WO2007137810A1 - Variants du récepteur de la cytokinine et leur utilisation - Google Patents

Variants du récepteur de la cytokinine et leur utilisation Download PDF

Info

Publication number
WO2007137810A1
WO2007137810A1 PCT/EP2007/004729 EP2007004729W WO2007137810A1 WO 2007137810 A1 WO2007137810 A1 WO 2007137810A1 EP 2007004729 W EP2007004729 W EP 2007004729W WO 2007137810 A1 WO2007137810 A1 WO 2007137810A1
Authority
WO
WIPO (PCT)
Prior art keywords
cytokinin
cytokinin receptor
amino acid
ahk4
cre1
Prior art date
Application number
PCT/EP2007/004729
Other languages
English (en)
Inventor
Thomas SCHMÜLLING
Alexander Heyl
Michael Riefler
Birgit Pils
Original Assignee
Freie Universität Berlin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Freie Universität Berlin filed Critical Freie Universität Berlin
Publication of WO2007137810A1 publication Critical patent/WO2007137810A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/8267—Seed dormancy, germination or sprouting

Definitions

  • the invention relates to cytokinin receptor protein variants exhibiting a reduced binding to cytokinin, to polynucleotides encoding these cytokinin receptor protein variants, to vectors and cells comprising these polynucleotides, and to transgenic plants comprising these polynucleotides, vectors, and cells.
  • the invention further relates to a process for making these transgenic plants and to the use of these transgenic plants for producing seeds of enhanced size, with enhanced seed filling, with reduced seed loss and/or with more rapid germination, and/or a live root system with increased root mass, root length and/or root branching.
  • the invention also relates to a method for enhancing the seed size, for enhancing seed filling, reducing seed loss and/or with more rapid germination and/or the root mass, root length and/or root branching of a plant and to seeds obtainable by the methods of the present invention.
  • Cytokinin is a plant hormone that plays positive and negative regulatory roles in many aspects of plant growth and development. It stimulates the formation and activity of shoot meristems, is able to establish sink tissues, retard leaf senescence, inhibits root growth and branching, and plays a role in seed germination and stress responses. Analysis of cytokinin-deficient plants has shown that cytokinin plays opposite roles in shoot and root meristems and suggests that the hormone has an essential function in quantitative control of organ growth (Mok, D. W. S. & Mok, M. C. (2001) Ann. Rev. Plant Physiol. MoI. Bio. 52, 89-1 18).
  • cytokinin receptor family which are sensor histidine kinases (Inoue, T. et al. (2001) Nature 409, 1060-3; Suzuki, T.et al. (2001) Plant Cell Physiol. 42, 107-13; Yamada, H. et al. (2001) Plant Cell Physiol. 42, 1017-23.).
  • sensor histidine kinases Inoue, T. et al. (2001) Nature 409, 1060-3; Suzuki, T.et al. (2001) Plant Cell Physiol. 42, 107-13; Yamada, H. et al. (2001) Plant Cell Physiol. 42, 1017-23.).
  • These three cytokinin receptors, AHK2, AHK3 and CRE1/AHK4 show a high degree of sequence identity, but each has distinguishing characteristics.
  • the current model predicts that the hormone binds to the Arabidopsis histidine kinase receptors (AHKs) via an extracellular ligand binding domain, the so-called CHASE (cyclases/histidine kinases associated sensory extracellular) domain (Mougel, C. & Zhulin, I. B. (2001) Trends Biochem. ScL 26, 582-4; Anantharaman, V. & Aravind, L. (2001) Trends in Biochem. ScL 26, 579-82).
  • AHKs Arabidopsis histidine kinase receptors
  • CHASE cyclases/histidine kinases associated sensory extracellular domain
  • the CHASE domain is exclusively found between two transmembrane regions as the N-terminal part of adenylyl cyclases, diguanylate cyclases or histidine kinases in a number of eukaryotes and numerous bacteria. It includes, for example, the spore differentiation factor, DhkA, and the osmosensing receptor-adenylyl cyclase ACG, which regulates spore dormancy, from the slime mold Dictyostelium discoideum. DhkA recognizes a small peptide, SDF-2 (Wang, N. et al. (1999) MoI. Cell. Biol.
  • cytokinin The binding of cytokinin to the receptor is thought to cause a conformational change leading to the autophosphorylation of a conserved histidine residue in the cytosolic part of the receptor. Subsequently, the signal is transferred to a canonical aspartate of the receiver domain within the C-terminal part of the protein and transduced further by a multi-step two-component signaling (TCS) system (for reviews see: Ferreira, F. J. & Kieber, J. J. (2005) Curr. Opin. Plant Biol. 8, 518-25; Mizuno, T. (2005) Biosci. Biotechnol. Biochem. 69, 2263-76). mRNA of all three receptor genes is found in all organs, although with different abundance.
  • TCS multi-step two-component signaling
  • CRE1/AHK4 is predominantly expressed in the root, where its mRNA was mainly localized to the vascular cylinder and the pericycle of the root.
  • Gel blot analyses and promoter-GUS fusions have detected CRE1/AHK4 expression in different shoot tissues, although in lower abundance than in the roots.
  • the AHK2 and in particular the AHK3 gene show greater expression in the aerial parts of Arabidopsis plants.
  • Riefler et al. used loss-of- function mutants to study A. thaliana AHK2, AHK3, and CRE1/AHK4 (Riefler et al. (2006) The Plant Cell 18, 40-54). Their study showed that ahk2 ahk3 double mutants developed a strongly enhanced root system through faster growth of the primary root and increased branching. Triple mutant seeds were more than twice as large as wild-type seeds. Werner et al. showed that cytokinin deficiency resulted in diminished activity of the vegetative and floral shoot apical meristems and leaf primordial. It was further shown that cytokinin have a negative regulatory function in root formation. (Werner, T., et al. (2003) Plant Cell 15, 2532-2550).
  • the technical problem underlying the instant invention is to provide a method for making seeds of enhanced size, with more rapid germination, with enhanced yield, with reduced seed loss and/or enhanced seed filling, and for making plants with enhanced root branching, root length and/or root mass, thereby, however, avoiding disadvantageous phenotype features.
  • the present invention relates to a cytokinin receptor protein variant, characterized in that compared to the corresponding wild-type cytokinin receptor protein one or more amino acids within the CHASE domain of said cytokinin receptor protein are exchanged by another amino acid, wherein said one or more amino acids within the CHASE domain are selected from the group consisting of: (a) the W244 in Arabidopsis thaliana CRE1/AHK4 or an amino acid corresponding thereto in another cytokinin receptor,
  • the present invention relates to a cytokinin receptor protein variant, characterized in that compared to the corresponding wild-type cytokinin receptor protein the CHASE domain is partially or completely deleted, wherein the cytokinin receptor protein variant exhibits a reduced binding to cytokinin.
  • the present invention relates to a polynucleotide comprising a nucleic acid sequence encoding the cytokinin receptor protein variant according to the first or the second aspect, a vector comprising said polynucleotide, a cell comprising said polynucleotide or said vector, and a transgenic plant comprising said polynucleotide, said vector, or said cell.
  • the invention is further directed to parts, cells, or seeds of said transgenic plant, and to plants or propagating material thereof regenerated from said transgenic plant.
  • the present invention is directed to a process for making the above transgenic plant or the above material, wherein the above vector is introduced in a gene technological manner into cells of a plant, wherein the cells are transformed.
  • the present invention relates to the use of the above transgenic plant for producing seeds of enhanced size, with enhanced seed filling, with reduced seed loss and/or with more rapid germination, wherein the transgenic plants are cultured under culturing conditions and the preferably mature seeds are harvested.
  • the present invention relates to the use of the above transgenic plant for producing a live root system with increased root mass, root length and/or root branching, wherein the transgenic plant is cultured under culturing conditions.
  • the present invention is directed to the use of a transgenically expressed cytokinin receptor variant with reduced cytokinin binding activity for enhancing the seed size, the seed filling, the root mass, the root length and/or the root branching and/or for reducing seed loss and/or germination time of a plant endogenously expressing functional cytokinin receptors.
  • the present invention is directed to the use of a transgenically expressed cytokinin receptor protein variant with reduced cytokinin binding activity for modifying the characteristics of wood, for altering shoot architecture, for altering leaf senescence and other senescence processes and/or for altering the timing of reproduction.
  • the invention relates to a method for enhancing the seed size, seed filling, for reducing seed loss and/or with more rapid germination and/or the root mass root length and/or root branching of a plant, comprising the steps of - introducing by genetic engineering into the plant a polynucleotide coding for a cytokinin receptor variant with reduced cytokinin binding activity in comparison to the cytokinin receptor endogenously expressed in the plant; and expressing said nucleic acid.
  • the instant invention relates to a method for making seeds of enhanced size, with enhanced seed filling, with reduced seed loss and/or with more rapid germination, wherein the transgenic plant, parts thereof, or seeds as described above are cultured under culturing conditions and preferably mature seeds being produced thereby are harvested.
  • the present invention is directed to seeds obtainable by any of the above methods.
  • variant is to be understood herein as a protein which differs in comparison to the protein from which it is derived by one or more changes in the amino acid sequence.
  • a variant may be naturally occurring or it may be constructed artificially, preferably by gene-technological means.
  • the protein from which the variant is derived is a wild-type protein.
  • the variants of the present invention may also be derived from naturally occurring variants or from artificially constructed variants, provided that the variants of the present invention exhibit a reduced binding to cytokinin as compared to the protein from which the variant is derived.
  • the changes in the amino acid sequence may be amino acid exchanges, insertions, deletions, N-terminal truncations, or C- terminal truncations, or any combination of these changes.
  • the amino acid exchanges may be conservative or non-conservative.
  • a cytokinin receptor protein variant of the present invention differs from the protein from which it is derived at least by one or more non-conservative amino acid exchanges.
  • the amino acid sequence Arabidopsis thaliana CRE1/AHK4 is shown in the sequence listing of this specification as SEQ ID NO.: 29 and, accordingly, numbering of amino acids in Arabidopsis thaliana CRE1/AHK4 refers to the numbering in SEQ ID NO.: 29.
  • the expression "wherein the cytokinin receptor protein variant exhibits a reduced binding to cytokinin” is to be understood in that the binding of cytokinin to the cytokinin receptor protein variant is reduced by at least 40% in comparison to the binding of cytokinin to the wild-type cytokinin receptor, preferably by at least 50%, more preferably by at least 60%, more preferably by at least 70%, even more preferably by at least 80%, and most preferably by at least 90%.
  • the binding of cytokinin to the cytokinin receptor can be determined by any art-known binding assay allowing quantitative assessment of the binding strength including three-hybrid assays, pull-downs, co-immunoprecipitations, etc. It is particularly preferred that the binding is assessed as set out in Example 1, i.e. by the assay described in (Romanov, G. A. et al. (2005) Anal. Biochem. 347, 129-134).
  • Non-conservative substitutions or “non-conservative amino acid exchanges” are defined as exchanges of an amino acid by another amino acid listed in a different group of the six standard amino acid groups shown below:
  • hydrophobic Met, Ala, VaI, Leu, He
  • neutral hydrophilic Cys, Ser, Thr
  • wild-type cytokinin receptor protein is used in this context to refer to the cytokinin receptor protein found in the majority of plants from one species and which is capable of conferring cytokinin response to a plant.
  • wild-type sequences are known in the prior art and comprise the sequences accessible under the following Ace.
  • an amino acid corresponding thereto in another cytokinin receptor refers to an amino acid which within the CHASE domain is located at the same position based on an amino acid alignment of the given wild-type cytokinin receptor to be mutated and Arabidopsis thaliana CRE1/AHK4 (GI 13067759).
  • Such alignments can be carried out with several art-known algorithms, preferably with hmmalign (HMMER package, http://hmmer.wustl.edu/) or with the CLUSTAL algorithm (Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-80) available e.g.
  • amino acid aligned with W244, F304, R305, T317, F216, M249, A262, G282, N288, L325, L342, G343, V352, or M410 is considered as the corresponding amino acid of the cytokinin receptor to be mutated to arrive at a cytokinin receptor protein variant of that cytokinin receptor.
  • amino acid to be mutated which aligns with W244, F304, R305, T317, F216, M249, A262, G282, N288, L325, L342, G343, V352, or M410 is identical to or a conservative change of the respective amino acid in A. thaliana CRE1/AHK4.
  • promoter includes the transcriptional regulatory sequences derived from a classical eukaryotic genomic gene, including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence and additional regulatory or control elements (e.g. upstream activating sequences, repressors, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner.
  • TATA box which is required for accurate transcription initiation
  • CCAAT box sequence e.g. upstream activating sequences, repressors, enhancers and silencers
  • promoter also includes the transcriptional regulatory sequences of a classical prokaryotic gene, in which case it may include a -35 box sequence and/or a -10 box transcriptional regulatory sequences.
  • promoter is also used to describe a synthetic or fusion molecule, or derivative which confers, activates or enhances expression of a nucleic acid molecule in a cell, tissue or organ. Promoters may contain additional copies of one or more specific regulatory elements, to further enhance expression and/or to alter the spatial expression and/or temporal expression of a nucleic acid molecule to which it is operatively linked. Such regulatory elements may be placed adjacent to a heterologous promoter sequence to drive expression of a nucleic acid molecule in response to e.g.
  • the promoter preferably is a plant-expressible promoter sequence. Promoters that also function or solely function in non-plant cells such as bacteria, yeast cells, insect cells and animal cells are not excluded from the invention.
  • plant-expressible is meant that the promoter sequence, including any additional regulatory elements added thereto or contained therein, is at least capable of inducing, conferring, activating or enhancing expression in a plant cell, tissue or organ, preferably a monocotyledonous or dicotyledonous plant cell, tissue, or organ.
  • plant-operative and “operative in a plant” when used herein, in respect of a promoter sequence shall be taken to be equivalent to a plant-expressible promoter sequence.
  • Regulatable promoters as part of a binary viral plant expression system are also known to the skilled artisan (Yadav 1999 - WO 99/22003; Yadav 2000 - WO 00/17365).
  • a "regulatable promoter sequence” is a promoter that is capable of conferring expression of a structural gene in a particular cell, tissue, or organ or group of cells, tissues or organs of a plant, optionally under specific conditions, however does generally not confer expression throughout the plant under all conditions.
  • a regulatable promoter sequence may be a promoter sequence that confers expression of a gene to which it is operatively linked in a particular location within the plant or alternatively, throughout the plant under a specific set of conditions, such as following induction of gene expression by a chemical compound or other elicitor.
  • the regulatable promoter used in the performance of the present invention confers expression in a specific location within the plant, either constitutively or following induction, however, not in the whole plant under any circumstances.
  • promoters include cell-specific promoter sequences, tissue-specific promoter sequences, organ-specific promoter sequences, cell cycle specific gene promoter sequences, inducible promoter sequences and constitutive promoter sequences that have been modified to confer expression in a particular part of the plant at any one time, such as by integration of said constitutive promoter within a transposable genetic element (Ac, Ds, Spm, En, or other transposon).
  • tissue-specific shall be taken to indicate that expression is predominantly in a particular tissue or tissue-type, preferably of plant origin, albeit not necessarily exclusively in said tissue or tissue-type.
  • organ- specific shall be taken to indicate that expression is predominantly in a particular organ, preferably of plant origin, albeit not necessarily exclusively in said organ.
  • cell cycle specific shall be taken to indicate that expression is predominantly cyclic and occurring in one or more, not necessarily consecutive phases of the cell cycle albeit not necessarily exclusively in cycling cells, preferably of plant origin.
  • an "inducible promoter” is a promoter the transcriptional activity of which is increased or induced in response to a developmental, chemical, environmental, or physical stimulus.
  • a "constitutive promoter” is a promoter that is transcriptionally active throughout most, but not necessarily all parts of an organism, preferably a plant, during most, but not necessarily all phases of its growth and development.
  • Those skilled in the art will readily be capable of selecting appropriate promoter sequences for use in regulating appropriate expression of the cytokinin receptor protein variant from publicly-available sources, without undue experimentation. Placing a nucleic acid molecule under the regulatory control of a promoter sequence, or in operative connection or linkage with a promoter sequence, means positioning said nucleic said molecule such that expression is controlled by the promoter sequence.
  • a promoter is usually, but not necessarily, positioned upstream, or at the 5 '-end, and within 2 kb of the start site of transcription, of the nucleic acid molecule which it regulates, albeit enhancers and silencers, which are also comprised by the term "promoter" may be placed further away from the transcriptional start site. It is thought that these elements bind to proteins capable of long range action due to looping out of the intervening sequence. In the construction of heterologous promoter/structural gene combinations it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting (i.e., the gene from which the promoter is derived).
  • promoters suitable for use in gene constructs of the present invention include those listed in Table 1, amongst others.
  • Table 1 Promoters usable in the invention.
  • the promoters listed in Table 1 are provided for the purposes of exemplification only and the present invention is not to be limited by the list provided therein. Those skilled in the art will readily be in a position to provide additional promoters that are useful in performing the present invention. In the case of constitutive promoters or promoters that induce expression throughout the entire plant, it is preferred that such sequences are modified by the addition of nucleotide sequences derived from one or more of the tissue- specific promoters listed in Table 1 , or alternatively, nucleotide sequences derived from one or more of the above-mentioned tissue-specific inducible promoters, to confer tissue- specificity thereon.
  • the CaMV 35S promoter may be modified by the addition of maize Adhl promoter sequence, to confer anaerobically-regulated root-specific expression thereon, as described previously (Ellis et al., 1987).
  • Another example describes conferring root specific or root abundant gene expression by fusing the CaMV35S promoter to elements of the maize glycine-rich protein GRP3 gene (Feix and Wulff 2000 - WO 00/15662). Such modifications can be achieved by routine experimentation by those skilled in the art.
  • Terminator refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are 3 '-non-translated DNA sequences containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3'-end of a primary transcript. Terminators active in cells derived from viruses, yeasts, moulds, bacteria, insects, birds, mammals and plants are known and described in the literature. They may be isolated from bacteria, fungi, viruses, animals and/or plants.
  • terminators particularly suitable for use in the gene constructs of the present invention include the Agrobacterium tumefaciens nopal ine synthase (NOS) gene terminator, the Agrobacterium tumefaciens octopine synthase (OCS) gene terminator sequence, the Cauliflower mosaic virus (CaMV) 35S gene terminator sequence, the Oryza sativa ADP-glucose pyrophosphorylase terminator sequence (t3'Bt2), the Zea mays zein gene terminator sequence, the rbcs-lA gene terminator, and the rbcs-3A gene terminator sequences, amongst others.
  • NOS Agrobacterium tumefaciens nopal ine synthase
  • OCS Agrobacterium tumefaciens octopine synthase
  • CaMV Cauliflower mosaic virus
  • t3'Bt2 Oryza sativa ADP-glucos
  • Preferred promoter sequences of the invention include root specific promoters such as but not limited to the ones listed in Table 1 and as outlined in the Examples. Those skilled in the art will be aware of additional promoter sequences and terminator sequences which may be suitable for use in performing the invention. Such sequences may readily be used without any undue experimentation.
  • organogenesis means a process by which shoots and roots are developed sequentially from meristematic centres.
  • embryogenesis means a process by which shoots and roots develop together in a concerted fashion (not sequentially), whether from somatic cells or gametes.
  • Agrobacterium is meant a member of the Agrobacteriaceae, more preferably Agrobacterium or Rhizobacterium and most preferably Agrobacterium tumefaciens.
  • T-DNA or transferred DNA
  • T-DNA borders or transferred DNA
  • T-DNA borders or transferred DNA
  • RB right T-DNA border
  • LB left T-DNA border
  • Such a border comprises a core sequence flanked by a border inner region as part of the T- DNA flanking the border and/or a border outer region as part of the vector backbone flanking the border.
  • the core sequences comprise 22 bp in case of octopine-type vectors and 25 bp in case of nopaline-type vectors.
  • the core sequences in the right border region and left border region form imperfect repeats.
  • Border core sequences are indispensable for recognition and processing by the Agrobacterium nicking complex consisting of at least VirDl and VirD2.
  • Core sequences flanking a T-DNA are sufficient to promote transfer of said T-DNA.
  • efficiency of transformation using transformation vectors carrying said T-DNA solely flanked by said core sequences is low. Border inner and outer regions are known to modulate efficiency of T-DNA transfer (Wang et el. 1987).
  • T-DNA transformation vector or "T-DNA vector” is meant any vector encompassing a T-DNA sequence flanked by a right and left T-DNA border consisting of at least the right and left border core sequences, respectively, and used for transformation of any eukaryotic cell.
  • T-DNA vector backbone sequence or "T-DNA vector backbone sequences” is meant all DNA of a T-DNA containing vector that lies outside of the T-DNA borders and, more specifically, outside the nicking sites of the border core imperfect repeats.
  • the current invention includes optimized T-DNA vectors such that vector backbone integration in the genome of a eukaryotic cell is minimized or absent.
  • optimized T-DNA vector is meant a T-DNA vector designed either to decrease or abolish transfer of vector backbone sequences to the genome of a eukaryotic cell.
  • T-DNA vectors are known to the one familiar with the art and include those described by Hanson et al. (1999) and in WO 99/01563.
  • the current invention clearly considers the inclusion of a DNA sequence encoding a cytokinin receptor protein variant in any T-DNA vector comprising binary transformation vectors, super-binary transformation vectors, co-integrate transformation vectors, bi-derived transformation vectors as well as in T-DNA carrying vectors used in agrolistic transformation.
  • binary transformation vector is meant a T-DNA transformation vector comprising: (a) a T-DNA region comprising at least one gene of interest and/or at least one selectable marker active in the eukaryotic cell to be transformed; and (b) a vector backbone region comprising at least origins of replication active in E. coli and Agrobacterium and markers for selection in E. coli and Agrobacterium.
  • the T-DNA borders of a binary transformation vector can be derived from octopine-type or nopaline-type Ti plasmids or from both.
  • the T-DNA of a binary vector is only transferred to a eukaryotic cell in conjunction with a helper plasmid.
  • helper plasmid is meant a plasmid that is stably maintained in Agrobacterium and is at least carrying the set of vir genes necessary for enabling transfer of the T-DNA.
  • Said set of vir genes can be derived from either octopine-type or nopaline-type Ti plasmids or from both.
  • “super-binary transformation vector” is meant a binary transformation vector additionally carrying in the vector backbone region a vir region of the Ti plasmid pTlBo542 of the super-virulent A. tumefaciens strain A281 (EP 0 604 662, EP 0 687 730). Super-binary transformation vectors are used in conjunction with a helper plasmid.
  • co-integrate transformation vector is meant a T-DNA vector at least comprising: (a) a T-DNA region comprising at least one gene of interest and/or at least one selectable marker active in plants; and (b) a vector backbone region comprising at least origins of replication active in Escherichia coli and Agrobacterium, and markers for selection in E. coli and Agrobacterium, and a set of vir genes necessary for enabling transfer of the T-DNA.
  • the T-DNA borders and said set of vir genes of a said T-DNA vector can be derived from either octopine-type or nopaline-type Ti plasmids or from both.
  • Ti-derived plant transformation vector is meant a binary transformation vector in which the T-DNA borders are derived from a Ti plasmid and said binary transformation vector being used in conjunction with a helper Ri-plasmid carrying the necessary set of vir genes.
  • selectable marker gene or “selectable marker” or “marker for selection” includes any gene which confers a phenotype to a cell in which it is expressed to facilitate the identification and/or selection of cells which are transfected or transformed with a gene construct of the invention or a derivative thereof.
  • Suitable selectable marker genes contemplated herein include the ampicillin resistance (Amp r , tetracycline resistance gene (Tc r ), bacterial kanamycin resistance gene (Kan 1 ), phosphinothricin resistance gene, neomycin phosphotransferase gene (nptll), hygromycin resistance gene, ⁇ -glucuronidase (GUS) gene, chloramphenicol acetyltransferase (CAT) gene, green fluorescent protein (gfp) gene, and luciferase gene, amongst others.
  • ampicillin resistance Amicillin resistance
  • Tc r tetracycline resistance gene
  • Kan 1 bacterial kanamycin resistance gene
  • neomycin phosphotransferase gene nptll
  • hygromycin resistance gene ⁇ -glucuronidase (GUS) gene
  • chloramphenicol acetyltransferase (CAT) gene green fluorescent protein (gfp)
  • agrolistics agrolistic transformation
  • agrolistic transfer a transformation method combining features of Agrobacterium-mediated transformation and of biolistic DNA delivery.
  • a T-DNA containing target plasmid is co-delivered with DNA/RNA enabling in plantal production of VirDl and VirD2 with or without, VirE2 (W09712046).
  • foreign DNA any DNA sequence that is introduced in the host's genome by recombinant techniques.
  • Said foreign DNA includes e.g. a T-DNA sequence or a part thereof such as the T-DNA sequence comprising the selectable marker in an expressible format.
  • Foreign DNA furthermore includes intervening DNA sequences as defined supra or infra.
  • the present invention provides a cytokinin receptor protein variant, characterized in that compared to the corresponding wild-type cytokinin receptor protein one or more amino acids within the CHASE domain of said cytokinin receptor protein are exchanged by another amino acid, wherein said one or more amino acids within the CHASE domain are selected from the group consisting of:
  • the W244 in Arabidopsis thaliana CRE1/AHK4 can be found in the conserved amino acid sequence F-E-X-X-X-(NZG)-W-X-(IZM)-X-X-M and is highlighted by underlining;
  • the F304 in Arabidopsis thaliana CRE1/AHK4 can be found in the conserved amino acid sequence (AZS)-R-X-(TZS)-G-K-X-(VZA)-L-T-X-P-F-(RZKZP)-L-(LZM) and is highlighted by underlining;
  • the R305 in Arabidopsis thaliana CRE1ZAHK4 can be found in the conserved amino acid sequence (AZSVR-X-rTZSVG-K-
  • LZM and the R as well as the K and the P which may be found in other plant cytokinin receptors at this position are highlighted by underlining; and the T317 in Arabidopsis thaliana CRE1ZAHK4 can be found in the conserved amino acid sequence G-V-(VZI)- (LZKZS)- ⁇ -(FZY)-(PZAZT)-V-Y and is highlighted by underlining.
  • the present invention provides a cytokinin receptor protein variant, wherein the one or more amino acids within the CHASE domain are selected from the group consisting of:
  • X is any amino acid and wherein the cytokinin receptor protein variant exhibits a reduced binding to cytokinin.
  • amino acids are shown in brackets and separated by slashes, it is to be understood that at this position two or more different amino acids can be found dependent on the cytokinin receptor examined.
  • (NZG) denotes that in some cytokinin receptors an N (asparagine) is found, whereas in other cytokinin receptors a G (glycine) is found at this position.
  • (RZKZP) denotes that in some cytokinin receptors an R (arginine) is found, in other cytokinin receptors a K (lysine) is found, and in other cytokinin receptors a P (proline) is found at the position in question.
  • the present invention provides a cytokinin receptor protein variant, wherein one or more amino acids within the CHASE domain are independently from each other non-conservatively exchanged.
  • the amino acids non-conservatively exchanged within the CHASE domain are the W244 in Arabidopsis thaliana CRE1/AHK4, the F304 in Arabidopsis thaliana CRE1/AHK4, the R305 in Arabidopsis thaliana CRE1/AHK4, the T317 in Arabidopsis thaliana CRE1/AHK4, the F216 in Arabidopsis thaliana CRE1/AHK4, the M249 in Arabidopsis thaliana CRE1/AHK4, the A262 in Arabidopsis thaliana CRE1/AHK4, the G282 in Arabidopsis thaliana CRE1/AHK4, the N288 in Arabidopsis thaliana CRE1/AHK4, the L325 in Arabidopsis thaliana CRE1/AHK4, the
  • the present invention provides a cytokinin receptor protein variant, wherein the one or more amino acids within the CHASE domain are independently from each other exchanged by an alanine, a glycine, a valine, a leucine, or an isoleucine.
  • the amino acids exchanged within the CHASE domain by an alanine, a glycine, a valine, a leucine, or an isoleucine are the W244 in Arabidopsis thaliana CRE1/AHK4, the F304 in Arabidopsis thaliana CRE1/AHK4, the R305 in Arabidopsis thaliana CRE1/AHK4, the T317 in Arabidopsis thaliana CRE1/AHK4, the F216 in Arabidopsis thaliana CRE1/AHK4, the M249 in Arabidopsis thaliana CRE1/AHK4, the A262 in Arabidopsis thaliana CRE1/AHK4, the G282 in Arabidopsis thaliana CRE1/AHK4, the N288 in Arabidopsis thaliana CRE1/AHK4, the L325 in Arabidopsis thaliana CRE1/AHK4, the L342 in Arabidopsis thaliana CRE1/AHK4, the G
  • the present invention provides a cytokinin receptor protein variant, wherein the CHASE domain is partially or completely deleted.
  • the CHASE domain of Arabidopsis thaliana CRE1/AHK4 based on homology considerations spans amino acids Ll 31 to A446, while the strongest homology is found in a region spanning N 198 to 141 1.
  • Preferably, of this domain at least 40%, at least 50%, at least 60, at least 70%, at least 80%, more preferably at least 90 %, even more preferably 100 % of the amino acids constituting the CHASE domain or amino acids corresponding to these amino acids in another cytokinin receptor are deleted.
  • this deletion comprises at least the amino acid segment of the CHASE domain of a given cytokinin receptor corresponding to amino acids 300 to 305, preferably amino acids 290 to 310, more preferably amino acids 280 to 330, more preferably amino acids 260 to 350, more preferably amino acids 240 to 380, more preferably amino acids 215 to 410, more preferably amino acids 195 to 410 and more preferably amino acids 130 to 446 of Arabidopsis thaliana CRE1/AHK4 or the amino acids corresponding thereto in another cytokinin receptor and wherein the cytokinin receptor protein variant having a deleted CHASE domain exhibits a reduced binding to cytokinin.
  • the exact end of the deletions does not appear particularly critical.
  • the deletion can start at amino acid 131, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300 and end at amino acid 305, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, or 446.
  • the deletion may cover amino acids 131 to 305, 131 to 310, 131 to 320 etc.
  • the wild-type cytokinin receptor protein on which the cytokinin receptor protein variant of the invention is based is selected from a cytokinin receptor protein derived from Cucurbita maxima, Zea mays, Oryza sativa or Phyllostachys praecox.
  • the cytokinin receptor protein on which the cytokinin receptor protein variant of the invention is based is selected from cytokinin receptor proteins listed in table 2.
  • the cytokinin receptor protein variant of the invention may comprise one or more further modifications selected from the group consisting of amino acid exchanges, amino acid insertions, and amino acid deletions.
  • the deletions can be internal deletions, N-terminal truncations and/or C-terminal truncations.
  • the cytokinin receptor protein variant preferably comprises from 1 to 100, from 1 to 80, from 1 to 60, from 1 to 50, from 1 to 40, from 1 to 30, from 1 to 20, from 1 to 15, from 1 to 12, or from 1 to 10 modifications.
  • These modifications can be any combination of amino acid exchanges, amino acid insertions, and amino acid deletions (i.e.
  • the cytokinin receptor protein variant comprises from 1 to 50, from 1 to 40, from 1 to 30, from 1 to 20, from 1 to 15, from 1 to 12, or from 1 to 10 amino acid insertions. In further preferred embodiments thereof the cytokinin receptor protein variant comprises from 1 to 50, from 1 to 40, from 1 to 30, from 1 to 20, from 1 to 15, from 1 to 12, or from 1 to 10 amino acid deletions. In other preferred embodiments thereof the cytokinin receptor protein variant comprises from 1 to 50, from 1 to 40, from 1 to 30, from 1 to 20, from 1 to 15, from 1 to 12, or from 1 to 10 amino acid substitutions.
  • the further modification leads to a molecule that is at least 50% identical to the cytokinin receptor, from which it is derived, preferably at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% identical to the cytokinin receptor.
  • the present invention further provides a polynucleotide comprising a nucleic acid sequence encoding any of the cytokinin receptor protein variants described throughout this specification.
  • the invention also provides a vector comprising said polynucleotide.
  • said vector is constructed in such a manner that the polynucleotide is operatively linked to expression control sequences allowing expression of the nucleic acid sequence encoding the cytokinin receptor protein variant in prokaryotic and/or eukaryotic host cells.
  • the present invention further provides a cell comprising the above polynucleotide or the above vector.
  • the present invention further provides a transgenic plant comprising a polynucleotide of the present invention or a vector of the present invention, or a cell of the present invention.
  • the invention also provides parts, cells, or seeds of said transgenic plant, as well as plants or propagating material thereof regenerated from said transgenic plant or from parts, cells, or seeds of said transgenic plant.
  • the present invention further relates to a process for making the above transgenic plant or the above propagating material, wherein a vector of the invention is introduced in a gene technological manner into cells of a plant, wherein the cells are transformed.
  • transformed cells are selected, and transformed plants are regenerated from the cells.
  • the cell that can be used include any cell that is known in the art to be transfectable with a vector including without limitation tissue culture cells and developing floral tissues as in the floral-dip method (Clough SJ and Bent AF (1998) Plant J. 16:735-43)
  • the present invention further relates to a use of a transgenic plant of the invention for producing seeds of enhanced size, with enhanced seed filling, with reduced seed loss and/or with more rapid germination, wherein the transgenic plants are cultured under culturing conditions and the preferably mature seeds are harvested.
  • the present invention also relates to a use of a transgenic plant of the invention for producing a live root system with increased root mass, root length and/or root branching, wherein the transgenic plant is cultured under culturing conditions.
  • this live root system with increased root mass, root length and/or root branching is useful for bioremediation and/or lodging resistance and/or altered mineral composition of the shoot and/or the harvested product and/or the root products.
  • this live root system is a rootstock used in a grafting procedure with a scion for improving the root-related characteristics of the resulting plant or tree (or similar).
  • the present invention further relates to a use of a transgenic plant of the invention for producing wood with modified characteristics, wherein the activity of the cambial tissue is modified, and wherein the transgenic plant is cultured under culturing conditions.
  • the present invention further relates to a use of a transgenic plant of the invention for producing a shoot with altered shoot architecture (i.e. with modified branching pattern), wherein the apical dominance in plants is altered, and wherein the transgenic plant is cultured under culturing conditions.
  • the present invention also relates to a use of a transgenic plant of the invention for producing leaves with altered leaf senescence, wherein the transgenic plant is cultured under culturing conditions.
  • the present invention also relates to a use of a transgenic plant of the invention for producing flowers with altered timing of reproduction, e.g. with later flower induction, wherein the transgenic plant is cultured under culturing conditions.
  • the present invention relates to a use of a transgenically expressed cytokinin receptor protein variant with reduced cytokinin binding activity for enhancing the seed size, the seed filling, the root mass, the root length and/or the root branching and/or for reducing seed loss and/or germination time of a plant endogenously expressing functional cytokinin receptors.
  • the present invention relates to a use of a transgenically expressed cytokinin receptor protein variant with reduced cytokinin binding activity for modifying the characteristics of wood, for altering shoot architecture (i.e. modifying the branching pattern of the shoot), for altering leaf senescence and other senescence processes and/or for altering the timing of reproduction, e.g. causing later flower induction.
  • cytokinin receptor protein variants exert on functional cytokinin receptors and, thus, which facilitates its use even in the presence of functional cytokinin receptors.
  • a cytokinin receptor protein variant of the present invention exerts this trans- dominant negative activity only on the corresponding cytokinin receptor protein present in the plant, e.g. a variant of the cytokinin receptor AHK4/CRE1 might only exert a trans- dominant negative activity on the endogenous wild-type AHK4/CRE1.
  • other cytokinin receptor proteins present in the plant e.g.
  • AHK2 or AHK3 of A. thaliana may exhibit normal activity.
  • the positive effect of suppressing cytokinin action could be achieved selectively for certain tissues, because the abundance of the different types of cytokinin receptors changes with tissue-type.
  • a cytokinin receptor protein variant of the present invention will exert its trans-dominant negative activity on two or more cytokinin receptor proteins present in the plant, even more preferably on all cytokinin receptor proteins present in the plant; e.g. a variant of the cytokinin receptor AHK4/CRE1 could exert a trans-dominant negative activity on the endogenous wild-type AHK2, AHK3, and AHK4/CRE1.
  • the effect of suppressing cytokinin action can be achieved for the whole plant.
  • the term "functional cytokinin receptors" is to be understood in that these cytokinin receptors are capable of binding cytokinin to the same or a slightly lower extent as wild- type cytokinin receptors.
  • the term “slightly lower extent” in this context means that the functional cytokinin receptors exhibit at least 80 % cytokinin binding activity, preferably at least 85 %, more preferably at least 90 %, even more preferably 95 % cytokinin binding activity as compared to the corresponding wild-type cytokinin receptor.
  • the cytokinin receptor protein variants of the present invention are used in the context of wild-type cytokinin expressing plants, however, it is also possible to use them in the context of plants carrying cytokinin receptor mutants with an already decreased cytokinin activity, in as long as the expression of the cytokinin receptor protein variant leads to a further lowering of the cytokinin receptor activity.
  • the cytokinin receptor protein variant comprises one or more amino acid exchanges in the CHASE domain.
  • the endogenously expressed cytokinin receptor the activity of which is down-regulated, comprises a wild-type CHASE domain.
  • the cytokinin receptor protein variant is any cytokinin receptor protein variant as described above, especially a cytokinin receptor variant, wherein the W244 in Arabidopsis thaliana CRE1/AHK4, the T301 in Arabidopsis thaliana CRE1/AHK4, the F304 in Arabidopsis thaliana CRE1/AHK4, the R305 in Arabidopsis thaliana CRE1/AHK4, the T317 in Arabidopsis thaliana CRE1/AHK4, the F216 in Arabidopsis thaliana CRE1/AHK4, the M249 in Arabidopsis thaliana CRE1/AHK4, the A262 in Arabidopsis thaliana CRE1/AHK4, the G282 in Arabidopsis thaliana CRE1/AHK4, the N288 in Arabidopsis thaliana CRE1/AHK4, the L325 in Arabidopsis thaliana CRE1/AHK4, the L342 in Arabid
  • these mutations are made on the basis of the teaching above with respect to the cytokinin receptor protein variants as such, e.g. preferably the amino acids are non-conservatively exchanged and more preferably they are exchanged by an alanine, a glycine, a valine, a leucine, or an isoleucine.
  • the cytokinin receptor protein variant has a partially or completely deleted CHASE domain. As set out above the CHASE domain of Arabidopsis thaliana CRE1/AHK4 based on homology considerations spans amino acids Ll 31 to A446, while the strongest homology is found in a region spanning Nl 98 to 1411.
  • this domain at least 40%, at least 50%, at least 60, at least 70%, at least 80%, more preferably at least 90 %, and even more preferably 100 % of the amino acids constituting the CHASE domain or amino acids corresponding to these amino acids in another cytokinin receptor are deleted.
  • this deletion comprises at least the amino acid segment of the CHASE domain of a given cytokinin receptor corresponding to amino acids 300 to 305, preferably amino acids 290 to 310, more preferably amino acids 280 to 330, more preferably amino acids 260 to 350, more preferably amino acids 240 to 380, more preferably amino acids 215 to 410, more preferably amino acids 195 to 410 and more preferably amino acids 130 to 446 of Arabidopsis thaliana CRE1/AHK4 or the amino acids corresponding thereto in another cytokinin receptor and wherein the cytokinin receptor protein variant having a deleted CHASE domain exhibits a reduced binding to cytokinin.
  • the exact end of the deletions does not appear particularly critical.
  • the deletion can start at amino acid 131, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300 and end at amino acid 305, 310, 320, 330, 340, 350, 360, 370, 380. 390. 400, 410, 420, 430, 440, or 446.
  • the deletion may cover amino acids 131 to 305, 131 to 310, 131 to 320 etc.
  • the endogenously expressed cytokinin receptor comprises a wild-type CHASE domain.
  • the cytokinin receptor protein variant is tissue-specifically expressed, even more preferred the cytokinin receptor variant is specifically expressed in tissue selected from the group consisting of root tissue, embryo tissue, endosperm tissue, and aleurone tissue.
  • the present invention further relates to a method for enhancing the seed size, the seed filling, the root mass, the root length and/or the root branching and/or for reducing seed loss and/or germination time of a plant, comprising the steps of endogenously expressing functional cytokinin receptors.
  • the polynucleotide is any of the above polynucleotides or any of the above vectors.
  • expression of the polynucleotide is controlled by a tissue-specific regulatory element; preferably the tissue for which the regulatory element is specific is selected from the group consisting of root tissue, embryo tissue, endosperm tissue, and aleurone tissue.
  • tissue-specific regulatory element is a promoter selected from the group consisting of the promoters disclosed in table 1.
  • the invention relates to a method for making seeds of enhanced size, with enhanced seed filling, reduced seed loss and/or germination time, wherein the transgenic plant, parts thereof, or seeds of the invention are cultured under culturing conditions and preferably mature seeds being produced thereby are harvested.
  • the present invention provides seeds obtainable by any of the methods set forth above.
  • Cytokinin-receptors are known from several plants. Cytokinin-receptors of
  • Arabidopsis are in particular AHK2, AHK3 and CRE1/AHK4.
  • different combinations of cytokinin receptor protein variants may be introduced.
  • the optimum combination of cytokinin receptor protein variants to be introduced may be identified by simple experiments.
  • Plant cytokinin receptor genes other than Arabidopsis have been published by e.g. in
  • CHASE domain The CHASE domain of CRE1/AHK4 has on the protein level 70% homology with the closest homologous sequence, which is found in rice. Homology to one HK of maize is 68%, to Arabidopsis AHK3 60%, and to AHK2 59%. There are other related domains with homologies in the range of 30-50%.
  • sequence matching may be calculated using e.g. BLAST, BLAT or BlastZ (or BlastX).
  • sequence matching analysis may be supplemented by established homology mapping techniques like Shuffle-LAGAN (Brudno M., Bioinformatics 2003b, 19 Suppl 1 :154-162) or Markov random fields.
  • the invention allows obtaining favorable phenotype features, but avoiding unfavorable phenotype features.
  • conserved amino acids identified within this invention this may be put to practice for essentially all plants of commercial interest by simply identifying the amino acids corresponding to the conserved amino acid residues of the invention and by exchanging them non-conservatively.
  • enhanced root branching may be obtained without dwarf growth of other plant parts.
  • yield parameters like the harvest index are considerably improved.
  • the target tissue is preferably selected from the group consisting of "root tissue, embryo tissue, endosperm tissue, and aleurone tissue".
  • the target tissue is root tissue and other tissue is not target tissue, a plant is obtained, which shows enhanced root branching but unaltered shoot growth.
  • the target tissue is embryo tissue, endosperm tissue or aleurone tissue, but other tissue is not target tissue, larger seeds are obtained at unaltered other properties of the plant. It is, however, also possible to combine both said subgroups of target tissue, provided that other tissue is not target tissue. This will result in a plant, wherein both, root branching and seed size are enhanced. This is most favorable since the increase in yield parameters is enhanced further.
  • Tissue specific expression of cytokinin receptor protein variants may be achieved in that the expression of the compound is controlled by a regulatory element, which is tissue specific, i.e. promotes expression only in the target tissue and not in tissue not being target tissue.
  • the transgenic plant of the invention is naturally not capable of reducing cytokinin- receptor binding activity tissue-specifically.
  • a foreign DNA sequence is introduced by genetic engineering, which encodes for at least one nucleic acid or at least one protein or peptide, wherein the foreign DNA sequence stands under the control of a tissue-specific regulatory element.
  • the transgenic plant of the invention produces seeds of enhanced size, enhanced seed filling, reduced seed loss, reduced germination time and/or produces roots with enhanced branching, length and/or mass.
  • the invention further comprises a method for enhancing the seed size, the seed filling, the root mass, the root length and/or the root branching and/or for reducing seed loss and/or germination time of a plant, wherein the activity of the cytokinin-receptor is essentially unaltered in tissue not being target tissue.
  • the target tissue is preferably selected from the group consisting of "root tissue, embryo tissue, endosperm tissue, and aleurone tissue".
  • the tissue-specific regulatory element may be a promoter selected from the group consisting of the elements of the table 1 or any other promoter of the said specificity. Further details about applicable promoters and how to identify such promoters are obtainable from the following data sources.
  • Plants with an enhanced root system are better adapted to stress, they enhance plant vigour, they grow better on soil poor in nutritional elements (minerals), they show improved growth with limited water resources and enhanced resistance to drought finally leading to improved yield parameters, in particular an improved harvest index. They can also be used for phytoremediation, i.e. plant mediated removal of toxic substances from soil, and/or prevention and/or arrest of soil erosion.
  • the methods of the invention as well as the plants thereof typically result in enhanced growth of the primary root and/or strongly enhanced root branching.
  • Improvement of the root system in particular is favourable for staple crops, like sugar beet, manioc, yams, sweet potato, vegetables with consumable root parts like carrots and radish, and medicinal plants with usable root parts, like ginseng.
  • the yield parameters of other crops like wheat, maize etc. are increased, since the plant growth is improved due to the comparatively better uptake of water and nutritional substances from the soil. Plants with an increased seed size provide higher yield parameters for obvious reasons.
  • the present invention is applicable to any plant, in particular to monocotyledonous plants and dicotyledonous plants including a fodder or forage legume, ornamental plant, food crop, tree, or shrub selected from the list comprising Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Avena sativa, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp, Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chaen
  • Means for introducing foreign resp. recombinant DNA into plant tissue or cells include, but are not limited to, transformation using CaCl 2 and variations thereof, in particular the method described by Hanahan (1983), direct DNA uptake into protoplasts (Krens et al, 1982; Paszkowski et al, 1984), PEG-mediated uptake to protoplasts (Armstrang et al, 1990) microparticle bombardment, electroporation (Fromm et al., 1985), microinjection of DNA (Crossway et al., 1986), microparticle bombardment of tissue explants or cells (Christau et al, 1988; Sanford, 1988), vacuum-infiltration of tissue with nucleic acid, or in the case of plants, T-DNA-mediated transfer from Agrobacterium to the plant tissue as described essentially by An et al.(1985), Dodds et al., (1985), Herrera- Estrella et al.
  • Methods for transformation of monocotyledonous plants are well known in the art and include Agrobacterium-mediated transformation (WO 97/48814; WO 98/54961; WO 94/00977; WO 98/17813; WO 99/04618; WO 95/06722), microprojectile bombardment (US 5,969,213; US 5,736,369; WO 94/13822; US 5,874,265 / US 5,990,390; US 5,405,765; US 5,955,362), DNA uptake (WO 93/18168), microinjection of Agrobacterium cells (DE 43 092 03) and sonication (US 5,693,512).
  • Agrobacterium-mediated transformation WO 97/48814; WO 98/54961; WO 94/00977; WO 98/17813; WO 99/04618; WO 95/06722
  • microprojectile bombardment US 5,969,213; US 5,736,369; WO 94/
  • a microparticle is propelled into a cell to produce a transformed cell.
  • Any suitable ballistic cell transformation methodology and apparatus can be used in performing the present invention. Exemplary apparatus and procedures are disclosed in US 5,122,466 and US 4,945,050.
  • the gene construct may incorporate a plasmid capable of replicating in the cell to be transformed. Examples of microparticles suitable for use in such systems include 1 to 5 ⁇ m gold spheres.
  • the DNA construct may be deposited on the microparticle by any suitable technique, such as by precipitation. A whole plant may be regenerated from the transformed or transformed cell, in accordance with procedures well known in the art.
  • Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a gene construct of the present invention and a whole plant regenerated therefrom.
  • the particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed.
  • Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem).
  • the plant produced according to the inventive method is transfected or transformed with a genetic sequence, or amenable to the introduction of a cytokinin receptor protein variant by any art-recognized means, such as microprojectile bombardment, microinjection, Agrobacterium-mediated transformation (including in planta transformation), protoplast fusion, or electroporation, amongst others.
  • a cytokinin receptor protein variant by any art-recognized means, such as microprojectile bombardment, microinjection, Agrobacterium-mediated transformation (including in planta transformation), protoplast fusion, or electroporation, amongst others.
  • said plant is produced by Agrobacterium-mediated transformation.
  • Agrobacterium-mediated transformation or agrolistic transformation of plants, yeast, moulds or filamentous fungi is based on the transfer of part of the transformation vector sequences, called the T-DNA, to the nucleus and on integration of said T-DNA in the genome of said eukaryote.
  • the present invention relates to a method for making plants with increased root mass, root length and/or root branching and/or for reducing seed loss and/or germination time of a plant, wherein the transgenic plant, parts thereof, or seeds of the present invention are cultured under culturing conditions.
  • Fig. 1 Domain structure of CRE1/AHK4 and secondary structure prediction of the CHASE domain.
  • Fig. 2 The CHASE domain of CRE1/AHK4 is necessary for cytokinin binding.
  • Fig. 3 Phylogenetic tree and alignment of CHASE domains.
  • Fig. 4 Identification of amino acid residues of the CRE1/AHK4 CHASE domain important for ligand binding.
  • FIG. 5 T-DNA regions of the crel/ahk4 fusion genes in the binary vector pGPTV-nptll.
  • A pGPTV-PFWA-tfM4,
  • B pGPTV-PPYK10- ⁇ / ⁇ A:4;
  • C T-DNA the binary vector pB2GW7 harbouring a 35S:crel/ahk4 gene.
  • Fig. 6 Full sequence alignment of the CHASE domain from various organisms. The sequences are labelled with GI numbers and the start and end position of the subset of the sequences used for the alignment is given. In case of EST data, the complete translated sequences were used. Evolutionary site rate categories for the 5 subclasses depicted in Fig. 3 are given below the alignment. The amino acids W244, K297, F304, R305 or T317 of A. thaliana CRE1/AHK4, which were examined in the mutagenesis studies (example Ib), and the corresponding amino acids in other plant cytokinin receptors are in bold type.
  • Fig. 7 Amino acid sequence of CRE1/AHK4.
  • the amino acids W244, K297, F304, R305 or T317 of A. thaliana CRE1/AHK4 which were examined in the mutagenesis studies (example Ib) are in bold type.
  • Amino acids F216, M249, A262, G282, N288, L325, T301 , L325, L342, G343, V352, M410, which can also be mutated to arrive at the cytokinin receptor variants of the present invention, are marked by grey background.
  • Example Ia Characterization of the cvtokinin binding site by using truncated CRE1/AHK variants
  • Truncated variants of CRE1/AHK4 were generated by PCR using the respective primers (Table 3) and cloned into the entry vector pDONR221 of the GatewayTM cloning system (Invitrogen, Carlsbad). Subsequently, all clones were shuttled into the pDEST15 vector (Invitrogen, Carlsbad) and transformed into the E. coli strain BL21(DE3)pLys (Novagen, San Diego). Table 3: Primers used for cloning in the different amino acid substitutions and truncation experiments
  • Proteins were transferred to PVDF membrane (Bio-Rad) using a tank transfer system (Bio-Rad) with Towbin buffer without methanol (Towbin, H. et al. (1979) Proc. Natl. Acad. Sci. U S A 76, 4350-4). After blocking for 2 h at room temperature with Tris- buffered saline (TBS) including 5% low fat dried milk powder, the membrane was incubated with anti GST primary antibody (B-14) (1 :500 in blocking buffer; Santa Cruz Biotechnology, Heidelberg, Germany) 3 h at room temperature.
  • TBS Tris- buffered saline
  • B-14 anti GST primary antibody
  • Horseradish peroxidase- conjugated goat anti mouse secondary antibody (1 :4000 in blocking buffer; Santa Cruz Biotechnology, Heidelberg, Germany) and enhanced chemiluminescence reagent (Pierce SuperSignal West Pico; Perbio Science, Bonn, Germany) were used for detection. Blots were exposed to Pierce CL-Xposure films (Perbio Science).
  • the cytokinin binding domain of CRE1/AHK4 was mapped by expressing the cytoplasmic part, the CHASE domain with the adjacent transmembrane domains as GST- fusion proteins in E. coli (Fig. IA).
  • the cytokinin binding capacity was tested in an in vivo binding assay (Romanov, G. A. et al. (2005) Anal. Biochem. 347, 129-134) and compared to the binding capacity of the full-length protein in the same experimental setup.
  • the full- length protein showed the highest relative frvms-zeatin binding (Fig. 2).
  • the binding capacity was slightly lower in the truncated version of CRE1/AHK4 consisting of the CHASE domain and the flanking transmembrane domains.
  • the cytoplasmic domain and the empty vector control showed very weak or no binding (Fig. 2).
  • the results of the binding assay clearly demonstrate that the CHASE domain is the cytokinin binding domain of CREl/AHK4.
  • Example Ib Characterization of the cytokinin binding site by using CREl /AHK variants with amino acid exchanges
  • the CHASE domain is the cytokinin binding domain of
  • CRE1/AHK4 the inventors further characterized the cytokinin binding site by mutagenesis studies which were based on a novel bioinformatics analysis. Functional differences between subgroups of a protein family are often reflected in the evolutionary rates of amino acid substitutions. Sites, crucial to protein function, are under strong selection and evolve at slow substitution rates (Kimura, M. (1983) The neutral theory of molecular evolution (Cambridge University Press, Cambridge [Cambridgeshire]; New York). By comparing evolutionary site rates of homologous sites from different subgroups of a given protein or domain family, it is possible to identify amino acid positions with highly varying rates indicating functional divergence (Gaucher, E. A. et al. (2002) Trends Biochem. Sci. 27, 315-21).
  • the cytokinin binding assay and immunoblotting was carried out as described in example Ia.
  • Sequences containing the CHASE domain were retrieved from Genbank's non- redundant database using a Hidden Markov Model, which was built from a representative multiple sequence alignment (Anantharaman, V. & Aravind, L. (2001) Trends in Biochem. Sci. 26, 579-82) obtained from the Pfam database (HMMER package, http://hmmer.wustl.edu/).
  • Genbank's EST database was searched with the CHASE domain of CRE1/AHK4. EST sequences were translated into proteins. Sequences were aligned with hmmalign (HMMER). The alignment was manually optimized (Fig. 6) and used to calculate a phylogenetic tree with CLUSTAL W (Thompson, J.
  • a phylogenetic tree built of CHASE domains from plants, slime-molds, cyanobacteria and proteobacteria reveals distinct subgroups, one of which includes all plant sequences.
  • the plant subgroup has either a basic amino acid or a proline, while in the other subgroups the class of amino acids is not conserved.
  • Another candidate is the residue 301, as the threonine is highly conserved in plants only, but not in the other subgroups.
  • an allele mutated in this position which leads to an amino acid change to isoleucine, is known as wooden leg (wol) and was discovered in a screen for altered root morphology (Mah ⁇ nen, A. P. et al. (2000) Gen. Dev. 14, 2938-43).
  • Analysis of this only known mutation of the CHASE domain in plants revealed the complete loss of cytokinin binding of the mutant protein (Yamada, H. et al. (2001) Plant Cell Physiol. 42, 1017-23). This mutation was included as a positive control in the analysis.
  • Example 2 General decrease of cytokinin signaling by expressing receptor variants under control of a constitutive promoter
  • CRE1/AHK4 mutant alleles described in example 1 are expressed in Ar ⁇ bidopsis plants. Constitutive expression is achieved by the cauliflower mosaic virus promoter 35S (CaMV35S). The mutations are introduced by site-directed mutagenesis according to established procedures. The resulting ⁇ hk4lcrel alleles are named by the amino acid exchange. Experiments described here are carried out with ⁇ hk4-F304A and ⁇ hk4-T317A. For reasons of simplicity the alleles will be named ⁇ hk4 in the following experiments.
  • modified ⁇ hk4 (F304A or T317A) is amplified via PCR using template
  • AAAAAGCAGGCTTGATGAACTGGGCACTCAAC (SEQIDNO.: 19)
  • pDONR201-uni- ⁇ M4-reverse AGAAAGCTGGGTAATTCGACGAAGGTGAGATAG (SEQ IDNO.: 20)
  • ahk4 is recombined into the attP 1 and attP2 sites of the pDONR201 vector. This is accomplished with the BP ClonaseTM, which catalyses the BP-reaction. The resulting pENTR201- ⁇ /*& ⁇ vector is subsequently transformed in the c ⁇ /5-sensitive E. coli strain DH5 ⁇ .
  • Step3 pENTR201- ⁇ M ⁇ is extracted from E. coli cells, purified and directionally cloned into the attRl and attR2 sites of the pB2GW7 vector (Flanders Interuniversity, Institute for
  • pB2GW7 is a plant expression vector with a
  • CaMV35S promoter other constitutive plant promoter elements selected from the group consisting of CaMVl 9S plant promoter, FMV34S plant promoter, sugarcane bacilliform badnavirus plant promoter, CSVMV plant promoter, Arabidopsis ACT2/ACT8 actin plant promoter, Arabidopsis ubiquitin UBQl plant promoter, barley leaf thionin BTH6 plant promoter, and rice actin plant promoter may also be used.
  • CaMVl 9S plant promoter FMV34S plant promoter
  • sugarcane bacilliform badnavirus plant promoter CSVMV plant promoter
  • Arabidopsis ACT2/ACT8 actin plant promoter Arabidopsis ubiquitin UBQl plant promoter
  • barley leaf thionin BTH6 plant promoter and rice actin plant promoter
  • Fig. 8A shows that elongation of primary roots of a transgenic line harbouring the F304A receptor variant is enhanced compared to wild type. A less strong effect was noted for the T317 A variant. Subsequently, the elongation of the primary root on cytokinin-containing medium
  • Figs. 8B and 8C show that in particular seedlings of clone F304A continue to grow on cytokinin-containing medium while growth of wild type roots was inhibited. Thus transgenic lines expressing this receptor variant are more resistant against cytokinin.
  • Fig. 9 shows that in vitro grown plants harbouring the F304A or T317A receptor variants develop a significantly enhanced root system.
  • Example 3 Increase of plant seed size Introduction To generate plants with larger seeds the CRE1/AHK4 mutant alleles described in example 1, which code for a mutated CHASE-domain, are expressed. Tissue-specific expression is accomplished by an endosperm specific promoter. The mutations are introduced by site-directed mutagenesis according to established procedures. The resulting crel/ahk4 alleles are named by the amino acid exchange. The experiments described below are done with ahk4-F304A and ahk4-T317A. For reasons of simplicity the alleles will be named ahk4 in the following experiments.
  • Step 1 Cloning of the endosperm-specific promoter in pUC19.
  • the cloning is exemplarily described with the FWA promoter (Luo et al. (2000) Proc Natl Acad Sci U S A. 97, 10637-10642).
  • the PCR-based cloning of the FWA promoter (Ace. No.: AT4G25530) is carried out using HmdIII and Psil for directional insertion with these two primers:
  • pFWA-forward TACAAAGCTTCCCGGGTTAATATTATGGGAAGGAGT (SEQ ID NO.: 23)
  • pFWA-reverse GAACTGCAGCCTAGGTTTCCCTCAATGCAATAACCT (SEQ ID NO.: 24).
  • the FWA promoter (of 2104 bp length) is amplified in a PCR reaction. Restriction enzymes HmdIII and Psil are used for directional cloning into the MCS of pUC19.
  • pUC19- ⁇ M4-forward TAGGATCCTGGAGTGGCTTATGCTGAAA (SEQ ID NO.: 25)
  • pUC19- ⁇ M4-reverse AGCCTAGGAACGGTATTGGTGCCTTTTG (SEQ IDNO.: 26).
  • Step 3 Cloning of the FWA promoter and the linked ahk4 mutant gene in the binary vector (pGPTV-nptll; Becker et al. (1992) Plant MoI. Biol., 20, 1195-1 197) using the Sma ⁇ restriction enzyme.
  • the T-DNA of the resulting plasmid pGPTV-PFWA-ahk4 is shown in Fig. 5.
  • Step 4 Transformation of the resulting pGPTV-PF WA-ahk4 in Agrobacterium strain GV3101. Transformation of the T-DNA by the flower dip vacuum infiltration method in Arabidopsis thaliana.
  • the cloning is exemplarily described with the PYKlO promoter (Nitz, I. et al. (2001) Plant Sci. 161, 337-346).
  • the PCR-based cloning of the PYKlO promoter, (Ace. No.: AT3G09260) is carried out using HmdIII and Pstl for directional insertion with these two primers:
  • pP YKl 0-forward TACAAAGCTTCCCGGGGAGCCCACCGTCCACCAATA (SEQ ID NO.: 27)
  • pPYKIO-reverse GGATCCGAACAGCCTAGGTTTTGTTTGTAATTCTGATT
  • the PYKlO promoter (of 2038 bp length) is amplified in a PCR reaction. Restriction enzymes HmdIII and BamYW are used for directional cloning into the MCS of pUC19.
  • Step 4 Transformation of the resulting plasmid pGPTV-PPYK10-ahk4 in Agrobacterium strain GV3101. Transformation of the T-DNA (see Fig. IB) by the flower dip vacuum infiltration method in Arabidopsis thaliana.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physiology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des variants protéiques du récepteur de la cytokinine présentant une liaison réduite à la cytokinine, des polynucléotides codant pour ces variants protéiques du récepteur de la cytokinine, des vecteurs et des cellules comprenant ces polynucléotides, et des plantes transgéniques comprenant ces polynucléotides, vecteurs et cellules. L'invention concerne, en outre, un procédé pour fabriquer ces plantes transgéniques et l'utilisation de ces plantes transgéniques pour produire des graines présentant une taille et un remplissage améliorés, une perte de graines réduite et/ou une germination plus rapide, et/ou un système de racines présentant une masse, une longueur et/ou des ramifications améliorées. L'invention concerne également un procédé pour améliorer la taille et le remplissage de graines, réduire la perte de graines, et/ou accélérer la germination, et/ou augmenter la masse, la longueur et/ou la ramification des racines d'une plante; des graines peuvent être obtenues par les procédés de la présente invention.
PCT/EP2007/004729 2006-05-30 2007-05-29 Variants du récepteur de la cytokinine et leur utilisation WO2007137810A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US80927906P 2006-05-30 2006-05-30
US60/809,279 2006-05-30

Publications (1)

Publication Number Publication Date
WO2007137810A1 true WO2007137810A1 (fr) 2007-12-06

Family

ID=38442504

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2007/004729 WO2007137810A1 (fr) 2006-05-30 2007-05-29 Variants du récepteur de la cytokinine et leur utilisation

Country Status (1)

Country Link
WO (1) WO2007137810A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2272862A1 (fr) * 2009-07-10 2011-01-12 Freie Universität Berlin Rock2 et rock3, deux nouvelles variantes de gain de fonction des récepteurs de cytokine AHK2 et AHK3
CN107122870A (zh) * 2017-05-17 2017-09-01 宁波城市职业技术学院 一种估算高产雷竹林氮素需求量的计量模型

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002044337A2 (fr) * 2000-11-29 2002-06-06 New York University Gene wooden leg, promoteur et utilisations de ce dernier

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002044337A2 (fr) * 2000-11-29 2002-06-06 New York University Gene wooden leg, promoteur et utilisations de ce dernier

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
ANANTHARAMAN V ET AL: "The CHASE domain: a predicted ligand-binding module in plant cytokinin receptors and other eukaryotic and bacterial receptors", TRENDS IN BIOCHEMICAL SCIENCES, ELSEVIER, HAYWARDS, GB, vol. 26, no. 10, 1 October 2001 (2001-10-01), pages 579 - 582, XP004335862, ISSN: 0968-0004 *
ARI PEKKA MAHONEN ET AL: "A NOVEL TWO-COMPONENT HYBRID MOLECULE REGULATES VASCULAR MORPHOGENESIS OF THE ARABIDOPSIS ROOT", GENES AND DEVELOPMENT, COLD SPRING HARBOR LABORATORY PRESS, PLAINVIEW, NY, US, vol. 14, 2000, pages 2938 - 2943, XP002952926, ISSN: 0890-9369 *
DERUERE JEAN ET AL: "Molecular mechanisms of cytokinin signaling", JOURNAL OF PLANT GROWTH REGULATION, vol. 21, no. 1, March 2002 (2002-03-01), pages 32 - 39, XP002449758, ISSN: 0721-7595 *
HEYL ALEXANDER ET AL: "Cytokinin signal perception and transduction.", CURRENT OPINION IN PLANT BIOLOGY, vol. 6, no. 5, October 2003 (2003-10-01), pages 480 - 488, XP002362524, ISSN: 1369-5266 *
HEYL ALEXANDER ET AL: "Evolutionary proteomics identifies amino acids essential for ligand-binding of the cytokinin receptor CHASE domain", BMC EVOLUTIONARY BIOLOGY, BIOMED CENTRAL LTD., LONDON, GB, vol. 7, no. 1, 17 April 2007 (2007-04-17), pages 62, XP021022137, ISSN: 1471-2148 *
HIGUCHI MASAYUKI ET AL: "In planta functions of the Arabidopsis cytokinin receptor family", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 101, no. 23, 8 June 2004 (2004-06-08), pages 8821 - 8826, XP002362523, ISSN: 0027-8424 *
MOUGEL C ET AL: "CHASE: an extracellular sensing domain common to transmembrane receptors from prokaryotes, lower eukaryotes and plants", TRENDS IN BIOCHEMICAL SCIENCES, ELSEVIER, HAYWARDS, GB, vol. 26, no. 10, 1 October 2001 (2001-10-01), pages 582 - 584, XP004335863, ISSN: 0968-0004 *
NISHIMURA CHIKA ET AL: "Histidine kinase homologs that act as cytokinin receptors possess overlapping functions in the regulation of shoot and root growth in Arabidopsis", PLANT CELL, vol. 16, no. 6, June 2004 (2004-06-01), pages 1365 - 1377, XP002362522, ISSN: 1040-4651 *
PAS J ET AL: "Structure prediction, evolution and ligand interaction of CHASE domain", FEBS LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 576, no. 3, 22 October 2004 (2004-10-22), pages 287 - 290, XP004605701, ISSN: 0014-5793 *
ROMANOV ET AL: "A live cell hormone-binding assay on transgenic bacteria expressing a eukaryotic receptor protein", ANALYTICAL BIOCHEMISTRY, ACADEMIC PRESS, SAN DIEGO, CA, US, vol. 347, no. 1, 1 December 2005 (2005-12-01), pages 129 - 134, XP005502683, ISSN: 0003-2697 *
WERNER T ET AL: "Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem activity", PLANT CELL, AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, ROCKVILLE, MD, US, vol. 15, no. 11, November 2003 (2003-11-01), pages 2532 - 2550, XP002288482, ISSN: 1040-4651 *
YAMADA H ET AL: "THE ARABIDOPSIS AHK4 HISTIDINE KINASE IS A CYTOKININ-BINDING RECEPTOR THAT TRANSDUCES CYTOKININ SIGNALS ACROSS THE MEMBRANE", PLANT AND CELL PHYSIOLOGY, JAPANESE SOCIETY OF PLANT PHYSIOLOGISTS, XX, vol. 42, no. 9, September 2001 (2001-09-01), pages 1017 - 1023, XP008058224, ISSN: 0032-0781 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2272862A1 (fr) * 2009-07-10 2011-01-12 Freie Universität Berlin Rock2 et rock3, deux nouvelles variantes de gain de fonction des récepteurs de cytokine AHK2 et AHK3
WO2011004005A1 (fr) * 2009-07-10 2011-01-13 Freie Universität Berlin Rock2 et rock3, deux nouvelles variantes à gain de fonction des récepteurs ahk2 et ahk3 des cytokinines
US9127073B2 (en) 2009-07-10 2015-09-08 Freie Universitat Berlin Rock2 and Rock3, two new gain-of-function variants of the cytokinin receptors AHK2 and AHK3
CN107122870A (zh) * 2017-05-17 2017-09-01 宁波城市职业技术学院 一种估算高产雷竹林氮素需求量的计量模型

Similar Documents

Publication Publication Date Title
AU2006265264B2 (en) Plants having increased yield and a method for making the same
EP1756284A1 (fr) Procede de modification de la morphologie, de la biochimie et de la physiologie des plantes, comprenant l'expression de l'oxydase de cytokinine dans les graines
EP1723242B1 (fr) Plantes présentant des charactéristiques de croissance modifiées et procédé de fabrication associé
US20110179527A1 (en) Plants Having Increased Yield and Method for Making the Same
US8648231B2 (en) Wall-associated kinase-like polypeptide mediates nutritional status perception and response
AU2004303529B2 (en) Plants having increased yield and method for making the same
EP2121935B1 (fr) Répresseurs transcriptionnels de la signalisation par cytokinine et leur utilisation
CA2594541A1 (fr) Plantes a rendement accru et leur procede de production
US8598411B2 (en) Plants having improved growth characteristics and a method for making the same
AU2006226460B2 (en) Plants having increased yield and a method for making the same
EP1590466B1 (fr) Methodes permettant de modifier les caracteristiques de croissance de plantes
WO2007137810A1 (fr) Variants du récepteur de la cytokinine et leur utilisation
WO2007003317A2 (fr) Plante transgenique a activite du recepteur de cytokinine reduite selectivement par rapport a un tissu
WO2004029257A1 (fr) Plantes transformees a l'aide de cdc27a au developpement modifie

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07725623

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07725623

Country of ref document: EP

Kind code of ref document: A1