WO2007131345A1 - Genetic risk factor in sod1 and sfrs15 in renal disease, diabetic cataract, cardiovascular disease and longevity - Google Patents

Abstract

The invention relates to a composition comprising an isolated nucleic acid sequence that specifically hybridizes to at least one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 and their complements. The composition is useful as a probe to detect the presence of at least one allele of three single nucleotide polymorphisms (SNPs) that are associated with renal disease, cataract, cardiovascular disease and longevity.

Description

Title: GENETIC RISK FACTOR IN SOD1 AND SFRS15 IN RENAL DISEASE, DIABETIC CATARACT, CARDIOVASCULAR DISEASE AND

LONGEVITY

Field of the invention

[0001] The invention relates to methods and compositions for screening, detecting or diagnosing a risk of developing renal disease, particularly diabetic nephropathy or diabetic cataract. The invention also relates to methods and compositions for determining survival in the general population.

Background of the invention

The Diabetes Control and Complications Trial (DCCT).

[0002] The DCCT was a multi-center randomized clinical trial to compare intensive and conventional insulin therapy with regard to their effects on the development and progression of early vascular and neurological complications of T1 D [The DCCT Research Group, in Diabetes. 1986. p. 530- 45; The Diabetes Control and Complications Trial Research Group, in N Engl J Med. 1993. p. 977-86]. From 1983-9, 1 ,441 unrelated type 1 diabetes ("T1 D") patients were recruited from 29 centers across North America in two cohorts: the primary (prevention) cohort (n=726) was studied to determine if intensive therapy prevented the development of diabetic retinopathy in patients with no retinopathy; the secondary (intervention) cohort (n=715) was recruited to determine whether intensive therapy would affect the progression of early retinopathy. Intensive therapy consisted of three or more daily insulin injections, or use of an insulin pump, with frequent blood glucose monitoring, while conventional treatment consisted of one or two daily insulin injections. The main outcome measures during the DCCT included seven-field fundus photographs (obtained every six months), HbA_1c and urinary albumin excretion rate (AER) per 24 hours. DCCT probands were followed for a mean of 6.5 years (range 3-9 years) and the trial was terminated prematurely because of significant findings. The DCCT demonstrated that intensive therapy aimed at reducing glycemic exposure reduced the development and progression of long-term complications by as much as 76% compared with conventional therapy [The Diabetes Control and Complications Trial Research Group, in N Engl J Med. 1993. 329(14): p. 977-86]. After completion of DCCT in 1993, 96% of subjects have continued follow-up in a study named: Epidemiology of Diabetes Interventions and Complications (EDIC) and have had their complications measured for the last 12 years in EDIC and will continue to be followed for at least another 10 years.

Genetics of Diabetic Nephropathy. [0003] The development of diabetic nephropathy occurs in only a minority of subjects despite long duration and poor glycemic control. The prevalence of nephropathy differs by ethnicity, with higher prevalence rates seen in non-Ashkenazi vs Ashkenazi Jews [Kalter-Leibovici, O., et al., Diabetes, 1991. 40(2): p. 204-10] and higher rates in Blacks, Asians, and Latinos compared to Whites [Karter, A.J., et al., Jama, 2002. 287(19): p. 2519-27]. There have been four family studies showing familial clustering of nephropathy in T1 D [Seaquist, E.R., et al., N Engl J Med, 1989. 320(18): p. 1161-5; Borch-Johnsen, K., et al., 1992. 41(4): p. 719-22; Quinn, M., et al., Diabetologia, 1996. 39(8): p. 940-5; Harjutsalo, V., et al., Diabetes, 2004. 53(9): p. 2449-54]. In the DCCT family study significant clustering of microalbuminuria, as defined by AER >40 mg/24 hour, was observed in both the intensive and conventional treatment arms of the secondary cohort [The Diabetes Control and Complications Trial Research Group. Diabetes, 1997. 46(11): p. 1829-39]. In addition, correlations of nephropathy grade (log AER) were significant for parent-offspring pairs (r=0.41 , p< 0.01). Finally, in a study of glomerular structure from biopsy specimens of T1 D sibs [Fioretto, P., et al., Diabetes, 1999. 48(4): p. 865-9] it was shown that there was a strong concordance for the severity and patterns of glomerular lesions among sibpairs consistent with genetic effects. [0004] Many candidate gene association studies have been performed for nephropathy in T1 D, including ACE [Boright, AP. , et al., Diabetes, 2005. 54(4): p. 1238-44; Ng, DP., et al., Diabetologia, 2005. 48(5): p. 1008-16], AGT [Moczulski, D.K., et al., Diabetes, 1998. 47(7): p. 1164-9], AGTR1 [Miller, J.A., et al., Diabetes, 2000. 49(9): p. 1585-9], APOE [Araki, S., et al., Diabetes, 2000. 49(12): p. 2190-5], IL1RN [Blakemore, A.I., et al., Hum Genet, 1996. 97(3): p. 369-74], NPPA [Nannipieri, M., et al., Hypertension, 2001. 37(6): p. 1416-22], AKR1 B1 [Moczulski, D.K., et al., Diabet Med, 2000. 17(2): p. 111-8], NOS3 [Zanchi, A., et al., Kidney Int, 2000. 57(2): p. 405-13]], IL1 B [Loughrey, B.V., et al., Cytokine, 1998. 10(12): p. 984-8], REN [Deinum, J., et al., Nephrol Dial Transplant, 1999. 14(8): p. 1904-11], but results are conflicting [van Ittersum, F.J., et al., Nephrol Dial Transplant, 2000. 15(7): p. 1000-7; Tarnow, L., et al., Diabetologia, 2000. 43(6): p. 794-9; Onuma, T., et al., J Am Soc Nephrol, 1996. 7(7): p. 1075-8; Schmidt, S., et al., Diabetic Nephropathy Study Group. Nephrol Dial Transplant, 1998. 13(7): p. 1807-10; Dyer, P.H., et al., Diabetologia, 1999. 42(8): p. 1030-1 ; Degen, B., et al., Nephrol Dial Transplant, 2001. 16(1): p. 185], and may be explained by small sample size and low power, differences in phenotypic definition, population stratification or failure to adjust for covariate data such as diabetes duration and long term glycemic exposure.

SOD1 Locus and Diabetic Nephropathy. [0005] Copper-zinc super oxide dismutase (SOD1) is an antioxidant enzyme present in the cytosol, nucleus, peroxisomes and inner-mitochondrial space in eukaryotic cells and has wide tissue distribution including lymphocytes and kidney. Its primary function is the lowering of the steady state intracellular concentration of a reactive oxygen species called superoxide anion. It converts cytosolic superoxide radicals to molecular oxygen and hydrogen peroxide which then is further metabolized to H₂O by H₂O₂ metabolizing enzymes (Catalase, Glutathione peroxidase). SOD1 is one member of a group of superoxide dismutases (SOD2, SOD3) that play important antioxidant roles in cellular metabolism. The genomic structure of SOD1 consists of 5 exons spanning 9.2 Kb of DNA on chromosome 21 and encodes a 32 KDa homodimer that consists of 153 amino acids and there is evidence for alternative splicing of the gene. Over 100 different mutations have been identified in SOD1 from patients with the familial form of amyotrophic lateral sclerosis (ALS). The majority of these mutations are non- synonymous and are genetically dominant [Selverstone Valentine, J., et al., Annu Rev Biochem, 2005. 74: p. 563-93].

[0006] There is in vitro and ex-vivo evidence that superoxide anion may have a role in the activation of multiple signaling pathways leading to cell injury seen in the pathogenesis of diabetic complications [Evans, J. L., et al., Endocr Rev, 2002. 23(5): p. 599-622; Brownlee, M., Nature, 2001. 414(6865): p. 813-20]. Recent data supports the role of SOD1 in DN in animal models of both T1 D and type 2 diabetes. In a 5 month old db/db mouse model of human type 2 diabetes, the overexpression of SOD1 in transgenic db/db animals prevented or attenuated several indexes of renal cell injury including albuminuria, glomerular accumulation of TGF-β, collagen α1 (IV), and mesangial matrix expansion when compared to nontransgenic diabetic animals [DeRubertis, F. R., et al., Diabetes, 2004. 53(3): p. 762-8]. Similar findings were seen in a transgenic streptozotocin diabetic mouse model overexpressing SOD1. Urinary albumin excretion, fractional albumin clearance, urinary TGF-β excretion, glomerular volume, glomerular content of immunoreactive TGF-β and collagen α1 (IV) were significantly higher in diabetic wildtype mice compared to diabetic mice overexpressing SOD1. It therefore appears that increases in cellular SOD1 activity attenuate diabetic renal injury [Craven, PA, et al., Diabetes, 2001. 50(9): p. 2114-25]. In a rat model of T1 D, renal mitochondria produced significantly increased quantities of superoxide anion and showed evidence of oxidative damage [Rosea, M. G., et al., Am J Physiol Renal Physiol, 2005. 289(2): p. F420-30] and specifically, mRNA expression of SOD1 is increased in kidneys of streptozotocin-induced diabetic rats that then normalized upon administration of insulin and return of metabolic control. [Sechi, L.A., et al., Diabetologia, 1997. 40(1): p. 23-9]. However, the genetic risk factors that indicate increased risk of kidney disease remain uncharacterized. [0007] Cardiovascular disease is a major determinant of mortality (or conversely longevity or survival) in individuals with diabetes and consumes the majority of the health care expenditures attributable to diabetes. Many of the risk factors for cardiovascular disease in the general population are also important for cardiovascular disease in T1D, including age, smoking, cholesterol (total, LDL and HDL), central obesity and family history of myocardial infarction. Among individuals with T1 D, poor glycemic control and nephropathy are additional cardiovascular disease risk factors. Many of the risk factors for cardiovascular disease are also under genetic control. [0008] Studies in diabetic and non-diabetic subjects have observed a strong link between kidney disease and cardiovascular disease [Gerstein, HC, et al., Jama, 2001. 286(4): p. 421-6; Adler, Al, et al., Kidney Int, 2003. 63(1): p. 225-32]. This kidney- cardiovascular disease link is further strengthened by observations that parents of individuals with Type 1 Diabetes and nephropathy have a higher prevalence of cardiovascular disease risk factors than parents of individuals with Type 1 Diabetes but without kidney disease [Earle, K, et al., N Engl J Med, 1992. 326(10): p. 673-7; De Cosmo, S, et al., Diabetologia, 1997. 40(10): p. 1191-6; Roglic, G, et al., Diabet Med, 1998. 15(5): p. 418-26; Verhage, B, et al., Diabetes Care, 1999. 22(7): p. 1048-52; Abraha, A, et al., Diabet Med, 1999. 16(7): p. 598-604; Tarnow, L, et al., Diabetes Care, 2000. 23(1): p. 30-3].

[0009] Cataract eye disease is the leading cause of blindness in the world and consumes about 60% of the medicare budget for vision in the US [Arch Ophthalmol. 2002;i20:804-8ii]. Diabetes mellitus and glycemia are established risk factors and are associated with the 5 year incidence of cataract in the Beaver Dam Eye study [Am J Ophthalmol. 1998 Dec;126(6):782-90]. In addition there is strong familial clustering of lens opacification such that for any pair of siblings in the Framingham and Framingham offspring eye study, the odds of a lens opacification in one sibling was estimated to be more than triple if the other sibling had a lens opacification. This familial clustering may be related to genetic causes [Am J Epidemiol. 1994 Sep 15; 140(6) : 555-64].

[0010] There remains a need to identify genetic risk factors for predicting kidney disease, cardiovascular disease, diabetic cataract and longevity. Summary of the invention

[0011] The present inventors have systematically investigated many of the genes in the mitochondrial electron transport chain as well as many of the genes encoding antioxidant enzymes involved in cellular defence to oxidative stress and looked for association with renal outcomes in probands that participated in the DCCT/EDIC study. Genetic variation at the SOD1 locus and/or SFRS15 locus has been determined to be highly significantly associated with renal outcomes in patients with type 1 diabetes.

[0012] The present inventors have identified four single nucleotide polymorphisms in the human superoxide dismutase gene (SOD1) and one nucleotide polymorphism in a neighboring gene, splicing factor, arginine/serine-rich 15 (SFRS15), where the presence of the G nucleotide at position 31 ,963,874 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135), the presence of the T nucleotide at position 31 ,954,158 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180) or the presence of an A nucleotide at position 31 ,950,512 of Build 36.2 (Build 36.2 is a more recent version of Build 35.1 ; SNP ID# from NCBI dbSNP Build 125: rs202446) and the presence of the T nucleotide at position 32,014,714 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs204732 and the presence of the G nucleotide at position of 31 ,940,240 chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610) are significantly associated with the risk of developing kidney disease in both individuals with type 1 diabetes and their non-diabetic siblings.

[0013] Accordingly, the invention provides methods of screening for, detecting or diagnosing renal disease by determining the presence of at least one of the specific alleles of the SNPs associated with renal disease. The invention also provides for kits used for screening for, detecting or diagnosing a risk of developing renal disease by determining the presence of at least one of the specific alleles of the SNPs associated with renal disease.

[0014] The invention also provides nucleic acid probes that specifically bind the specific alleles of the SNP sequences associated with a risk of developing renal disease. The invention further provides nucleic acid primers that amplify the region of the SOD1 and/or SFRS15 gene that may carry a SNP associated with renal disease.

[0015] The invention also includes kits containing the nucleic acid probes or primers of the invention and instructions for use.

[0016] The present inventors have also demonstrated that the same

SNP alleles associated with renal disease are associated with cataract in an individual, preferably an individual that is a diabetic or a parent of a diabetic. Accordingly, the invention also provides a method of screening for, diagnosing or detecting a risk of cataract in an individual comprising detecting the presence of at least one SNP allele associated with cataract in a sample of the individual; wherein detecting the presence of at least one of the SNP alleles associated with cataract is indicative of having a cataract or an increased risk of getting a cataract in the individual compared to an individual not having the SNP allele.

[0017] The present inventors have further demonstrated that the SNP alleles associated with renal disease are associated with longevity in an individual, such as the parents of diabetic subjects. The association with longevity is related to susceptibility to nephropathy and or cardiovascular disease. Since cardiovascular disease is a well established major cause of death in individuals with renal dysfunction [Am J Kidney Pis. 2006 Sep;48(3) : 392-401] and we see an association of SNP alleles with cystatin C (a measure of renal function) in non-diabetic relatives, the invention also provides a method of screening for, diagnosing or detecting a risk of cardiovascular disease in an individual that is a parent of a diabetic with diabetic nephropathy comprising detecting the presence of at least one SNP allele associated with cardiovascular disease in a sample of the individual; wherein detecting the presence of at least one of the SNP alleles associated with cardiovascular disease is indicative of having cardiovascular disease or an increased risk of cardiovascular disease in the individual compared to an individual not having the SNP allele.

[0018] Other features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

Brief Description of the Drawings

[0019] Embodiments of the invention will be described in relation to the drawings in which:

[0020] Figure 1a shows the full sequence of the SOD1 gene.

(NM_000454 which spans chr21 : 31 ,953,805-31 ,963,112 and Figure 1b shows the full sequence of the SFRS15 gene (NM_020706 which spans chr21 : 31 ,965,420 to 32,026,133). Figure 1a includes SOD1 gene sequence along with upstream and downstream sequence (Chr21 : 31 ,948,948- 31 ,967,838) [This is the sequence which was sequenced directly in some individuals from the DCCT/EDIC probands], and Figure 1b includes SFRS15 gene sequence along with upstream and downstream sequence (Chr21 :31 , 960,418 to 32,036,133 ). Detailed description of the invention

[0021] The present inventors have identified four single nucleotide polymorphisms in the human genomic region that contains superoxide dismutase gene (SOD1) and one single nucleotide polymorphism in a neighboring gene, splicing factor, arginine/serine-rich 15 (SFRS15): (a) the presence of a G nucleotide at position 31 ,963,874 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135) (the "G allele of rs17880135") rather than a T nucleotide (the "T allele of rs17880135");

(b) the presence of a T nucleotide at position 31 ,954,158 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180) (the "T allele of rs 17881180") rather than a C nucleotide (the "C allele of rs 17881180");

(c) the presence of an A nucleotide at position 31 ,950,512 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446) (the "A allele of rs202446") rather than a C nucleotide (the "C allele of rs202446");

(d) the presence of the T nucleotide at position 32,014,714 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs204732) (the "T allele of rs204732") rather than a C nucleotide (the "C allele of rs204732"); and

(e) the presence of the G nucleotide at position 31 ,940,240 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610) (the "G allele of rs9974610") rather than an A nucleotide (the "A allele of rs9974610"); all of which are significantly associated with the risk of developing kidney disease in both individuals with type 1 diabetes and their non-diabetic siblings.

[0022] rs204732 is in strong linkage disequilibrium with rs9974610, which is approximately 15 kb 5¹ to SOD1. As such, rs9974610 shows association with diabetic kidney disease, renal function in non-diabetic individuals, cataract and longevity.

[0023] The nucleotide sequence containing the G allele of rs17880135

SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:1. The nucleotide sequence containing the T allele of rs17880135 SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:2.

[0024] The sequence containing the T allele of rs17881180 SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:3. The sequence containing the C allele of rs17881180 SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:4.

[0025] The sequence containing the A allele of rs202446 SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:5. The sequence containing the C allele of rs202446 SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:6.

[0026] The sequence containing the T allele of rs204732 SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:7. The sequence containing the C allele of rs204732 SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:8.

[0027] The sequence containing the G allele of rs9974610 SNP as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO:9. The sequence containing the A allele of rs9974610 as well as 15 bp upstream and 15 bp downstream of the SNP is shown in SEQ ID NO: 10. [0028] Accordingly, in one aspect, the invention is a composition comprising an isolated nucleic acid sequence that specifically hybridizes to at least one of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or their complements. The composition is useful to detect the presence of at least one of the specific SOD1 SNPs associated with renal disease, cataract, cardiovascular disease or longevity.

[0029] In another aspect, the invention provides a composition comprising at least two isolated nucleic acid sequences that specifically hybridize to SEQ ID NO:1 or its complement, an isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:3 or its complement, an isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:5 or its complement, an isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:7 or its complement and an isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:9. The composition is useful as a probe to detect the presence of the specific SNP alleles associated with a risk of developing renal disease, cataract, cardiovascular disease or longevity. [0030] In an embodiment, the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:1 consists of, or comprises, all or part of CACTTACTGTGAACCTACTGT (SEQ ID NO:11). In another embodiment, the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:3 consists of, or comprises, all or part of ACCGGGCAGCACG (SEQ ID NO: 12). In another embodiment, the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:5 consists of, or comprises, all or part of CTCACTACAGACTCAC (SEQ ID NO: 13)).

[0031] In yet another embodiment, the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:7 consists of, or comprises, all or part of AGTTTTTGAGIAGTGAGTCC (SEQ ID NO:14). In yet a further embodiment, the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:9 consists of, or comprises, all or part of CGGCCTGTGTATCT (SEQ ID NO:15).

[0032] The phrase "specifically hybridizes to SEQ ID NO:1 or its complement" means that under the same conditions, the isolated nucleic acid sequence will not hybridize to the sequence shown in SEQ ID NO:2 or its complement. The phrase "specifically hybridizes to SEQ ID NO:3 or its complement" means that under the same conditions, the isolated nucleic acid sequence will not hybridize to the sequence as shown in SEQ ID NO:4 or its complement. The phrase "specifically hybridizes" to SEQ ID NO:5 means that under the same conditions, the isolated nucleic acid sequence will not hybridize to the sequence shown in SEQ ID NO:6 or its complement. [0033] The phrase "specifically hybridizes" to SEQ ID NO:7 means that under the same conditions, the isolated nucleic acid sequence will not hybridize to the sequence shown in SEQ ID NO:8 or its complement. The phrase "specifically hybridizes" to SEQ ID NO:9 means that under the same conditions, the isolated nucleic acid sequence will not hybridize to the sequence shown in SEQ ID NO: 10. [0034] In one embodiment, renal disease is an impairment in the function of the kidney resulting from damage to the nephrons, structures that filter the blood. The impaired kidney function is manifested, for example as reduced glomerular filtration rate, increased systemic blood pressure, and/or accumulation of protein in the urine and /or an impairment in regulating the concentrations of hydrogen, sodium, potassium, phosphate, calcium and other ions in the extracellular fluid. In a particular embodiment, the renal disease is nephropathy, such as diabetic nephropathy.

[0035] In one embodiment, the cardiovascular disease may be acute myocardial infarction, aortic aneurysm, congestive heart failure, ischemic heart disease, cerebrovascular disease, subarachnoid hemorrhage, intracerebral hemorrhage, stroke, or cerebral infarction.

[0036] The term "SNP allele associated with renal disease", "SNP allele associated with cataract", "SNP allele associated with cardiovascular disease" and "SNP allele associated with longevity" means having the G nucleotide at position 31 ,963,874 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135) rather than a T nucleotide or the presence of the T allele at position 31 ,954,158 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180) rather than a C nucleotide or the presence of the A allele at position 31 ,950,512 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446) rather than a C nucleotide or the presence of a T nucleotide at position 32,014,714 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs204732) rather than a C nucleotide or the presence of a G nucleotide at position 31 ,940,240 of chromosome 21 in Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610) rather than an A nucleotide. The SNP ID NOs. are from the NCBI SNP database (dbSNP) build 125. Build 36.2 is the build of the human genome sequence available from the National Center for Biotechnology Information. It is available at the U.S. National Library of Medicine of the U.S. National Institutes of Health and is online at: http://www.ncbi.nlm.nih.gov/qenome/quide/human/release notes. html#b36 - also known as the September 2006 build. The position of the nucleotide is based on the distance in nucleotides in the reference sequence from the start of the p-terminal (short arm) of the chromosome. These SNPs are located in the human superoxide dismutase 1 gene (SOD1) and in the human splicing factor, arginine/serine-rich 15 (SFRS15) or the sequences surrounding these genes.

[0037] The term "probe" refers to a nucleic acid sequence that will hybridize to a nucleic acid target sequence. In one example, the probe hybridizes to SEQ ID NO:1 or SEQ ID NO:3 or SEQ ID NO:5 or SEQ ID NO: 7 or SEQ ID NO:9 or their complements. The length of probe depends on the hybridization conditions and the sequences of the probe and nucleic acid target sequence. In one embodiment, the probe is 8-100, 8-200 or 8-500 nucleotides in length, such as 8-10, 11- 15, 16-20, 21-25, 26-50, 51-75, 76- 100, 101-150 or 151-200 nucleotides in length or at least 200, 250, 400, 500 or more nucleotides in length. In other embodiments, 10, 15, 20 or 25 nucleotides provide a lower end for the aforementioned nucleotide ranges.

[0038] The term "isolated nucleic acid sequence" refers to a nucleic acid substantially free of cellular material or culture medium, for example, when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized. An "isolated nucleic acid" is also substantially free of sequences which naturally flank the nucleic acid (i.e. sequences located at the 5' and 3¹ ends of the nucleic acid) from which the nucleic acid is derived. The term "nucleic acid" is intended to include DNA and RNA and can be either double stranded or single stranded. [0039] The term "hybridize" refers to the sequence specific non- covalent binding interaction with a complementary nucleic acid. One aspect of the invention provides an isolated nucleotide sequence, which hybridizes to SEQ ID NO:1 or its complement or SEQ ID NO:3 or its complement or SEQ ID NO:5 or its complement or SEQ ID NO:7 or its complement or SEQ ID NO:9 or its complement. In a preferred embodiment, the hybridization is under high stringency conditions. [0040] By "high stringency conditions" it is meant that conditions are selected which promote selective hybridization between two complementary nucleic acid molecules in solution. Hybridization may occur to all or a portion of a nucleic acid sequence molecule. The hybridizing portion is typically at least 15-20, 21-25, 26-30, 31-40, 41-50 or 50 or more nucleotides in length. Those skilled in the art will recognize that the stability of a nucleic acid duplex, or hybrids, is determined by the Tm, which in sodium containing buffers is a function of the sodium ion concentration and temperature (Tm = 81.5°C - 16.6 (Log10 [Na+]) + 0.41(%(G+C) - 600/I), or similar equation). Accordingly, the parameters in the wash conditions that determine hybrid stability are sodium ion concentration and temperature. In order to identify molecules that are similar, but not identical, to a known nucleic acid molecule a 1 % mismatch may be assumed to result in about a 1°C decrease in Tm, for example if nucleic acid molecules are sought that have a >95% identity, the final wash temperature will be reduced by about 5°C. Based on these considerations those skilled in the art will be able to readily select appropriate hybridization conditions. In preferred embodiments, stringent hybridization conditions are selected. By way of example the following conditions may be employed to achieve stringent hybridization: hybridization at 5x sodium chloride/sodium citrate (SSC)/5x Denhardt's solution/1.0% SDS at Tm - 5⁰C for 15 minutes based on the above equation, followed by a wash of 0.2x SSC/0.1 % SDS at 60⁰C. It is understood, however, that equivalent stringencies may be achieved using alternative buffers, salts and temperatures. Additional guidance regarding hybridization conditions may be found in: Current Protocols in Molecular Biology, John Wiley & Sons, N.Y., 1989, 6.3.1-6.3.6 and in: Sambrook et al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989, Vol.3.

[0041] In another embodiment, the invention provides a composition of two or more isolated nucleic acid sequences that are specific primers that are able to amplify a sequence containing SEQ ID NO:1 and/or SEQ ID NO:3 and/or SEQ ID NO:5 in the endogenous SOD1 gene, and/or SEQ ID NO:7 in the endogenous SFRS15 gene and/or SEQ ID NO:9 upstream of the SOD1 gene.

[0042] Pairs of primers may be selected wherein one primer is upstream of the SNP location and one primer is downstream of the SNP location within the SOD1 nucleotide sequence (Figure 1a and SEQ ID NO: 16). (NM_000454 which spans chr21: 31 ,953,805-31 ,963,112. Figure 1a includes SOD1 gene sequence along with upstream and downstream sequence (Chr21 : 31 ,948,949-31 ,967,838). This is the sequence which was sequenced directly in some individuals from the DCCT/EDIC probands). For example, for the SNP found in rs17880135, one primer is upstream of the nucleotide at position 31 ,963,874 and another primer is downstream from the nucleotide at position 31 ,963,874. In an embodiment for the SNP found in rs17880135, one primer is within 73 bp 5' of the SNP allele of the SOD1 gene (SEQ ID NO:28 or its complement) and another primer is within 96 bp 3' of the SNP allele of the SOD1 gene (SEQ ID NO: 29 or its complement). For the SNP found in rs17881180, one primer is upstream of the nucleotide at position 31 ,954,158 and another primer is downstream from the nucleotide at position 31 ,954,158. In another embodiment for the SNP found in rs17881180, one primer is within 35 bp 5¹ of the SNP allele of the SOD1 gene (SEQ ID NO:30 or its complement) and another primer is within 56 bp 3¹ of the SNP allele of the SOD1 gene (SEQ ID NO: 31 or its complement). For the SNP found in rs202446, one primer is upstream of the nucleotide at position 31 ,950,512 and another primer is downstream from the nucleotide at position 31,950,512. In another embodiment for the SNP found in rs202446, the first primer is within the sequence as shown in SEQ ID NO:32 or its complement and the second primer is within the sequence shown in SEQ ID NO:33 or its complement. For the SNP found in rs204732, one primer is upstream of the nucleotide at position 32,014,714 and another primer is downstream from the nucleotide at position 32,014,714. In an embodiment for the SNP found in rs204732, one primer is within 60 bp 5¹ of the SNP allele of the SFSR15 gene (SEQ ID NO: 34 or its complement) and another primer is within 65 bp 3' of the SNP allele of the SFSR15 gene (SEQ ID NO:35 or its complement). For the SNP found in rs9974610, one primer is upstream of the nucleotide at position 31 ,940,240 and another primer is downstream from the nucleotide at position 31 ,940,240. In an embodiment for the SNP found in rs9974610, the first primer is within 48 bp 5¹ of the SNP allele of SOD1 gene (SEQ ID NO:36 or its complement)and the second primer is within 56 bp 3' of the SNP allele of SOD1 gene (SEQ ID NO:37 or its complement).

[0043] In one embodiment, primers for amplifying the rs17880135 location comprise a SNP Forward primer 5'-

GGAGAGGAAAAGCTAAATTGGAAGACA-S' (SEQ ID NO: 18) and a SNP Reverse primer δ'-GCAACAAACTACATTAGGGAAATGTGT-S' (SEQ ID NO:19).

[0044] In another embodiment, primers for amplifying the rs17881180 location comprise a SNP Forward primer 5'-GCCGCCCTGGTCCAG-3'(SEQ ID NO: 20) and SNP Reverse primer 5'-CCCGGTGACTCAGCACTTG-3¹ (SEQ ID NO:21). [0045] In another embodiment, primers for amplifying the rs202446 location comprise a SNP Forward primer 5'-GTGGTTAAAAGGTGGGCAAA (SEQ ID NO:22) and a SNP Reverse primer 5'- TGAGGTTGGAGAATTGCCTAA (SEQ ID NO:23).

[0046] In a further embodiment, primers for amplifying the rs9974610 location comprise a SNP forward primer 5'-

CTTCCAAAGTGCTGGGAGTACAG (SEQ ID NO:26) and a SNP Reverse primer 5'- GAGGGAAACTCAGTTGGAAACTTCT (SEQ ID NO:27)

[0047] Figure 1 b includes the SFRS15 gene sequence along with upstream and downstream sequence (Chr21 : 31 ,960,418-32,036,133) (SEQ ID NO:17).

[0048] In yet another embodiment, primers for amplifying the rs204732 location comprise a SNP Forward primer 5'-

TTTGAAGAGCCCATCTGAGTCTAGTC (SEQ ID NO:24) and a SNP Reverse primer 5'- GACGTATAAAAGCTGTTCACTGAGTCTTC (SEQ ID NO:25). [0049] The compositions are useful to identify the presence of the at least one SNP allele by direct sequencing, restriction mapping, SSCP (single strand conformational polymorphism), dHPLC (denaturing high performance liquid chromatography) or other methods of mutation screening. Since the position of the SNPs of interest is known, methods are available for genotyping a nucleic acid sample. For example, single nucleotide primer extension, allele-specific hybridization, allele-specific primer extension, oligonucleotide ligation assay, and invasive signal amplification, Matrix- assisted laser desorption/ionization time-of-f light (MALDI-TOF) mass spectrometry, restriction length fragment polymorphism (RFLP) and Fluorescence polarization (FP) may be used to identify the presence of a particular SNP from a nucleic acid sample or an amplified nucleic acid sample.

[0050] The term "primer" as used herein refers to a nucleic acid sequence, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of synthesis of when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand is induced (e.g. in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon factors, including temperature, sequences of the primer and the methods used. A primer typically contains 15-25 or more nucleotides, although it can contain less, such as 8-14 nucleotides. The factors involved in determining the appropriate length of primer are readily known to one of ordinary skill in the art.

Methods and Uses of the Invention

[0051] The invention discloses SOD1 and SFRS15 SNPs associated with individuals with renal disease or an increased risk of or predisposition to renal disease. Accordingly, one embodiment of the invention is a method of screening for, diagnosing or detecting a risk of developing renal disease comprising determining the presence of at least one of the SOD1 and SFSR15 SNPs associated with renal disease in a sample of an individual; wherein detecting the presence of at least one of the alleles of the SNPs associated renal disease is indicative of an increased risk of renal disease in the individual. The increased risk is relative to a person not having at least one of the risk allele SNPs. The invention also provides use of a composition of the invention for screening for, diagnosing or detecting an increased risk of developing renal disease. [0052] The present inventors have shown a 3-fold hazard of developing renal disease associated with the risk allele at the SNPs, which is an instantaneous measure of risk of developing renal disease at a particular time and is consistent with an overall increased risk of renal disease. Accordingly, in one embodiment, there is approximately a 3-fold hazard of developing severe renal disease compared to a person not having at least one of the SNPs.

[0053] The phrase "screening for, diagnosing or detecting a risk of developing renal disease" refers to a method or process of determining if an individual has an increased risk of or predisposition to renal disease, or if a person does not have an increased risk of renal disease. The increased risk is measured relative to a person not having the risk alleles of the SNP's of the invention.

[0054] In one embodiment, the individual is any member of the animal kingdom, preferably a human being. In another embodiment, the individual is a non-diabetic first degree relative of a human with Type 1 diabetes. A "first degree relative" as used herein refers to an offspring, sibling, parent or grandparent. In one embodiment, the individual is a non-diabetic sibling of a human with Type 1 diabetes. In another embodiment, the individual is a human with Type 1 diabetes. A person skilled in the art would readily be able to determine if an individual suffers from Type 1 diabetes. For example, an individual's blood glucose levels can be measured in order to determine if they are diabetic. Diabetes is diagnosed if fasting blood glucose is >7.0 mmol/l on 2 separate occasions. Normal fasting glucose is considered between 4.0 and 6.0 mmol/l and impaired fasting glucose ("prediabetes") is between 6.0 and 7.0 mmol/l. Diabetes is also diagnosed if the 2 hour plasma glucose is >11.1 after a 75 gm. oral glucose tolerance test. A random glucose of >11.1 with symptoms of hyperglycemia on one occasion is also considered diagnostic of diabetes. Type 1 diabetes can be distinguished from type 2 diabetes using available criteria, such as those of the American Diabetes Association (Diagnosis and Classification of Diabetes Mellitus, American Diabetes Association Diabetes Care 2006 29: S43-48).

[0055] Without wishing to be bound by a particular theory, the SNP alleles alter the SOD1 and/or SFRS15 gene expression or the amount of SOD1 and/or SFRS15 protein. The risk alleles can be associated with a reduced mRNA expression and/or protein or it can change the stability of mRNA or the RNA splicing. Thus the invention also includes a method of detecting, diagnosing or screening for an increased risk of renal disease by measuring the mRNA expression or protein of the SOD1 and/or SFRS15 gene, wherein an altered amount compared to control levels is indicative of an increased risk of renal disease. [0056] In another embodiment, the invention provides a method of reducing the risk of renal disease in an individual with Type I diabetes comprising:

(a) genotyping the individual to determine if a SNP allele associated with renal disease is present; and (b) altering the glycemic target that individuals are advised to follow if at least one of the SNPs associated with renal disease is present.

[0057] Furthermore, the invention includes a method of identifying a

SNP-specific drug that only has effects on an individual with a specific genotype of the SNPs comprising contacting a candidate compound with each of a plurality of cell samples (eg. plurality of cell culture samples or a plurality of subjects) wherein each cell sample comprises cells encoding a different genotype of the SNP's described herein, and determining whether the compound is specifically therapeutically active (ie. preventing or treating a disease described herein) in one cell sample but not the other cell samples, wherein if the candidate compound is therapeutically active in one cell sample but not the other cell samples then it is a SNP-specific drug. Thus, genotyping the SNPs alleles associated with renal disease is useful to determine if a specific therapy should be followed.

[0058] The term "sample" as used herein refers to any fluid, cell or tissue sample from an individual that is suitable for genotyping the individual.

[0059] The present inventors have shown that rs17880135, which is in strong linkage disequilibrium with rs17881180 and in modest linkage disequilibrium with rs202446, rs204732 and rs9974610 is associated with cataract in diabetic individuals. Accordingly, in yet another embodiment, the invention provides a method of screening for, diagnosing or detecting a risk of cataract in an individual who is diabetic comprising detecting the presence of at least one SNP allele associated with cataract in a sample of the individual; wherein detecting the presence of at least one of the SNP alleles associated with cataract is indicative of having a cataract or an increased risk of or predisposition to getting a cataract in the individual compared to an individual not having the SNP allele. The invention also provides use of a composition of the invention for screening for, diagnosing or detecting an increased risk of developing cataract in an individual who is a diabetic.

[0060] The phrase "screening for, diagnosing or detecting a risk of developing cataract" refers to a method or process of determining if an individual has an increased risk of or predisposition to cataract, or if a person does not have an increased risk of or predisposition to cataract. The increased risk is measured relative to a person not having the risk alleles of the SNP's of the invention. [0061] In one embodiment, the at least one SNP allele associated with cataract comprises (a) the presence of a G nucleotide at position 31 ,963,874 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135);

(b) the presence of a T nucleotide at position 31 ,954,158 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180); (c) the presence of an A nucleotide at position 31 , 950,512 of

Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446);

(d) the presence of an T nucleotide at position 32,014,714 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs204732); or

(e) the presence of a G nucleotide at position 31 ,940,240 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610).

[0062] In a particular embodiment, the diabetic individual has Type 1 diabetes.

[0063] Parents of individuals with diabetic nephropathy are known to have higher prevalence of cardiovascular disease and earlier mortality than parents of diabetics without diabetic nephropathy. Furthermore, the present inventors have shown a significant decrease in survival of parents of diabetics that have at least one of the SNP alleles. Accordingly, in yet another embodiment, the invention provides a method of predicting or increasing the survival or longevity of an individual: (a) determining if the individual possesses at least one SNP allele associated with cardiovascular disease or longevity; and

(b) monitoring or treating heart function for the individual if at least one of the SNPs associated with renal disease is present.

[0064] In a particular embodiment, the individual is any member of the animal kingdom, preferably a human being. In another particular embodiment, the diabetic has Type 1 diabetes. In yet another particular embodiment, the individual is a parent of a diabetic. Since non-diabetic parents are not known to be fundamentally different from any individual, these results show that the effect is present for any individual. [0065] In one aspect, the at least one SNP allele associated with cardiovascular disease or longevity comprises

(a) the presence of a G nucleotide at position 31 ,963,874 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135); (b) the presence of a T nucleotide at position 31 ,954,158 of

Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180);

(c) the presence of an A nucleotide at position 31 ,950,512 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446);

(d) the presence of an T nucleotide at position 32,014,714 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs204732); or

(e) the presence of a G nucleotide at position 31 ,940,240 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610).

[0066] In yet a further embodiment, the invention provides a method of screening for, diagnosing or detecting a risk of cardiovascular disease or decreased survival in an individual, comprising detecting the presence of at least one SNP allele associated with cardiovascular disease or longevity in a sample of the individual; wherein detecting the presence of at least one of the SNP alleles associated with cardiovascular disease or longevity is indicative of having cardiovascular disease or an increased risk of or predisposition to cardiovascular disease in the individual compared to an individual not having the SNP allele. The invention also provides use of a composition of the invention for screening for, diagnosing or detecting an increased risk of or predisposition to developing cardiovascular disease in an individual.

[0067] The phrase "screening for, diagnosing or detecting a risk of developing cardiovascular disease" refers to a method or process of determining if an individual has an increased risk of or predisposition to cardiovascular disease, or if a person does not have an increased risk of or predisposition to cardiovascular disease. The increased risk is measured relative to a person not having the risk alleles of the SNP's of the invention. [0068] In one embodiment, the cardiovascular disease may be acute myocardial infarction, aortic aneurysm, congestive heart failure, ischemic heart disease, cerebrovascular disease, subarachnoid hemorrhage, intracerebral hemorrhage, stroke, or cerebral infarction. [0069] In one embodiment, the at least one SNP allele associated with cardiovascular disease or longevity comprises

(a) the presence of a G nucleotide at position 31 ,963,874 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135);

(b) the presence of a T nucleotide at position 31 ,954,158 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180);

(c) the presence of an A nucleotide at position 31 ,950,512 of Build 36.2(SNP ID# from NCBI dbSNP Build 125: rs202446);

(d) the presence of an T nucleotide at position 32,014,714 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs204732); or (e) the presence of a G nucleotide at position 31 ,940,240 of

Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610).

[0070] In a particular embodiment, the individual is any member of the animal kingdom, preferably a human being. In another particular embodiment, the diabetic has Type 1 diabetes. In yet another particular embodiment, the individual is a parent of a diabetic.

[0071] In another embodiment, the invention provides a method of detecting the stage of renal disease comprising detecting the presence of a SNP associated with renal disease in a sample; wherein having the SNP associated with renal disease at rs202446 or rs204732 or rs9974610 is indicative of early stages of renal disease and having the SNP associated with renal disease at rs17880135 or rs17881180 is indicative of the progression from early to later stage renal disease. The presence of albumin in the urine, which can be measured by the Albumin Excretion Rate can be used to distinguish early from late stage of kidney disease. A person skilled in the art will appreciate that a number of methods are useful to measure or detect the presence of a SNP within a sample, including microarrays, Restriction Fragment Length Polymorphism, Southern Blots, SSCP, dHPLC, single nucleotide primer extension, allele-specific hybridization, allele-specific primer extension, oligonucleotide ligation assay, and invasive signal amplification, Matrix-assisted laser desorption/ionization time-of-f light (MALDI-TOF) mass spectrometry, Fluorescence polarization (FP). Such methods typically employ the isolated nucleic acid compositions of the invention.

[0072] Accordingly, in one embodiment of the invention nucleic acids that bind to the SNP sequences at high stringency are used to determine the presence of the SNP allele. In a particular embodiment, the nucleic acids are labeled with a detectable marker.

[0073] The label is typically capable of producing, either directly or indirectly, a detectable signal. For example, the label may be radio-opaque or a radioisotope, such as ³H, ¹⁴C, ³²P, ³⁵S, ¹²³I, ¹²⁵I, ¹³¹I; a fluorescent (fluorophore) or chemiluminescent (chromophore) compound, such as fluorescein isothiocyanate, rhodamine or luciferin; an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase; an imaging agent; or a metal ion. In certain embodiments, the nucleic acids are labeled with 6-FAM or VIC. 6-FAM gives a blue fluorescence upon activation and VIC gives a red fluorescence upon activation. Other fluorescent dyes are available but 6-FAM and VIC are most common.

[0074] Any of the methods of the invention to screen for, diagnose or detect a risk of developing renal disease can be used in addition or in combination with traditional diagnostic techniques for renal disease. For example, measurement of creatinine levels, glomerular filtration rate, urinalysis to detect the presence of white or red blood cells in the urine or a microalbumin test (albumin/creatinine ratio (ACR)) to detect levels of albumin protein in the urine. The following could also be measured: systemic blood pressure, 24 hr urine excretion of albumin, serum cystatin C, blood urea nitrogen, serum electrolytes including sodium, potassium, bicarbonate, phosphate, calcium, magnesium or complete blood count. In addition a renal ultrasound or renal angiogram can be done.

[0075] Any of the methods of the invention to screen for, diagnose or detect a risk of cataract can be used in addition or in combination with traditional diagnostic techniques for cataract, for example direct opthalmoscopy.

[0076] Any of the methods of the invention to screen for, diagnose or detect a risk of cardiovascular disease can be used in addition or in combination with traditional diagnostic techniques for cardiovascular disease. For example, electrocardiogram, nuclear imaging, coronary angiography or coronary calcium measurements.

Kits of the Invention

[0077] Another aspect of the invention is a kit for screening for, diagnosing or detecting a risk of developing renal disease, cataract, longevity or cardiovascular disease comprising any one of the isolated nucleic acid compositions of the invention and instructions for use. In one embodiment, the kit comprises at least two species of isolated nucleic acid sequences, wherein each species specifically hybridizes to a different sequence of the group comprising or consisting of SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and/or SEQ ID NO:9 and their complements. In other embodiments, the kit comprises three, four or five or more species wherein each species specifically hybridizes to a different sequence of the group comprising or consisting of SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 and/or SEQ ID NO:9 and their complements. [0078] The above disclosure generally describes the present invention.

A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for the purpose of illustration and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances might suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.

[0079] The following non-limiting examples are illustrative of the present invention:

Examples The EDIC Genetics study (2000-6).

[0080] The steps of the EDIC genetics study were: Complete the collection of DNA, transformed lymphocytes, serum and plasma on all available parents (irrespective of whether a relative had diabetes) and at least one non-diabetic sib; measure diabetic complications on diabetic siblings; repeat the familial clustering and correlation of diabetic complications using updated measures on probands and diabetic siblings; establish a DNA repository for genetic studies of T1D and its complications; perform individual and family-based association studies of diabetic complications with candidate gene polymorphisms. Recruitment of relatives began in early 2002 and ended in August 2004. Diabetic siblings had their complications measured, similar to the DCCT family study such that 214 diabetic siblings had their complications measured and had DNA collected either during the DCCT family study or EDIC genetics. Combining the data from DCCT family study and EDIC genetics, DNA and cells have been collected on 1 ,419 DCCT/EDIC probands, 2,978 relatives, including 811 mothers, 586 fathers, 1 ,581 siblings making a total of 4,397 individuals and effective number of trios of 862.

Individual- and family-based association studies of diabetic complications

[0081] For the purposes of individual and family-based association study, time to event outcomes have been defined as based on the repeated measures of outcomes in DCCT/EDIC probands. The definitions are defined as time from DCCT baseline until the event up to and including EDIC year 8

(2001). The two renal outcomes are: Persistent Microalbuminuria = time to two consecutive AER ≥30 mg/24 hours (≥20.8 μg/min). There are 318 probands (23% of the cohort) with this outcome. Severe Nephropathy = time to AER ≥300mg/24 hours (≥208 μg/min) or end-stage renal failure. There were 116 probands with this outcome (8% of the cohort). By definition, an individual with severe nephropathy must have earlier achieved persistent microalbuminuria. The mean duration of observations in DCCT/EDIC for these renal measures is 13.5 ± 2.6 years with an average of 12 measures per proband. Since the duration of diabetes at DCCT baseline was 5.6 years on average, then probands have an average of 19.1 years total duration of T1 D.

Individual- and family-based association studies of diabetic complications. [0082] The present inventors have genotyped 86 markers in 40 genes and analyzed them for association with retinal and renal diabetic complications. Candidate genes were selected based on a variety of criteria, including prior evidence for association between markers and complications, genes in pathways proposed for the pathogenesis of diabetes complications. The present inventors have undertaken high-resolution association mapping of candidate genes using the lllumina Bead Array system. Specifically, the present inventors attempted to genotype 1 ,536 SNPs from 212 genes. The source of SNP and Linkage Disequilibrium information used to select SNPs was based on the CEU (CEPH samples of European ancestry) data in phase I of the HapMap project [Altshuler, D., et al., Nature, 2005. 437(7063): p. 1299- 320], the European American data in the Perlegen database [Hinds, D A. , et al., Science, 2005. 307(5712): p. 1072-9], or from SeattleSNPs [Carlson, CS. , et al., Am J Hum Genet, 2004. 74(1): p. 106-20]. The criteria for including a SNP was based on having a minor allele frequency in Caucasians of >0.05 and pairwise r²<0.8 using Tagger [Barrett, J. C, et al., Bioinformatics, 2005. 21(2): p. 263-5] or LDSELECT [Carlson, C.S., et al., Am J Hum Genet, 2004. 74(1): p. 106-20]. Selected SNPs underwent bioinformatics evaluation by lllumina to score their suitability for genotyping on the lllumina Bead Array GoldenGate custom assay. SNPs that did not pass the lllumina minimal criteria for successful genotyping were excluded and replaced by other SNPs within that bin until a suitable representative of the bin was identified. Some SNPs from singleton bins were deemed ungenotypeable by lllumina's bioinformatics criteria and therefore no replacement could be identified. Of the 2,750 SNPs submitted to lllumina, 1536 were predicted to have a high genotyping success rate. Results of association of markers/haplotypes with renal complications in DCCT/EDIC.

[0083] Briefly, the primary analysis was time to event for each of the outcomes using Cox proportional hazards including important baseline variables and certain repeated-measured variables. To understand the effects of covariates in the multivariate Cox proportional hazards models, the present inventors analyzed the association of covariates including gender, baseline lipids, duration of T1 D at baseline, smoking, eligibility HbAIc, updated mean HbAIc and updated hypertension for time to renal outcomes. Updated mean HbAIc and hypertension, generated from repeated measured variables during DCCT and EDIC, have highly significant association with both renal outcomes.

Genetic Association Results.

[0084] Because of the multiple testing, the inventors have calculated q values [Storey, J. D. and R. Tibshirani, Proc Natl Acad Sci U S A. 2003. p. 9440-5] for these results. The q value represents the minimum false discovery rate (FDR). Upon declaring hypotheses with q values of α significant, then the FDR is less than or equal to α when a large numbers of tests have been conducted: markers with q values of 0 are likely to be a true discovery; q values of 1 are very likely to be false discoveries. Of the 1472 DNA samples submitted to lllumina for genotyping, there was a 99.46% sample success rate. Of the 1536 SNPs that were selected for genotyping, there was success at 1450, corresponding to a locus success rate of 94.4%. Fifty-six SNPs were not polymorphic in the white probands. Of the >2 million genotypes possible, the successful genotype call rate was 99.95%. In over 52 thousand possible replicate genotype pairs the reproducibility was 100.00%, thus the quality of this genotype data is very high. Population stratification.

[0085] To confirm that the association with renal outcomes is not due to population stratification, the present inventors found no evidence for population structure among the white probands using 25 unlinked markers in 5 the program STRUCTURE [Pritchard, J. K., et al., Genetics. 2000. p. 945-59].

Association of SOD1 and SFRS15 with diabetic nephropathy

[0086] From the 80 SNPs identified in SOD1 by SeattleSNPs, fifty seven of these SNPs are represented in 19 bins (a bin is defined as a pairwise r² >0.64 between SNPs) and there are an additional 23 bins with

10 singleton SNPs. Many of these bins contain rare SNP's with MAF <0.5%. For this reason they were not genotyped. 5 tagSNPs were selected with MAF > 0.5 %. The inventors describe results for four SOD1 SNPs and one SNP in SFRS15 that were identified to be significantly associated with diabetic nephropathy (see table 1) which passed the quality control cutoffs for SNP

15 design from lllumina and were genotyped in 1391 white probands. Data from DNA sequencing of individuals carrying the high-risk alleles are rs17880135 have identified additional SNPs which occur on this haplotype, and which are different to the reference sequence.

Table 1. Descriptive information about SOD1 and SFRS15 SNPs 20 genotyped in DCCT/EDIC probands

[0087] The technique used for genotyping rs202446 is different from that used for genotyping rs17880135 and rs17881180. An RFLP assay was used for genotyping rs202446. A PCR fragment was amplified using the 5 primers mentioned for rs202446 with the reverse primer end-labeled with 6- FAM flouresceine, the amplified fragment (147bp) was then digested with the restriction enzyme Schl which recognizes the sequence GACTC which is available once if the amplified fragment has the C allele and cuts the fragment at the base 93 producing two fragments which are 93 and 54 long; and twice if

10 the amplified fragment has A allele (the associated allele) and cuts the fragment at the bases 93 as well as at 104 producing three fragments which are 93, 11 and 43 long. The digested PCR product is then electrophoresed and the fragment which is end-labeled with 6-FAM is then detected by a laser beam. In this scenario, if an individual is homozygous for the common allele

15 (C/C), one 54-bases fragment will be detected. If an individual is homozygous for the rare allele (A/A), a 43-bases fragment will be detected, and if an individual is heterozygous (A/C), two 54- and 43-bases fragments will be produced. A taqMan assay designed by Appliedbiosytstems is available for genotyping this SNP (assay ID = C 3272738 10).

20 [0088] The present inventors then tested for association between these markers and with renal outcomes. Significant association was observed in multivariate models between a log additive model at rs17880135 and both severe nephropathy (Hazard Ratio (HR)=2.62, 95% Confidence Interval = 1.64-4.18, p= 5.6 x 10^'5, q= 0.06) and persistent microalbuminuria (HR=1.82,

25 95%CI= 1.29-2.57, p=6.4 x 10^"4, q=0.46; See Table 2). The present inventors have also performed analysis at rs17880135 combining the rare homozygotes (G/G) and heterozygotes (T/G) and the results remain significant (x 2=18.1 , p=2.1 x 10^"5, HR=3.22, 95%CI 1.88-5.51 for severe nephropathy). The present inventors also genotyped rs17880135 using another technology (Taqman) in all DCCT/EDIC probands and the agreement of the genotypes from the two technologies is 99.9%. The present inventors have also 5 genotyped another SNP (rs17881180) which is known to be in strong linkage disequilibrium with rs17880135, and the association results at this SNP are also highly significant - for severe nephropathy (p=7.6 x 10^"6), for persistent microalbuminuria (p=1.3 x 10^~4). Coding of the rare homozygotes (JfT) and heterozyotes (CfT) compare to the common homozygote (C/C) at rs17881180 10 also produces significant association (x 2=11.8 p=5.9 x 10^'4, HR=2.00, 95%CI 1.35-2.98 for persistent microalbuminuria; χ 2=21.9, p=2.9 x 10^"6,HR=3.65, 95%CI 2.12-6.28 for severe nephropathy).

Table 2. Multivariate results for time to renal outcomes in DCCT/EDIC I robands

[0089] Marker-marker analyses indicated that rs17881180 and rs17880135 are in strong linkage disequilibrium (Table 3), as are rs9974610,

20 rs202446 and rs204732; whereas rs17881180 and rs17880135 are both in weaker linkage disequilibrium with rs202446 and rs204732 and rs9974610.

Table 3. Marker-marker linkage disequilibrium in SOD1 AND SFRS15 in DCCT/EDIC probands

5

[0090] The four SNPs showing the most significant association

(rs17880135, rs178801180, rs202446 and rs9974610) in the genomic region

10 of SOD1 gene lie 759 bp from the 3'UTR, in intron 1 , and 3441 bp upstream of the initiation codon of SOD1 gene, and 13,714 bp upstream of the initiation codon of SOD1 gene, respectively. Whereas the rs204732 marker in SFRS15 showing significant association with time to persistent microalbuminuria lies in intron one. Of the ~1 ,500 SNPs in 252 candidate genes that were analyzed

15 for association with diabetic complications, the results for these two SNPs in SOD1 represents the most significant association with renal outcomes. The present inventors estimate that these two variations (rs17880135 and rs17881180) account for ~1% of the variance in risk of developing severe nephropathy outcome and that the three variations (rs9974610, rs202446 and

20 rs204732) account for ~1% of the variance in risk of developing persistent microalbuminuria outcome. These variations are risk factors for kidney disease in the general population, or with cardiovascular disease. Microalbuminuria is a well recognized risk factor for the development of cardiovascular disease in type 1 diabetes, hence if the risk for

25 microalbuminura is increased so too is the risk for cardiovascular disease. The present inventors determined association with cardiovascular disease in diabetic and non-diabetic relatives. The methods, kits, primers and compositions of the invention are readily adapted for methods of screening for, detecting or diagnosing microalbuminuria and/or cardiovascular disease by determining the presence of at least one of the specific alleles of the SNPs described herein.

[0091] As part of a panel of other genetic markers (most of which remain to be identified) as well as clinical measures (e.g. HbAIc, age, sex, diabetes duration, ethnicity), the genotype at four SOD1 SNPs and at one SFRS15 SNP is readily adapted to form a screening test for individuals with type 1 diabetes to determine their risk of development of diabetic kidney disease. This is useful to alter the glycemic target that individuals are advised to follow. For example, the glycemic target could be reduced by 5-10% or 10- 15% to reduce the amount of circulating blood glucose and the risk of kidney disease. The reduced glycemic target could be achieved by adjusting diet to reduce sugar intake or by increasing the dose or altering the rate or mode of delivery of an individual's glucose-reducing drug, such as insulin.

[0092] Eight individuals who are homozygous for the rare (risk) alleles at rs17881180 and rs17880135 were sequenced and were identified as all homozygous for the rare allele at rs202446. rs202446 was thus genotyped and tested for association with renal outcomes. rs202446 is highly significantly associated with time to persistent microalbuminuria and modestly associated with time to severe nephropathy. (Table 2). Similarly, based on known linkage disequilibrium (The International haplotype map; www.hapmap.org; The International HapMap Consortium. A haplotype map of the human genome. Nature 437, 1299-1320. 2005), rs204732 was genotyped which is in a neighbouring gene (SFRS15) and observe it to be highly significantly associated with time to persistent microalbumunuria. Multistate modelling, including both rs202446 or rs204732 and rs17881180 in the model indicate that either rs202446 or rs204732 (but not rs17881180 nor rs17880135) is associated with the development of persistent microalbuminuria (p=0.0054), whereas the progression from persistent microalbuminuria to severe nephropathy is associated with rs1781180 (or rs17880135) but not rs9974610, rs202446 or rs204732. This shows that genotype at rs202446 is associated with the early development of diabetic kidney disease (persistent microalbuminuria) while rs17881180 and/or 17880135 are associated with the progression from persistent microalbuminuria to severe nephropathy. Marker-marker analyses showed that rs202446 is not in strong linkage disequilibrium with any of the other variants in SOD1 (Table 3), but is in strong linkage disequilibrium with rs204732 in SFRS15.

[0093] rs202446 is estimated to account for 1.2% of the variance in risk of developing persistent microalbuminuria. rs202446 is also a risk factor for kidney disease in the general population, or with cardiovascular disease.

[0094] As part of a panel of other genetic markers (most of which remain to be identified) as well as clinical measures (e.g. HbAIc), the genotype at rs9974610 or rs202446 or rs204732 is readily used to form part of a screening test for individuals with type 1 diabetes to determine their risk of development of diabetic kidney disease. This could alter the glycemic target that individuals are advised to follow.

Association of SOD1 rs17880135 with renal function in non-diabetic individuals

[0095] The present inventors genotyped rs17880135 in 925 non- diabetic white siblings of the DCCT/EDIC probands and tested for association of genotype with serum cystatin C, a measure of renal function (higher cystatin C is associated with renal disease). The inventors observed a significant association between rs17880135 genotype and serum cystatin C. Specifically, individuals with the genotype that is high risk for diabetic nephropathy (G/G and G/T) have higher Cystatin C then individuals with the genotype (TfT) that is low risk for diabetic nephropathy. Even after adjusting for sex, age and family, the association remains significant, p=0.0031. The absence of diabetes in the siblings was defined by clinical history and measurement of HbAIc. Because rs17880135 and rs17881180 are in strong linkage disequilibrium (association) with each other (Table 3) in the probands, they will show strong linkage disequilibrium with each other in the non-diabetic siblings and therefore significant association of rs17881180 with serum Cystatin C in the non-diabetic siblings.

Table 4:

Values are mean ± SD. P value is non-parametric (Kruskal-Wallis)

Diabetic Cataract

[0096] Rs17880135 is associated with cataract in diabetic parents

(p=0.0076, Table 5. Since rs17881180 is in strong linkage disequilibrium with rs17880135, this marker is also associated with cataract in diabetic parents. Also, given the modest linkage disequilibrium between both rs17881180 and rs17880135 with rs202446, rs202446 is associated with diabetic cataract.

Table 5. Association between rs17880135 and diabetic cataract

Group Cataract Genotype P value

G/G G/T T/T

Diabetic Yes 0 11 32 0.0076

Parents No 0 9 99

Diabetic Yes 0 0 4 1.0

Siblings No 1 13 117

Probands Yes 0 1 13 1.0

No 8 137 1 ,258

Probands, Yes 0 12 49 0.082 diabetic No 9 172 1474 parents and siblings

Legend to Table 5. Fisher's exact test

Survival of parents based on probands rs17880135 genotype [0097] Numerous studies have documented that parents of individuals with diabetic nephropathy have higher prevalence of cardiovascular disease and earlier mortality than parents of diabetic individuals without nephropathy [Onuma, T., et al., J Am Soc Nephrol, 1996. 7(7): p. 1075-8; Schmidt, S., et al., Diabetic Nephropathy Study Group. Nephrol Dial Transplant, 1998. 13(7): p. 1807-10; Dyer, P. H., et al., Diabetologia, 1999. 42(8): p. 1030-1 ; Degen, B., et al., Nephrol Dial Transplant, 2001. 16(1): p. 185], suggesting pleiotropy. Using survival analysis, the inventors determined the difference in the survival of parents (fathers and mothers were analysed separately) based on the probands rs17880135 genotype. Fathers of heterozygous probands had on average 6.2 years shorter survival than fathers of common homozygous probands (Hazard Ratio= 0.63, 95%CI 0.46-0.87; age at death: mean =71.0 Standard Error=1.4 vs. mean= 77.2, SE=O.8, Log rank p value=0.0045). Although there was no significant association between probands genotype and mothers survival, the point estimate was in same direction as fathers (age at death mean 79.4 SE=1.5 vs 81.5 SE=O.5; HR=O.80, 95%CI= 0.51-1.25, log rank p=0.32).

[0098] The sequence from rs17880135 from 15 nucleotides upstream of the SNP to 15 nucleotides downstream is TGGTAAACAA CAGTAGGTTCACAGTA AGTGG (SEQ ID NO: 1) for the G allele of rs17880135. The underlined and bolded G represents the single nucleotide polymorphism associated with renal disease which is more commonly found to be T. Thus, the T allele or rs17880135 is TGGTAAACAA CAGTAIGTTCACAGTA AGTGG (SEQ ID NO:2). [0099] The 5' flanking sequence information for rs17880135

(ss32469393) (http://www.ncbi.nlm.nih.gov/SNP/snp ref.cgi?rs=17880135)

GAGTCACTTT CTCTTAATGT ATTTATGTAC CTGAGAGAAT GCTTTTCAAT GTTAACCTAA CTCAGGTTTG ACTAAATTAT

TCAATTGGAA ATTGTAGAAT ATTATTTCTG ATAAACCAGA

AATAAGTGAA ATGCTGTTTG TTCATAAATA TGTACTTTAT

CAAATGTAGG AGAGATCATT TAGGAGAGGA AAAGCTAAAT

TGGAAGACAA ATCTGTAGTG TTTCCAAAGT TTTAAAATTA TGGTAAACAA CAGTA (SEQ ID NO: 28).

[00100] The 3¹ flanking sequence information for rs17880135 (ss32469393) f http://www.ncbi.nlm.nih.gov/SNP/snp ref.cqi?rs=17880135)

GTTCACAGTA AGTGGTTAAA ACAACCATTC TTTAAATCTC AGTAGAGAAT TTTTAAAAAG CAGTATTTAA CACATTTCCC TAATGTAGTT TGTTGCCTAT GTGGAATAAC TCAATTAGAG ACTCACTTAT GCCTTTTGAA ACTTCAAATA TAATTACACT ACCAGTTTTT ACATGTGCAT ATAGGATGGT CCCAATACTT TAAATTGGAA ATACAGGCTG TAAGTCCTTC AAGTCTGGAT GTTGGGTAAT CACGT (SEQ ID NO:29).

[00101] The sequence from rs17881180 from 15 nucleotides upstream of the SNP to 15 nucleotides downstream is GGTCCCGGCC

CGTGCTGCCCGGTCGG TGCCT (SEQ ID NO:3) for the T allele of rs17881180. The underlined and bolded T represents the single nucleotide polymorphism associated with renal disease which is more commonly found to be C. Thus, the C allele of rs17881180 is GGTCCCGGCC CGTGCCGCCCGGTCGG TGCCT (SEQ ID NO:4).

[00102] The 5' flanking sequence information for rs17881180 (SS32469335) http://www.ncbi. nlm.nih.gov/SNP/snp_ref.cgi?rs=17881180

GGTTTCCGTT GCAGTCCTCG GAACCAGGAC CTCGGCGTGG CCTAGCGAGT TATGGCGACG AAGGCCGTGT GCGTGCTGAA GGGCGACGGC CCAGTGCAGG GCATCATCAA TTTCGAGCAG

AAGGCAAGGG CTGGGACGGA GGCTTGTTTG CGAGGCCGCT

CCCACCCGCT CGTCCCCCCG CGCACCTTTG CTAGGAGCGG

GTCGCCCGCC AGGCCTCGGG GCCGCCCTGG TCCAGCGCCC GGTCCCGGCC CGTGC (SEQ ID NO:30).

[00103] The 3¹ flanking sequence information for rs17881180 (SS32469335) http://www.ncbi.nlm. nih.gov/SNP/snp_ref.cgi?rs=17881180

GCCCGGTCGG TGCCTTCGCC CCCAGCGGTG CGGTGCCCAA GTGCTGAGTC ACCGGGCGGG CCCGGGCGCG GGGCGTGGGA

CCGAGGCCGC CGCGGGGCTG GGCCTGCGCG TGGCGGGAGC

GCGGGGAGGG ATTGCCGCGG GCCGGGGAGG GGCGGGGGCG

GGCGTGCTGC CCTCTGTGGT CCTTGGGCCG CCGCCGCGGG

TCTGTCGTGG TGCCTGGAGC GGCTGTGCTC GTCCCTTGCT TGGCCGTGTT CTCGT (SEQ ID NO:31 )

[00104] The sequence from rs202446 from 15 nucleotides upstream of the SNP to 15 nucleotides downstream is

CTTGACTCACTACAGACTCACCCCGCTGGGC (SEQ ID NO:5) for the A allele of rs202446. The underlined and bolded A represents the single nucleotide polymorphism associated with renal disease which is more commonly found to be C. Thus, the C allele of rs202446 is CTTGACTCACTACAGCCTCACCCCGCTGGGC (SEQ ID NO:6).

[00105] The 5' flanking sequence information for rs202446 (ss 14442598) http://www.ncbi. nlm.nih.gov/SNP/snp_ref.cgi?rs=202446

AAACCCTGTC AGAAAGAAGA AAAGAGAGTG AGAGAGAAAG AGAAAGAAAG AGAAAGAGAG AAAGAAAAAG AAAGAGAAAG AAGAAGGAAG GAGGGAGGGA GGGAAGAAAG GGAGGAGGGA AGGAGGGAAG GAATTAGAGA AAGAGGAGAA TGTGGCACAT GTAGACAGTT CAACTTTGTC AGGAATGGTG AGGAGGAATA GATGCCTTAA ATCAGATGGC GGCACGTGCA GATGACTAAA CCGCTTGTAA TGTGTCATTT CAGCCTTCCT GAGAGTGAAA ATTCATGTTT GGGGACCTCT GTGGTTAAAA GGTGGGCAAA AAGGTAGACC AGAAATTTTT TTTTTTTTAG ATGGAGTGTT GCTCTGTCGC CCGGGCTGGA GTGCGGTGGT GCAGTCTTGA CTCACTACAG (SEQ ID NO: 32)

[00106] The 3' flanking sequence information for rs202446 (ss14442598) http://www.ncbi. nlm.nih.gov/SNP/snp_ref.cgi?rs=202446

CTCACCCCGC TGGGCTTAGG CAATTCTCCA ACCTCAGCCT CCCAAGTAGC TGGGACTGCA GTTTCAATAA TTCTCTCTAG ACCTCAGCTG CAAATCAAAG GCACTGGGCC TAGATGCAGT GTTTATCAAC CCTGGCTGCA CAATAGAATC ACCTGGGCAG TTGAAAACTA AAACAAAAAA TACTGTGCTT AGGCCCAATT ATATTAAAAC CTTAAAATTG TATATCTTTA TACTGTAAAT

ACACATTTCA TTGCTGTAAG AGTCATAAGA AACCCTCAAT GGTTATCGAT GGAAGTAGGC TGCTTATCTG TGTACTTTTC ATCACGAGAA AAATAAACCT T (SEQ ID NO:33)

[00107] The sequence from rs204732 from 15 nucleotides upstream of the SNP to 15 nucleotides downstream is TGTGAAGT M M GAGT AGTGAGTCCTTATCT (SEQ ID NO:7) for the T allele of rs204732. The underlined and bolded T represents the single nucleotide polymorphism associated with renal disease which is more commonly found to be C. Thus, the C allele of rs204732 is TGTGAAGTTTTTGAGCAGTGAGTC CTTATCT (SEQ ID NO:8).

[00108] The 5' flanking sequence information for rs204732 (ss44249389) http://www.ncbi.nlm.nih.gov/SNP/snp ref.cqi?rs=204732 GATAGGTTTA GTTTTGACGTACTATTTTAAGGAGTAATCCAGTGGGAACA GTTTAAGGGAAGGACAAGAAAAGAATCCTGCATTTGCCCATTAAATAACC AGGTGCTGGCTAATGAGTTAGGTGTTGTGT ACATGTCTTTGCATTCTTTC CATTTTAAAGGTAAGGAAACTAGAGAAGTTTGGCGAATGGTCTGAGGTCA CACAGTGTAAAAGTAACAGTTCTGAGATTTGACACAGTCCTTTGAAGAGC CCATCTGAGTCTAGTCCACAGCCCCACATGGCTGCTGTGAAGTTTTTGA G (SEQ ID NO:34)

[00109] The 3' flanking sequence information for rs204732 (ss44249389) http://www.ncbi.nlm.nih.gov/SNP/snp ref.cαi?rs=204732

AGTGAGTCCT TATCTAATGG ACCATTTATG TGGGGAGAAG

ACTCAGTGAA CAGCTTTTAT

ACGTCTGAAG CATGGTAGCA AGTGATAACT ATCAAAATAA

TGTGTACTTT TGGAAGGACT TGTCACAGTT TAAGAATAAC AAGGTTTGGT TAAGTTTTTG

AGCCATCCAC AGTAATGCAG

TAAATGTAAT CAGCATTTAA AACTAAAGAT GTCTATTCTT TTTACCAGTT

TATACTCCAT

TAAAAATTTT AACTCATTAA GGATTTTATA AATGCTAGCA TTAATATTGT TTTCTAATTA (SEQ ID: 35)

[00110] The sequence from rs9974610 from 15 nucleotides upstream of the SNP to 15 nucleotides downstream is

CCGCACCCGGCCTGTGTATCTTTTTTAAAAG (SEQ ID NO:9) for the G allele of rs9974610. The underlined and bolded G represents the single nucleotide polymorphism associated with renal disease which is more commonly found to be A. Thus, the A allele of rs9974610 is

CCGCACCCGGCCTGTATATCTTTTTTAAAAG (SEQ ID NO: 10).

[00111] The 5' flanking sequence information for rs9974610 (ss13816737) http://www.ncbi.nlm.nih.gov/SNP/snp ref.cαi?rs=9974610

AAAGTGCTGG GATTACAGGC ATGAGCCACC ATGCCCGACC TTATATATCA TTTTTTTTGT

TGTTTGTTTT TTGAGACAGG GTCTCACTCT GTCACCCAGG CTGGAGTGCA GTGGCACGAT

CTTGGCTCAC TGCAGCCTCC ACCTCCCAGG TTCAAGCAAT TCTTCCACCT CAGCCTCCCG

AGTAGCTGGG ATTACAGGGG TGTGCCACCA TGCCTGGCTT TTTTTTTTTT TGAGACAGAG

TCTCACACTG TTGCCCGGGC TGGAGTGCAG TGGCATGATC TTGGCTCACT GCAGTTCAAG CAATTCTCCT GCCTTAGCCC CCTGAGTAGC TGGGATTACA GGTGCCTGCT ACCACCCTCA

GCTAATTTTT TGTATTTTTA ATAGAGACGG GGTTTCACCA TGTTGGCCAG GCTGGTCTCG

AACTCCTGAC CTCGTGATTC GTCTGCCTCG GCCTTCCAAA GTGCTGGGAG TACAGGCATG

AGCCACCGCA CCCGGCCTGT (SEQ ID NO:36)

[00112] The 3' flanking sequence information for rs9974610

(8813816737) http://www.ncbi.nlm.nih.gov/SNP/snp ref.cgi?rs=9974610 TATCTTTTTT AAAAGGAAAA GAACATATCC CAGAAGTTTC CAACTGAGTT TCCCTCTGGG

TCAATACCAG AATTGGGTGG GGGTCTTCAG CTCACCCCTA AACTCATCAT TGATAAGCAG

AATGAATGAC CATGGCTGGT TTAGACAACT GAAATTTCCG CTGGCCACAT AAGGAAGGAT

AGACACTAGA ACAAAATCAG GTCTATCAGA GTGGAAGAAA GGGAAGAGGG CTGGTGGGGA

GGCAATGAAT AGTGCCAGCG AACTGGAAAA TCATCCTGAC ATTTCGGTTC TGCTCTTTGA CTACGGTAAC TGTGTGTAAG TTAAAAGGGG AGGTCCATCC ATCATTACCT TTCTTATCTC AGATAGCTAA GAGACATCAT GAACTTAACT GTGTCCAAAA TGAAACTACT GGTCTTCTTC

CTCACATCTG CTCCACTGGC AGCCTCCTTG GCCATATTAA TTAACAACAA CTCCTTCTAT TGAACCAACA CCTTGGAGTT (SEQ ID NO:37)

[00113] The full sequence for the S0D1 gene is shown in Figure 1a (SEQ ID NO: 16). The full sequence for the SFRS15 gene is shown in Figure 1 b (SEQ ID NO:17).

[00114] While the present invention has been described with reference to what are presently considered to be the preferred examples, it is to be understood that the invention is not limited to the disclosed examples. To the contrary, the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

[00115] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

REFERENCES

The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. The Diabetes Control and Complications Trial Research Group. N Engl J Med, 1993. 329(14): p. 977-86.

Epidemiology of Diabetes Interventions and Complications (EDIC). Design, implementation, and preliminary results of a long-term follow-up of the

Diabetes Control and Complications Trial cohort. Diabetes Care, 1999. 22(1): p. 99-111.

Clustering of long-term complications in families with diabetes in the diabetes control and complications trial. The Diabetes Control and Complications Trial Research Group. Diabetes, 1997. 46(11): p. 1829-

39.

The Diabetes Control and Complications Trial (DCCT). Design and methodologic considerations for the feasibility phase. The DCCT Research Group, in Diabetes. 1986. p. 530-45. The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. The Diabetes Control and Complications Trial Research Group, in N Engl J Med. 1993. p. 977-86.

Abraha, A, Schultz, C, Konopelska-Bahu, T, James, T, Watts, A, Stratton, IM, Matthews, DR, and Dunger, DB, Glycaemic control and familial factors determine hyperlipidaemia in early childhood diabetes. Oxford

Regional Prospective Study of Childhood Diabetes. Diabet Med, 1999.

16(7): p. 598-604.

Adler, Al, Stevens, RJ, Manley, SE, Bilous, RW, Cull, CA, and Holman, RR, Development and progression of nephropathy in type 2 diabetes: the

United Kingdom Prospective Diabetes Study (UKPDS 64). Kidney Int,

2003. 63(1 ): p. 225-32.

Altshuler, D., et al., A haplotype map of the human genome. Nature, 2005.

437(7063): p. 1299-320. Araki, S., et al., APOE polymorphisms and the development of diabetic nephropathy in type 1 diabetes: results of case-control and family- based studies. Diabetes, 2000. 49(12): p. 2190-5. Barrett, J. C₁ et al., Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics, 2005. 21(2): p. 263-5.

Blakemore, A.I., et al., lnterleukin-1 receptor antagonist allele (IL1RN*2) associated with nephropathy in diabetes mellitus. Hum Genet, 1996.

97(3): p. 369-74. Borch-Johnsen, K., et al., Is diabetic nephropathy an inherited complication?

Kidney Int, 1992. 41(4): p. 719-22.

Boright, A. P., et al., Genetic variation at the ACE gene is associated with persistent microalbuminuria and severe nephropathy in type 1 diabetes: the DCCT/EDIC Genetics Study. Diabetes, 2005. 54(4): p.

1238-44. Brown lee, M., Biochemistry and molecular cell biology of diabetic complications. Nature, 2001. 414(6865): p. 813-20. Carlson, CS. , et al., Selecting a maximally informative set of single-nucleotide polymorphisms for association analyses using linkage disequilibrium.

Am J Hum Genet, 2004. 74(1): p. 106-20. Craven, P.A., et al., Overexpression of Cu2+/Zn2+ superoxide dismutase protects against early diabetic glomerular injury in transgenic mice. Diabetes, 2001. 50(9): p. 2114-25.

De Cosmo, S, Bacci, S, Piras, GP, Cignarelli, M, Placentino, G, Margaglione,

M, Colaizzo, D, Di Minno, G, Giorgino, R, Liuzzi, A, and Viberti, GC,

High prevalence of risk factors for cardiovascular disease in parents of

IDDM patients with albuminuria. Diabetologia, 1997. 40(10): p. 1191-6. Degen, B., S. Schmidt, and E. Ritz, A polymorphism in the gene for the endothelial nitric oxide synthase and diabetic nephropathy. Nephrol

Dial Transplant, 2001. 16(1): p. 185. Deinum, J., et al., Plasma renin and prorenin and renin gene variation in patients with insulin-dependent diabetes mellitus and nephropathy. Nephrol Dial Transplant, 1999. 14(8): p. 1904-11.

DeRubertis, F. R., et al., Attenuation of renal injury in db/db mice overexpressing superoxide dismutase: evidence for reduced superoxide-nitric oxide interaction. Diabetes, 2004. 53(3): p. 762-8. Dyer, P. H., et al., The 5'-end polymorphism of the aldose reductase gene is not associated with diabetic nephropathy in Caucasian type I diabetic patients. Diabetologia, 1999. 42(8): p. 1030-1. Earle, K, Walker, J, Hill, C, and Viberti, G, Familial clustering of cardiovascular disease in patients with insulin-dependent diabetes and nephropathy.

N Engl J Med, 1992. 326(10): p. 673-7.

Evans, J. L., et al., Oxidative stress and stress-activated signaling pathways: a unifying hypothesis of type 2 diabetes. Endocr Rev, 2002. 23(5): p.

599-622. Fioretto, P., et al., Is diabetic nephropathy inherited? Studies of glomerular structure in type 1 diabetic sibling pairs. Diabetes, 1999. 48(4): p. 865-

9. Gerstein, HC, Mann, JF, Yi, Q, Zinman, B, Dinneen, SF, Hoogwerf, B, Halle,

JP, Young, J, Rashkow, A, Joyce, C, Nawaz, S, and Yusuf, S,

Albuminuria and risk of cardiovascular events, death, and heart failure in diabetic and nondiabetic individuals. Jama, 2001. 286(4): p. 421-6. Harjutsalo, V., et al., Population-based assessment of familial clustering of diabetic nephropathy in type 1 diabetes. Diabetes, 2004. 53(9): p.

2449-54. Hinds, D.A., et al., Whole-genome patterns of common DNA variation in three human populations. Science, 2005. 307(5712): p. 1072-9. Kalter-Leibovici, O., et al., Risk factors for development of diabetic nephropathy and retinopathy in Jewish IDDM patients. Diabetes, 1991.

40(2): p. 204-10. Karter, A.J., et al., Ethnic disparities in diabetic complications in an insured population. Jama, 2002. 287(19): p. 2519-27.

Loughrey, B.V., et al., An interluekin 1B allele, which correlates with a high secretor phenotype, is associated with diabetic nephropathy. Cytokine,

1998. 10(12): p. 984-8. Miller, J.A., K. Thai, and J.W. Scholey, Angiotensin Il type 1 receptor gene polymorphism and the response to hyperglycemia in early type 1 diabetes. Diabetes, 2000. 49(9): p. 1585-9. Moczulski, D. K., et al., Major susceptibility locus for nephropathy in type 1 diabetes on chromosome 3q: results of novel discordant sib-pair analysis. Diabetes, 1998. 47(7): p. 1164-9. Moczulski, D. K., et al., Aldose reductase gene polymorphisms and susceptibility to diabetic nephropathy in Type 1 diabetes mellitus. Diabet Med, 2000. 17(2): p. 111-8.

Nannipieri, M., et al., Polymorphisms in the hANP (human atrial natriuretic peptide) gene, albuminuria, and hypertension. Hypertension, 2001.

37(6): p. 1416-22. Ng, DP., et al., Angiotensin-I converting enzyme insertion/deletion polymorphism and its association with diabetic nephropathy: a meta- analysis of studies reported between 1994 and 2004 and comprising

14, 727 subjects. Diabetologia, 2005. 48(5): p. 1008-16. Onuma, T., et al., Apolipoprotein E genotypes and risk of diabetic nephropathy. J Am Soc Nephrol, 1996. 7(7): p. 1075-8. Pritchard, J. K., M. Stephens, and P. Donnelly, Inference of population structure using multilocus genotype data, in Genetics. 2000. p. 945-59.

Quinn, M., et al., Familial factors determine the development of diabetic nephropathy in patients with IDDM. Diabetologia, 1996. 39(8): p. 940-5. Roglic, G, Colhoun, HM, Stevens, LK, Lemkes, HH, Manes, C, and Fuller, JH,

Parental history of hypertension and parental history of diabetes and microvascular complications in insulin-dependent diabetes mellitus: the

EURODIAB IDDM Complications Study. Diabet Med, 1998. 15(5): p.

418-26. Rosea, M. G., et al., Glycation of mitochondrial proteins from diabetic rat kidney is associated with excess superoxide formation. Am J Physiol Renal Physiol, 2005. 289(2): p. F420-30.

Seaquist, E. R., et al., Familial clustering of diabetic kidney disease. Evidence for genetic susceptibility to diabetic nephropathy [see comments]. N

Engl J Med, 1989. 320(18): p. 1161-5.

Schmidt, S., et al., A polymorphism in the gene for the atrial natriuretic peptide and diabetic nephropathy. Diabetic Nephropathy Study Group. Nephrol

Dial Transplant, 1998. 13(7): p. 1807-10. Sechi, L.A., et al., Renal antioxidant enzyme mRNA levels are increased in rats with experimental diabetes mellitus. Diabetologia, 1997. 40(1): p.

23-9. Selverstone Valentine, J., P. A. Doucette, and S. Zittin Potter, Copper-zinc superoxide dismutase and amyotrophic lateral sclerosis. Annu Rev

Biochem, 2005. 74: p. 563-93. Storey, J. D. and R. Tibshirani, Statistical significance for genomewide studies, in Proc Natl Acad Sci U S A. 2003. p. 9440-5. Tarnow, L., et al., Lack of synergism between long-term poor glycaemic control and three gene polymorphisms of the renin angiotensin system on risk of developing diabetic nephropathy in type I diabetic patients.

Diabetologia, 2000. 43(6): p. 794-9. van Ittersum, F.J., et al., Genetic polymorphisms of the renin-angiotensin system and complications of insulin-dependent diabetes mellitus. Nephrol Dial Transplant, 2000. 15(7): p. 1000-7.

Verhage, B, Vervoort, G, Wolkotte, C, Elving, LD, Wetzels, JF, Willems, H,

Smits, P, Verbeek, AL, and Berden, JH, Prevalence of "syndrome X" features in parents of type 1 diabetic patients with or without nephropathy. Diabetes Care, 1999. 22(7): p. 1048-52. Zanchi, A., et al., Risk of advanced diabetic nephropathy in type 1 diabetes is associated with endothelial nitric oxide synthase gene polymorphism.

Kidney Int, 2000. 57(2): p. 405-13.

Claims

Claims:

1. A composition comprising an isolated nucleic acid sequence that specifically hybridizes to at least one of SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 and their complements.

2. A composition comprising an isolated nucleic acid sequence that specifically hybridizes to at least two of SEQ ID NO:1 or its complement; an isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:3 or its complement; an isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:5 or its complement; an isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:7 or its complement and an isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:9 or its complement.

3. The composition of claim 1 or 2, wherein the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:1 comprises CACTTACTGTGAACCTACTGT (SEQ ID NO: 11).

4. The composition of claim 1 or 2, wherein the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:3 comprises ACCGGGCAGCACG (SEQ ID NO: 12).

5. The composition of claim 1 or 2, wherein the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:5 comprises

CTCACTACAGACTCAC) (SEQ ID NO: 13).

6. The composition of claim 1 or 2, wherein the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:7 comprises AGTTTTTGAGIAGTGAGTCC (SEQ ID NO: 14).

7. The composition of claim 1 or 2, wherein the isolated nucleic acid sequence that specifically hybridizes to SEQ ID NO:9 comprises CGGCCTGTGTATCT (SEQ ID NO: 15).

8. The composition of any one of claims 1-7, wherein the composition is used as a probe to detect the presence of at least one of the SNP alleles associated with renal disease, cataract, cardiovascular disease or longevity.

9. The composition of claim 8, wherein renal disease comprises an impairment in the function of the kidney.

10. The composition of claim 9, wherein the renal disease comprises diabetic nephropathy.

11. A composition of two or more isolated nucleic acid sequences, the sequences comprising primers that amplify a sequence containing the region of the rs17880135 SNP allele associated with renal disease, cataract, cardiovascular disease or longevity, wherein the first primer is upstream and the second primer is downstream of nucleotide at position 31 ,963,874 of rs17880135.

12. The composition of claim 11 , wherein the first primer is part of the sequence shown in SEQ ID NO:28 or its complement and the second primer is part of the sequence shown in SEQ ID NO:29 or its complement.

13. The composition of claim 12, wherein the first primer comprises the sequence δ'-GGAGAGGAAAAGCTAAATTGGAAGACA-S' (SEQ ID NO: 18) and the second primer comprises the sequence 5'- GCAACAAACTACATTAGGGAAATGTGT-S' (SEQ ID NO: 19).

14. A composition of two or more isolated nucleic acid sequences, the sequences comprising primers that amplify a sequence containing a region of the rs17881180 SNP allele associated with renal disease, cataract, cardiovascular disease or longevity, wherein the first primer is upstream and the second primer is downstream of nucleotide at position 31 ,954,158 of rs17881180.

15. The composition of claim 14, wherein the first primer is part of the sequence as shown in SEQ ID NO:30 or its complement and the second primer is part of the sequence shown in SEQ ID NO:31 or its complement.

16. The composition of claim 15, wherein the first primer comprises the sequence 5'-GCCGCCCTGGTCCAG-3' (SEQ ID NO:20) and the second primer comprises the sequence 5'-CCCGGTGACTCAGCACTTG-S' (SEQ ID NO:21).

17. A composition of two or more isolated nucleic acid sequences, the sequences comprising primers that amplify a sequence containing a region of the rs202446 SNP allele associated with renal disease, cataract, cardiovascular disease or longevity, wherein the first primer is upstream and the second primer is downstream of nucleotide at position 31 ,950,512 of rs202446.

18. The composition of claim 17, wherein the first primer is part of the sequence as shown in SEQ ID NO:32 or its complement and the second primer is part of the sequence shown in SEQ ID NO:33 or its complement.

19. The composition of claim 18, wherein the first primer comprises the sequence GTGGTTAAAAGGTGGGCAAA (SEQ ID NO:22) and the second primer comprises the sequence TGAGGTTGGAGAATTGCCTAA (SEQ ID NO:23).

20. A composition of two or more isolated nucleic acid sequences, the sequences comprising primers that amplify a sequence containing a region of the rs204732 SNP allele associated with renal disease, cataract, cardiovascular disease or longevity, wherein the first primer is upstream and the second primer is downstream of nucleotide at position 32,014,714 of rs204732.

21. The composition of claim 20, wherein the first primer is part of the sequence as shown in SEQ ID NO:34 or its complement and the second primer is part of the sequence shown in SEQ ID NO:35 or its complement.

22. The composition of claim 21 , wherein the first primer comprises the sequence TTTGAAGAGCCCATCTGAGTCTAGTC (SEQ ID NO:24) and the second primer comprises the sequence

GACGTATAAAAGCTGTTCACTGAGTCTTC (SEQ ID NO:25).

23. A composition of two or more isolated nucleic acid sequences, the sequences comprising primers that amplify a sequence containing a region of the rs9974610 SNP allele associated with renal disease, cataract, cardiovascular disease or longevity, wherein the first primer is upstream and the second primer is downstream of nucleotide at position 31 ,940,240 of rs9974610.

24. The composition of claim 23, wherein the first primer is part of the sequence as shown in SEQ ID NO:36 or its complement and the second primer is part of the sequence shown in SEQ ID NO:37 or its complement.

25. The composition of claim 24, wherein the first primer comprises the sequence CTTCCAAAGTGCTGGGAGTACAG (SEQ ID NO:26) and the second primer comprises the sequence

GAGGGAAACTCAGTTGGAAACTTCT (SEQ ID NO:27).

26. A method of screening for, diagnosing or detecting a risk of developing renal disease comprising detecting the presence of at least one SNP allele associated with renal disease in a sample of an individual; wherein detecting the presence of at least one of the SNP alleles associated with renal disease is indicative of renal disease or an increased risk of renal disease in the individual compared to an individual not having the SNP allele.

27. The method according to claim 26, wherein the at least one SNP allele associated with renal disease comprises (a) the presence of a G nucleotide at position 31 ,963,874 of

Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135);

(b) the presence of a T nucleotide at position 31 ,954,158 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180); (c) the presence of an A nucleotide at position 31 ,950,512 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446);

(d) the presence of a T nucleotide at position 32,014,714 of Build 36.2 (SNP ID# from NCBI dbSNP build 125 rs204732); or (e) the presence of a G nucleotide at position 31 ,940,240 of

Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610).

28. The method according to claim 26 or 27, wherein the individual is a human.

29. The method according to claim 28, wherein the individual is a non- diabetic first degree relative of a human with Type 1 diabetes.

30. The method according to claim 28, wherein the individual is a non- diabetic sibling of a human with Type 1 diabetes.

31. The method according to claim 28, wherein the individual is a human with Type 1 diabetes.

32. A method of reducing the risk of renal disease in an individual with Type 1 diabetes comprising:

(a) determining if the individual possesses at least one SNP allele associated with renal disease; and

(b) altering the glycemic target for the individual if at least one of the SNPs associated with renal disease is present.

33. The method according to claim 32, wherein the at least one SNP allele associated with renal disease comprises

(a) the presence of a G nucleotide at position 31 ,963,874 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135); (b) the presence of a T nucleotide at position 31 ,954,158 of

Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180);

(c) the presence of an A nucleotide at position 31 ,950,512 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446);

(d) the presence of a T nucleotide at position 32,014,714 of Build 36.2 (SNP ID# from NCBI dbSNP build 125 rs204732); or

(e) the presence of a G nucleotide at position 31 ,940,240 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610).

34. The method of claim 32 or 33, wherein the individual takes a glucose- reducing drug and the glycemic target for the individual is altered by increasing the patient's dose of glucose-reducing drug.

35. The method according to any one of claims 26-34, further comprising determining if the individual has renal disease by conducting a diagnostic test measuring urine creatinine levels, urine white or red blood cell levels or urine albumin protein levels in the individual, wherein an increased level compared to a normal individual is indicative of renal disease.

36. The method according to any one of claims 26-34, further comprising determining if the individual has renal disease by conducting a diagnostic test measuring glomerular filtration rate in the individual, wherein a reduced glomerular filtration rate compared to a normal individual is indicative of renal disease.

37. The composition of any one of claims 1-10, wherein the nucleic acids are labeled with a detectable marker.

38. A kit for screening for, diagnosing or detecting a risk or developing renal disease, cataract, cardiovascular disease or for predicting longevity comprising any one of the compositions according to claims 1-25 and instructions for use.

39. The kit of claim 38, wherein the nucleic acids are labeled with a detectable marker.

40. A method of screening for, diagnosing or detecting a risk of cataract in an individual comprising detecting the presence of at least one SNP allele associated with cataract in a sample of the individual; wherein detecting the presence of at least one of the SNP alleles associated with cataract is indicative of having a cataract or an increased risk of getting a cataract in the individual compared to an individual not having the SNP allele.

41. The method according to claim 18, wherein the at least one SNP allele associated with cataract comprises

(a) the presence of a G nucleotide at position 31 ,963,874 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135); (b) the presence of a T nucleotide at position 31 ,954,158 of

Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180);

(c) the presence of an A nucleotide at position 31 ,950,512 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446);

(d) the presence of a T nucleotide at position 32,014,714 of Build 36.2 (SNP ID# from NCBI dbSNP build 125 rs204732); or

(e) the presence of a G nucleotide at position 31 ,940,240 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610).

42. The method according to claim 40 or 41 , wherein the individual is a human.

43. The method according to claim 42, wherein the individual has Type 1 diabetes.

44. The method according to claim 42, wherein the individual is a parent of a diabetic.

45. A method of increasing the survival of an individual comprising: (a) determining if the individual possesses at least one SNP allele associated with cardiovascular disease or longevity; and

(b) monitoring or treating heart function for the individual if at least one of the SNPs associated with renal disease is present.

46. The method according to claim 45, wherein the at least one SNP allele associated with cardiovascular disease or longevity comprises

(a) the presence of a G nucleotide at position 31 ,963,874 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135);

(b) the presence of a T nucleotide at position 31 ,954,158 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180);

(c) the presence of an A nucleotide at position 31 ,950,512 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446); (d) the presence of a T nucleotide at position 32,014,714 of

Build 36.2 (SNP ID# from NCBI dbSNP build 125 rs204732); or

(e) the presence of a G nucleotide at position 31 ,940,240 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610).

47. A method of screening for, diagnosing or detecting a risk of cardiovascular disease or for predicting longevity in an individual that is a parent of a diabetic comprising detecting the presence of at least one SNP allele associated with cardiovascular disease or longevity in a sample of the individual; wherein detecting the presence of at least one of the SNP alleles associated with cardiovascular disease or longevity is i) indicative of having cardiovascular disease or an increased risk of cardiovascular disease in the individual compared to an individual not having the SNP allele and/or ii) indicative of a risk of decreased longevity in the individual compared to an individual not having the SNP allele.

48. The method according to claim 47, wherein the at least one SNP allele associated with cardiovascular disease or longevity comprises

(a) the presence of a G nucleotide at position 31 ,963,874 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17880135);

(b) the presence of a T nucleotide at position 31 ,954,158 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs17881180); (c) the presence of an A nucleotide at position 31 ,950,512 of Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs202446);

(d) the presence of a T nucleotide at position 32,014,714 of Build 36.2 (SNP ID# from NCBI dbSNP build 125 rs204732); or (e) the presence of a G nucleotide at position 31 ,940,240 of

Build 36.2 (SNP ID# from NCBI dbSNP Build 125: rs9974610).

49. The method according to any one of claims 45-48, wherein the individual is a human.

50. The method according to claim 49, wherein the individual has Type 1 diabetes.

51. The method according to claim 49, wherein the individual has diabetic nephropathy.

52. The method according to claim 49, wherein the individual is a parent of a diabetic.