therapeutic agents
  • Diagnostic kits comprising one or more MPPT are also provided for
  • the MPPT(s) provided in the diagnostic kit can incorporate a detectable label or the kit may include reagents for labeling the MPPT(s)
  • the liquid solution can be an aqueous solution, for example a sterile aqueous solution
  • the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the composition may be administered to a patient or applied to and mixed with the othet components of the kit
  • kits of the invention may also be provided in dried or lyophihzed form and the kit can additionally contain a suitable solvent for reconstitution of the lyophilized components Irrespective of the numbei or type of containers, the kits of the invention also may comprise an instrument for assisting with the administration of the composition to a patient Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye-dropper or similar medically appioved delivery vehicle
  • Histidine tagged MPPTs comprising an IL-2 targeting unit were prepared as described below
  • IL-2-uPA-PA which comprises a naturally occur ⁇ ng proaerolysin polypeptide with an IL-2 taigettng unit attached to the N-terminus via a six amino acid linker cleavable by uPA and by trypsin, was prepared as follows (Figuie 5)
  • This MPPT also contains the pioaerolysm signal sequence
  • the nucleotide sequence of this IL-2 MPPT is shown m Figure 21 (SEQ ID NO 34) and the amino acid sequence of this IL-2 MPPT is shown in Figure 22 (SEQ ID NO 35)
  • the gene encoding PA with a His-tag (containing 6 histidines) at its N-terminus was prepared by insetting 6 codons (CAT) at the 3" end of the gene by two rounds of site- directed mutagenesis using a Quick Change Site-Directed mutagenesis kit
  • G88rev TTCACACATGAATGTTGTTTCAGAGCCCTTTAGTTCCAGAAC [SEQ ID NO: 12] and plasmid pGEMl containing the gene for human interleukin-2 (hIL-2) as a template according to manufacturer's instructions.
  • the resulting plasmid was named pNIL2.
  • a DNA fragment containing the gene for hIL-2 (amino acids 2-131) with part of the signal sequence (SS) of aerolysin at the 5'-end and a six amino acid linker at the 3'- end was prepared by PCRl using the primers: PSLfwd: CAAGCGGCAGAGCCTACTTCAAGTTC [SEQ ID NO: 13]; and
  • the DNA fragment containing the SS of aerolysin with the part of the hIL-2 gene at the 3 ' -end was prepared by PCR2 using the primers: pUCfwd: GGGTAACGCCAGGGTTTTCCCAGTCACGAC [SEQ ID NO: 15]
  • PSLrev ACTTGAAGTAGGCTCTGCCGCTTGC [SEQ ID NO: 16], with the plasmid pPA-H6 as a template.
  • the DNA fragment containing the signal sequence of aerolysin fused to the gene coding hIL-2 (with the uPA linker at the 3'-end) was prepared by recombinant PCR
  • PCR3 using the primers pUCfwd and UPArev, and the products of PCRl and PCR2 as a template.
  • the DNA fragment containing the gene for PA with the uPA linker attached to its 5'- end was prepared by PCR4 using the primers:
  • pUCrev GGATAACAATTTCACACAGGAAACAGCTATG [SEQ ID NO: 18] (downstream from £coRI site in pTZ18U) with the plasmid ⁇ PA-H6 as a template.
  • the whole recombinant gene SS-IL-2-uPA-PA-H6 was prepared by recombinant PCR (PCR5) using the primers pUCfwd and pUCrev, and the products of PCR3 and PCR4 as a template.
  • PCR5 was then cleaved with the restriction endonucleases Hin ⁇ lll and EcoR ⁇ and cloned into the cloning vector ⁇ TZ18U cut with the same enzymes.
  • the gene was cloned into the broad host range expression vector pMMB66HE (using Hindlll and Ec ⁇ Rl) and moved into A. salmonicida CB3 by conjugation using the filter-mating technique described by Harayama et al. (1980) High frequency mobilization of the chromosome of Escherichia coli by a mutant of plasmid RF4 temperature-sensitive for maintenance. MoI. Gen. Genet.
  • the IL-2-uPA-R336A-PA MPPT comprises a proaerolysin polypeptide with an IL-2 targeting unit attached to the N-terminus via a six amino acid linker, cleavable by uPA and by trypsin, and that also comprises the R336A point mutation (i.e., the amino acid 336 - Arg- in PA) in its binding domain.
  • This MPPT also contains the proaerolysin signal sequence.
  • the nucleotide sequence of this IL-2 MPPT is shown in Figure 23 (SEQ ID NO:36) and the amino acid sequence of this IL-2 MPPT is shown in Figure 24 (SEQ ID NO:37).
  • This MPPT was prepared as follows.
  • the R336A variants of PA and of BL-2-uPA-PA were prepared by site-directed mutagenesis using Quick Change Site-Directed mutagenesis kit with the pair of primers: R336Afwd:CACCCGGACAACGCACCGAACTGGAACCAC [SEQ ID NO: 38], R336Arev: GTGGTTCCAGTTCGGTGCGTTGTCCGGGTG [SEQ ID NO: 39], and the corresponding gene (encoding PA or EL-2-PA) cloned in the vector pTZISU as a template.
  • the genes were cloned into the broad host iange expiession vector pMMB66HE (using Hindlll and EcoRl) and moved into A salmonwula CB3 by conjugation using the filter mating technique described by Harayama et al supra
  • the IL 2 hjb ⁇ ds were each produced by growing 400 ml cultures of the coiTesponding CB3 strains and inducing them overnight with 1 mM IPTG at 27 0 C with shaking at 250 rpm Neither of the IL 2 containing hyb ⁇ ds was secreted by the bdcte ⁇ a, presumably because the IL-2 moiety prevented transfer of the proteins across the outer membiane
  • the two hyb ⁇ d proteins were purified from the soluble fiaction after Fiench pressing and cent ⁇ fugation as follows The cells were centnfuged at 10,000 rpm forlO minutes at 4°C using a JA 16 25 rotor and resuspended in 40 mL PBS containing 10 ⁇ g/mL DNase, 10 ⁇ g/mL RNase, 2 ⁇ g/mL aprotinine, 0 5 ⁇ g/mL leupeptin, 0 7 ⁇ g/mL pepstatin A and
  • EXAMPLE 2 EFFECT OF PROTEASES ON IL-2 MPPTs
  • the MPPTs and controls wild-type proaerolysin (PA) and the binding variant R336A-PA, in which the arginine at ammo acid 336 is mutated to an alanine
  • PA proaerolysin
  • R336A-PA binding variant R336A-PA, in which the arginine at ammo acid 336 is mutated to an alanine
  • Hemolytic titers were pei formed using a final concentration of 04% hoise red blood cells in HBS
  • the toxin samples (3 5 ⁇ g) weie preactivated with one of the following proteases 20 units/mL fu ⁇ n (Sigma) in HBS, 10 mM CaCl 2 , pH 74 for 4 hours at 37°C, 0 04 mg/mL urokinase plasminogen activator (uPA) in HBS for 4 hours at 37
  • Figure 7 shows the results of the actions of trypsin (T), furm (F), or uPA (U) on these protein toxins
  • the iesults show that native PA and IL-2-uPA-PA are converted to active aerolysin by trypsin and uPA
  • the R336A-PA and IL 2-uPA R336A-PA molecules aie only very weakly active after trypsin and uPA treatment
  • the IL-2- uPA-PA appears to be somewhat active after fu ⁇ n treatment, indicating that IL-2 uPA-aerolysin has some ability to form channels (i e , the IL 2 does not have to be removed)
  • the iesults further suggest that IL-2-uPA-aerolysm is capable of forming oligomers
  • the toxicities of the IL-2 MPPTs were tested in a cell killing assay with three cell lines the mouse EL-4 cell line which does not display the IL-2 receptor and is sensitive to native PA, the mouse CTLL 2 cell line which displays a high affinity IL 2 receptor, and the human Hut 78 cell line which displays a low affinity IL-2 receptor
  • CeIi killing assays were performed at concentrations of 1 x 10* cells/mL by resuspending cell pellets in cell culture media after centiifugation at 1100 vpm for 5 minutes at room temperature in an IEC Centra CL2 centrifuge Each MMPT was assayed in triplicate Using 96 well title plates, the PA, R336A-PA, IL-2-uPA-PA and IL-2-uPA R336A-PA were serially diluted 1 5 m supplemented cell media using a fmal volume of 20 ⁇ L After serial dilution, cells were added to appropriate rows to a volume of 100 ⁇ L Two control rows were used the first containing no toxin and no cells and the second containing no toxin with cells The cells were then premcubated with the toxins for 1 hour at 37°C before adding 20 ⁇ L of cell killing reagent (Promega CelITiter 96 AQueous One Solution Cell Proliferation Assay) followed by furthei incubation for 4
  • EL-2 MPPTs The ability of EL-2 MPPTs, according to the present invention, to bind to cells was measured by flow cytometry using a FacsCalibur Flow Cytometer (Pearson).
  • EL4 and CTLL-2 cells were piepared in unsupplemented cell cultuie media to a concentration of 2 x 10 6 cells/mL by resuspending cell pellets after cent ⁇ fugation at 1100 rpm for 5 minutes at room temperature in an IEC Centra CL2 centrifuge.
  • Protein toxin was added to a final concentiation of 2 x 10 8 M and the mixtures were incubated on ice foi 30 minutes Cells were cent ⁇ fuged for 7 seconds in an IEC Microhte microfuge, washed 3x in unsupplemented media and resuspended to their original volume The polyclonal antibody pAb ⁇ AerA (Buckley) was added to cells at a 1/500 dilution and incubation was continued on ice for 30 minutes.
  • Figmes 13 and 14 show MPPT binding to cells that do not display the IL 2 receptor (EL-4 cells) and to cells that do display the IL-2 receptor (CTLL 2 cells), lespectively The native PA and IL-2-uPA -PA MPPT bound to the EL-4 cells via GPI-anchored proteins whereas the R336A-PA and IL-2-UPA -R336A-PA MPPT 1 having a damaged GPI-anchor piotein binding site, did not bind As shown in Figure 9, the IL 2-uPA-R336A-PA MPPT did bind to the CTLL 2 cells, indicating binding via the IL-2 receptor, but the R336A-PA did not
  • Aeiolysin can form oligomers in vitro when no target cells are present, if the concentration exceeds about 0 5 mg/ml These oligomers can be detected by SDS-PAGE
  • R336A-PA and IL-2-uPA-R336A- PA can oligome ⁇ ze undei these conditions, they each were incubated at a concentration of 0 8 mg/ml with 0 002 mg/ml trypsin for 20 minutes at 37°C Trypsin was inhibited by the addition of 0 1 mg/ml trypsin inhibitor, and this was followed by 1 hour incubation at 37°C Samples were prepared m ix sample buffer (NuPAGE) and loaded on to a NuPAGE 10% Bis T ⁇ s gel (Invitrogen) in Ix MOPS SDS running buffer under non-reduced conditions and run foi 50 minutes at 200 V constant
  • IL-2-uPA-PA and IL-2-uPA-R336-PA form oligomers on CTLL-2 cells
  • Cells were incubated with R336A-PA (lane 1), IL-2-uPA-R336-PA (lane 2), IL-2-uPA-PA (lane 3), or PA (lane 4).
  • the BL-2 oligomers are laiger No ohgomei was detected after incubation of CTLL-2 cells with R336A-PA, presumably because this variant can't bind to the cells
  • the results show that IL-2-uPA-R336A-PA MPPT, which can bind to cells via the IL-2 receptor, does produce oligomers and that they aie larger than the native aerolysm oligomers, indicating that it is not necessary for the IL-2 targeting unit to be lemoved for oligome ⁇ zation to occur

Abstract

Pore-forming protein toxins (MPPTs) are provided that comprise a cytokine-receptor targeting unit. The MPPTs according to the present invention are capable of selectively targeting cytokine receptor bearing cells. Optional further modifications that allow specific targeting of these molecules are also described. Methods of using these MPPTs to treat cancer and other diseases are also described.

Description

MODIFIED PROTEIN TOXINS TARGETING CYTOKINE -RECEPTOR BEARING CELLS AND USE THEREOF FOR TREATING DISEASE
FIELD OF THE INVENTION The present invention relates to the field of modified protein toxins, and in particular to modified protein toxins that include a cytokine-receptor targeting unit, and their use to treat disease.
BACKGROUND OF THE INVENTION
Many cytolytic proteins have been described (Lesieur et al. MoI. Membr. Biol. 14:45064, 1997), These naturally occurring cytotoxic proteins include mammalian proteins such as perforin, and bacterial proteins such as aerolysin (produced by Aeromonas hydrophila), α-hemolysin (produced by Staphylococcus aureus), alpha toxin (produced by Clostridium septicum), and δ-toxin (produced by Bacillus thuringiensis), anthrax protective antigen, Vibrio cholerae VCC toxin, Staphylococcus leucocidins, LSL toxin from Laetiporus sulphureus, epsilon toxin from Clostridium perfringens, and hydralysins produced by Cnidaria spp.
Some of these cytotoxic proteins are synthesized as inactive protoxins, for example proaerolysin and alpha toxin. These protoxins contain discrete functionalities including a binding domain, which allows binding of the protoxin to a cell, a toxin domain, and either an N-terminal or a C-terminal inhibitory peptide domain that contains a protease cleavage site. Cleavage of the inhibitory peptide domain at the protease cleavage site results in activation of the protoxin, leading to oligomerization of the cytotoxin and insertion into the plasma membrane, producing pores that lead to rapid cytolytic cell death (Rossjohn et al. J. Struct. Biol. 121 :92-100,1998). Pore formation physically disrupts the cell membranes, and results in death of cells in all phases of the cell cycle, including non-proliferating cells (i.e. Go arrested). These cytotoxins are not specific in the type of cells they are able to kill, as their binding domains target molecules that are found on most cells, and they are generally activated by proteases that are not cell -specific. Cytolytic poie-forming proteins or modified versions of these proteins have been proposed as potential therapeutics foi the treatment of disease, particularly cancer In general, cytolytic proteins have been modified in various ways to control target cell specificity and/or toxicity to cancer cells For example, U S Patent No 5,777,078 describes pore- forming agents that are activated at the surface of a cell by a number of conditions, including proteolysis, to lyse the cell These pore-forming agents can be used generally to destroy unwanted cells associated with a pathological condition in an animal WO 98/020135 describes methods and compositions relating to Pseudomonas exotoxin proproteins modified for selective toxicity The exotoxin is modified to be activated by a desired protease by insertion of a protease activatable sequence m the propiotem In one example the exotoxin is modified to insert a prostate specific antigen (PSA) cleavage site for the purpose of targeting and killing prostate cancer cells U S Patent Application No 2004/0235095 describes the use of modified cytolytic pioteins, in particulai proaeroiysin, for the treatment of prostate cancer The cytolytic proteins can be modified to include a prostate-specific cleavage site, and/or a prostate-specific binding domain and can be used to selectively target and kill piostate cancer cells
Modification of cytolytic peptides to include an inhibitoiy oi targeting domain has been described U S Patent Application No 2002/0045736 describes the modification of cytotoxic peptides, including proaeiolysm and homologs, via attachment of an inhibitory molecule that acts to inhibit formation of the active conformation of the cytolytic peptide This application also describes attachment of taigeting molecules to the cytolytic peptide, or molecules that can act as both a tatgeting molecule and an inhibitory molecule These inhibitory and/or taigeting molecules aie attached to the cytolytic peptide via a hnkei that may or may not be cleavable U S Patent No 4,867,973 describes antibody therapeutic enzyme conjugates in which the antibody is linked to a therapeutic agent via a protease cleavable linker The theiapeutic agent may include toxins or fragments of toxins In addition, International Patent Application No PCT/US94/04016 (WO 94/25616) describes a chimeric compound active at a cell surface having a delivery component, for example, an antibody or other ligands binding specifically to a target cell that is linked to a pore-foπning component such as aerolysin This application also describes modifications designed to inactivate the pore-forming agent, which can then be specifically activated by a cell-associated substance or condition. International Patent Application No. PCT/CA2004/000309 (WO 2004/078097) describes peptides including aerolysin or an aerolysin homolog, linked to an agent that specifically binds to a lung cancer cell, as well as nucleic acids that encode such peptides. Methods of using these peptides and nucleic acid sequences to treat lung cancer are also described.
This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.
SUMMARY OF THE INVENTION
An object of the present invention is to provide modified protein toxins targeting cytokine-receptor bearing cells and use thereof for treating disease. In accordance with an aspect of the present invention, there is provided an isolated pore-forming protein toxin derived from a naturally occurring aerolysin-related pore-forming protein and comprising one or more cytokine-receptor targeting units capable of specifically binding to a cytokine receptor, wherein said pore-forming protein toxin is capable of binding to and killing cells expressing said cytokine receptor. In accordance with another aspect of the invention, there is provided an isolated polynucleotide encoding the isolated pore-forming protein toxin according to the invention.
In accordance with another aspect of the invention, there is provided a vector comprising a polynucleotide according to the invention, operatively linked to one or more expression control sequences.
In accordance with another aspect of the invention, there is provided a host cell comprising a vector according to the invention.
In accordance with another aspect of the invention, there is provided an isolated pore- forming protein toxin derived from proaerolysin comprising one or more cytokine- receptor targeting units capable of specifically binding to a cytokine receptoi, said pore forming protein toxin comprising an amino acid sequence substantially identical to the sequence as set foi th in SEQ ID NO 35, or SEQ ID NO 37
In accordance with another aspect of the invention, there is provided a pharmaceutical composition comprising a pore-formmg piotem toxm according to the invention
In accoidance with another aspect of the invention, there is provided a pharmaceutical composition comprising an isolated polynucleotide according to the invention
In accordance with another aspect of the invention, there is provided an isolated pore- foπning piotein toxm according to the invention foi use in decreasing the number of cytokine-receptor bearing cells in a subject
In accordance with another aspect of the invention, theie is provided an isolated pore- forming protein toxm according to the invention, for use m the treatment of a T-cell dependent autoimmune disease in a subject
In accoidance with another aspect of the invention, there is provided an isolated pore forming protein toxin according to the invention, for use in the treatment of cancer in a subject
In accordance with another aspect of the invention, there is provided a use of an isolated poie-forming piotein toxin accoiding to the invention, for use m the preparation of a medicament In accordance with another aspect of the invention, there is provided a method of decreasing the number of cytokine ieceptor bearing cells in a subject, comprising administering to the subject having cancer an effective amount of a pore-formmg protein toxin accoiding to the invention
In accordance with another aspect of the invention, there is provided a method of tieating a T-cell dependent autoimmune disease in a subject comprising administering to the subject an effective amount of a pore forming protein toxm according to the invention In accordance with another aspect of the invention, there is provided a method of treating cancer in a subject comprising administering to the subject having cancer an effective amount of a pore-forming protein toxin according to the invention.
In accordance with another aspect of the invention, there is provided a method of preparing a modified pore-forming protein toxin, said method comprising: providing a native pore forming protein toxin wherein said native pore forming protein toxin is proaerolysin or Clostridium septicum alpha toxin; and attaching to said native pore- forming protein toxin, one or more cytokine-receptor targeting units capable of specifically binding to a cytokine receptor, wherein said modified pore-forming protein toxin is capable of killing cells expressing said cytokine.
In accordance with another aspect of the invention, there is provided a kit comprising one or more pore-forming protein toxins according to the invention and optionally instructions for use.
BRIEF DESCRIPTION OF THE DRAWINGS These and other features of the invention will become more apparent in the following detailed description in which reference is made to the appended drawings.
Figure 1 depicts the nucleotide sequence of proaerolysin from Aeromonas hydrophila (SEQ ID NO: 1).
Figure 2 depicts the amino acid sequence of proaerolysin from Aeromonas hydrophila (SEQ ID NO:2).
Figure 3 depicts the nucleotide sequence of alpha toxin from Clostridium septicum (SEQ ID NO:3).
Figure 4 depicts the amino acid sequence of alpha toxin from Clostridium septicum (SEQ ID NO:4). Figure 5 illustrates a schematic drawing of an IL-2-uPA-PA MPPT according to one embodiment of the invention.
Figure 6 illustrates the IL-2-uPA-R336A-PA MPPT according to an embodiment of the invention. Figure 7 depicts an SDS-PAGE gel showing the results of digestion of IL-2 MPPTs by trypsin, furm, and uPA
Figure 8 presents a graph illustrating the toxicity of IL-2 MPPTs against EL 4 cells Figure 9 presents a graph illustrating the toxicity of IL-2 MPPTs against HuT 78 cells Figuie 10 piesents a giaph illustrating the toxicity of IL-2 MPPTs against CTLL-2 cells
Figuie 11 piesents a graph illustiating the toxicity of IL-2 MPPTs against CTLL-2 cells in IL-4 containing medium
Figuie 12 presents a graph illustrating IL 2 competition cell killing of IL-2 MPPTs against CTLL-2 cells
Figuie 13 depicts binding of IL-2 MPPTs to EL-4 cells as assessed by flow cytometry
Figure 14 depicts binding of IL-2 MPPTs to CTLL-2 cells as assessed by flow cytometry Figuie 15 depicts an SDS-PAGE gel showing evidence of oligomeπzation of PA and R336A-PA
Figuie 16 depicts an SDS-PAGE gel showing evidence of ohgomeπzation of IL-2 MPPTs
Figure 17 depicts the nucleotide sequence of proaerolysin from Aeromonas hydrophda, including the signal sequence (SEQ ID NO 19)
Figuie 18 depicts the amino acid sequence of pioaerolysm from Aeromonas hydrophda, including the signal sequence (SEQ ID NO 20)
Figuie 19 depicts the nucleotide sequence of alpha toxin from Clostridium sepucum, including the signal sequence (SEQ ID NO 21) Figure 20 depicts the amino acid sequence of alpha toxin from Clostridium sepncum, including the signal sequence (SEQ ED NO 22)
Figure 21 depicts the nucleotide sequence of IL 2-uPA-PA (SEQ ID NO 34) Figure 22 depicts the ammo acid sequence of II -2-uPA-PA (SEQ ID NO 35) Figure 23 depicts the nucleotide sequence of IL 2-uPA R336A-PA (SEQ ID NO 36)
Figure 24 depicts the amino acid sequence of IL-2-uPA-R336A-PA (SEQ ID NO 37), with the R336A mutation indicated in bold and underlined text
Figure 25 depicts an SDS PAGE gel of purified IL-2 MPPTs, R336A-PA and PA piotems
DETAILED DESCRIPTION OF THE INVENTION
The present invention piovides pore- forming protein toxins that have been modified to include a cytokme-receptor targeting unit The modified pore-forming protein toxins (MPPTs) of the present invention aie capable of selectively binding and killing cytokine receptor beating cells The MPPTs aie derived from naturally-occurring protein toxins (nPPTs) such as aeiolysin and aerolysin-related toxins that have been modified to compπse one or more cytokine-receptor targeting units Addition of the cytokine-receptor targeting unit enables the MPPTs to specifically bind to one or moie taiget cell displaying the coπesponding cytokine ieceptor By selectively targeting cytokine receptoi bearing cells, the MPPTs of the present invention aie capable of binding and killing a diverse gioup of cells that may be associated with a pathological condition Foi example, such cells include, but are not limited to, piogemtor cells, Th cells, B cells, NK cells, stem cells, mast cells, activated T and B lymphocytes, and some tumoi cells Thus, the MPPTs of the present invention can be used foi therapeutic puiposes, for example, to treat diseases characterized by an increase of cytokine-receptor bearing cells such as, T cell dependent autoimmune diseases and certain cancers such as, leukemia, lymphoma, solid human tumors, head and neck cancer, pancreatic cancer, ovaπan cancer, glioblastoma, non small cell lung cancer, renal cell carcinoma, ovaπan cancer, acute myeloid leukemia, androgen dependent piostate cancer, and small cell lung cancer In vai ious embodiments, the MPPTs according to the present invention can also be used foi selective elimination of unwanted cells such as regulatory T-lymphocytes, or to destroy pluπpotent hematopoetic stem cells and lineage committed progenitors pπoi to bone marrow grafting In one embodiment of the present invention, the MPPT acts on the target cells by inserting into the plasma membrane of the taiget cell and forming channels that cause cell death Insertion of the MPPT into the membrane is lrreveisible and, as such, bystander cells are not affected
The MPPTs according to the present invention can optionally further comprise one or moie additional modifications which may further enhance target cell specificity These modifications include, but are not limited to, modifications to the cell binding domain(s) of the MPPTs to decrease or eliminate non-selective binding of the MPPTs to cells other than cytokine-receptoi bearing cells, modifications to the activation sequence to selectively activate the protein toxin at the target cell, as well as the addition of other artificial regulatoiy domain(s) capable of either targeting the MPPT to a specific type of cell, and/or inhibiting the activity of the MPPT in such a way that inhibition of the MPPT is released at a target cell
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs Generally, the nomenclatuie used herein and the laboratory procedures m drug discovery, cell culture, molecular genetics, diagnostics, ammo acid and nucleic acid chemistry, and sugar chemistry described below are those well known and commonly employed in the art Standard techniques are typically used for signal detection, recombinant nucleic acid methods, polynucleotide synthesis, and miciobial culture and transformation (e g , electroporation, hpofection)
The techniques and procedures are generally performed according to conventional methods in the art and various genet al references (for example, Sambrook et al Molecular Cloning A Laboratory Manual, 2d ed (1989) Cold Spring Harboi Laboratory Press, Cold Spring Harbor, N Y ) Standard techniques aie used for chemical syntheses, chemical analyses, and biological assays As employed throughout the disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings,
"Binding pair' refeis to two moieties (e g chemical or biochemical) that have an affinity for one another Examples of binding pairs include homo-dimers, hetero- dimeis, antigen/antibodies, lectm/avidm, target polynucleoiide/probe, oligonucleotide, antifaody/aπti-antibody, receptor/ligand, enzyme/hgand and the like ' One member of a binding pair" iefers to one moiety of the pair, such as an antigen or ligand
'Isolated polynucleotide" refers to a polynucleotide of genomic cDNA, or synthetic origin or some combination thereof, which (1) is not associated with the cell in which the "isolated polynucleotide" is found in natuie, or (2) is operably linked to a polynucleotide which it is not linked to in nature
"Operably linked" refeis to a juxtaposition wherein the components so desciibed are in a relationship permitting them to function in their intended manner A control sequence "operably linked" to a coding sequence is hgated in such a way that exptession of the coding sequence is achieved undei conditions compatible with the contiol sequence
"Control sequence" iefers to a polynucleotide sequence which is necessaiy to effect the expression of coding and non-coding sequences to which it is ligated The nature of such control sequences differs depending upon the host organism, in piokaryotes, such control sequences gencially include one or more of piomotei , πbosomal btnding site, and transciiption termination sequence, in eukaryotes, generally, such control sequences include one or more of promoters and transcription termination sequences The term "control sequences" is intended to include, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences
' Polynucleotide" refers to a polymeric form of nucleotides of at least 10 nucleotides in length, either ribonucleotides or deoxynucleotides or a modified form or forms of either type of nucleotide The term includes single and double stianded foims of DNA oi RNA
"Polypeptide fragment ' refers to a polypeptide that has an amino-terminal and/or carboxy-terminal deletion, in which the remaining amino acid sequence is usually identical to the corresponding positions in the naturally-occurring sequence Fragments can be, for example, are at least 5, 6, 8 or 10 amino acids long, at least 14 amino acids long, at least 20 amino acids long, at least 50 ammo acids long, or at least 70 amino acids long The terms ' label" or "labeled" refei to incorporation of a detectable marker, e g , foi a polypeptide by incorporation of a iadiolabeled amino acid or attachment to a polypeptide of biotinyl moieties that can be detected by marked avidin (e g , streptavidin containing a fluorescent maiker or enzymatic activity that can be detected by optical or coloπmetπc methods) Various methods of labeling polypeptides, polynucleotides, antibodies and the like are known in the art and may be used Examples of labels include, but are not limited to, the following iadioisotopes (e g , ^H, 14C, "S1 125I, πlI), fluoiescent labels (e g , FITC, rhodamine, lanthanide phosphors), enzymatic labels (or reporter genes) (e g , horseradish peroxidase, β- galactosidase, β-lactamase, luciferase, alkaline phosphatase), chemilummescent labels, biotmyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e g , leucine zipper pan sequences, binding sites for secondary antibodies, metal binding domains, epitope tags) In some embodiments, labels aie attached by linker arms of various lengths to icduce potential steπc hindrance The teim "gene," as used herein, refers to a segment of nucleic acid that encodes an individual prolem or RNA molecule (also referred to as a "coding sequence" or "coding legion") and may include associated regulatory iegions such as promoters, opcratois, terminators and the like, that may be located upstream oi downstream of the coding sequence The teim "selectively hybπdize," as used herein, refers to the ability of a nucleic acid to bind detectably and specifically to a second nucleic acid Polynucleotides selectively hybπdize to target nucleic acid strands under hybridization and wash conditions that minimize appieciable amounts of detectable binding to non-specific nucleic acids High stringency conditions can be used to achieve selective hybndization conditions as known m the art and discussed herein Typically, hybndization and washing conditions are performed at high stringency according to conventional hybndization procedures Washing conditions are typically 1-3 x SSC, 0 1-1% SDS, 50-700C with a change of wash solution after about 5-30 minutes
The term "corresponding to" or "corresponds to" indicates that a polynucleotide sequence is identical to all or a portion of a reference polynucleotide sequence In contradistinction, the term "complementary to" is used herein to indicate that the polynucleotide sequence is identical to all or a portion of the complementary strand of a reference polynucleotide sequence. For illustration, the nucleotide sequence "TATAC" corresponds to a reference sequence "TATAC" and is complementary to a reference sequence "GTATA." The following terms are used herein to describe the sequence relationships between two or more polynucleotides or two or more polypeptides: "reference sequence," "window of comparison," "sequence identity," "percent sequence identity," and "substantial identity." A "reference sequence" is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA, gene or protein sequence, or may comprise a complete cDNA, gene or protein sequence. Generally, a reference polynucleotide sequence is at least 20 nucleotides in length, and often at least 50 nucleotides in length. A reference polypeptide sequence is generally at least 7 amino acids in length and often at least 17 amino acids in length. A "window of comparison", as used herein, refers to a conceptual segment of the reference sequence of at least 15 contiguous nucleotide positions or at least 5 contiguous amino acid positions over which a candidate sequence may be compared to the reference sequence and wherein the portion of the candidate sequence in the window of comparison may comprise additions or deletions (i.e. gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The present invention contemplates various lengths for the window of comparison, up to and including the full length of either the reference or candidate sequence. Optima! alignment of sequences for aligning a comparison window may be conducted using the local homology algorithm of Smith and Waterman {Adv. Appl. Math. {1981) 2:482), the homology alignment algorithm of Needleman and Wunsch (/. MoI. Biol. (1970) 48:443), the search for similarity method of Pearson and Lipman (Proc. Natl. Acad. ScL (U.S.A.) (1988) 85:2444), using computerized implementations of these algorithms (such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 573 Science Dr., Madison, WI), using publicly available computer software such as ALIGN or Megahgn (DNASTAR), or by inspection The best alignment (ι e iesulting in the highest percentage of identity over the comparison window) is then selected
The term "sequence identity" means that two polynucleotide or polypeptide sequences are identical (ι e on a πucleotide-by-nucleotide or amino acid-by-amino acid basis) over the window of comparison
The term "percent (%) sequence identity," as used herein with respect to a reference sequence is defined as the peicentage of nucleotide or ammo acid residues m a candidate sequence that are identical with the residues in the reference polypeptide sequence ovei the window of comparison after optimal alignment of the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, without considering any conservative substitutions as part of the sequence identity
The term "substantial identity" as used herein denotes a chatacteπstic of a polynucleotide or polypeptide sequence, wherein the polynucleotide or polypeptide comprises a sequence that has at least 50% sequence identity as compaied to a reference sequence over the window of comparison Polynucleotide and polypeptide sequences with at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, and at least 90% sequence identity as compared to a reference sequence over the window of comparison are also considered to have substantial identity with the ieference sequence
As used herein, the term "antibody" refers to an isolated or recombinant binding agent that comprises the necessary variable iegion sequences to specifically bind to a target antigenic epitope The term thus encompasses vaπous forms of antibody and antibody fragments known in the art that are capable of specifically binding the target antigen including, but not limited to, monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, human antibodies, humanized antibodies, chimeric antibodies, camehsed antibodies, nanobodies, diabodies, multispecific antibodies (e g , bispccific antibodies), and antibody fiagments including but not limited to scFv, Fab, and Fab2 The terms "therapy" and "treatment," as used inteichangeably herein, refer to an intervention performed with the intention of improving a subject's status The improvement can be subjective oi objective and is related to amehoi ating the symptoms associated with, preventing the development of, or altering the pathology of a disease or disorder being treated Thus, the terms therapy and treatment are used in the broadest sense, and include the prevention (prophylaxis), moderation, reduction, or curing of a disease or disorder at various stages Preventing deterioration of a subject's status is also encompassed by the term Subjects in need of therapy/tieatmcnt thus may be those already having the disease or disorder, those pi one to, or at risk of developing, the disease 01 disorder and/or those in whom the disease or disorder is to be prevented The term "ameliorate" refers to the arrest, prevention, decrease, or improvement in one oi more the symptoms, signs, and features of the disease or disorder being treated, either temporal y or long-term.
The leim "subject" oi "patient" as used herein refers to an animal in need of treatment. The teim "animal," as used herein, refers to both human and non-human animals, including, but not limited to, mammals, biids and fish.
Administration of the compounds of the invention "in combination with" one or more further therapeutic agents, is intended to include simultaneous (concurrent) administration and consecutive administiation Consecutive administration is intended to encompass administration of the therapeutic agent(s) and the compound(s) of the invention to the subject in vanous oiders and via various routes
The term "inhibit," as used herein, means to decrease, reduce, slow-down or prevent
The term "polypeptide" is used herein as a generic term to refer to an ammo acid sequence of at least 20 amino acids in length that can be a wild-type (naturally- occurring) protein sequence, a fragment of a wild-type protein sequence, a variant of a wild-type protein sequence, a derivative of a wild-type protein sequence, or an analogue of a wild-type piotein sequence Hence, native protein sequences and fragments, variants, derivatives and analogues of native protein sequences, as defined heiein, aie consideied to be species of the polypeptide genus. 1416-107PCI
The term "isolated polypeptide," as used herein, refers to d polypeptide which by vu tue of its origin is not associated with other polypeptides with which it is normally associated with in nature, and/or is isolated from the cell in which it normally occurs and/or is free of other polypeptides from the same cellular source and/or is expressed by a cell from a different species, and/or does not occur in nature
"Naturally occurring," or "native" as used hetein, as applied to an object, refers to the fact that an object can be found in naUiτe For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated fiom a souice in natuie and which has not been intentionally modified by man in the laboratory is natui ally-occurring
The term "activity" as used with respect to a "pore-formmg activity" or "activity of modified pore-foimmg protein toxins" refers to the ability of a naturally occuπing pore-forming piotem toxin or a modified pore-forming protein toxin to exhibit one or mote of the ability to bind to a cell, the ability to be activated by protease cleavage, or the ability to foim pores in a cell membiane
The term "mutation," as used herein, refeis to a deletion, insertion, substitution, inversion, oi combinations thereof, of one or more nucleotides in a polynucleotide sequence oi one or more amino acids in a polypeptide sequence when compared to the coπesponding naturally occurring polynucleotide or polypeptide sequence The term "activation sequence" as used herein, refers to an ammo acid sequence in a poie-forming protein toxin that can be cleaved by an appropriate protease, iesultmg in activation of the pore foi mmg ability of the protein toxin
The term "amino acid residue," as used heiein, encompasses both naturally-occuπing amino acids and non-natuially-occurrmg amino acids Examples of non-natural Iy occurring ammo acids include, but aie not limited to, D-amino acids (i e an ammo acid of an opposite chirahty to the natuially-occurπng form), N-α-meth>l amino acids, C α methyl amino acids, β-methyl ammo acids and D- or L β amino acids Othei non-naturally occurring ammo acids include, for example, β-alanine (β Ala), noileucine (NIe), norvahne (Nva), homoarginine (Har), 4-dminobutyπc acid (γ-Abu), 2 aminoisobutyπc acid (Aib), 6-aminohexanoic acid (ε-Ahx), ornithine (orn), sarcosine, α ammo isobutyric acid, 3-aminopropionic acid, 2 3-diaminoρropiomc acid (2,3 didP), D or L-phenylglycine, D-(tπfluoromethyI)-phenyIalanine, and D-p fluorophenylalanme
As used heiein, "peptide bond" can be a naturally occurring peptide bond or a non- naturally occurring (ι e modified) peptide bond Examples of suitable modified peptide bonds aie well known in the art and include, but are not limited to, -CH2NH , -CH2S-, -CH2CH2-, -CH=CH- (cts or tram), -COCH2 , CH(OH)CH2-, -CH2SO-, - CS NH and -NH-CO (ι e a leversed peptide bond) (see for example, Spatola, Vega Data VoI 1, Issue 3, (1983), Spatola, in Chemistry and Biochemistry of Amino Ac tds Peptides and Proteins Weinstein, ed , Marcel Dekker, New Yoik, p 267 (1983), Morley, J S , Trends Pharm Sci pp 463-468 (1980), Hudson et al , Int J Pept Prot Res 14 177 185 (1979) Spatola et al , Life Sci 38 1243-1249 (1986), Hann, / Chem Soc Perkin Trans / 307-314 (1982), Almquist et al , J Med Chem 23 1392- 1398 (1980), Jennings-White et al , Tetrahedron Lett 23 2533 (1982), Szelke et al , EP 45665 (1982), Holladay et al , Tetrahedron Lett 24 4401-4404 (1983), and Hruby, Life Sci 31 189-199 (1982))
Naturally-occurring amino acids are identified throughout by the conventional three- letter or one-letter abbieviations indicated below, which are as generally accepted in the peptide art and aie iecommended by the IUPAC IUB commission in biochemical nomenclature
Table 1. Amino Acid Codes
Name 3-letter 1-letter Name 3-letter 1-Ietter code code code code
Alanine Ala A Leucine Leu L
Arginme Arg R Lysine Lys K
Asparagine Asn N Methionine Met M
Aspartic acid Asp D Phenylalanine Phe F
Cysteine Cys C Prohne Pro P Name 3-letter 1-letter Name 3-letter 1-Ietter code code code code
Glutamic acid GIu E Serine Sei S
Glutamine GIn Q Threonine Thr T
Glycine GIy G Tryptophan Trp W
Histidme His H Tyrosine Tyr Y
Isoleucme He I Valine VaI V
The peptide sequences set out herein are written according to the generally accepted convention whereby the N-termmal ammo acid is on the left and the C-terminal ammo acid is on the i ight By convention, L-airπno acids are represented by upper case letters and D-amino acids by lower case letters
The teim "alkyl," as used herein, refers to a straight chain or branched hydrocarbon of one to ten caibon atoms or a cyclic hydrocarbon group of three to ten carbon atoms Said alkyl gioup is optionally substituted with one or more substHuents independently selected from the group of alkyl, alkenyl, alkynyl, aryl, heteioalkyl, aialkyl, hydroxy, alkoxy, aralkyloxy, aryloxy, carboxy, acyl, aioyl, halo, nitro, tπhalomethyl, cyano, dlkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl, acylamino, aroylamino, dialkylamino, carbamoyl, alkylcarbamoyl, dialkjlcarbamoyl, alkylthio, aralkylthio, arylthio, alkylene and NZiZ2 where Z, and Z2 are independently hydrogen, alkyl, aryl, and aralkyl This term is exemplified by such groups as methyl, ethyl, n-piopyl, * propyl, n butyl, t-butyl, 1-butyl (or 2-methylpropyl), cyclopropylmethyl, i-amyl, n- amyl, hexyl, cyclopropyl, cyclobutyl, cyclopentyl, and the like
The term "alkenyl" refers to a straight chain or branched hydrocarbon of two to ten carbon atoms having at least one carbon to carbon double bond Said alkenyl group can be optionally substituted with one or more substituents as defined above. Exemplary groups include allyl and vinyl
The term "alkynyl" refers to a straight chain or branched hydrocarbon of two to ten carbon atoms having at least one carbon to carbon triple bond Said alkynyl group can be optionally substituted with one or more substituents as defined above Exemplary groups include ethynyl and piopaigyl.
The term "heteroalkyl," as used herein, refers to an alkyl group of 2 to 10 carbon atoms, wherein at least one carbon is replaced with a hetero atom, such as N, O or S The term "aryl" (or "Ar"), as used herein, iefeis to an aromatic carbocyclic group containing about 6 to about 10 caibon atoms or multiple condensed rings in which at least one ring is an aromatic carbocyclic group containing 6 to about 10 caibon atoms Said aryl or Ar group can be optionally substituted with one oi more substituents as defined above. Exemplary aryl groups include phenyl, tolyl, xylyl, bφhenyl, naphthy], 1,2,3,4-tetrahydronaphthyl, anthryl, phenanthryl, 9-fluorenyl, and the like
The term "aralkyl," as used herein, refers to a stiaight or branched chain alkyl, alkenyl or alkynyl group, wherein at least one of the hydrogen atoms is replaced with an aryl gioup, wherein the aryl group can be optionally substituted with one or more substituents as defined above Exemplary aralkyl groups include benzyl, 4- phenylbutyl, 3,3-diphenylpropyl and the like
The term "alkoxy," as used herein, refers to RO , wherein R is alkyl, alkenyl or alkynyl in which the alkyl, alkenyl and alkynyl groups are as previously described. Exemplary alkoxy groups include methoxy, ethoxy, n-propoxy, I-piopoxy, n-butoxy, and heptoxy The tetm "aryloxy" as used herein, refers to an "ary]-O-" group in which the aryl group is as previously described Exemplary aryloxy gioups include phenoxy and naphthoxy
The term "alkylthio," as used herein, refers to RS-, wherein R is alkyl, alkenyl or alkynyl in which the alkyl, alkenyl and alkynyl groups are as previously described. Exemplary alkylthio groups include methylthio, ethylthio, I-propylthio and hepthylthio.
The term "aiylthio," as used herein, refers to an "aryl-S-" group in which the aiyl group is as pieviously descπbed Exemplaiy arylthio groups include phenylthio and naphlhylthio. The term "aralkyloxy," as used herein, iefers to an "aialkyl-O-" gioup in which the aralkyl group is as previously desciibed Exemplary aialkyloxy groups include benzyloxy
The teim "aralkylthio," as used herein, refers to an "aralkyl-S-" group m which the aralkyl group is as previously described Exemplary aralkylthio groups include benzylthio
The term "dialkylamino," as used herein, refers to an -NZ1Z2 gioup wherein Z| and Z2 are independently selected from alkyl, alkenyl or alkynyl, wherein alkyl, alkenyl and alkynyl are as previously described Exemplary dialkylamino groups include ethylmethyldmino, dimethylamino and diethylammo
The term "alkoxycarbonyl," as used herein, refers to R-O-CO-, wherein R is dlkyl, alkenyl or alkynyl, wherein alkyl, alkenyl and alkynyl are as previously described Exemplary alkoxycaibony) gioups include methoxy-carbonyl and ethoxy carbonyl
The term "aryloxycarbonyl," as used herein, refeis to an "aiyl-O-CO-", wherein aryl is as defined pieviously Exemplary aryloxycarbonyl groups include phenoxy- carbonyl and naphtoxy-carbonyl
The teim "aralkoxycarbonyl," as used herein, refers to an "aralkyl-O-CO ," wherein aralkyl is as defined previously Exemplary at alkoxycarbonyl groups include benzyloxycarbonyl The term "acyl" as used herein, refers to RC(O)-, wherein R is alkyl, alkenyl , alkynyl, heteroalkyl, a heterocyclic ring, 01 a heteroaromatic ring, wherein alkyl, alkenyl, alkynyl, heteroalkyl, heteiocychc, and heteroaromatic are as defined previously
The term "aroyl" as used heiem, iefers to an ArC(O)- group, wherein Ar is as defined pieviously The term "carboxy" as used herein, iefers to ROC(O) , wherein R is H, alkyl, alkenyl 01 alkynyl, and wherein alkyl> alkenyl or alkynyl are as defined previously
The term "carbamoyl," as used herein, iefers to a H2N-CO- group
The term "alkylcaibamoyl," as used herein, refers to an "Z^N-CO-" group wherein one of the Z| and Z2 is hydrogen and the other of Zi and Z2 is independently selected from alkyl, alkenyl or alkynyl and wherein alkyl, alkeny! and alkynyl are as defined previously
The term "dialkylcarbamoyl," as used herein, refers to a "Z1Z2N-CO-" group wherein Zi and Z2 are independently selected from alkyl, alkenyl or alkynyl and wherein alkyl, alkenyl and alkynyl are as defined pieviously
The teπn "acylamino", as used herein, refers to an "acyl-NH-" group, wherein acyl is as defined pteviously
The term "halo" as used herein, refers to fluoro, chloio, bioino or iodo In one embodiment, "halo" refeis to fluoio, chloro 01 bromo As used heiein, the term "about" iefers to approximately a +/-10% variation from a stated value It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to
Other chemistry terms herein are used according to conventional usage in the art, as exemplified by The McGiaw-Hill Dictionary of Chemical Terms (ed Parker, S , 1985), McGraw-Hill, San Francisco, incorporated herein by reference)
1. Modified Pore-forming Protein Toxins
The modified pore-formmg piotein toxins (MPPTs) according to the piesent invention are derived from naturally occurring pore-forming protein toxins (nPPTs) such as aerolysin or aerolysin-i elated polypeptides Suitable aerolysin-related nPPTs have the following features a pore-forming activity that is activated by removal of an inhibitory domain via protease cleavage, and the ability to bind to receptors that are piesent on cell membianes through one or more binding domains Examples include, but are not limited to, preproaeiolysin and proaeiolysin from Aei omonas hydrophύa, Aeromonas trota and Aeromonas salmomcida, alpha toxin from Clostridium septicum, anthrax protective antigen, Vibrio cholerae VCC toxin, epsilon toxin from Clostridium perfringens, and Bacillus thunngiensis delta toxins
Pioaeiolysin (PA) polypeptides from the Aeromonas species noted above have been charactei ized These polypeptides exhibit greater than 80% pan wise sequence identity between them (Parker et al , Progress m Biophysics & Molecular Biology 88 (2005) 91-142). Each of these PA polypeptides is an appioximately 52 kDd protoxm with approximately 470 amino acid residues A cDNA sequence for wild-type PA from A hydrophila is shown in SEQ ID NO 1 (Figure 1) and the corresponding amino acid sequence of this wild-type PA is shown in SEQ ID NO 2 (Figure 2) Where applicable, one of skill in the art will understand that MPPTs can be designed based on the sequence of the nPPT with or without a signal sequence For example, MPPTs can be designed based on the nucleotide sequence for preproaeiolysin as shown in Figure 17 (SEQ ED KO 19) oi based on the amino acid sequence for preptoaeiolysin as shown in Figure 18 (SEQ ID NO 20) The nucleotide and protein sequences for numerous natuially occurring nPPTs ate known in the art and non- limiting examples die listed in the following Table
Table 2: Exemplary nPPTs and corresponding GenBank™ Accession Numbers
Figure imgf000022_0001
The A hydrophila PA protein includes a binding domain (approximately ammo acids 1-83 of SEQ ID NO 2) in what is known as the small lobe of the polypeptide and is referred to herein as the small lobe binding domain (SBD), and a C-terminal inhibitoiy peptide (CIP) domain (approximately amino acids 427-470 of SEQ ID NO 2) that is lemoved by protease cleavage at an activation sequence to activate PA Cleavage at the activation sequence to remove the ClP domain can be carried out by a number of ubiquitous proteases including fuπn and trypsin The amino acid residues fi om approximately 84-426 of SEQ ID NO 2 are known as the large lobe of the PA polypeptide, and contain a toxin domain and other functional domains, including a second binding domain, referred to herein as the large lobe binding domain (LBD)
Alpha toxin from C septicum is considered to be a homologue of proaeiolysin based on significant sequence identity and other similarities (Parker et al , supra) Alpha toxin is secreted as a 46,450 Da piotoxm (approximately 443 amino acids) that is activated by protease cleavage to remove a C-terminal inhibitory peptide (CIP) domain, and it also binds to glycosyl-phosphatidylinositol (GPI)-anchored proteins Alpha toxin, however, does not have a iegion corresponding to the small lobe of PA An example of a Clostridium septicum alpha toxin nucleic acid sequence is provided in GenBank™ Accession No S75954 A Clostridium septicum alpha toxin nucleotide sequence is also shown in Figure 3 (SEQ ID NO 3) An example of a Clostridium septicum alpha toxin piotein sequence is provided in GenBank1 M Accession No AAB32892 SEQ ID NO 4, as shown m Figure 4 is also an example of a Clostridium septicum piotein sequence The sequence of a Clostridium septicum nucleotide sequence including signal sequence (SEQ ID NO 21) is shown in Figure 19 (signal sequence underlined) An exemplary Clostridium septicum nucleotide sequence including signal sequence (SEQ ID NO 22) is shown in Figure 20 (signal sequence undei lined) Based on sequence homology, alpha toxin is thought to have a similai sti ucture and similar GPI-anchored protein binding activity to that of proaerolysm
In one embodiment, the MPPTs accoiding to the present invention comprise modified proaerolysm polypeptides In a further embodiment, the MPPTs comprise modified proaerolysm polypeptides fiom Λ hydrophda In another embodiment, the MPPTs comprise modified proaeiolysin polypeptides from A salmomcida In a further embodiment of the invention, the MPPTs comprise modified alpha toxin polypeptides The present invention further includes MPPTs that are derived ftom fragments of nPPTs Suitable fragments include those that are capable of being activated to form pores m target cells by removal of the CIP domain Foi example, in the case of PA, a suitable fragment would be one that comprised the large lobe of the protein as well as 1436-107PCr
the ClP domain and activation sequence Thus, in one embodiment of the invention, the MPPT is derived from a fragment of proaerolysm that includes the large iobe, the CIP domain and the activation sequence. In another embodiment, the MPPT is derived from a fragment of pioaeioiysm that comprises the small lobe, the large lobe, the activation sequence, but only part of a CIP domain Othei functional fragments could be readily deteimined by the skilled technician using standard techniques known in the art
MPPTs according to the piesent invention comprise a cytokine receptor targeting unit that permits specific binding to cytokine receptor bearing cells The MPPTs of the present invention comprise one or more cytokine-receptor targeting units that can be attached to a variety of legions of the MPPT For example, in one embodiment the one or more cytokine-receptor targeting units are attached at or proximal to the C- terminus of the MPPT In another embodiment of the present invention, the one or moie cytokine-receptor targeting units are attached at or proximal to the N-terminus of the MPPT The term "proximal" in this context is defined as within 100 amino acid of the C-termmus, or withm 100 amino acids of the N-termmus These cytokme- receptoi taigetmg units are described m greater detail below
In addition, one or more further modifications may be made to the MPPTs of the present invention These optional modifications can enhance the selectivity of the MPPT by reducing or eliminating non-selective binding to non-target cells and/or allow the MPPT to be selectively activated to kill specific types of cytokine-receptor beaimg cells. These modifications include but are not limited to one or more modifications to the native small lobe binding domain (SBD), one or more modifications to the native large lobe binding domain (LBD), one or more modifications to the activation sequence, and addition of one or more artificial iegulatory domains (ARD). These modifications are described in detail below
In one embodiment of the invention, the MPPT comprises one or moie cytokine- receptor targeting units but no further modifications. In another embodiment of the invention, the MPPT compiises one or more cytokine-receptor targeting units and a modified binding domain In yet another embodiment, the MPPT comprises one or more cytokine-receptor targeting units and a modified activation sequence In still another embodiment, the MPPT comprises one or moie cytokine-receptor targeting units and one or more ARD In a further embodiment, the MPPT comprises one or more cytokine-receptoi targeting units, a modified SBD, and a modified LBD In a still fuither embodiment, the MPPT comprises one or more cytokine-receptor targeting units, one or more modified binding domains and a modified activation sequence In another embodiment, the MPPT comprises one or more cytokme- ieceptor targeting units, one or moie modified binding domains, and one or more ARD In yet another embodiment, the MPPT comprises one or more cytokine- receptor targeting units, one 01 more modifications to the activation sequence, and one oi more ARD In another embodiment of the invention the MPPT comprises one or moie cytokine-receptor taigeting units, one or more modified binding domains, one or moie modifications to the activation sequence, and one or more ARD
1.1. Cytokine-Receptor Targeting Unit
MPPTs accoiding to the piesent invention comprise one or more cytokme-ieceptor targeting units The cytokine-receptor tai geting units function to provide binding specificity to the MPPT Specifically, the cytokine-receptor taigeting unit allows the MPPT to bind to the target cell (i e , a cell displaying the corresponding cytokine leceptor) where the MPPT can be activated and subsequently kill the target cell The cytokme-receptor targeting unit may be added, for example, to the N- oi C-terrmnus of the protein toxin, or to both Altei natively, the cytokine-receptor targeting unit may be added to a different region of the protein toxm, as long as it does not interfere with the poie-forming activity of the final MPPT The cytokine-receptor targeting unit may also replace a functional domain of the nPPT, for example a binding domain Determination of appropriate points of attachment can be readily determined by one skilled in the art. The cytokine-receptor tatgetmg unit can be duectly attached to a nPPT to provide a MPPT, or it may be indirectly attached via an appropriate linker, as disclosed in more detail in Section 1 1 1 below
In one embodiment, the MPPT comprises a cytokine-receptor targeting unit at its N- terminus In another embodiment, an MPPT based on proaerolysin that comprises a cytokine-receptor targeting unit is added at the N-terminus of proaerolysin is provided. In stiil another embodiment, an MPPT based on alpha toxin that comprises a cytokine-receptor targeting unit at the N terminus of alpha toxin is provided In a further embodiment, the MPPT comprises a cytokine-receptor targeting unit at its C terminus In yet another embodiment, an MPPT based on proaerolysm that comprises a cytokme-receptoi targeting unit is added at the C-terminus of proaeroiysin is provided In still another embodiment, an MPPT based on alpha toxm that comprises a cytokine-receptor targeting unit at the C terminus of alpha toxin is provided In a further embodiment, the MPPT compiising a cytokine-receptor targeting unit is prepared using recombinant DNA methods
The cytokine-receptor targeting unit according to the present invention can be a molecule or hgand that recognizes or is capable of specific binding to a cytokine ieceptor For example suitable cytokine-receptor targeting units include a cytokine or d cytokine fragment, analogue or derivative that is capable of specifically binding to a cytokine ieceptoi Othei suitable cytokine ieceptor taigeting units contemplated by the present imention include, but are not limited to, antibodies and cytokine receptor inhibitors or antagonists that specifically bind to their target receptor
In one embodiment, the cytokine-receptor targeting unit is a cytokine Cytokines contemplated by the instant invention can be selected from a variety of cytokine molecules including, foi example, cytokines that are involved m the proliferation or differentiation of cells of the hematopoietic lineage, and cytokines that participate in the immune and inflammatoiy response mechanisms of the body For example, the cytokine can be an interleukin, such as IL-2 and IL-4, a lyrnphokine, a monokine, such as GM-CSF and IL-I, an interferon, such as IFN alpha and IFN-beta, a colony stimulating factor, such as M-CSF and G-CSF, a chemokine, a peptide regulatory factoi (PRF), macrophage inflammatoiy proteins such as MIP lα, MIP lβ, c kit hgand, tumor necrosis factors such as lymphotoxin (TNF beta), or a stem cell factor (SCF) In a further embodiment, the cytokine is a naturally occurring hybrid cytokine composed of the bioactive components of two unrelated cytokines In another embodiment, the cytokine is hybπd molecule composed of the bioactive components of a cytokine and another molecule such as a growth factor For example, the hybrid molecule can be a hybrid of the cytokine IL-2 and the giowth factor EGF In one embodiment, the MPPT comprises one or more cytokine receptoi targeting units that include a cytokine In another embodiment, the MPPT comprises one or moie cytokme-receptor targeting units involved in haematopoeisis or immune and/or inflammatory responses In another embodiment, the cytokine-receptor targeting unit comprised by the MPPT is a cytokine involved in haematopoiesis, such as c-kit Ugand, IL-3, IL-7, IL-9, IL-11, or a colony stimulating factor In a further embodiment, the cytokine-receptor targeting unit comprised by the MPPT is a cytokine that is involved in the immune and/or inflammatory iesponses such as IFN- α, IFN-p, IFN γ, IL I, IL 2, IL-4, IL 5, IL 6, IL 10, IL- 12, DL-13, IL-15, IL-16, EL- 17, TGF-β, TNFβ (lymphotoxm), TNF-α, oi a chemokine In another embodiment, the cytokine-ieceptoi targeting unit comprised by the MPPT is an interleukin In a further embodiment, the MPPT comprises one oi more cytokine-receptor targeting units that include a lymphokine In a further embodiment, the MPPT comprises one or more cytokine-receptor targeting units that include a monokine In yet another embodiment, the one or more cytokine receptor targeting units comprised by the MPPT include an interferon In a further embodiment, the one or more cytokme- ieceptoi targeting units compiised by the MPPT include a colony stimulating factoi In another embodiment, the one or more cytokine receptor targeting units comprised by the MPPT include a chemokine In a furthei embodiment, the one or more cytokine-ieceptor targeting units comprised by the MPPT include IL-2, IL-3, IL-4, IL- 13 or IL- 17 In yet another embodiment, the one or more cytokme-receptor targeting units compused by the MPPT include TNF-α In another embodiment, the cytokine- receptor targeting units comprised by the MPPT include a stem cell factor (SCF)
As is known in the art, cytokines can also be classified according to the sequence homology of the ieceptor to which they bind Cytokine receptors can be divided into five general families based on sequence similaπties the Class I cytokine receptor family (also known as Type I cytokine receptor, or haematopoietic growth factor, family) \v hich includes receptors for GM-CSF, IL-6, IL-2, Class II cytokine receptor family (also known as Type II cytokine receptor, or inteiferon, family) which includes ieceptors for IFN-α, β, and γ, Immunoglobulin Superfamily which includes teceptors for IL-I and M-CSF, TNF receptor family which includes receptors for various TNFs, and the Seven transmembrane helix family which includes receptors for various chemokines
In one embodiment the cytokine-receptor targeting unit comprised by the MPPT is a cytokine that binds to a membei of theType 1 cytokine receptor family In another embodiment, the cytokine-receptor targeting unit comprised by the MPPT is a cytokine that binds to a member of the Type 2 cytokine receptor family In a further embodiment, the cytokine-receptor targeting unit comprised by lhe MPPT is a cytokine that binds to a membei of the cytokine receptor family from the Immunoglobulin Superfaroily In another embodiment, the cytokine-receptor taigeting unit comprised by the MPPT is a cytokine that binds to a cytokine ieceptor from the Seven transmembrane helix Family of receptors In yet another embodiment, the cytokine-receptor taigeting unit comprised by the MPPT is a cytokine that binds to a cytokine ieceptor from the Tumor Necrosis Factor Family of receptors
The present invention furthei includes MPPTs comprising cytokine-receptor targeting units that are fidgments of a cytokine molecule Suitable fragments include
"functional fragments" that have maintained the ability to bind to their corresponding cytokine receplois Thus, m one embodiment of the invention, the MPPT comprises one or more cytokine receptor targeting units that include a functional fragment of a cytokine molecule In another embodiment, the MPPT comprises one or more cytokine-receptor targeting units that include a fragment of an interleukin In a further embodiment, the MPPT comprises one or moie cytokine-receptor targeting units that include a fiagment of IL-2 Suitable ftagments of IL-2 include, but are not limited to N-termmal ammo acid residues 1 to 20, C-terminal amino acid residues 121-133, oi the internal amino acid iesidues 30 to 60 as described in Ju G, et al , (1987) Journal of Biological Chemistry, 262 5723-5731 (herein incorporated by reference)
The present invention furthei includes MPPTs comprising cytokine-receptor targeting units that are derived from a cytokine molecule These may include, for example, recombinant cytokines that have maintained the ability to bind to their corresponding cytokine ieceptois as well as cytokine molecules that have been mutated, or muteins, to cieate different permutations of the molecule These mutant cytokines can be derived frequently from cloned genes that have been subjected to site-directed 01 random mutagenesis, or from completely synthetic genes using methods well known in the art and can carry single ot multiple ammo acid substitutions For example, the cytokine may be a truncated form of a cytokine molecule ot a circularly permuted form of the cytokine Circularly peimuted fotms of cytokines are those in which the natuial termini of the cytokine are joined and the resulting circulat protein is opened at another point to create a new C-terminus and N-termmus In an alternative embodiment, the MPPT may comprise a cytokine-ieceptor targeting unit that includes a designer cytokine, or a recombinant chimera comprising sequences from two or more cytokines Examples of designer cytokines aie well known in the art such as H- 1L-6, which is a fusion protein consisting of the amino acid chains of Il 6 and a soluble IL6 ieceptor in which the two moieties are linked by a flexible peptide chain
Thus, in one embodiment, the MPPT of the instant invention comprises one or more cytokine-receptor taigeting units that include a cytokine derivative In another embodiment, the MPPT comprises one or more cytokine-receptor taigeting units that include a circularly permuted foim of a cytokine
According to another embodiment of the present invention, the cytokine-receptor taigeting unit is an antibody to a cytokine receptor, capable of specifically binding to a cytokine receptor bearing cell Antibodies contemplated by the instant invention are descπbed above and include full-length (i e , naturally occurring or formed by not ma) immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecules (for example, an IgG antibody) and immunologically active (i e , specifically binding) poitions of an immunoglobulin molecule, and may or may not be humanized Suitable antibodies can be polyclonal or monoclonal antibodies Alternatively, the antibody may be a single chain antibody as known in the art and described in Bird et al Science 242 423-6, 1988, and Huston et al , Proc Natl Acad Sci 85 5879 83, 1988, or an antibody fragment In one embodiment, an antibody includes camehzed antibodies (foi example see Tanha et al , J Biol Chem 276 24774 80, 2001) Suitable antibodies that target cytokine receptors are known in the art, and many are available commercially, for example, from Abeam Inc (Cambridge, UK), and QED Bioscience Inc (San Diego, CA). In those cases where a receptor can be expressed in various forms, for example, the IL-2 receptor which can be expressed in differentially spliced forms and as a single (alpha) chain (i.e. CD25), an antibody that recognises one, or multiple, forms of the receptor can be used. Methods of preparing antibodies are known in the art (see, for example, Current Protocols in Immunology, ed. J. E. Coligan, et al, Wiley & Sons, New York, NY).
In one embodiment the MPPT comprises a targeting unit that is an antibody that selectively binds to a Type I cytokine receptor. In another embodiment, the MPPT comprises a targeting unit that is an antibody that binds selectively to a Type 2 cytokine receptor. In a further embodiment, the MPPT comprises a targeting unit that is an antibody that binds selectively to a cytokine receptor from the Immunoglobulin Superfamily. In another embodiment, the MPPT comprises a targeting unit that is an antibody that binds selectively to a cytokine receptor from the Seven transmembrane helix family of receptors. In yet another embodiment, the MPPT comprises a targeting unit that is an antibody that binds selectively to a cytokine receptor from the Tumor Necrosis Factor Family of receptors.
The cytokine-receptor targeting unit may be directly attached to the polypeptide, or it may be attached via an appropriate linker. Appropriate linkers and methods of adding them are described below. 1.1.1. Optional Linker
According to one embodiment of the present invention, a cytokine-receptor targeting unit may be covalently attached to the protein toxin through an appropriate linker or spacer. In the context of the present invention, the linker acts as a molecular bridge to link the cytokine-receptor targeting unit to the protein toxin. The linker can serve, for example, simply as a convenient way to link the two entities, as a means to spatially separate the two entities, to provide an additional functionality to the MPPT, or a combination thereof. For example in some instances it may be desirable to spatially separate the cytokine-receptor targeting unit and the protein toxin moiety to prevent the cytokine-receptor targeting unit from interfering with the pore-forming activity of the MPPT and/or the protein toxin interfering with the activity of the cytokine targeting unit. The linker can also be used to provide, for example, lability to the connection between the cytokine-receptor taigeting unit and the protein toxin moiety, an enzyme cleavage site (for example a cleavage site for a piotease), a stability sequence, a molecular tag, a detectable label, 01 various combinations thereof
The selected linker can be bifunctional or polyfunctional, i e contains at least a first reactive functionality at, or proximal to, a first end of the linker that is capable of bonding to, or being modified to bond to, the cytokine-receptor targeting unit and a second leactive functionality at, or proximal to, the opposite end of the hnket that is capable of bonding to, or being modified to bond to, the protein toxm being modified The two oi more reactive functionalities can be the same (i e the linker is homobifunctional) or they can be diffeient (i e the linker is heterobifunctional) A variety of bifunctional or polyfunctional cross-linking agents aie known m the art that are suitable for use as linkers (foi example, those commercially available fiom Pierce Chemical Co , Rockford, IL ) Alternatively, these reagents can be used to add the hnkei to the cytokine-receptor targeting unit and/or MPPT The length and composition of the linkei can be varied considerably provided that it can fulfill its puipose as a tnoleculai bridge The length and composition of the Linker are generally selected taking into consideration the intended function of the linker, and optionally othei factors such as ease of synthesis, stability, resistance to ceitain chemical and/or temperature paiameters, and biocompatibility For example, the linker should not significantly inteifere with the ability of the cytokine-receptor targeting unit to target the MPPT to a cytokine receptor bearing cell, or with the activity of the MPPT relating to activation, or pore-formmg ability
Linkers suitable for use according to the present invention may be bianched, unbranched, satuiated, or unsatuialed hydrocarbon chains, including peptides as noted above Furthermore, if the linker is a peptide, the linker can be attached to the protein toxm moiety and/or the cytokme-receptor targeting unit using recombinant DNA technology Such methods are well-known in the art and details of this technology can be found, for example, in Sambrook et at , supra
Examples of suitable linkers include branched or unbranched, saturated or unsaturated, hydrocarbon chains having from 1 to 100 carbon atoms, wherein one or moie of the caibon atoms is optionally replaced by -O- or -NR- (wherein R is H, or Cl to C6 alkyl), and wheiem the chain is optionally substituted on carbon with one 01 more substituents selected from the group of (C1 -C6) alkoxy, (C3 C6) cycloalkyl, (CL-C6) alkanoyl, (C1-C6) alkanoyloxy, (C1-C6) alkoxycarbonyl, (C1-C6) alkylthio, amide, azido, cyano, nitro, halo, hydroxy, oxo (=O), carboxy, aryl, aryloxy, heteroat yl, and heteroaryloxy
Other examples of suitable linkeis include, but are not limited to peptides having a chain length of 1 to 100 atoms, and linkers derived from groups such as ethanolamine, ethylene glycol, polyethylene with a chain length of 6 to 100 carbon atoms, polyethylene glycol with 3 to 30 repeating units, phenoxyethanol, propanolamide, butylene glycol, butyleneglycolamide, propyl phenyl, and ethyl, propyl, hexyl, steryl, cetyl, and palrmtoyl alkyl chains
In one embodiment, the MPPT comprises a linker that is a branched or unbianched, saturated o\ unsaturated, hydrocarbon chain, having from 1 to 50 carbon atoms, wherein one or more of the carbon atoms is optionally replaced by -O- or -NR- (wherein R is as defined above), and wheiein the chain is optionally substituted on carbon with one oi more substituents selected from the group of (C1-C6) alkoxy, (Cl- C6) alkanoyl, (C1-C6) alkanoyloxy, (C1-C6) alkoxycarbonyl, (C1-C6) alkylthio, amide, hydioxy oxo (=O), carboxy, aryl and aiyloxy
In another embodiment, the MPPT comprises a linker that is an unbranched, satutated hydrocarbon chain having fiom 1 to 50 carbon atoms, wherein one or more of the caibon atoms is optionally ieplaced by -O- oi -NR- (wherein R is as defined above) and wherein the chain is optionally substituted on carbon with one or more substituents selected from the group of (C1-C6) alkoxy, (C1-C6) alkanoyl, (C1-C6) alkanoyloxy, (C1-C6) alkoxycarbonyl, (C1-C6) alkylthio, amide, hydroxy, oxo (=O), caiboxy, aryl and aryloxy
In a specific embodiment of the present invention, the MPPT comprises a linker that is a peptide having a length of between about 1 and about 30 amino acids In another embodiment, the MPPT comprises a linker that is a peptide having a length of between about 5 and about 20 amino acids In one embodiment, the MPPT comprises a peptide linker that is at least thiee amino acids in length In one embodiment, the MPPT comprises a peptide linker that is at least four amino acids in length In one embodiment, the MPPT comprises d peptide linker that is at least five amino acids m length In one embodiment, the MPPT comprises a peptide linker that is at least ten ammo acids in length In one embodiment, the MPPT comprises a peptide linker that is at least fifteen amino acids in length Peptide linkers that aie susceptible to cleavage by enzymes of the complement system, uiokinase, tissue plasminogen activator, trypsin, plasmin, or another enzyme having pioteolytic activity may be used to attach the cytokine-receptor targeting unit(s) In one embodiment of the present invention, the MPPT comprises a cytokine- receptor targeting unit attached via a linker susceptible to cleavage by enzymes having a pioteolytic activity such as a urokinase, a tissue plasminogen activator, plasmin, thiombin or trypsin In addition, cytokine-ieceptor targeting units may be attached to the protein toxin moiety via disulfide bonds (for example, the disulfide bonds on a cysteine molecule) Since many tumors natuially release high levels of glutathione (a reducing agent) this can reduce the disulfide bonds with subsequent release of the MPPT at the site of delivery
In one embodiment, the MPPT comprises a cytokine-receptor targeting unit linked by a cleavable linker region In another embodiment of the invention, the MPPT comprises a cleavable linker region that is a protease-cleavable linker Other linkers, cleavable foi example by small molecules, may also be used Examples of protease cleavage sites are those cleaved by factor Xa, thrombin and collagenase In one embodiment of the invention, the MPPT comprises a linker having a protease cleavage site that is cleaved by a protease that is associated with a disease In another embodiment, the piotease cleavage site is one that is cleaved by a protease that is up regulated or associated with cancers in general Examples of such proteases die uPA, the matrix metalloproteinase (MMP) family, the caspases, elastase, and the plasminogen activator family, as well as fibroblast activation protein In still another embodiment, the MPPT comprises a hnkei having a cleavage site that is cleaved by a protease secreted by cancer-associated cells Examples of these proteases include matπxmetalloproteases, elastase, plasmin, thrombin, and uPA In another embodiment, the MPPT comprises a linker having a protease cleavage site that is up- regulated or associated with a specific cancer The precise sequences are available in the art and the skilled person will have no difficulty in selecting a suitable cleavage site. By way of example, a protease cleavage region targeted by Factor Xa is I E G R (SEQ ID NO:23). A protease cleavage region targeted by Enterokinase is D D D D K (SEQ ID NO:24). A protease cleavage region targeted by Thrombin is L V P R G (SEQ ID NO:25). In one embodiment, the MPPT comprises a cleavable linker region which is targeted by endocellular proteases.
Table 3 identifies additional non-limiting examples of selected cleavage sites recognized by the proteases described above.
Table 3: Peptide Sequences Favored by Proteases
Figure imgf000034_0001
One of skill in the art would understand that cleavage sites other than those listed in Table 3 are recognized by the listed proteases, and can be used in the linkers described above.
As known in the art, the attachment of a linker to the protein toxin moiety (or of a linker element to a cleavable element, or a cleavable element to another toxin moiety) need not be a particular mode of attachment or reaction. Any reaction providing a product of suitable stability and biological compatibility is acceptable.
1.2. Other modifications
1.2.1 Modifications to Binding Domain(s) MPPTs accoiding to the present invention are derived fiom nPPTs that comprise one or more binding domains, as known in the art In the context of the present invention, when an nPPT, such as alpha toxin, comprises only one binding domain, it is consideied to be a "large lobe binding domain " MPPTs according to the present invention may optionally comprise modifications to one or moie binding domains, as applicable Foi example, native proaerolysin from Aeromonas species comprises two binding domains, a small lobe binding domain, and a large lobe binding domain In contiast, native alpha toxin from Clostridium septicum comprises only a large lobe binding domain In one embodiment, modifications of the binding domains include functional deletion of a binding domain A functionally deleted binding domain in an MPPT results in an MPPT that has an attenuated ability to bind to its cell surface receptor, yet still retains pore forming ability A functional deletion can be made, for example, by deleting all oi a part of a binding domain or introducing one or moie mutations into a binding domain of an MPPT Alternatively, insertion of heteiologous sequences into the binding domain may be used to functionally delete the binding domain Addition of these hetei ologous sequences may confer an additional functionality to the MPPT Foi example, addition of a heterologous sequence can result in the addition of a region that can function as an ARD as described in Section 1 4 below Functional deletion of a binding domain may also be achieved by attaching a blocking group to the nPPT that functions to prevent interaction of the binding domain with us cell membrane receptor Methods of attaching blocking groups to nPPTs are known in the art and described in Section 2 below Point mutations to the ammo acid sequence of the native binding domain of the nPPT can also be made to decrease the ability of the binding domain to bind to its receptor Further details regaiding these modifications are described below
MPPTs with functional deletions in the binding domain may be prepared using methods known m the art These methods include the use of recombinant DNA technology as described in Sambrook et al , supra Alternatively, functional deletions of the binding domain may also be achieved by duect modification of the protein itself accoiding to methods known in the art, such as pioteolysis to generate fragments of the MPPT, which can then be chemically linked together (See Section 2 2) In one embodiment of the invention, the MPPT comprises functional deletion of its small lobe binding domain (SBD) Examples of functional deletions of the SBD that may be made in the A hydrophda proaerolysm polypeptide include, but are to limited to deletion of the entπe SBD, corresponding to amino acid 1-83 of SEQ ID NO- 2, or portions of this region, for example amino acids 45-66 of SEQ ID NO 2
Altei natively, one or more point mutations can be made in the SBD, for example, at one oi more of the following positions W45, 147, M57, Y61 , K66 (amino acid numbeis refer to SEQ ID NO 2) Exemplary mutations at these positions include, but aie not limited to W45A, I47E, M57A,Y61A, Y61C, K66Q (amino acid numbers refei to SEQ ID NO 2) and those described in Mackenzie et al J Biol Chem 274 22604-22609, 1999 (herein incoiporated by refeience)
In one embodiment of the invention, the MPPT comprises functional deletion of its large lobe binding domain (LBD) Exemplaiy functional deletions of the LBD of MPPTs lhat aie based on pioaerolysm include, but are not limited to, deletion of the entire LBD (contained m approximately ammo acid residues 84-426 of SEQ ID NO T) or portions thereof, or intioduction of compπses one or more point mutations into the LBD, foi example at one or more of amino acid residues Y 162, W324, R323, R336, and/oi W 127 In one embodiment of the invention, an MPPT based on proaerolysm is provided that comprises a point mutation at W127 and/or R336 In anothei embodiment, an MPPT based on proaerolysm is provided that comprises the point mutations Y162A and/or W324A. In a fuither embodiment an MPPT based on proaerolysm is piovided that comprises the point mutations R336A or R336C, and/or W127T. MPPTs based on proaeiolysin may also comprise mutations to other residues that interact directly with the GPI-protein ligand resulting in functional deletion of the LBD
Exemplary mutations to the LBD of MPPTs derived fiom alpha toxin are noted below and include at least one substituted ammo acid in the receptor binding domains of the alpha toxin, for example at one or moie of amino acid residues 53, 54, 62, 84-102, 259-274 and 309-315 of the sequence of the native alpha toxm as shown in SEQ ID NO 4 In one embodiment of the invention, MPPTs derived from alpha toxin are provided that include mutations at one or moie of the following residues W85, Y128, R292, Y293, and R305 1.2.2. Modification of Activation Sequence
MPPTs according to the piesent invention may optionally comprise modifications of the naturally occurring activation sequence of the nPPT to permit selective activation of the MPPT For example, the activation sequence may be modified so as to permit activation of the MPPT in a specific sub-group of cytokine-receptor bearing cells or m certain types of diseased cells, such as cancer cells In this regard, the MPPTs may be modified with a single cleavage site modification (ι e the native activation sequence is modified to piovide a single cleavage site that is diffeient to the native cleavage site(s)), or with a plurality of cleavage site modifications (ι e the native activation sequence is mnodified to provide a plurality of different cleavage sites, which may or may not include the native cleavage site(s)) MPPTs with a plurality of cleavage site modifications may include different types of cleavage sites that are recognized by diffeient enzymes The naturally occurring activation sequence may be modified to provide one or more cleavage sites for one or more enzymes associated with certain diseased cells and/or cell types For example, the expression of the target enzyme can be up-iegulated in a certain type of cell, or in a diseased cell compared to a normal cell, oi the enzyme can be localized to a paiticular cell type, or diseased cell as compared to normal cells, or the enzyme may be produced by the particular type of tissue or cells, oi disease associated tissue or cells In one embodiment, the MPPT comprises a modified activation sequence comprising one cleavage site modification In another embodiment, the MPPT comprises a modified activation sequence comprising one cleavage site recognized by a protease associated w ith a particular type of cell In a further embodiment, the MPPT compiises a modified activation sequence comprising one cleavage site recognized by a protease associated with a particulai disease In yet another embodiment, the MPPT comprises a modified activation sequence comprising a plurality of diffeient cleavage site modifications In another embodiment, the MPPT comprises a modified activation sequence compπsing two or more different cleavage sites recognized by two or more different proteases associated with a paiticular type of cell and/or a particular disease
Modification to the naturally occurring activation sequence may be achieved by methods known in the art, and may iesult in functional deletion of the naturally occurring activation sequence Functional deletion is achieved by mutation, partial or complete deletion, insertion, or othei variation made to the naturally occurring activation sequence that rendeis it inactive In one embodiment, the MPPT comprises ά modified activiation sequence in which the native activation sequence of the nPPT has been functionally deleted by insertion of one or more cleavage site modifications In another embodiment, the MPPT comprises a modified activation sequence in which the naturally occurring activation sequence is functionally deleted via mutations of one oi more ammo acid residues in the native activation sequence to produce one or more cleavage site modifications In another embodiment, the MPPT comprises a modified activation sequence in which the native activation sequence of the nPPT has been functionally deleted by replacing the natuially occurring activation sequence with one or more cleavage site modifications In one embodiment of the invention, the MPPT comprises a modified activation sequence having one or more cleavage site modifications In another embodiment, the MPPT comprises a modified activation sequence having one or more cleavage sites that aie recognized by a piotease, the presence of which is associated with a paiticuldr disease An example of such a protease includes prostate specific protease such as PSA, PMSA, or HK2, associated with BPH In another embodiment, the MPPT comprises a modified activation sequence having one or more cleavage sites that are tecogmzed by a protease, the presence of which is associated with conditions associated with angiogencsis Non-limiting examples of such pioteases include matrix metalloproteases such as MTl MMP, MMP-2, MMP-9, ADAM (a disintegπn and metalloproteinase domain), ADAMTS (a disintegrin and metalloproteinase domain with thiombospondin motifs), urokinases, serine proteases, and cysteine cathepsins In a further embodiment, the MPPT comprises a modified activation sequence having one oi mote cleavage sites that are recognized by a protease, the piesence of which is associated with cancer Examples of such proteases include caspases, matrix metalloproteinases (including MMP-3, MMP-9), fibroblast activation proteins, elastase, plasrmn, thrombin, and plasminogen activator proteins such as uPA and tPA As is known in the art, these proteases recognize certain cleavage sites. Examples of some cleavage sites recognized by some of these proteases are shown in Table 3, in Section 1.1.1. In one embodiment, the MPPT comprises a modified activation sequence that includes one or more cleavage sites that are recognized by uPA. In a further embodiment the MPPT comprises a modified activation sequence that includes a uPA cleavage site. An example of a uPA cleavage site is: SGRSAQ (SEQ ID NO:31). In another embodiment of the invention, the MPPT comprises a modified activation sequence comprising a cleavage site for the protease PSA. An example of a PSA-specific cleavage site is: HSSKLQ (SEQ ID NO:33). 1.2.3. Addition of an Artificial Regulatory Domain (ARD)
The MPPTs according to the invention may optionally be further modified by the addition of one or more artificial regulatory domains (ARDs) other than the cytokine- receptor targeting unit(s). ARDs that can be added to MPPTs include secondary targeting units that are capable of improving the selective targeting of the MPPT to a cytokine-receptor bearing target cell, or that are capable of further refining the selective targeting of the MPPT, for example, to a specific sub-group or type of cytokine-receptor bearing cells such as those associated with a particular organ, tissue or disease. Inhibitory units that are capable of inhibiting the activity of the MPPT are also contemplated as suitable ARDs. One skilled in the art will recognize the possibility that an ARD can function as both a secondary targeting unit and an inhibitory unit. According to one embodiment of the invention, an MPPT comprises one or more ARD that is a secondary targeting unit. In another embodiment of the invention, the MPPT comprises one or more ARD that is an inhibitory unit. In still another embodiment the MPPT comprises an ARD that can function as both a secondary targeting unit and an inhibitory unit. In an additional embodiment, the MPPT comprises an ARD that is capable of functioning to inhibit binding to normal cells, yet able to direct binding to diseased cells, such as cancer cells. ARDs according to the present invention may be proteins, peptides, antibodies, Hgands, or other moieties. The ARD may be covalently attached directly to the nPPT, or it may be attached via an appropriate linker. Appropriate linkers and methods of adding them are as described in relation to the attachment of cytokine-receptor targeting units, in Section 1.1.1. The ARD may be added to the N- or C-terminus of the MPPT, or both. Alternatively, the ARD may be added to a different region of the MPPT. In one embodiment, the MPPT comprises an ARD added at or proximal to the N-terminus of the nPPT. In another embodiment, the MPPT comprises an ARD added at or proximal to the N-terminus of proaerolysin. In still another embodiment, the MPPT comprises an ARD added at or proximal to the N-terminus of alpha toxin. In a further embodiment the MPPT comprises an ARD added at or proximal to the C-terminus of the nPPT. In another embodiment, the ARD is added to the C-terminus of proaerolysin. In yet another embodiment, the ARD is added to the C-terminus of alpha toxin. In still another embodiment, the ARD is added to proaerolysin using recombinant DNA methods, such as those described in Section 2.
Secondary Targeting Units
As noted above, in addition to the cytokine-receptor targeting unit, the MPPTs of the present invention comprise secondary targeting units that may be used to provide additional target selectivity to the MPPT. Additionally, the secondary targeting molecule may act as an inactivator of the MPPT. In this regard, the secondary targeting molecule may charge neutralize or sterically inhibit the MPPT from pore formation. The secondary targeting unit can be a ligand which binds selectively to the target cell. In one embodiment, the MPPT comprises a secondary targeting molecule that is an antibody. Antibodies contemplated by the instant invention can be a full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecule (for example, an IgG antibody) or an immunologically active (i.e., specifically binding) portion of an immunoglobulin molecule, and may or may not be humanized. Suitable antibodies can be polyclonal or monoclonal antibodies. Alternatively, the antibody may be a single chain antibody as known in the art and described in Bird et al. Science 242:423-6, 1988; and Huston et al., Proc. Natl. Acad. Sci. 85:5879-83, 1988 or an antibody fragment, such as a Fab fragment. The antibody can also be a camelized antibody (for example see Tanha et al., J. Biol. Chem. 276:24774-80, 2001). In one embodiment, the MPPT comprises a secondary targeting unit that is an antibody that selectively binds a specific type of diseased cell In a further embodiment, the MPPT comprises a secondary targeting unit that is a monoclonal Oi single chain antibody that binds to prostate specific membrane antigen that can be expiessed at high levels on prostate cells In yet another embodiment, the MPPT comprises a secondaiy targeting unit that is a monoclonal antibody or single chain antibody against CD4 or CD8 that can be expressed on T-cells In anothei embodiment, the MPPT comprises a secondary targeting unit that is an antibody that selectively binds a cancer cell In another embodiment, the secondary targeting unit is an antibody that recognizes one of CA-15-3 (for example, catalog number RDI- CAl 53-AG from Research Diagnostics, recognizes breast cancer cells), thyroid transcription factor 1 (TTFl, foi example, catalog number AB 869 from Abeam Inc , Cambridge, MA, recognizes lung and thiyroid carcinomas) In another embodiment, the MPPT compπses a secondary targeting unit that is an antibody that recognizes the L6 antigen on renal cell caicinomas or an antibody that recognizes the transfeinn receptor on glioblastoma cells In a fuither embodiment, the MPPT comprises a secondary targeting unit that is an AFAI antibody that is capable of selectively binding lung cancer cells
In anothei embodiment, the MPPT compπses a secondaiy targeting unit that is the antibody Rituxan, which taigets CD20 and B-cell non-Hodgkin's lymphoma cells
Other examples of suitable antibodies for use as secondaiy targeting units include, but arc not limited to, Heiceptin® (Genentech) which recognizes some breast cancers, and lymphomas, Alemtuzumab (MabCampath®) which binds to CD52, a molecule found on white blood cells and recognizes chronic lymphocytic leukemia cells, Lym-1 (Oncolym®, Scheπng), which binds to the HLA-DR-encoded histocompatibility antigen that can be expressed at high levels on lymphoma cells, Bevaαzumab (Avastin®, Avastm), which binds to vascular endothelial growth factor (VEGF) thus blocking its action and depπving the tumor of its blood supply, and Cetuximab (Eibitux®, Merck) which binds to colorectal cancers In another embodiment, the MPPT compπses a secondary targeting unit that is a molecule or hgand that recognizes or is capable of specific binding to a second molecule that is selectively expressed on the target cell In one embodiment, the MPPT comprises a secondary taigeting unit that is a hgand that is specific for a receptor that is selectively expressed on the target cell Non-limiting examples of such ligands include hormones such as steroid hormones, or peptide hormones, neuroactive substances, for example opioid peptides, insulin, growth factors, e g , epidermal growth factor, msuhn-hke growth factor, fibroblast growth factor, platelet derived growth factor, melanocyte stimulating hormone, a substance or receptor which has affinity for a particular class of cells (or viruses) foi example, cancer cells, virally infected cells, immune cells, for example, B cells or T cells or a subset thereof, for example, soluble fragments of CD4, which bind to the protein gpl20 expressed on HIV-infected cells, or a substance with an affinity for a class of molecules, for example, a lectin, such as concanavahn A, which binds a subset of glycoproteins Adhesion molecules, for example, molecules expressed on cells of hematopoetic origin, such as CD2, CD4, CD8 which are expressed on T cells, selectins, lntegπns, as well as adhesion molecules expiessed on non immune cells, may also be used as secondaiy targeting units to direct the MPPT of the invention to target cells Since some cancer cells abnormally express certain adhesion molecules, receptors for such adhesion molecules may also be used as secondaiy targeting units
In one embodiment, the MPPT compiises a secondaiy targeting unit that selectively duects the MPPT to diseased cells In another embodiment, the MPPT comprises a secondary targeting unit that selectively directs the MPPT to a specific tissue or organ
In yet another embodiment, the MPPT composes a secondaiy targeting unit that is additionally capable of acting as an inhibitory unit For example, the AFAI antibody fiagment is capable of reducing the activity of the MPPT, as well as selectively targeting the MPPT to a lung cancer cell Similarly, other proteins of similar size are capable of acting as an inhibitory unit
Inhibitory Units
As noted above, the ARD may be an inhibitory umt Without being limited by mechanism, an inhibitory unit may inactivate the MPPT by, for example, charge neutralization, and/or by steπcally inhibiting eithei the ability of the MPPT to bind to its ieceptor on the cell membrane, or the ability of the MPPT to form pores in the cell membrane Examples of suitable inhibitory units include antibodies, enzymes, carbohydrates, peptides, ubiquitin, a phage (via phage engineering) or a strcptavidin microbead via peptide biotinylation
In one embodiment of the invention, the MPPT comprises an inhibitoty unit that is an antibody In a further embodiment, the MPPT compπses an inhibitory unit that is an AFAI antibody fragment As noted above, the inhibitoiy unit can also be capable of functioning as a secondary targeting unit
1.2.4 Modifications to other regions
The present invention contemplates that the MPPTs may further comprise additional modifications provided that the modifications do not affect the ability of the MPPTs to selectively target cancer cells Such modifications include ammo acid substitutions, insertions or deletions, and modifications, for example, to reduce antigenicity of the MPPT, to enhance the stability of the MPPT and/or to improve the pharmacokinetics of the MPPTs In general, such furthei modifications to MPPTs involve only a small number of ammo acids and include deletions (for example of 1-3 or more amino acids), insertions (for example of 1-3 or more residues), or substitutions that do not interfere with the ability of the MPPTs to selectively target and kill cancer cells In one embodiment, the MPPT compπses further modifications that involve less than 30%, 20%, 15%, 10%, 5%, or 2% of the total number of amino acids and maintains the ability to selectively target and kill cancer cells
The modification can be a substitution whereby at least one residue in the amino acid sequence has been removed and a different residue inserted in its place In one embodiment, the MPPT compπses as a furthei modification a substitution that is a conservative substitution A conservative substitution is one in which one or more amino acids are substituted with amino acid residues having similar biochemical properties Typically, conservative substitutions have little to no impact on the activity of a resulting polypeptide Examples of amino acids which may be substituted for an original ammo acid in a protein and which are regarded as conservative substitutions include Ser for Ala, Lys for Arg, GIn or His for Asn, GIu for Asp, Sei for Cys, Asn for GIn, Asp foi GIu, Pro foi GIy, Asn or Gin foi His, Leu oi VaI for He, He or VaI for Leu, Arg or GIn for Lys, Leu or He for Met, Met, Leu or Tyi foi Phe, Thi for Ser, Ser for Thi , Tyr for Tip, Trp or Phe for Tyr, and He or Leu for VaI
In another embodiment the MPPT compi ises as a further modification a substitution that is a permissive substitution Permissive substitutions are non-conservative ammo acid substitutions, but also do not significantly alter MPP activity An example is substitution of Cys for AIa at position 300 of SEQ ID NO 2 in a proaerolysin polypeptide Othei non-conservative substitutions that do not affect the activity of the MPPT can be readily determined by the skilled technician
One oi more substitutions can be introduced by manipulating the nucleotide sequence that encodes the MPPT polypeptide using, for example, standard procedures such as site-directed mutagenesis or PCR Further information about substitutions can be found m, among other locations, Ben-Bassat et al , (J Bacterid 169 751 7, 1987), O'Regan et al , (Gene 77 237-51, 1989), Sahin-Toth et al , (Protein Sci 3 240-7, 1994), Hochuh et al , (Bio/Technology 6 1321-5, 1988), WO 00/67796 (Curd et al ) and in standard textbooks of genetics and molecular biology
In one embodiment, the MPPTs include as a further modification, 1 or more amino acid substitutions of single residues In another embodiment, the MPPTs include as a fuither modification 1 amino acid substitution In another embodiment, the MPPTs include as a furthei modification from about 2 to about 10 amino acid substitutions In another embodiment, the MPPTs include as a further modification about 3 to about 5 amino acid substitutions
Non-hmiting examples of further modifications that may be made to MPPTs derived fiom proaerolysin in various embodiments of the invention include substitutions at one or more of positions 22, 107, 1 14, 121, 127, 135, 159, 164, 171, 186, 198, 201, 202, 203, 216, 220, 238, 248, 249, 250, 252, 253, 254, 256, 258, 259, 263, 284, 285, 293, 294, 296, 299, 300, 309, 332, 341, 349, 361, 369, 371, 372, 373, 416, 417, 418, 445 and 449 Specific non limiting examples of substitutions at these positions are listed in Table 4
Table 4: Exemplary Single Mutations of MPPTs derived from a Native Proaerolysin Polypeptide
Figure imgf000045_0001
Pcptidomimetic and organomimetic embodiments are also contemplated, whereby the three-dimensional arrangement of the chemical constituents of such peptido- and oiganomimetics mimic the three-dimensional arrangement of the polypeptide backbone and component ammo acid side chains in the polypeptide, iesulting in such peptido- and organomimetics of an MPPT which have the ability to lyse target cells For computer modeling applications, a pharmacophore is an idealized, three- dimensional definition of the structural requiiements for biological activity Peptido- and organomimetics can be designed to fit each pharmacophore with current computer modeling software (usmg computer assisted drug design or CADD) See Walters, Computer-Assisted Modeling of Drugs", in Klegerman & Groves, eds , 1993, Phaimaceutical Biotechnology, Interpharm Press Buffalo Grove, 111 , pp 165- 174 and Principles of Pharmacology (ed Munson, 1995), chapter 102 tor a description of techniques used in CADD Other modifications that may be made to the amino acids comprised by the MPPTs include, for example, modifications to the carboxylic acid groups of the amino acids, whether carboxyl-terminal or side chain, in which these groups are in the form of a salt of a phaimaceuticdlly-acceptdble cation or esteπfied to foim a Q-Qc ester, or converted to an amide of formula NRiR2 wherein Ri and R2 are each independently H or C|-Ci6 alky], or combined to form a heterocyclic ring, such as a 5- or 6 membered ring Amino gioups of the polypeptide, whether amino-terminal or side chain, can be in the form of a pharmaceutically-acceptable acid addition salt, such as the HCl, HBr, acetic, ben7oic, toluene sulfonic, maleic, tartaric and other organic salts, or may be modified to Q-Qe alkyl or dialkyl amino or further converted to an amide
Othei modifications include conveision of hydioxyl groups of the polypeptide side chain to Ci-Ci6 alkoxy or to a Q-CK; ester using well-recognized techniques Phenyl and phenolic rings of the polypeptide side chain can be substituted with one or moie halogen atoms such as F, Cl, Br or !, 01 with Ci-Qg alkyl, Q-Qβ alkoxy, carboxylic acids and esters thereof, or amides of such carboxyhc acids Methylene groups of the polypeptide side chains can be extended to homologous C2-C4 alkylenes Thiols can be protected with any one of a numbei of well-iecognized protecting groups, such as acetamide groups Those skilled in the art will also recognize methods foi introducing cyclic structures into the polypeptides described herein to select and provide conformational constraints to the structure that result in enhanced stability For example, a caiboxyl-teiminaLou amino terminal _cystejne-re.vidυe can be added tn the polypeptide, so that when oxidized the polypeptide will contain a disulfide bond, generating a cyclic peptide Othei peptide cychzing methods include the formation of thioethers and carboxyl- and amino-terminal amides and esters The present invention further contemplates that the MPPT can comprise further modifications intended to improve the pharmacokinetic propeities of the molecule when admimsteied to a subject Various modifications to reduce immunogemcit> and/01 improve the half-life of therapeutic proteins aie known in the art For example, the MMPTs can undergo glycosylation, isomeπzation, or deglycosylation according to standard methods known m the art Similaily, the MPPT can be modified by non natuially occurring covalent modification for example by addition of polyethylene glycol moieties (pegylation) or lipidation In one embodiment, the MPPl s of the invention are conjugated to polyethylene glycol (PEGylated) to improve their pharmacokinetic piofiles Conjugation can be carried out by techniques known to those skilled in the art (see, for example, Dcckert et al , lnt J Cancer 87 382-390, 2000, Knight et al , Platelets 15 409 418, 2004, Leong et al , Cytokine 16 106-119, 2001, and Yang et al , Protein Eng 16 761-770, 2003) If desired, antigenic epitopes can be identified and altered by mutagenesis Methods of identifying antigenic epitopes are known in the art (see for example, Sette et al , Bioiogicals 29 271-276), as ate methods of mutating such antigenic epitopes
2. Preparation of Modified Pore-forming Protein Toxins Modified pore- forming piolem toxins (MPPTs) according to the present invention can be prepaied by many methods, as known in the art Addition of the cytokine receptor targeting unit and othei optional modifications to the nPPT polypeptide in ordei to provide an MPPT can be acheived, for example, by engineering the nucleic acid encoding the nPPT using recombinant DNA technology Alternatively, the cytokine- receptor targeting unit can be added and other optional modifications made to the nPPT polypeptide itself, using chemical techniques and/oi limited proteolysis Combinations of these methods may also be used to prepate the MPPTs according to the present invention, as is also known in the art
The cytokine-receptoi targeting unit(s) and optional ARD(s) can be dπectly attached to the nPPT polypeptide or can be indirectly attached via an appropπate linker Appiopi iate linkers are desci ibed in Section 1 1 1
2.1. Recombinant preparation of MPPTs
The MPPTs can be prepared entiiely by recombinant techniques, or eithei the nPFF or the cytokine targeting unit, or both, can be prepared by recombinant techniques and subsequently joined by chemical techniques MPPTs comprising ARD(s) may likewise be prepared entirely or partially by recombinant methods
Sequences for various nPPTs are available from GenBank™ as noted heiein Isolation and cloning of the nucleic acid sequence encoding these proteins can thus be achiev ed using standard techniques [see, for example, Ausubel et al , Current Protocols in Molecular Biology, Wiley & Sons, NY (1997 and updates), Sambrook et al , πupra] Foi example, the nucleic acid sequence can be obtained directly from a suitable organism, such as Aeromonas hyclrophila, by extracting the mRNA by standard techniques and then synthesizing cDNA from the mRNA template (for example, by RT-PCR) Alternatively, genomic DNA can be isolated and the sequence encoding the nPPT amplified by PCR or the nucleic acid sequence encoding the nPPT can be obtained from an appropriate cDNA or genomic DNA libiary by standard procedures The nucleic acid sequence encoding the nPPT is then inserted directly or after one or more subclomng steps into a suitable expression vector One skilled in the art will appreciate that the pi ease vector used is not cπtical to the instant invention Examples of suitable vectors include, but aie not limited to, plasmids, phagemids, cosmids, bacteπophage, baculoviruses, retroviruses or DNA viruses The vector may be a cloning vectoi or it may be an expression vector
Once the nucleic acid sequence encoding the nPPT has been obtained, the nucleic acid sequence encoding the nPPT can be further engineered to include a nucleic acid sequence encoding the cytokine targeting unit and/or to introduce mutations into the binding doτnam(s) and/or activation sequence and/or to include an ARD Nucleic acid sequences encoding various cytokines are known in the art and are available fiom the GenBank™ database For example, interleukins such as interleukin-2 (IL 2) (GenBank Ace No S77834), IL-3 (GenBank Ace No M 14743), IL-4 (GenBank Ace No M23442), IL-5 (GenBank Ace No J03478), IL-6 (GenBank Ace No M14584), IL-7 (GenBank Ace No NMJ)00880), IL-10 (GenBank Ace No NM_000572), IL- 12 (GenBank Ace No AF180562 and GenBank Ace No AF180563), IL- 13 (GenBank Ace No U10307), JL-14 (GenBank Ace No XM_170924), IL-15 (GenBank Ace No X91233), IL-16 (GenBank Ace No
NM_004513), IL- 17 (GenBank Ace No NM_002190) and IL- 18 (GenBank Ace No NM_001562), hematopoietic factors such as granulocyte macrophage colony stimulating factor (GM-CSF) (GenBank Ace No X03021), granulocyte colony stimulating factor (G-CSF) (GenBank Ace No X03656), platelet activating factor (GenBank Ace No NM_000437) and erythropoeitm (GenBank Ace No X02158), tumor necrosis factors (TNF) such as TNF alpha (GenBank Ace No X02910), lymphokines such as lymphotoxm alpha (GenBank Ace No X02911), lymphotoxm- beta (GenBank Ace No Ll 1016), leukoteguhn, macrophage migration inhibitory factor (GenBank Ace No M25639), and neuroleukin (GenBank Ace No K03515), regulators of metabolic processes such as leptin (GenBank Ace No U43415), mterfeions such as interferon alpha (IFN alpha ) (GenBank Ace No M54886), EFN beta (GenBank Ace No V00534), IFN gamma (GenBank Ace No J00219), IFN alpha (GenBank Ace No NM_002177), thrombospondin 1 (THBSl) (GenBank Ace No NM_003246), THBS2 (GenBank Ace No L12350), THBS3 (GenBank Ace No L38969), THBS4 (GenBank Ace No NM_003248), and chemokines Nucleic acid sequences encoding antibodies to cytokine receptors are also available Cloning of the nucleic acid sequence encoding the cytokine targeting unit (such as a cytokine, cytokine fragment, cytokine derivative, antibody or antibody fragment) can be achieved as described above with respect to the nPPT
Mutations in either the nPPT or cytokine targeting unit can be introduced at specific, pie-selected locations in the nucleic acid sequence by in vitto site-directed mutagenesis techniques well-known in the ait Mutations can be intioduced by deletion, inseition, substitution, inversion, or a combination theicof, of one or more of the appropriate nucleotides making up the coding sequence This can be achieved, for example, by PCR based techniques for which primers are designed that incorporate one or more nucleotide mismatches, insertions or deletions The presence of the mutation can be verified by a number of standard techniques, foi example by restπction analysis or by DNA sequencing
The MPPTs according to the present invention can be prepaied as fusion proteins In addition to the cytokine receptor targeting unit, such fusion proteins may include nPPTs that have been modified to include an ARD with or without a linker
Methods for making fusion proteins are well known to those skilled in the ai t For example U S Pat No 6,057,133 to Bauer et al discloses methods for making fusion molecules composed of human interleukin 3 (hIL 3) variant or mutant proteins functionally joined to a second colony stimulating factor, cytokine, lymphokme, mterleukm, hematopoietic giowth factor or 1L-3 vanant U S Pat No 6 072,041 to Davis et al discloses the generation of fusion proteins comprising a single chain Fv molecule directed against a transcytotic receptor covalently linked to a therapeutic protein
Similar methods can be used to generate fusion proteins compπsing MPPTs of the present invention Linker regions can be used to space the two portions of the protein from each othei and to provide flexibility between them as described above Linker regions that can be added to the MPPTs using recombinant DNA technology are generally peptides of between 1 and 30 amino acids in length, foi example less than 20 ammo acids in length
DNA sequences encoding a fusion protein can be inserted into a suitable expression vector which is used to transform prokaryotic or eukaryotic cells, for example bacteria, yeast, insect cells oi mammalian cells
One of ordinal y skill in the art will appieciate that the DNA can be altered in numeious ways without affecting the biological activity of the encoded protein For example, PCR can be used to pioduce variations in the DNA sequence which encodes an MPPT Such variations in DNA sequence may be used to optimize for codon preference in a host cell used to express the protein, or may contain other sequence changes that facilitate expression
One skilled in the art will understand that the expression vector may further include regulatory elements, such as transcriptional elements, required for efficient tianscπption of the MPPT-encodtng sequences Examples of regulatory elements that can be incorporated into the vector include, but are not limited to, promoters, enhancei s, terminatots, and polyadenylation signals The present invention, therefore, provides vectors compπsing a iegulatory element operatively linked to a nucleic acid sequence encoding a genetically engineered MPPT One skilled in the art will appreciate that selection of suitable iegulatory elements is dependent on the host cell chosen for expression of the genetically engineered MPPT and that such regulatory elements may be det ived from a variety of sources, including bacterial, fungal, viral, mammalian or insect genes In the context of the present invention, the expression vector may additionally contain heterologous nucleic acid sequences that facilitate the purification of the expressed MPPT. Examples of such heterologous nucleic acid sequences include, but are not limited to, affinity tags such as metal-affinity tags, histidme tags, avidm / streptavidm
5 encoding sequences, glutathione-S-transferase (GST) encoding sequences and biotin encoding sequences The amino acids corresponding to expression of the nucleic acids can be removed fiom the exptessed MPFT pπoi to use accoiding to methods known in the art Alternatively, the amino acids coπesponding to expression of heteiologous nucleic acid sequences can be ietained on the MPPT, providing that they
10 do not interfere with the ability of the MPPT to target and kill cytokine ieceptor bearing cells
In one embodiment of the invention, the MPPT is prepared and expressed as a histidine tagged protein The histidme tag can be located at the carboxyl terminus or the amino terminus of the MPPT
15 The expression vectors can be introduced into a suitable host cell or tissue by one of a variety of methods known m the an Such methods can be found generally described in Ausubel et al , Current Protocols in Molecular Biology, Wiley & Sons, NY (1997 and updates), Sambrook et al , Molecular Cloning- A Ixώoiatory Manual, CoId- Spπng Harbor Press, NY (2001) and include, for example, stable or transient
20 transfection, lipofection, electropoiation, and infection with recombinant vital vectors One skilled in the art will understand that selection of the appropriate host cell for expression of the MPP will be dependent upon the vector chosen Examples of host cells include, but are not limited to, bacterial, yeast, insect, plant and mammalian cells
25 In addition, a host cell may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product m a specific, desired fashion Such modifications (e g , glycosylation) and processing (e g , cleavage) of piotein pioducts may be important foi the function of the protein Different host cells have characteristic and specific mechanisms for the post-translational processing and
30 modification of proteins and gene products Appiopπate cell lines oi host systems can be chosen to ensure the correct modification and processing of the foreign protein
49
/ U 6 / Ξ 007 A J>Ξ 1 2 1 ^ 394 - 050S ©r e ce i v e d expressed To this end, eukaryotic host cells (hat possess the cellular macnineiy for pioper processing of the pπmaiy transcript, and for post translational modifications such as glycosylation and phosphoi ylation of the gene product can be used Such mammalian host cells include, but aie not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38
Methods of cloning and expressing proteins arc well-known in fhe art, detailed descriptions of techniques and systems for the expression of recombinant proteins can be found, for example, in Current Protocols in Protein Science (Cohgan, J E , et al , Wiley & Sons, New York) Those skilled in the field of molecular biology will understand that a wide variety of expression systems can be used to provide the iecombinant protein The precise host cell used is not critical to the invention Accoidingly, the present invention contemplates that the MPPTs can be produced vn a piokaryotic host (e g , E coh, A salmonicida or B subtilis) oi in a eukaryotsc host (e g , Saccharomycei oi Pichia, mammalian cells, e g , COS, NIH 3T3, CHO, BHK, 293, or HeLa cells, or msect cells)
The MPPTs can be purified from the host cells by standard techniques known in the ait If desired, the changes in amino acid sequence engineered into the protein can be determined by standard peptide sequencing techniques using either the intact protein or proteolytic fragments thereof As an alternative to a directed appioach to introducing mutations into naturally occurring pore-forming proteins, a cloned gene expressing a pore-forming protein can be subjected to random mutagenesis by techniques known in the art Subsequent expiession and screening of the mutant forms of the protein thus generated would allow the identification and isolation of MPPTs according to the piesent invention
2.2. Other methods of preparing MPPTs
The cytokine receptoi targeting unit and/or additional ARDs, and/oi linkers, may be added to the nPPTs of the present invention via a covalent or non-covalent bond, or both Non-covalent intei actions can be ionic, hydrophobic, or hydrophihc, such as interactions involved in a leucme-zφper or antibody-Piotein G interaction (Derrick et al , Nature 359 752, 1992)
Attachment of a cytokme-ieceptor targeting unit oi ARD to a nPPT may be achieved using methods known in the art Such methods include, for example, covalent linkage of the cytokine-receptoi targeting unit or ARD to the nPPT Foi example, cytokme- receptor taigeting units may be added to the nPPT via covalent crosshnking (see Woo et al , Arch Pharm Res 22(5) 459-63, 1999 and Debmski and Pastan, Chn Cancer Res 1(9) 1015-22, 1995) Crosshnkmg can be non-specific, for example by using d homobifunctional-lysine-reactive crosshnking agent, or it can be specific, for example by using a crosshnking agent that ieacts with amino gioups on the cytokine-receptot targeting unit or ARD and with a cysteine residue located in the nPPT For example, in the proaeiolysin polypeptide, ammo acids Cysl9, Cys75, Cysl59, and/or Cysl64 as noted in SEQ ID NO 2 may be used to crosslink a cytokine receptor targeting unit oi ARD to the proaerolysin polypeptide One or more of the nPPT and cytokine receptor targeting unit (and optional ARD) can have been prepared by recombinant techniques, may be isolated from natural sources, or obtained commercially For example, a numbei of cytokines are commeicially available fiom companies such as BioSource1M (Invitrogen, Carlsbad, CA), Pieice BioTechnology Inc (Rockford, IL) and PreproTech, Inc (Rocky Hill, NI) Alternatively, the covalent linkage may take the form of a disulfide bond Foi example, the DNA encoding one of the components can be engineered to contain a unique cysteine codon oi advantage can be taken of a naturally occmπng cysteine iesidue The second component can be deπvatized with a sulfhydryl group reactive with the cysteine of the first component Alternatively, a sulfhydryl group, either by itself or as pait of a cysteine iesidue, can be introduced using solid phase polypeptide techniques For example, the introduction of sulfhydryl groups into peptides is described by Hiskey (Peptides 3 137, 1981)
Proteins can be chemically modified by standard techniques to add a sulfhydryl gioup For example, Traut's reagent (2-iiτnnothiolane-HCl) (Pierce Chemicals, Rockford 111 ) can be used to introduce a sulfhydryl group on primary amines, such as lysine residues or N-terminal amines A protein or peptide modified with Traut's reagent can then react with a protein or peptide which has been modified with reagents such as N-succinimidyl 3 (2 pyπdyldithio) propionate (SPDP) or succmirmdyl 4-(N-maleιrnidomethyl)cyclohexane-l-carboxylate (SMCC) (Pierce Chemicals, Rockford, III )
Once the correct sulfhydryl groups are present on each component, the two components are purified, sulfur groups on each component are reduced, the components are mixed, and disulfide bond formation is allowed to proceed to completion at room temperature To improve the efficiency of the coupling reaction, the cysteine residue of one of the components, e g , cysteine MPPT, can be activated ptior to addition to the reaction mixture with 5,5 -dithiobis(2-nitiobenzoic) acid (DTNB) or 2,2' duhiopyπdme, using methods known in the art Following the reaction, the mixture is dialyzed against phosphate buffered saline to remove unconjugated molecules Sephadex chiomatogiaphy or the like is then carried out to sepaiate the compound of the invention from its constituent parts on the basis of size MBS-medidted coupling can also be utilised to join the cytokine receptor targeting unit and the nPPT through a c>steme thiol group in either the cytokine receptor tai geting unit oi the nPPT
The components can also be joined using the pol ymer, monomethoxy-polyethylene glycol (mPEG), as desci ibed in Maiti et al , Int J Cancer Suppl 3 17-22, 1988
Other methods of attaching the cytokine targeting unit to the nPPT include the use of binding pairs, one membei of which is attached to or pait of the cytokine targeting unit and the other member of which is attached to or part of the nPPT Various suitable binding pairs are known in the art Non-Jimiting examples include antigen or hapten with antibody, antibody with anti antibody, receptor with ligand, enzyme or enzyme fragment with substrate, substrate analogue or ligand, biotin oi lectin with avidin or streptavidin, lectin with cai bohydrate, digoxin with anti-digoxin, His-tags with Ni2+ ions, pans of leucine zipper motifs (see, for example, U S Patent No 5,643,731), bacitracin with undecaphosphopi eyl pyiophosphate as well as various homodimers and heterodimers known in the art The cytokine receptor targeting unit and the nPPT can also be conjugated through the use of standard conjugation chemistries as is known in the art, such as, carbodπmide- mediated coupling (for example, DCC, EDC or activated EDC), and the use of 2- iminothiolane to convert epsilon ammo groups to thiols for crosshnking and m- maleimidobenzoyl-n-hydroxysuccinimidyl ester (MBS) as a crosshnking agent Various other methods of conjugation known in the art can be employed to join the cytokine targeting unit and the nPPT
2.3. Large Scale Preparation of MPPTs
The prepaiation of the MPPTs can also be conducted on a large scale, for example for manufacturing purposes, using standard techniques known in the art such as large scale fermentation processes for production of recombinant proteins, and ultrafiltration, ion exchange chromatography, immobilized metal ion affinity chromatography for purification of iecombmant proteins
3. Testing of Modified Pore-forming Protein Toxins
The MPPTs accoiding to the piesent invention retain their pore-forming activity and specifically bind to target cytokine receptor bearing cells The ability of the MPPTs according to the piesent invention to selectively target cells can be tested using standaid techniques known m the art Exemplary methods of testing candidate MPPTs are provided below and in the Examples included herein One skilled in the art will undei stand that other methods of testing the compounds are known in the art and are also suitable for testing candidate MPPTs
3 I In vitro methods
MPPTs accoiding to the present invention that comprise one or moie cytokme- ieceptor targeting units can be tested for their ability to specifically bind to target c> tokine receptor bearing cells according to methods known m the art For example, the ability of the candidate MPPTs to specifically bind to the target cytokine receptor bearing cell can be measured in vitro using flow cytometric methods as is known in the art. In general, MPPTs of the present invention can be tested for the ability to specifically bind a target cell by incubating the candidate MPPT with a suitable cell line bearing the targeted cytokine receptor and determining binding by flow cytometry. Alternatively, the binding ability of the candidate MPPT can be quantitated by surface plasmon resonance using standard protocols.
In order to determine if the MPPTs of the present invention retain pore-forming activity, and thus the ability to kill cells, the MPPT can be reacted with the appropriate ρrotease(s) and the reaction products can be tested in a hemolysis assay as is known in the art. An example of a suitable assay is described in Howard, S. P., and Buckley, J.T. (1985). Activation of the hole-forming toxin aerolysin by extracellular processing. J. Bacterid. 163:336-340 (herein incoiporated by reference).
The critical step for some pore-forming proteins, such as aerolysin, is oligomerization which is followed by insertion. MPPTs of the present invention can be tested for their ability to oligomerize using methods known in the art. For example, MPPTs of the present invention can be incubated with a suitable cell-line and the incubation products can be electrophoresed on SDS-PAGE gels. Oligomerization can be assessed by examining the size of the polypeptide on the gel for cell-associated oligomers.
MPPTs according to the present invention can be tested for their ability to kill the targeted cytokine receptor bearing cell, using techniques known in the art. For example, the ability of the MPPTs to kill cells can be assayed in vitro using a suitable cell-line bearing the targeted cytokine receptor. In general, cells of the selected test cell line are grown to an appropriate density and the candidate MPPT is added. After an appropriate incubation time (for example, about 48 to 72 hours), cell survival is assessed. Methods of determining cell survival are well known in the art and include, but are not limited to, the resazurin reduction test (see Fields & Lancaster (1993) Am. Biotechnol. Lab, 11:48-50; O'Brien et al., (2000) Eur. J. Biochem. 267:5421-5426 and U.S. Patent No. 5,501,959), the sulforhodamine assay (Rubinstein et al, (1990) J. Natl. Cancer Inst. 82: 113-118) or the neutral red dye test (Kitano et ai, (1991) Euro J Clin Investg. 21 53-58, West et al , (1992) 7 Investigative Derm 99 95- 100) or trypan blue assay. Numerous commercially available kits may also be used, for example the CellTiter 96® AQueous One Solution CeIL Proliferation Assay (Promega) Cytotoxicity is determined by comparison of cell survival in the treated culture with cell survival in one or more control cultuies, for example, untreated cultuies and/or cultuies comprising a cell line that does not express the targeted cytokine receptor, or other apptopπate control
The cell-line selected for testing the candidate MPPT will depend on the particular cytokine-receptor targeting unit attached to the MPPT The suitable cell-line will display the targeted cytokine teceptor A variety of cell-lines suitable for testing the candidate MPPTs are known m the art and many are commercially available (for example, fiom the American Type Cultuie Collection, Manassas, VA) Examples of suitable cell-lines for in vitro testing include, but are not limited to, the mouse CTLL- 2 and human Hut 78 cell-lines displaying IL-2 receptors, mouse Ba/F3 peripheral blood pio-B cells and human TF/H-Ras acute myeloid leukemia cells displaying IL-3 receptors, head and neck cell line SCC-25, breast carcinoma MDA-MB231, pancreatic cells PANC 1, ovarian cell line PA-I displaying IL-4 receptors, mouse WEHl fibroblast cells displaying TNF-α receptors, human ACC-LC-80 small cell lung cancer cells displaying SCF leceptors, androgen dependent human prostate cancer cells PC3, Dul45, and cd51 displaying IL-17 receptors, and human ienal cell carcinoma cells PN-RCC displaying the IL- 13 receptors
3.2 In vivo methods The ability of the MPPTs of the present invention to kill targeted cells, and/or treat disease, in vivo can be determined m an appropriate animal model using standard techniques known in the art (see, for example, Enna, et al , Current Protocols in Pharmacology, J Wiley & Sons, Inc , New York, NY)
For example, the ability of the MPPTs to treat T-cell dependent autoimmune diseases, such as rheumatoid aτthπtis (RA), multiple sclerosis, (MS) or msulin-dependent diabetes can be tested by administering the MPPT to a suitable animal model Suitable animal models include, foi example, adjuvant-induced arthritis m rats (see Colpdert, F C et al , (1982) Further evidence validating adjuvant arthritis as an experimental model of chronic pain in the rat Life Sci 31 67-75, and Enna et al , supra), experimental allergic encephalttis in guinea pigs (see Dπscoll B F et al , (1976) Protection against experimental allergic encephalomyelitis with pepetides derived from myelin basic protein piesence of intact encephalitogenic site is essential, J Immunol 117 110-114) or othei rodents and the non-obese diabetic (NOD) mouse (see Tochino Y (1987) The NOD mouse as a model of type I diabetes, Cut Rev Immunol 8 49-81)
Cuirent animal models for screening anti-tumor compounds include xenograft models, in which a human tumor has been implanted into an animal Examples of xenogi aft models of human cancer include, but are not limited to, human solid tumor xenografts, implanted by sub cutaneous injection or implantation and used in tumoi growth assays, human solid tumor isogiafts, implanted by fat pad injection and used in tumor giowth assays, human solid tumor orthotopic xenogiafts, implanted directly into the relevant tissue and used in tumor growth assays, experimental models of lymphoma and leukemia in truce, used in suivival assays, and experimental models of lung metastasis in mice In addition to the implanted human tumor cells, the xenograft models can furthei comprise transplanted human peripheral blood leukocytes, which allow for evaluation of the anti-cancer immune iesponse
Alternatively, murine cancer models can be used for screening anti-tumor compounds Examples of appropriate murine cancer models are known in the ait and include, but are not limited to, implantation models in which murine cancer cells are implanted by intravenous, subcutaneous, fat pad or orthotopic injection, murine metastasis models, transgenic mouse models, and knockout mouse models
For example, the MPl1Ts can be tested in vivo on solid tumors using mice that are subcutaneously grafted bilaterally with 30 to 60 mg of a tumor fragment, or implanted with an appropriate number of cancer cells, on day 0 The animals bearing tumors are mixed before being subjected to the various treatments and controls In the case of treatment of advanced tumors, tumors are allowed to develop to the desired size, animals having insufficiently developed tumors being eliminated The selected animals are distributed at random to undergo the treatments and controls Animals not bearing tumors may also be subjected to the same treatments as the tumor-bearing animals in order to be able to dissociate the toxic effect fiom the specific effect on the tumor Chemotherapy generally begins from 3 to 22 days after grafting, depending on the type of tumor, and the animals ate obsei ved every day The MPPTs of the present invention can be administered to the animals, for example, by i p injection, intravenous injection, direct injection into the tumor, or bolus infusion The different animal gioups are weighed about 3 oi 4 times a week until the maximum weight loss is attained, after which the gioups aie weighed at least once a week until the end of the tπal
The tumors are measured after a pre-determined time period, or they can be monitored continuously by measuring about 2 or 3 times a week until the tumor reaches a predetermined size and / or weight, or until the animal dies if this occurs before the tumor reaches the pre-determined size / weight The animals are then sacrificed and the tissue histology, size and / or proliferation of the tumor assessed
Orthotopic xenograft models are an alternative to subcutaneous models and may more accurately reflect the cancel development process In this model, tumor cells are implanted at the site of the organ of oπgm and develop internally Daily evaluation of the size of the tumors is thus more difficult than in a subcutaneous model A recently developed technique using green fluorescent protein (GFP) exptessing tumois in noninvasive whole body imaging can help to address this issue (Yang et al , Pi oc Nat Aca Sa, (2000), pp 1206 1211) This technique utilizes human or murine tumors that stably express very high levels of the Aqueora vitoria green fluorescent protein The GFP expressing tumors can be visualized by means of externally placed video detectors, allowing for monitoring of details of tumor growth, angiogenesis and metastatic spread Angiogenesis can be measured over time by monitoring the blood vessel density within the tumor(s) The use of this model thus allows for simultaneous monitoring of several features associated with tumor progression and has high preclinical and clinical relevance.
For the study of the effect of the compositions on leukemias, the animals are grafted with a particular number of cells, and the anti-tumor activity is determined by the increase in the survival time of the treated mice relative to the controls.
To study the effect of the MPPTs of the present invention on tumor metastasis, tumor cells are typically treated with the composition ex vivo and then injected into a suitable test animal. The spread of the tumor cells from the site of injection is then monitored over a suitable period of time.
In vivo toxic effects of the MPPTs can be evaluated by measuring their effect on animal body weight during treatment and by performing hematological profiles and liver enzyme analysis after the animal has been sacrificed.
Table 5: Examples of xenograft models of human cancer
Figure imgf000060_0001
Figure imgf000061_0001
3 2 1 General toxicity
The general toxicity of the MPPTs according to the present invention can be tested according to methods known m the art Foi example, the overall systemic toxicity of the MPPTs can be tested by determining the dose that kills 100% of mice (i e LDioo) following a single intravenous injection
3.3 Determination and Reduction of Antigenicity
Theiapeutic pioteins may elicit some level of antibody response when adminstered to a subject, which in some cases may lead to undesirable side effects Therefore, if necessary, the antigenicity of the MPFFs can be assessed as known m the art and described below In addition, methods to reduce potential antigenicity aie described The kinetics and magnitude of the antibody response to the MPPTs described herein can be determined, for example, in immunocompetent mice and can be used to facilitate the development of a dosing regimen that can be used in a immunocompetent human. Immunocompetent mice such as the strain C57-BL6 are administered intravenous doses of MPPT. The mice are sacrificed at varying intervals (e.g. following single dose, following multiple doses).
To decrease antigenicity of MPPTs according to the present invention, the native binding domain of the MPPT can be functionally deleted and replaced, for example with an ARD as described above. The antigenicity of such MPPTs can be determined following exposure to varying schedules of the MPPT which lack portions of the native binding domain using the methods described above. Another method that can be used to allow continued treatment with MPPTs is to use sequentially administered alternative MPPTs derived from other nPPTs with non-overlapping antigenicity. For example, an MPPT derived from proaerolysin can be used alternately with an MPPT derived from Clostridium septicum alpha toxin or Bacillus thuringiensis delta-toxin. All of these MPPTs would target cancer cells, but would not be recognized or neutralized by the same antibodies.
Serum samples from these mice can be assessed for the presence of anti-MPPT antibodies as known in the art. As another example, epitope mapping can also be used to determine antigenicity of proteins as described in Marcia M. Stickler, David A. Estell and Fiona A. Harding. CD+ T cell epitope prediction using unexposed human donor peripheral blood mononuclear cells. J. Immunotherapy, 23(6):654-660, 20(X). Briefly, immune cells known as dendritic cells and CD4+ T cells are isolated from the blood of community donors who have not been exposed to the protein of interest. Small synthetic peptides spanning the length of the protein are then added to the cells in culture. Proliferation in response to the presence of a particular peptide suggests that a T cell epitope is encompassed in the sequence. This peptide sequence can subsequently be deleted or modified in the MPPT thereby reducing its antigenicity.
4. Pharmaceutical Compositions
The present invention piovides for pharmaceutical compositions comprising one or more MPPTs and one oi more non-toxic pharmaceutically acceptable carriers, diluents, excipients and/or adjuvants If desired, other active ingiedients may be included in the compositions As indicated above, such compositions aie suitable for use in the treatment of cancer The term "pharmaceutically acceptable carrier" refers to a caπiei medium which does not interfere with the effectiveness of the biological activity of the active ingredients and which is not toxic to the host or patient Representative examples are provided below The pharmaceutical compositions may comprise, for example, from about 1% to about 95% of a MPPT of the invention Compositions formulated for administration in a single dose form may comprise, for example, about 20% to about 90% of the MPPTs of the invention, whereas compositions that aie not in a single dose fotm may comprise, foi example, from about 5% to about 20% of the MPPTs of the invention Concentration of the MPPT in the final formulation can be as low as 001 μg/mL For example, the concentration in the final formulation can be between about 0 01 μg/mL and about 1,000 μg/mL In one embodiment, the concentration in the final formulation is between about 001 μg/mL and about 100 μg/mL Non-limiting examples of unit dose forms include dragees, tablets, ampoules, vials, suppositories and capsules Non-hmiting examples of unit dose forms include dragέes, tablets, ampoules, vials, suppositories and capsules
The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder For solid compositions (e g , powder, pill, tablet, or capsule foims), conventional non toxic solid earners can include, for example, pharmaceutical grades of mannitol, lactose, starch, sodium saccharine, cellulose, magnesium caibonate, or magnesium stearate The composition can be formulated as a suppository, with traditional binders and carriers such as triglyceπdes
For administration to an animal, the pharmaceutical compositions can be formulated for administration by a variety of routes For example, the compositions can be formulated for oial, topical, rectal or paienteial administration or for administration by inhalation or spray The term parenteral as used herein includes subcutaneous injections, intravenous, intramuscular, intrathecal, intiasternal injection or infusion techniques Direct injection or infusion into a tumor is also contemplated Convection enhanced delivery, a standard administration technique for piotein toxins, is also contemplated by the present invention
The MPPTs can be delivered along with a pharmaceutically acceptable vehicle In one embodiment, the vehicle may enhance the stability and/or delivery propeities Thus, the present invention also provides for formulation of the MPPT with a suitable vehicle, such as an artificial membrane vesicle (including a liposome, noisome, nanosome and the like), microparticle or microcapsule, or as a colloidal formulation that compiises a pharmaceutically acceptable polymer The use of such vehicles/polymeis may be beneficial in achieving sustained release of the MPPTs Alternatively, or in addition, the MPPT formulations can include additives to stabilise the protein in vivo, such as human serum albumin, or other stabilisers foi protein therapeutics known in the art MPPT formulations can also include one or tnoie viscosity enhancing agents which act to pi event backflow of the formulation when it is administered, foi example by injection or via catheter Such viscosity enhancing agents include, but are not limited to, biocompatible glycols and sucrose
Pharmaceutical compositions foi oral use can be formulated, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion hard or soft capsules, or syrups or elixirs Such compositions can be prepaied according to standard methods known to the art for the manufacture of pharmaceutical compositions and may contain one or more agents selected from the group of sweetening agents, flavoring agents, colouring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations Tablets contain the active ingredient in admixtuie with suitable non-toxic pharmaceutically acceptable excipients including, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate, gi anulating and disintegrating agents, such as corn starch, or alginic acid; binding agents, such as starch, gelatine or acacia, and lubricating agents, such as magnesium stearate, stearic acid or talc The tablets can be uncoated, or they may be coated by known techniques in order to delay disintegration and absorption m the gastrointestinal tract and thereby provide a sustained action over a longer period For example, a time delay material such as glyceiyl monostearate or glyceryl distearate may be employed
Pharmaceutical compositions for oial use can also be presented as haid gelatine capsules wheiein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatine capsules wheiein the active ingredient is mixed with water 01 an oil medium such as peanut oil, liquid paraffin 01 olive oil
Pharmaceutical compositions formulated as aqueous suspensions contain the active comρound(s) in admixtuie with one oi more suitable excipients, foi example, with suspending agents, such as sodium carboxymethylcellulose, methyl cellulose, hydropi opylmethylcellulose, sodium alginate, polyvinylpyirohdone, hydroxypropyl- β-cyclodextπn, gum tiagacanth and gum acacia, dispersing or wetting agents such as a naturally occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example, polyoxyethyene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example, hepta-decaethjleneoxycetanol, or condensation products of ethylene oxide with paitial esters derived fiom fatty acids and a hexitol for example, polyoxyethylene sorbitol monooleate, oi condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example, polyethylene sorbitan monooleate The aqueous suspensions may also contain one or more preservatives, foi example ethyl, or n propyl p hydtoxy-ben_x>ate, one or more colouring agents, one or moie flavonng agents or one or more sweetening agents, such as sucrose or saccharin Phaimaceutical compositions can be foimulated as oily suspensions by suspending the active compound(s) in a vegetable oil, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin The oily suspensions may contain a thickening agent, for example, beeswax, hard paraffin or cetyl alcohol Sweetening agents such as those set forth above, and/or flavoring agents may be added to provide palatable oral pieparations These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid The pharmaceutical compositions can be formulated as a dispeisible powder 01 gianules, which can subsequently be used to prepare an aqueous suspension by the addition of water Such dispersible powders or granules provide the active ingredient in ddmixtuie with one or more dispersing or wetting agents, suspending agents and/or preservatives Suitable dispeising or wetting agents and suspending agents aie exemplified by those already mentioned above Additional excipients, for example, sweetening, flavoring and coloring agents, can also be included in these compositions
Pharmaceutical compositions of the invention can also be formulated as oil-in-water emulsions The oil phase can be a vegetable oil, for example, olive oil or arachis oil, or a mineral oil, for example, liquid paraffin, or it may be a mixture of these oils Suitable emulsifying agents for inclusion m these compositions include naturally- occurring gums, for example, gum acacia oi gum tragacanth, naturally-occurring phosphatides, for example, soy bean, lecithin, or esters ot partial esteis derived from fatty acids and hexitol, anhydrides, for example, sorbitan monoleate, and condensation products of the said paitial esters with ethylene oxide, for example, polyoxyethylene sorbitan monoleate The emulsions can also optionally contain sweetening and flavoring agents
Pharmaceutical compositions can be formulated as a syiup or elixir by combining the active ingredient(s) with one oi mote sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose Such formulations can also optionally contain one or more demulcents, preservatives, flavoring agents and/or coloring agents
The pharmaceutical compositions can be formulated as a sterile injectable aqueous or oleaginous suspension according to methods known in the art and using suitable one or more dispeising or wetting agents and/or suspending agents, such as those mentioned above The sterile injectable preparation can be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol Acceptable vehicles and solvents that can be employed include, but aie not limited to, water, Ringer's solution, lactated Ringer's solution and isotonic sodium chloride solution Other examples include, sterile, fixed oils, which are conventionally employed as a solvent or suspending medium, and a vanety of bland fixed oils including, for example, synthetic mono- or diglyceπdes Fatty acids such as oleic acid can also be used in the preparation of iηjectables
In one embodiment, the MPPT is conjugated to a water-soluble polymer, e g , to increase stability or cπculating half life oi reduce immunogenicity Clinically acceptable, water-soluble polymeis include, but are not limited to, polyethylene glycol (PEG), polyethylene glycol propionaldehyde, carboxymethylcellulose, dextran, polyvinyl alcohol (PVA), polyvinylpyi rohdone (PVP), polypropylene glycol homopolymers (PPG), polyoxyethylated polyols (POG) (e g , glycerol) and other polyoxyethylated polyols, polyoxyethylated sorbitol, or polyoxyethylated glucose, and othei caibohydrate polymers Methods for conjugating polypeptides to water soluble polymeis such as PEG are described, e g , in U S patent Pub No 20050106148 and references cited therein
Other pharmaceutical compositions and methods of preparing pharmaceutical compositions are known in the art and are described, for example, in "Remington The Science and Practice of Pharmacy" (formerly "Remingtons Pharmaceutical Sciences"), Gennaro, A , Lφpincott, Williams & Wilkms, Philidelphia, PA (2000)
The pharmaceutical compositions of the present invention described above include one or more MPPTs of the invention m an amount effective to achieve the intended purpose Thus the teim "therapeutically effective dose" refers to the amount of the MPPT that amehoiates the symptoms of cancel Determination of a therapeutically effective dose of a compound is well within the capability of those skilled in the art For example, the therapeutically effective dose can be estimated initially either in cell culture assays, or in animal models, such as those descπbed herein Animal models can also be used to determine the appropriate concentration range and route of administration Such information can then be used to determine useful doses and routes for administration m other animals, including humans, using standard methods known m those of ordinary skill in the ait
Theiapeutic efficacy and toxicity can also be determined by standard pharmaceutical proceduies such as, for example, by determination of the median effective dose, oi ED5O 0 e the dose therapeutically effective in 50% of the population) and the median lethal dose, or LD50 0 e the dose lethal to 50% of the population) The dose ratio between therapeutic and toxic effects is known as the "therapeutic index," which can be expressed as the ratio, LD50/ED50. The data obtained from cell culture assays and animal studies can be used to formulate a range of dosage for human or animal use. The dosage contained in such compositions is usually within a range of concentrations that include the ED50 and demonstrate little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the subject, and the route of administration and the like.
The exact dosage to be administered to a subject can be determined by the practitioner, in light of factors related to the subject requiring treatment. Dosage and administration are adjusted to provide sufficient levels of the MPPT and/or to maintain the desired effect. Factors which may be taken into account when determining an appropriate dosage include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Dosing regimens can be designed by the practitioner depending on the above factors as well as factors such as the half-life and clearance rate of the particular formulation.
5. Use of Modified Pore-forming Toxins 5./ Therapeutic use
The MPPTs of the present invention can be used to treat, stabilize or prevent a disease or disorder, or other conditions characterized by the presence of a class of unwanted cells bearing a cytokine receptor and/or by proliferation of cytokine receptor bearing cells. The invention thus provides a method of lysing unwanted cells in a mammal, which cells have on their surfaces a receptor for a cytokine, by administering to the mammal an effective amount of a MPPT. The unwanted cells can be, for example, lymphocytes, i.e., T-lymρhocytes or B-lymphocytes, or cancer cells.
In one embodiment, the invention provides for the use of the MPPTs to lyse T- lymphocytes, which are the cell type primarily responsible for causing rejection of allografts (e.g., transplanted organs such as the heart). As is known in the art, T- lymphocytes (killer and helper) respond to allografts by undergoing a proliferative but st characterized by the transitory presence on the T-iymphocyte sui faces of IL-2 receptors Killing these cells by the administiation, during the proliferative burst, of a MPPT thus attenuates allograft rejection, and also advantageously fails to adversely affect other cells (including resting or long-term memory T-lymphocytes needed for fighting infections), since these othei cells do not bear IL 2 receptors
The use of MPPTs targeted to other cytokine ieceptors on T-lymphocytes such as IL- 7 (see Plum, J , et al , (1996) Interleukin-7 is a critical growth factor in early T-cell development Blood 88 4239-4245), IL 4 (Dokter, W H . ef al , (1992) Interleukin-4 (see IL-4) ieceptoi expression on human T-cells is affected by intracellular signalling pathways and at IL-4 transcriptional and post-transcπptional level Blood 80 2721- 2728), and IL-21 (see Nutt, S L , Brady, J , Hayakawa, Y , and Smyth, M J (2004) Interleukin 21 is a key player in lymphocyte maturation Cπt Rev Immunol 24 239- 250), enables othei theiapeutic applications for T-cell associated diseases Such T- cell-associated diseases include, for example, arthntis, T-cell lymphoma, skin cancers, psoπasis, multiple sclerosis, Type II diabetes melhtus, and diseases resulting from HIV infection
Further examples of conditions that may be tieated or stabilized in accordance with the pjesent invention include, but are not limited to, T cell dependent autoimmune diseases such as, rheumatoid arthritis, multiple sclerosis, and insulin-dependent diabetes melhtus, and cancer The MPPTs can also be used for selective elimination of unwanted cells such as regulatory T-lymphocytes, or pluπpotent hematopoetic stem cells and lineage committed progenitors prior to bone maπow grafting
With respect to the treatment of cancej, treatment with the MPPTs may result m, for example, a reduction in the size of a tumor, the slowing or prevention of an increase in the size of a tumor, an increase in the disease free survival time between the disappearance or removal of a tumor and its reappearance, prevention of an initial or subsequent occuirence of a tumor (e g metastasis), an inciease in the time to progression, reduction of one or moie adverse symptom associated with a tumor, or an inciease in the oveiall survival time of a subject having cancer
61 Examples of cancers which may be tieated or stabilized in accordance with the present invention include, but are not limited to, leukemia, lymphoma, solid human tumors, head and neck cancer, pancreatic cancer, ovarian cancer, glioblastoma, non small cell lung cancer, renal cell carcinoma, ovarian cancer, acute myeloid leukemia, andiogen dependent prostate cancer, and small cell lung cancel
The term "leukemia" refers broadly to progressive, malignant diseases of the blood- forming organs Leukemia is typically characterized by a distorted proliferation and development of leukocytes and their precursois in the blood and bone marrow but can also refer to malignant diseases of other blood cells such as erythroleukemia, which affects immature red blood cells Leukemia is generally clinically classified on the basis of (1) the duration and chaiacter of the disease - acute or chronic, (2) the type of cell involved - myeloid (myelogenous), lymphoid (lymphogenous) or monocytic, and (3) the increase or non-increase in the number of abnormal cells m the blood - leukdemic or aleukaemic (subleukaemic) Leukemia includes, foi example, acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocyte leukemia, adult T-cell leukemia, aleukaemic leukemia, aleukocythemic leukemia, basophylic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, hairy-cell leukemia, hemoblastic leukemia, hemocytoblastic leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosaicoma cell leukemia, mast cell leukemia, megakaryocyte leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblasts leukemia, myelocytic leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia, Naegeh leukemia, plasma cell leukemia, plasmacytic leukemia, promyelocyte leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemic leukemia, and undifferentiated cell leukemia
The term "lymphoma" geneially refers to a malignant neoplasm of the lymphatic system, including cancer of the lymphatic system The two main types of lymphoma are Hodgkin's disease (HD or HL) and non-Hodgkin's lymphoma (NHL) Abnormal cells appeal as congregations which enlarge the lymph nodes, form solid tumors in the body, or more larely, like leukemia, circulate in the blood Hodgkin's disease lymphomas, include nodular lymphocyte predominance Hodgkin's lymphoma, classical Hodgkin's lymphoma, nodular scleiosis Hodgkin's lymphoma, lymphocyte rich classical Hodgkin's lymphoma, mixed cellulaiity Hodgkin's lymphoma, lymphocyte depletion Hodgkin's lymphoma Non-Hodgkm's lymphomas include small lymphocytic NHL, follicular NHL, mantle cell NHL, mucosa-associated lymphoid tissue (MALT) NHL, diffuse large cell B cell NHL, mediastinal large B- cell NHL, precursor T lymphoblastic NHL, cutaneous T-cell NHL, T-cell and natural killer cell NHL, mature (peπpheial) T-ce!l NHL, Burkitt's lymphoma, mycosis fungoides, Sόzary Syndrome, precursor B-lymophoblastic lymphoma, B-cell small lymphocytic lymphoma, Iymphoplasmacytic lymphoma, spenic marginal zome B-cell lymphoma, nodal marginal zome lymphoma, plasma cell myeloma/plasmacytoma, mtravasculai large B-cell NHL, primary effusion lymphoma, blastic natural killer cell lymphoma, enteropathy-type T-cell lymphoma, hepatosplenic gamma-delta T cell lymphoma, subcutaneous panniculitis-hke T-cell lymphoma, angioimmunoblastic T cell lymphoma, and primary systemic anaplastic large T/null cell lymphoma
In accoi dance with the piesent invention, the MPPTs can be used to treat various stages and grades of cancer development and progression The present invention, therefore, contemplates the use of the MPPTs in the treatment of early stage cancers including eaily neoplasias that may be small, slow growing, localized and/or nonaggressive, for example, with the intent of curing the disease or causing regression of the cancer, as well as in the treatment of intermediate stage and in the treatment of late stage cancers including advanced and/or metastatic and/or aggressive neoplasms, for example, to slow the progression of the disease, to reduce metastasis or to increase the survival of the patient Similarly, the MPPTs may be used in the treatment of low grade cancers, intermediate grade cancers and oi high grade cancers
The present invention also contemplates that the MPPTs can be used in the tteatment of indolent cancers, recurrent cancers including locally recurrent, distantly recurrent and/or refractory cancers (i.e. cancers that have not responded to treatment), metastatic cancers, locally advanced cancers and aggressive cancers. Thus, an "advanced" cancer includes locally advanced cancel and metastatic cancer and refers to overt disease in a patient, wherein such overt disease is not amenable to cure by local modalities of treatment, such as surgery or radiotherapy. The term "metastatic cancer" refeis to cancer that has spread from one part of the body to another Advanced cancers may also be unresectable, that is, they have spread to surrounding tissue and cannot be surgically removed.
One skilled in the art will appreciate that many of these categories may overlap, for example, aggressive cancers are typically also metastatic. "Aggressive cancer," as used herein, refers to a rapidly growing cancer. One skilled in the art will appreciate that for some cancers, such as breast cancer or prostate cancer the term "aggressive cancer" will refer to an advanced cancer that has relapsed within approximately the eailier two-thirds of the spectrum of relapse times for a given cancer, whereas for other types of cancel, such as small cell lung carcinoma (SCLC) nearly all cases present rapidly growing canceis which are considered to be aggressive. The term can thus cover a subsection of a certain cancer type or it may encompass all of other cancer types
The MPPTs may also be used to treat diug iesistant cancers, including multidrug resistant tumors. As is known in the art, the resistance of cancer cells to chemotherapy is one of the central problems m the management of cancer.
Certain cancers, such as prostate and breast cancer, can be treated by hormone therapy, i e. with hormones or anti-hormone drugs that slow or stop the growth of certain cancels by blocking the body's natural hormones. Such cancers may develop resistance, or be intrinsically resistant, to hormone therapy. The present invention further contemplates the use of the MPPTs in the treatment of such "hormone- resistant " or "hormone-refractory" cancers
Thus, the present invention contemplates the administration to a subject of a theiapeuticdlly effective amount of one or more MPPTs together with one or more anti-cancer therapeutics The compound(s) can be administered before, during or after treatment with the anti-cancer theiapeutic An "anti cancer therapeutic" is a compound, composition or treatment that prevents or delays the growth and/or metastasis of cancer cells Such anti cancer therapeutics include, but are not limited to, chemotherapeutic drug treatment, radiation, gene therapy, hormonal manipulation, immunotheiapy and antisense oligonucleotide theiapy Examples of useful chemotherapeutic drugs include, but are not limited to, hydroxyuiea, busulphan, cisplatin, caiboplatin, chlorambucil, meiphalan, cyclophosphamide, Ifosphamide, danorubicin, doxorubicin, epirubicin, mitoxantrone, vincristine, vinblastine, Navelbine© (vmorelbme), etoposide, temposide, pachtaxel, docetaxel, gemcitabine, cytosme, arabinoside, bleomycin, neocarcinostatin, suiamm, taxol, mitomycin C and the like The compounds of the invention are also suitable for use with standard combination therapies employing two or more chemotherapeutic agents It is to be understood that anti-cancer therapeutics for use in the present invention also include novel compounds oi treatments developed in the future
5.2 Administration The MPPTs can be administered systemically to patients, foi example, by bolus injection oi continuous infusion into a patient's bloodstream, or they can be administered locally, foi example at the site of a tumor (intratumorally) When used in conjunction with one or more known therapeutic agents, the compounds can be administered pπoi to, or after, administration of the therapeutic agents, or they can be administered concomitantly The one or more therapeutics may be administered systemically, foi example, by bolus injection or continuous infusion, or they may be administered orally
If necessary to reduce a systemic immune response to the MPPTs, immunosuppressive therapies can be administered m combination with the MPPTs Examples of immunosuppressive theiapies include, but are not limited to, systemic or topical corticosteioids (Suga et al , Ann Thorac Surg 73 1092-7, 2002), cyclosporin A (Fang et al , Hum Gene Ther 6 1039-44, 1995), cyclophosphamide (Smith et al , Gene Ther 3 496-502, 1996), deoxyspergualm (Kaplan et al , Hum Gene Ther
8 1095-1104, 1997) and antibodies to T and/ot B cells [e g anti-CD40 hgand, anti CD4 antibodies, anti-CD20 antibody (Rituximab)] (Manning et al , Hum Gene Ther
9 477-85, 1998) Such agents can be administered before, dunng, or subsequent to administration of MPPTs according to the present invention)
In the treatment of cancel, the MPPTs may be used as part of a neo-adjuvant therapy (to primary theiapy), as part of an adjuvant theiapy regimen, where the intention is to cure the cancer in a subject The piesent invention contemplates the use of the MPPTs at various stages in tumoi development and piogression, including m the tieatment of advanced and/or aggressive neoplasias (ι e overt disease in a subject that is not amenable to cure by local modalities of treatment, such as surgery or radiotheiapy), metastatic disease, locally advanced disease and/or iefractory tumors (ι e a cancer or tumor that has not responded to treatment)
"Primary therapy" refers to a first line of treatment upon the initial diagnosis of cancer in a subject Exemplary primary theiapies may involve surgeiy, a wide range of chemotherapies and radiotherapy "Adjuvant therapy" refers to a therapy that follows a primary therapy and that is administered to subjects at risk of relapsing Adjuvant systemic therapy is begun soon after primary therapy to delay recurrence, prolong smvival oi cure a subject
It is contemplated that the compounds of the invention can be used alone oi in combination with one or more other chemotherapeutic agents as part of an adjuvant therapy Combinations of the MPPTs and standard chemotherapeutics may act to improve the efficacy of the chemotherapeutic and, theiefore, can be used to improve standaid cancer therapies This application is particularly important in the treatment of diug resistant cancers which are not responsive to standard treatment Drug-resistant cancels can arise, for example, from heterogeneity of tumor cell populations, alterations in response to chemotherapy and increased malignant potential Such changes are often more pronounced at advanced stages of disease and have, in part, as an underlying cause, changes in genome/message stability.
The dosage to be administered is not subject Io defined limits, but it will usually be an effective amount. It will usually be the equivalent, on a molar basis of the pharmacologically active free form produced from a dosage formulation upon the metabolic release of the active free drug to achieve its desired pharmacological and physiological effects. The compositions may be formulated in a unit dosage form. The term "unit dosage form" refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient. The unit dosage forms may be administered once or multiple unit dosages may be administered, for example, throughout an organ, or solid tumor. Examples of ranges for the compound(s) in each dosage unit are from about 0.005 to about 100 mg, or more usually, from about 1.0 to about 30 mg.
Daily dosages of the compounds of the present invention will typically fall within the range of about 0.01 to about 100 mg/kg of body weight, in single or divided dose. However, it will be understood that the actual amount of the compound(s) to be administered will be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound administered, the age, weight, and response of the individual patient, and the severity of the patient's symptoms. The above dosage range is given by way of example only and is not intended to limit the scope of the invention in any way. In some instances dosage levels below the lower limit of the aforesaid range may be more than adequate, while in other cases still larger doses may be employed without causing harmful side effects, for example, by first dividing the larger dose into several smaller doses for administration throughout the day.
5.5. Other uses The invention also provides for the use of the MPPTs as diagnostic reagents, for example, for detection of cancerous cells, or proliferation of other cytokine-receptor bearing cells, and as laboratory reagents In this context, the MPPT can be labeled with one or mo:e detectable labels A "detectable label" is a molecule or moiety a propeity or characteristic of which can be detected diiectly or indirectly Examples of detectable labels include, but are not limited to, radioisotopes (e g , 3H, 14C, 1^S, 125I, 131I), fluorescent labels (e g , FITC, rhodanune, lanthanide phosphois, fluorescein isothiocyanate, phycoerytheπn, phycocyanm, allophycocyanin, o-phthaldehyde, fluoiescamsne, and commeicially avalailable fluorophores such as Alexa Fluor 350, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647, and BODIPY dyes such as BODIPY 493/503, BODIPY FL, BODIPY R6G, BODIPY 530/550, BODIPY TMR, BODIPY 558/568, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY TR, BODIPY 630/650, BODIPY 650/665, Cascade Blue, Cascade Yellow, Dansyl, hssamine rhodamme B, Manna Blue, Oregon Green 488, Oiegon Green 514, Pacific Blue, ihodamine 6G, rhodamme green, rhodamine ied, tetramethyhhodamme and Texas Red), enzymatic labels (for example, horseiadish pet oxidase, β-galactosidase, β-lactamase, alkaline phosphatase), chermluminescent gioups (for example, luminol, isoluminol, an acπdmium ester, an acπdinium sulphonamide, a phenanthπdmium, a 1,2-dioxetane, an imidazole, an acπdmium salt and oxalate estei s), bioluminescent groups (foi example, lucifeπn, luciferase and aequoπn), paramagnetic labels (for example, chromium (FII), manganese (II), manganese (III), iron (II), iron (III), cobalt (II), nickel (II), copper (II), praseodymium (III), neodymium (III), samarium (III), gadolinium (III), terbium (III), dysprosium (III), holmmm (III), erbium (III) and ytterbium (III)) which can be detected by MRI), predetermined polypeptide sequences iecognised by a secondary repoHer (for example, leucine zipper pair sequences, binding sites for secondaiy antibodies, metal binding domains, epitope tags), colloidal particles, fluoiescent microparticles, intercalating dyes such as SYBR gieen or ethidium bromide, and the like One skilled in the art will undei stand that detectable labels may require additional components, such as substrates, triggering reagents, light, and the like to enable detection of the label In some embodiments, detectable labels are attached by spacer arms of various lengths to reduce potential steπc hindrance Methods of labelling proteins are well-known in the art
6. Gene Therapy
The MPPTs according to the present invention, may also be employed in accordance with the present invention by expression of such proteins in vivo, which is often referred to as "gene therapy "
Thus, foi example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding an MPPT ex vivo, with the engineeied cells then being provided to a patient to be treated with the polypeptide Such methods are well- known in the art For example, cells may be engineered by procedures known in the art by use of a tetroviral particle containing RNA encoding an MPPT or a biologically active fragment thereof
Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo using pioceduies known in the art As known in the art, a pioducer cell for producing a retroviral particle containing RNA encoding an MPPT, or a biologically active fragment thereof, may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo These and other methods for administering MPPTs by such methods should be apparent to those skilled in the art from the teachings of the piesent invention For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable dehveiy vehicle
Retroviruses, fioin which the retroviral plasmid vectors hereinabove mentioned, may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovπ us, Myeloproliferative Sarcoma Virus, and mammary tumor virus In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and β-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase
(TK) promoters, and B 19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
The nucleic acid sequence encoding the MPPTs of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; oτ heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viτal thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described); the β-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the genes encoding the MPPTs.
The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP+E-86, GP+envAm l2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPCU precipitation In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or PTH to a lipid, and then administered to a host
The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides Such retroviral vector panicles then may be employed, to transduce eukaryotic cells, eithei in vitro or in vivo The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide Eukaiyotic cells which may be transduced include, but aie not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepαtocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bionchial epithelial cells
7. Clinical Trials One skilled in the art will appreciate that, following the demonstrated effectiveness of MPPTs in vitro and in animal models, MPPTs should be tested m Clinical Trials in order to furthei evaluate their efficacy in the treatment of the particular disease and to obtain regulatory appioval foi therapeutic use As is known in the art, clinical trials progress through phases of testing, which are identified as Phases I, II, III, and IV
Initially MPPTs will be evaluated in a Phase I trial Typically Phase I trials are used to determine the best mode of administration (for example, by pill or by injection), the frequency of administration, and the toxicity foi the compounds Phase I studies fiequently include laboratory tests, such as blood tests and biopsies, to evaluate the effects of a compound in the body of the patient For a Phase I trial, a small group of patients JS tieated with a specific dose of MPPTs During the trial, the dose is typically inci eased gioup by group in Older to determine the maximum tolerated dose (MTD) and the dose-limiting toxicities (DLT) associated with the compound This piocess determines an appropriate dose to use in a subsequent Phase II trial
A Phase II trial can be conducted to further evaluate the effectiveness and safety of MPPTs. In Phase II trials, an MPPT is administered to groups of patients using the dosage found to be effective in Phase I tπais.
Phase III trials focus on determining how a compound compares to the standard, or most widely accepted, treatment. In Phase III trials, patients are randomJy assigned to one of two or more "arms". In a trial with two arms, for example, one arm will receive the standard treatment (control group) and the other arm will receive MPPT treatment (investigational group).
Phase IV trials are used to further evaluate the long-term safety and effectiveness of a compound. Phase IV trials are less common than Phase I, II and III trials and will take place after the MPPT has been approved for standard use.
7.1 Eligibility of patients for Clinical Trials
Participant eligibility criteria can range from general (for example, age, sex, type of disease) to specific (for example, type and number of prior treatments, disease characteristics, blood cell counts, organ function). Eligibility criteria may also vary with trial phase. For example, in Phase I and II trials, the criteria often exclude patients who may be at risk from the investigational treatment because of abnormal organ function or other factors. In Phase II and III trials additional criteria are often included regarding disease type and stage, and number and type of prior treatments.
Phase I trials usually comprise 15 to 30 participants for whom other treatment options have not been effective. Phase II trials typically comprise up to 100 participants who have already received treatment, but for whom the treatment has not been effective. Participation in Phase II trials is often restricted based on the previous treatment received. Phase HI trials usually comprise hundreds to thousands of participants. This large number of participants is necessary in order to determine whether there are true differences between the effectiveness of MPPTs and the standard treatment. Phase III may comprise patients ianging from those newly diagnosed with the disease to those with extensive disease in order to covet the disease continuum
One skilled in the art will appreciate that clinical trials should be designed to be as inclusive as possible without making the study population too diverse to determine whether the treatment might be as effective on a more narrowly defined population The more diverse the population included in the trial, the more applicable the results could be to the geneiai population, particulaily in Phase III trials Selection of appropriate paiticipants in each phase of clinical trial is considered to be within the ordinary skills of a worker in the art
7.2 Assessment of patients prior to treatment
Prior to commencement of the study, several measures known in the art can be used to first classify the patients Patients can first be assessed, for example, using the Eastern Cooperative Oncology Gtoup (ECOG) Performance Status (PS) scale ECOG PS is a widely accepted standard for the assessment of the progression of a patient's disease as measured by functional impairment in the patient, with ECOG PS 0 indicating no functional impairment, ECOG PS 1 and 2 indicating that the patients have progressively gieatei functional impairment but are still ambulatory and ECOG PS 3 and 4 indicating progressive disablement and lack of mobility
Patients' overall quality of life can be assessed, for example, using the McGiIl Quality of Life Questionnaire (MQOL) (Cohen et al (1995) Palliative Medicine 9 207-219) The MQOL measures physical symptoms, physical, psychological and existential well-being, support, and overall quality of life To assess symptoms such as nausea, mood, appetite, insomnia, mobility and fatigue the Symptom Distress Scale (SDS) developed by McCoikle and Young ((1978) Cancer Nursing 1 373-378) can be used
Patients can also be classified according to the type and/or stage of their disease
73 Administration of MPPTs in Clinical Trials MPPTs are typtcally administeted to the trial participants parenterally In one embodiment, MPPTs are administered by intravenous infusion In another embodiment, MPPTs aie administered intratumorally Methods of administering drugs by intiavenous infusion are known in the ait Usually intravenous infusion takes place over a certain time period, for example, ovei the comse of 60 minutes
A range of doses of MPPTs can be tested An exemplary dose range for MPPT treatment includes dosages in the range 2 5 mg/m2 to 30 mg/m
7.4 Pharmacokinetic monitoring
To fulfill Phase I criteria, distribution of the MPPTs is monitored, for example, by chemical analysis of samples, such as blood or urine, collected at iegular intervals For example, samples can be taken at regular intervals up to until about 72 hours after the start of infusion In one embodiment, samples are taken at 0, 0 33, 0 67, 1, 1 25, 1 5, 2, 4, 6, 8, 12, 24, 48 and 72 hours after the start of each infusion of MPPTs
If analysis is not conducted immediately, the samples can be placed on dry ice after collection and subsequently transported to a freezer to be stored at -70 0C until analysis can be conducted Samples can be prepared for analysis using standard techniques known in the art and the amount of MPPTs piesent can be determined, for example by high-performance liquid chiomatography (HPLC)
Pharmacokinetic data can be generated and analyzed in collaboration with an expert chnical pharmacologist and used to determine, for example, clearance, half life and maximum plasma concentration
75 Monitoring of Patient Outcome
The endpoint of a clinical tπal is a measurable outcome that indicates the effectiveness of a compound under evaluation The endpoint is established prior to the commencement of the trial and will vary depending on the type and phase of the clinical trial Examples of endpoints include, fot example, tumor response rate - the proportion of trial participants whose tumor was reduced in size by a specific amount, usually described as a percentage; disease-free survival - the amount of time a participant survives without cancer occurring or recurring, usually measured in months; overall survival - the amount of time a participant lives, typically measured from the beginning of the clinical trial until the time of death. For advanced and/or metastatic cancers, disease stabilization - the proportion of trial participants whose disease has stabilized, for example, whose tumor(s) has ceased to grow and/or metastasize, can be used as an endpoint. Other endpoints include toxicity and quality of life.
Tumor response rate is a typical endpoint in Phase II trials in the case of cancer. However, even if a treatment reduces the size of a participant's tumor and lengthens the period of disease-free survival, it may not lengthen overall survival. In such a case, side effects and failure to extend overall survival might outweigh the benefit of longer disease-free survival. Alternatively, the participant's improved quality of life during the tumor-free interval might outweigh other factors. Thus, because tumor response rates are often temporary and may not translate into long-term survival benefits for the participant, response rate is a reasonable measure of a treatment's effectiveness in a Phase II trial, whereas participant survival and quality of life are typically used as endpoints in a Phase IH trial.
8- Kits
The present invention additionally provides for therapeutic kits or packs containing one or more of the MPPTs or a pharmaceutical composition comprising one or more of the MPPTs for use in the treatment of a disease. Individual components of the kit can be packaged in separate containers, associated with which, when applicable, can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human or animal administration. The kit can optionally further contain one or more other therapeutic agents for use in combination with the MPPTs of the invention. The kit may optionally contain instructions or directions outlining the method of use or dosing regimen for the MPPTs and/oi additional therapeutic agents
Diagnostic kits comprising one or more MPPT are also provided for The MPPT(s) provided in the diagnostic kit can incorporate a detectable label or the kit may include reagents for labeling the MPPT(s)
When the components of the kit are provided in one or more liquid solutions, the liquid solution can be an aqueous solution, for example a sterile aqueous solution In this case the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the composition may be administered to a patient or applied to and mixed with the othet components of the kit
The components of the kit may also be provided in dried or lyophihzed form and the kit can additionally contain a suitable solvent for reconstitution of the lyophilized components Irrespective of the numbei or type of containers, the kits of the invention also may comprise an instrument for assisting with the administration of the composition to a patient Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye-dropper or similar medically appioved delivery vehicle
The invention will now be described with refeience to specific examples It will be understood that the following examples are intended to describe embodiment1! of the invention and are not intended to limit the invention in any way
EXAMPLES
EXAMPLE 1: PRODUCTION OF IL-2 MPPTs
Histidine tagged MPPTs comprising an IL-2 targeting unit were prepared as described below
1.1. ΪL-2-uPA-PA A histidme-tagged MPPT, IL-2-uPA-PA, which comprises a naturally occurπng proaerolysin polypeptide with an IL-2 taigettng unit attached to the N-terminus via a six amino acid linker cleavable by uPA and by trypsin, was prepared as follows (Figuie 5) This MPPT also contains the pioaerolysm signal sequence The nucleotide sequence of this IL-2 MPPT is shown m Figure 21 (SEQ ID NO 34) and the amino acid sequence of this IL-2 MPPT is shown in Figure 22 (SEQ ID NO 35)
The gene encoding PA with a His-tag (containing 6 histidines) at its N-terminus was prepared by insetting 6 codons (CAT) at the 3" end of the gene by two rounds of site- directed mutagenesis using a Quick Change Site-Directed mutagenesis kit
(Stratdgene), and two pairs of primers
EndHislfwd GTTGCCAATCAACATCATCATTAACGGCAGCGC [SEQ ID NO
5], EndHislrev GCGCTGCCGTTAAATGATGATGTTGATTGGCAGC [SEQ ED
NO 6], and EndHis2fwd GCCAATCAACATCATCATCATCATCATTAACGGCAGCGC [SEQ ID NO 7J,
EndHis2rev GCGCTGCCGTTA ATGATG ATG ATGATGATGTTGATTGGC [SEQ
ID NO 8] and the wt aerA gene cloned in pTZ18U cloning vector as a template The resulting plasmid was named pPA-Hό
To accommodate the codon usage preferences of Aeromonas sp , two codons for GIy
(G27, G88) in the gene coding for human IL 2, GenBank™ Accession No XOl 586,
(GGA) were changed to GGC preferred by Aeromonas Two rounds of site-directed mutagenesis were performed using Quick Change Site-Directed mutagenesis kit, and two pan s of primers
G27 fwd TGGATTrACAGATGATTTTGAATGGCATTAATAATTACAAGAATCCC
LSEQ ID NO 9],
G27rev GGGATTCTTGTAATTATTAATGCCATTCAAAATCATCTGTAAATCC AGC [SEQ ID NO 10], and
G88fwd GTTCTGGAACTAAAGGGCTCTGAAACAACATTCATG TGTG [SEQ
ID NO 11], G88rev: TTCACACATGAATGTTGTTTCAGAGCCCTTTAGTTCCAGAAC [SEQ ID NO: 12] and plasmid pGEMl containing the gene for human interleukin-2 (hIL-2) as a template according to manufacturer's instructions. The resulting plasmid was named pNIL2.
A DNA fragment containing the gene for hIL-2 (amino acids 2-131) with part of the signal sequence (SS) of aerolysin at the 5'-end and a six amino acid linker at the 3'- end was prepared by PCRl using the primers: PSLfwd: CAAGCGGCAGAGCCTACTTCAAGTTC [SEQ ID NO: 13]; and
UPArev. TTGAGCACTACGGCCTGATGTTGAGATGATGC [SEQ ID NO: 14], with the plasmid pNIL2 as a template.
The DNA fragment containing the SS of aerolysin with the part of the hIL-2 gene at the 3 ' -end was prepared by PCR2 using the primers: pUCfwd: GGGTAACGCCAGGGTTTTCCCAGTCACGAC [SEQ ID NO: 15]
(upstream from HmdIII site in the vector pTZ18U), and
PSLrev: ACTTGAAGTAGGCTCTGCCGCTTGC [SEQ ID NO: 16], with the plasmid pPA-H6 as a template.
The DNA fragment containing the signal sequence of aerolysin fused to the gene coding hIL-2 (with the uPA linker at the 3'-end) was prepared by recombinant PCR
(PCR3), using the primers pUCfwd and UPArev, and the products of PCRl and PCR2 as a template.
The DNA fragment containing the gene for PA with the uPA linker attached to its 5'- end was prepared by PCR4 using the primers:
UPAfwd: TCAGGCCGTAGTGCTCAAGCAGACCCCGTCTATCC [SEQ ID NO:
17], and pUCrev: GGATAACAATTTCACACAGGAAACAGCTATG [SEQ ID NO: 18] (downstream from £coRI site in pTZ18U) with the plasmid ρPA-H6 as a template. The whole recombinant gene SS-IL-2-uPA-PA-H6 was prepared by recombinant PCR (PCR5) using the primers pUCfwd and pUCrev, and the products of PCR3 and PCR4 as a template.
The product of PCR5 was then cleaved with the restriction endonucleases Hinάlll and EcoRΪ and cloned into the cloning vector ρTZ18U cut with the same enzymes. After the sequence of the gene was confiπned by DNA sequencing, the gene was cloned into the broad host range expression vector pMMB66HE (using Hindlll and EcόRl) and moved into A. salmonicida CB3 by conjugation using the filter-mating technique described by Harayama et al. (1980) High frequency mobilization of the chromosome of Escherichia coli by a mutant of plasmid RF4 temperature-sensitive for maintenance. MoI. Gen. Genet. 180: 47-56 (herein incorporated by reference). DNA manipulations were carried out as described by Sambrook et al. (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor (herein incorporated by referenc).
1.2. IL-2-UPA-R336A-PA
Another histidine tagged MPPT, IL-2-uPA-R336A-PA (Figure 6), was also prepared. The IL-2-uPA-R336A-PA MPPT comprises a proaerolysin polypeptide with an IL-2 targeting unit attached to the N-terminus via a six amino acid linker, cleavable by uPA and by trypsin, and that also comprises the R336A point mutation (i.e., the amino acid 336 - Arg- in PA) in its binding domain. This MPPT also contains the proaerolysin signal sequence. The nucleotide sequence of this IL-2 MPPT is shown in Figure 23 (SEQ ID NO:36) and the amino acid sequence of this IL-2 MPPT is shown in Figure 24 (SEQ ID NO:37). This MPPT was prepared as follows.
The R336A variants of PA and of BL-2-uPA-PA were prepared by site-directed mutagenesis using Quick Change Site-Directed mutagenesis kit with the pair of primers: R336Afwd:CACCCGGACAACGCACCGAACTGGAACCAC [SEQ ID NO: 38], R336Arev: GTGGTTCCAGTTCGGTGCGTTGTCCGGGTG [SEQ ID NO: 39], and the corresponding gene (encoding PA or EL-2-PA) cloned in the vector pTZISU as a template. When the sequences of the mutated genes were confirmed by DNA sequencing, the genes were cloned into the broad host iange expiession vector pMMB66HE (using Hindlll and EcoRl) and moved into A salmonwula CB3 by conjugation using the filter mating technique described by Harayama et al supra
1.3 Expression and purification ofIL-2 hybrids
The IL 2 hjbπds were each produced by growing 400 ml cultures of the coiTesponding CB3 strains and inducing them overnight with 1 mM IPTG at 270C with shaking at 250 rpm Neither of the IL 2 containing hybπds was secreted by the bdcteπa, presumably because the IL-2 moiety prevented transfer of the proteins across the outer membiane The two hybπd proteins were purified from the soluble fiaction after Fiench pressing and centπfugation as follows The cells were centnfuged at 10,000 rpm forlO minutes at 4°C using a JA 16 25 rotor and resuspended in 40 mL PBS containing 10 μg/mL DNase, 10 μg/mL RNase, 2 μg/mL aprotinine, 0 5 μg/mL leupeptin, 0 7 μg/mL pepstatin A and 1 mM PMSF The IL-2 hybπd was ieleased from the cells by French pressing 3 4 times at 800 psi to form a ceil lysate The cell lysate was clarified by centπfugation at 10,000 rpm, 10 minutes, 4°C using at JA 25 S rotor Half of the clarified cell lysate was purified by FPLC nickel affinity chromatography using a 10 mL Chelating Sephaiose Fast Flow (Amersham) column at room temperature The FPLC program used 2 buffers, buffer A 20 mM NaH2PCU, 500 mM NaCl, 10 mM lmidizole, pH 7 4 and buffer B 20 mM NaH2PO4, 500 mM NaCl, 500 mM imidizole, pH 7 4 Each cell lysate was loaded at 1 mL/minute onto the column, which was equilibrated in buffer A, and washed with 100 mL of 10% buffer B (50 mM imidaiole) at 5 mL/mmute EIution was achieved using a gradient of 10 60% buffer B at 5 ml/mmute The peak fractions were pooled and loaded onto a 60 mL Macro-Piep Ceramic Hydroxyapatite Type 1 40 μm (BioRad) column equilibrated in 20 mM KH2PO4, 300 mM NaCl, pH 7 4 at 1 mL/mmute, 4°C The IL- 2 hybrids were eluted from the column at 0 25 mL/minute using a linear gradient of 20 200 mM KH2PO4 in 300 mM NaCl, pH 7 4 The IL 2 hybπd peak fraction concentrations were determined by measuring absorbance at 280 nm The purified IL-2 hybrids and PA and R336A-PA proteins migrated as single major bands of expected appaient mass upon SDS-PAGE (Figure 25)
EXAMPLE 2: EFFECT OF PROTEASES ON IL-2 MPPTs To determine the effect of proteases on the activity of IL-2 MPPTs, the MPPTs and controls (wild-type proaerolysin (PA) and the binding variant R336A-PA, in which the arginine at ammo acid 336 is mutated to an alanine) were tested for then ability to iyse horse red blood cells Hemolytic titers were pei formed using a final concentration of 04% hoise red blood cells in HBS The toxin samples (3 5 μg) weie preactivated with one of the following proteases 20 units/mL fuπn (Sigma) in HBS, 10 mM CaCl2, pH 74 for 4 hours at 37°C, 0 04 mg/mL urokinase plasminogen activator (uPA) in HBS for 4 hours at 37°C, or 0 1 mg/mL trypsin in HBS for 10 minutes at ioom temperature As negative controls the MPPT's were also incubated in HBS for 10 minutes at room temperature without the addition of protease All reactions were inhibited by the addition of PMSF (1 mM final concentration) and cooled on ice The volume of ieaction mixture containing 3 μg was transferred to the frrst well in the fust column of a 96 well titre plate (2 plates were used) The volume in the well was brought to 200 μL with HBS Each sample was serially diluted 1 2 acioss the plate by transferring 100 μL from the fπst well into 100 μL HBS in the next well, removing and discarding 100 μL from the last well before adding the horse red blood cells Visual readings were made at 1 hour Samples fiom the same reaction mixtures (100 ng) were loaded onto 10% Bis-Tπs NuPAGE gels in non- leducedlx MOPS-SDS running buffer, run at 200 V constant voltage for 50 minutes and stained using a SilverXpress Silvei Staining Kit (Invitrogen)
Figure 7 shows the results of the actions of trypsin (T), furm (F), or uPA (U) on these protein toxins The iesults show that native PA and IL-2-uPA-PA are converted to active aerolysin by trypsin and uPA The R336A-PA and IL 2-uPA R336A-PA molecules aie only very weakly active after trypsin and uPA treatment The IL-2- uPA-PA appears to be somewhat active after fuπn treatment, indicating that IL-2 uPA-aerolysin has some ability to form channels (i e , the IL 2 does not have to be removed) The iesults further suggest that IL-2-uPA-aerolysm is capable of forming oligomers
EXAMPLE 3: CELL KILLING ABILITY OF IL-2 MPPTs
3.1. Cell Killing
The toxicities of the IL-2 MPPTs were tested in a cell killing assay with three cell lines the mouse EL-4 cell line which does not display the IL-2 receptor and is sensitive to native PA, the mouse CTLL 2 cell line which displays a high affinity IL 2 receptor, and the human Hut 78 cell line which displays a low affinity IL-2 receptor
CeIi killing assays were performed at concentrations of 1 x 10* cells/mL by resuspending cell pellets in cell culture media after centiifugation at 1100 vpm for 5 minutes at room temperature in an IEC Centra CL2 centrifuge Each MMPT was assayed in triplicate Using 96 well title plates, the PA, R336A-PA, IL-2-uPA-PA and IL-2-uPA R336A-PA were serially diluted 1 5 m supplemented cell media using a fmal volume of 20 μL After serial dilution, cells were added to appropriate rows to a volume of 100 μL Two control rows were used the first containing no toxin and no cells and the second containing no toxin with cells The cells were then premcubated with the toxins for 1 hour at 37°C before adding 20 μL of cell killing reagent (Promega CelITiter 96 AQueous One Solution Cell Proliferation Assay) followed by furthei incubation for 4 hours After incubation, 7 μL of 70% isopropyl alcohol was added to each well in ordei to pop an bubbles The plates were read using a BioTec plate reader at 490 nm Cell killing curves were generated by plotting the calculated average percent cell viability for each well against the respective toxin concentration For EL4 replacement cell killing assays, 200 umts/mL of mouse IL4 (BioVision) was added to each well in cell cultuie media prior to toxin dilutions Similarly, human recombinant IL 2 was added in cell culture media for a final concentration of 10 μg/mL for IL 2 competition cell killing assays
The results in Figures 8 to 10 show that the IL 2-R336A-PA MPPT is selectively very toxic to cells displaying a high affinity IL-2 receptor (i e , CTLL 2 cell line), indicating that the IL-2-R336A-PA MPPT can bmd to the cells via the DL-2 receptor, can be activated, and kill the IL-2 receptor bearing cells The R336A-PA vai iant was inactive or only very weakly active against all the cell lines.
3.2. CTLIu-2 IL-4 replacement cell killing
To confirm that the cell killing by IL-2-uPA -R336A-PA MPPT was not due to an indirect effect of the IL-2 constructs on the CTLL-2 cells, the cells were grown in medium that contained 200 units/ml of mouse IL-4 (BioVision) in place of IL-2 The IL-4 replacement in the medium obviated the cells IL-2 lequirement The iesults in Figure 1 1 show that ΪL-2-uPA -R336A-PA MPPT was still able to kill the CTLL-2 cells
3.3 CTLL-2 IL-2 competition cell killing
To confirm that the cell killing by IL-2-uPA -R336A-PA MPPT was due to binding to the IL-2 receptor, a competition cell killing assay was conducted where IL-2 was added to the medium to a final concentiation of ] 0 μg/mL The results in Figure 12 show that cell killing by IL-2-uPA -R336A-PA MPPT was inhibited by the addition of IL-2 to the medium thus confirming that cell killing is due to binding to the IL-2 receptor.
EXAMPLE 4: CELL BINDING
The ability of EL-2 MPPTs, according to the present invention, to bind to cells was measured by flow cytometry using a FacsCalibur Flow Cytometer (Pearson). EL4 and CTLL-2 cells were piepared in unsupplemented cell cultuie media to a concentration of 2 x 106cells/mL by resuspending cell pellets after centπfugation at 1100 rpm for 5 minutes at room temperature in an IEC Centra CL2 centrifuge. Protein toxin was added to a final concentiation of 2 x 108 M and the mixtures were incubated on ice foi 30 minutes Cells were centπfuged for 7 seconds in an IEC Microhte microfuge, washed 3x in unsupplemented media and resuspended to their original volume The polyclonal antibody pAb αAerA (Buckley) was added to cells at a 1/500 dilution and incubation was continued on ice for 30 minutes. Cells weie washed and resuspended as above The secondary antibody, polyclonal goat α-iabbit IgG H+L chain specific fluorescein conjugate (CalBiochem) was added at a 1/5000 dilution and incubated on ice for 30 minutes Cells weie washed and iesuspended as above Histograms were prepared using CellQuest softwaie
The iesults in Figmes 13 and 14 show MPPT binding to cells that do not display the IL 2 receptor (EL-4 cells) and to cells that do display the IL-2 receptor (CTLL 2 cells), lespectively The native PA and IL-2-uPA -PA MPPT bound to the EL-4 cells via GPI-anchored proteins whereas the R336A-PA and IL-2-UPA -R336A-PA MPPT1 having a damaged GPI-anchor piotein binding site, did not bind As shown in Figure 9, the IL 2-uPA-R336A-PA MPPT did bind to the CTLL 2 cells, indicating binding via the IL-2 receptor, but the R336A-PA did not
EXAMPLE 5: IL-2 MPPT OLIGOMERIZATION
The critical step in channel formation by aerolysin is ohgomeπzation, which is followed by insertion Aeiolysin can form oligomers in vitro when no target cells are present, if the concentration exceeds about 0 5 mg/ml These oligomers can be detected by SDS-PAGE In order to determine if R336A-PA and IL-2-uPA-R336A- PA can oligomeπze undei these conditions, they each were incubated at a concentration of 0 8 mg/ml with 0 002 mg/ml trypsin for 20 minutes at 37°C Trypsin was inhibited by the addition of 0 1 mg/ml trypsin inhibitor, and this was followed by 1 hour incubation at 37°C Samples were prepared m ix sample buffer (NuPAGE) and loaded on to a NuPAGE 10% Bis Tπs gel (Invitrogen) in Ix MOPS SDS running buffer under non-reduced conditions and run foi 50 minutes at 200 V constant voltage The gel was stained with Coomassie Brilliant Blue R-250
As shown m Figure 15, the R336A-PA variant oligomeπzes with the same ability as native PA, confirming that the binding domain modification does not interfere with ohgomeπzation, but specifically affects binding to GPI-AP (Figure 15)
When proaerolysin binds to cells, it is quickly activated and converted to the oligomer, which causes cell death by channel formation Ohgomeπzation on the cell surface occurs at much lower concentiations than are required foi ohgomeπzation in the absence of cells In order to determine if R336A-PA and IL-2-uPA-R336A-PA can ohgomerize under these conditions, each was incubated with CTLL-2 cells m cell culture media for 5 hours at 370C as modeled after the cell killing assay. After incubation, the samples were centufuged at 10,000 ipm for 5 minutes at room temperature in an IEC Microlite microfuge The supernatants were removed and cell pellets were resuspended in Ix SDS-PAGE sample buffer (NuPAGE) The samples weic electi ophoi esed using 10% Bis-Tπs NuPAGE gels (Invitrogen) in Ix MOPS- SDS buffer under non-reduced conditions foi 50 minutes at 200V constant voltage The proteins were transfeπed to nitrocellulose membrane in Ix NuPAGE transfer buffer with 10% methanol per gel for 2 horns at 30V constant voltage The membrane was blocked overnight at 40C in 5% skim milk m PBST Later, the membrane was probed with pAb αAerA at 1/4000 dilution in 5% skim milk in PBST foi 1 hour, followed by a 30 minute wash in PBST and then, piobed with donkey Oc- rabbit horseradish peroxidase conjugate (Ameisham) at 1/4000 in PBST for 1 hour, followed by a 30 minute wash in PBST The blot was developed using an ECL detection system (Amersham) with a 5 minute exposure tune
As shown in Figure 16, IL-2-uPA-PA and IL-2-uPA-R336-PA form oligomers on CTLL-2 cells Cells were incubated with R336A-PA (lane 1), IL-2-uPA-R336-PA (lane 2), IL-2-uPA-PA (lane 3), or PA (lane 4). As shown in this figure, the BL-2 oligomers are laiger No ohgomei was detected after incubation of CTLL-2 cells with R336A-PA, presumably because this variant can't bind to the cells The results show that IL-2-uPA-R336A-PA MPPT, which can bind to cells via the IL-2 receptor, does produce oligomers and that they aie larger than the native aerolysm oligomers, indicating that it is not necessary for the IL-2 targeting unit to be lemoved for oligomeπzation to occur
Although the invention has been described with reference to certain specific embodiments, various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention as outlined m the claims appended hereto

Claims

WE CLAIM:
1 An isolated pore-forming protein toxin derived from a naturally occuning aerolysin-related pore-formmg protein and comprising one or more cytokine- receptor targeting units capable of specifically binding to a cytokine receptor, wherein said pore forming protein toxin is capable of binding to and killing cells expressing said cytokine receptor
2 The isolated pore-forming protein toxin according to claim 1, wherein said aerolysin-related pore forming protein toxin is proaerolysm or Clostridium septicum alpha toxm
3 The isolated pore-formmg protein toxm according to claim 1, wherein said aerolysin-related pore forming protein toxin is proaerolysm.
4 The isolated pore-forming protein toxin according to any one of claims 1 to 3, wherein said one or more cytokme-rcceptor targeting unit is a cytokine, a cytokine fragment, an antibody that specifically binds a cytokine receptor, a cytokine receptor antagonist, or a cytokine receptor inhibitor
5 The isolated pore-forming protein toxin according to any one of claims 1 to 4, wherein said one or more cytokine receptor targeting unit is a cytokine
6 The isolated pore-forming protein toxin according to claim 5, wherein said cytokine is a cytokine that is involved in piohfeiation or differentiation of cells of the hematopoietic lineage, or a cytokine that participates in immune and inflammatory response mechanisms
7 The isolated pore-formmg protein toxm according to claim 5 or 6, wheiem said cytokine is an interleukin, a lymphokine, a monokine, an interferon, a colony stimulating factor, a chemokine, a peptide regulatory factor, or a stem cell factor
8 The isolated pore-forming protein toxin according to any one of claims 5, 6, or 7, wherein said cytokine is an interleukin.
9 The isolated pore forming protein toxin according to claim 5 or 6, wherein said cytokine is selected from a cytokine that binds to a member of the Class I cytokine receptor family, a member of the Class II cytokine receptor family, a member of the Immunoglobulin Superfamily of receptors, a member of the Seven transmembiane helix family of ieceptors, or a member of the Tumour Necrosis Factor Family of receptors
10 The isolated pore- forming protein toxin according to claim 5 or 6, wherein said cytokine is selected from IL-I, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-I l, IL-12, IL-13, IL-15, IL- 16, IL-17, TGFβ, GM-CSF, M-CSF, IFNα, IFNβ, IFNγ, MIP- lot, MIP- lβ, c-kit Iigand, TNFα, TNFβ, or a naturally occurring hybrid cytokine.
11. The isolated pore-forming protein toxin according to claim 5 or 6, wherein said cytokine is IL-2
12 The isolated pore-forming protein toxin according to any one of claims 1 to 11, wherein said cytokine-receptor targeting unit is attached to said aerolysin- ielated pore-forming toxin by a linker
13 The isolated pore-forming protein toxin according to claim 12, wherein said linker is a peptide of between about 5 and about 30 amino acids in length
14 The isolated pore-forming protein toxin according to claim 13, wherein said peptide linker compπses one oi more enzyme cleavage sites
15 The isolated pore-forming protein toxin according to claim 14, wherein said one or more enzyme cleavage sites is cleavable by urokinase-type plasminogen activator, trypsin, matrix metalloprotease 2, Factor Xa, enterokmase, or thrombin 16 The isolated pore-forming piotein toxin according to claim 14 ot 15, wherein said one or more enzyme cleavage sites is recognized by urokinase-type plasminogen activator
17 The isolated pore- forming protein toxin according to claim 14 or 15 wherein said one or moie enzyme cleavage sites is recognized by trypsin
18 The isolated pore-forming piotein toxm according to claim 1 or 13, wherein said pore fotming protein toxm comprises an amino acid sequence substantially identical to the sequence as set forth in SEQ ED NO 35
19 The isolated pore forming piotem toxin accoiding to any one of claims 1 to 18, wherein said pore forming protein toxin further comprises one or more mutations in a native binding domain
20 The isolated pore-forming protein toxin according to claim 19, wherein said naturally occurring aerolysin related poie-forming protein is proaerolysin and said one or more mutations in a native binding domain are a mutation at position Y61, a mutation at position Y162, a mutation at position W324, a mutation at position R323, a mutation at position R336, a mutation at position W 127, oi a combination thereof
21 The isolated pore forming protein toxin according to claim 20, wherein at least one mutation is R336A oi R336C
22 The isolated pore-forming piotein toxin according to claim 1 or 21, wherein said pore-foiming protein toxin comprises an amino acid sequence substantially identical to SEQ ID NO 37
23 An isolated polynucleotide encoding the isolated pore-forming protein toxm according to any one of claims 1 to 22
CT
A vector comprising the polynucleotide according to claim 23, opeiatively linked to one or more expression control sequences.
A host cell comprising the vector according to claim 24
An isolated poie-forming protein toxin derived from proaerolysin comprising one oi more cytokine-receptor targeting units capable of specifically binding to a cytokine receptor, said poie forming protein toxin comprising an amino acid sequence substantially identical to the sequence as set forth in SEQ ED NO 35, or SEQ ID NO 37.
A pharmaceutical composition comprising the pore-forming protein toxin according to any one of claims 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 26
A pharmaceutical composition comprising the isolated polynucleotide accoiding to claim 23.
An isolated pore-forming protein toxin according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 26, for use in decreasing the numbei of cytokine receptor beaπng cells in a subject
An isolated poie-forming protein toxin according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 26, for use in the treatment of a T-cell dependent autoimmune disease in a subject
An isolated pore-forming protein toxin according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 26, for use in the treatment of cancer in a subject
Use of the isolated poie-forming piotein toxin according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 26, for use in the preparation of a medicament CT
The use according to claim 32, wherein said medicament is for decreasing the number of cytokme-receptor beaπng cells in a subject
The use according to claim 32, wherein said medicament is for the tieatment of a T-cell dependent autoimmune disease in a subject
The use according to claim 32, wherein said medicament is for treating cancer in a subject
A method of decreasing the number of cytokme-receptor beaπng cells in a subject, comprising administering to the subject having cancer an effective amount of the pore-forming piotein toxin according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 26
A method of tieatmg a T-cell dependent autoimmune disease in a subject comprising administering to the subject an effective amount of the pore- forming protein toxin accoiding to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 26
A method of treating cancer in a subject comprising administering to the subject having cancer an effective amount of the pore-foiming piotein toxin according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 26
A method of preparing a modified pore-forming protein toxin, said method compπsing
- providing a native pore forming protein toxin wheiein said native pore forming protein toxin is proaerolysin or Clostridium septicum alpha toxin, and attaching to said native pore-forming protein toxin, one or more cytokine- ieceptor targeting units capable of specifically binding to a cytokine receptor, wherein said modified pore-forming protein toxin is capable of killing cells expiessing said cytokine
40 A kit compπsing one or more pore-forming protein toxins according to any one of claims 1,2,3,4,5,6,7,8,9, 10, 11,12, 13, 14, 15, 16, 17, 18,19,20, 21, 22, or 26 and optionally instructions for use.
PCT/CA2007/001018 2006-06-09 2007-06-11 Modified protein toxins targeting cytokine -receptor bearing cells and use thereof for treating disease WO2007140618A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CA002657946A CA2657946A1 (en) 2006-06-09 2007-06-11 Modified protein toxins targeting cytokine -receptor bearing cells and use thereof for treating disease

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US80441306P 2006-06-09 2006-06-09
US60/804,413 2006-06-09

Publications (1)

Publication Number Publication Date
WO2007140618A1 true WO2007140618A1 (en) 2007-12-13

Family

ID=38801023

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2007/001018 WO2007140618A1 (en) 2006-06-09 2007-06-11 Modified protein toxins targeting cytokine -receptor bearing cells and use thereof for treating disease

Country Status (2)

Country Link
CA (1) CA2657946A1 (en)
WO (1) WO2007140618A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010069060A1 (en) * 2008-12-15 2010-06-24 Protox Therapeutics Inc. Method for treating prostatitis utilizing modified pore-forming protein proaerolysin
WO2013103614A1 (en) * 2011-12-30 2013-07-11 Stc.Unm Crlf-2 binding peptides, protocells and viral-like particles useful in the treatment of cancer, including acute lymphoblastic leukemia (all)
US9579283B2 (en) 2011-04-28 2017-02-28 Stc.Unm Porous nanoparticle-supported lipid bilayers (protocells) for targeted delivery and methods of using same
CN111909275A (en) * 2019-05-08 2020-11-10 上海大学 Targeted drug-loading system for prolonging circulating half-life period of polypeptide drug and construction method thereof
US11344629B2 (en) 2017-03-01 2022-05-31 Charles Jeffrey Brinker Active targeting of cells by monosized protocells
US11672866B2 (en) 2016-01-08 2023-06-13 Paul N. DURFEE Osteotropic nanoparticles for prevention or treatment of bone metastases

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110171219A1 (en) * 2008-09-19 2011-07-14 Fahar Merchant Treating cancer stem cells using targeted cargo proteins

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994025616A1 (en) * 1993-04-28 1994-11-10 Worcester Foundation For Experimental Biology Cell-targeted lytic pore-forming agents
WO1996020688A2 (en) * 1994-12-27 1996-07-11 Worcester Foundation For Biomedical Research Triggered pore-forming agents
WO2005090393A2 (en) * 2004-02-09 2005-09-29 The Government Of The United States, As Represented By The Secretary Of Health And Human Services Multimeric protein toxins to target cells having multiple identifying characteristics
WO2006133553A1 (en) * 2005-06-14 2006-12-21 Protox Therapeutics Incorporated Method of treating or preventing benign prostatic hyperplasia using modified pore-forming proteins

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994025616A1 (en) * 1993-04-28 1994-11-10 Worcester Foundation For Experimental Biology Cell-targeted lytic pore-forming agents
WO1996020688A2 (en) * 1994-12-27 1996-07-11 Worcester Foundation For Biomedical Research Triggered pore-forming agents
WO2005090393A2 (en) * 2004-02-09 2005-09-29 The Government Of The United States, As Represented By The Secretary Of Health And Human Services Multimeric protein toxins to target cells having multiple identifying characteristics
WO2006133553A1 (en) * 2005-06-14 2006-12-21 Protox Therapeutics Incorporated Method of treating or preventing benign prostatic hyperplasia using modified pore-forming proteins

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MACKENZIE C.R. ET AL.: "Analysis of Receptor Binding by the Channel-forming Toxin Aerolysin Using Surface Plasmon Resonance", J. BIOL. CHEM., vol. 274, no. 32, 6 August 1999 (1999-08-06), pages 22604 - 22609, XP003005549 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010069060A1 (en) * 2008-12-15 2010-06-24 Protox Therapeutics Inc. Method for treating prostatitis utilizing modified pore-forming protein proaerolysin
US8278279B2 (en) 2008-12-15 2012-10-02 Protox Therapeutics Corp. Method for treating prostatitis utilizing modified pore-forming protein proaerolysin
US10654900B2 (en) 2008-12-15 2020-05-19 Sophiris Bio, Corp. Method for treating prostatitis utilizing the pore-forming protein proaerolysin PRX302
US9579283B2 (en) 2011-04-28 2017-02-28 Stc.Unm Porous nanoparticle-supported lipid bilayers (protocells) for targeted delivery and methods of using same
WO2013103614A1 (en) * 2011-12-30 2013-07-11 Stc.Unm Crlf-2 binding peptides, protocells and viral-like particles useful in the treatment of cancer, including acute lymphoblastic leukemia (all)
US11672866B2 (en) 2016-01-08 2023-06-13 Paul N. DURFEE Osteotropic nanoparticles for prevention or treatment of bone metastases
US11344629B2 (en) 2017-03-01 2022-05-31 Charles Jeffrey Brinker Active targeting of cells by monosized protocells
CN111909275A (en) * 2019-05-08 2020-11-10 上海大学 Targeted drug-loading system for prolonging circulating half-life period of polypeptide drug and construction method thereof

Also Published As

Publication number Publication date
CA2657946A1 (en) 2007-12-13

Similar Documents

Publication Publication Date Title
US20230025572A1 (en) High avidity antigen recognizing constructs
AU714541B2 (en) IL-13 receptor specific chimeric proteins and uses thereof
EP2386639A2 (en) Modified pore-forming protein toxins and use thereof
US6428788B1 (en) Compositions and methods for specifically targeting tumors
EP0751781B1 (en) Use of monoclonal antibodies or soluble oligomeric ligands in the manufacture of a medicament for the prevention or treatment of neoplastic disorders
US6518061B1 (en) IL-13 receptor specific chimeric proteins and uses thereof
US20160271231A1 (en) Treating cancer stem cells using targeted cargo proteins
US20220062376A1 (en) Molecular signature of cancer
JP2021522786A (en) Interleukin 15 fusion protein, its composition and therapeutic method
US20110091413A1 (en) Therapeutic use of interleukin-2 mutants
KR20180008862A (en) Modified NK-92 cells to treat cancer
WO2007140618A1 (en) Modified protein toxins targeting cytokine -receptor bearing cells and use thereof for treating disease
EP1806143A2 (en) Baff receptor (BCMA), an immunoregulatory agent
CN100488981C (en) Proaerolysin containing protease activation sequences and its uses
KR102055847B1 (en) A cancer-treating recombinant protein that improves the activity of cytotoxic killer cells targeting cancer cells and use thereof
CA2333923A1 (en) Treatment of celiac disease with interleukin-15 antagonists
CN115297881A (en) Pharmaceutical composition for treating cancer comprising fusion protein comprising IL-2 protein and CD80 protein and anticancer drug
Schanzer et al. Antitumor activity of a dual cytokine/single-chain antibody fusion protein for simultaneous delivery of GM-CSF and IL-2 to Ep-CAM expressing tumor cells
CN114746106A (en) Method for increasing lymphocyte number by using IL-7 fusion protein in tumor
US20030129132A1 (en) IL-13 receptor specific chimeric proteins & uses thereof
WO2003031474A2 (en) Cd137 as a proliferation factor for hematopoietic stem cells
EP1999269A2 (en) Soluble monomeric ephrin a1
Huang et al. Protein Expression and Purification fi
Löffel et al. Gastrointestinal Cancer
WO2010008561A2 (en) Methods and compositions for protecting against cytotoxic therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07719934

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2657946

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07719934

Country of ref document: EP

Kind code of ref document: A1