WO2007128829A2 - 18,21-didesoxymacbecin derivatives for the treatment of cancer - Google Patents
18,21-didesoxymacbecin derivatives for the treatment of cancer Download PDFInfo
- Publication number
- WO2007128829A2 WO2007128829A2 PCT/EP2007/054476 EP2007054476W WO2007128829A2 WO 2007128829 A2 WO2007128829 A2 WO 2007128829A2 EP 2007054476 W EP2007054476 W EP 2007054476W WO 2007128829 A2 WO2007128829 A2 WO 2007128829A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- strain
- represent
- compound according
- pharmaceutically acceptable
- acceptable salt
- Prior art date
Links
- 0 CC(CC(C(*)C(C)C=C(C)C(*)C(C)C(*)C(*)C=C(C)C(N1)=O)OC)C(*)c2c(*)c(*)cc1c2* Chemical compound CC(CC(C(*)C(C)C=C(C)C(*)C(C)C(*)C(*)C=C(C)C(N1)=O)OC)C(*)c2c(*)c(*)cc1c2* 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D225/00—Heterocyclic compounds containing rings of more than seven members having one nitrogen atom as the only ring hetero atom
- C07D225/04—Heterocyclic compounds containing rings of more than seven members having one nitrogen atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
- C07D225/06—Heterocyclic compounds containing rings of more than seven members having one nitrogen atom as the only ring hetero atom condensed with carbocyclic rings or ring systems condensed with one six-membered ring
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/10—Antimycotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
- A61P33/06—Antimalarials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- Hsp90 The 90 kDa heat shock protein
- So far nearly 50 of these so-called client proteins have been identified and include steroid receptors, non-receptor tyrosine kinases e.g. src family, cyclin-dependent kinases e.g.
- Hsp90 plays a key role in stress response and protection of the cell against the effects of mutation (Bagatell and Whitesell, 2004; Chiosis et al., 2004).
- Hsp90 The function of Hsp90 is complicated and it involves the formation of dynamic multi-enzyme complexes (Bohen, 1998; Liu et al., 1999; Young et al., 2001 ; Takahashi ef a/., 2003; Sreedhar et al., 2004; Wegele et al., 2004).
- Hsp90 is a target for inhibitors (Fang et ai, 1998; Liu et al., 1999; Blagosklonny, 2002; Neckers, 2003; Takahashi et al., 2003; Beliakoff and Whitesell, 2004; Wegele et ai, 2004) resulting in degradation of client proteins, cell cycle dysregulation and apoptosis.
- Hsp90 has been identified as an important extracellular mediator for tumour invasion (Eustace et ai., 2004). Hsp90 was identified as a new major therapeutic target for cancer therapy which is mirrored in the intense and detailed research about Hsp90 function (Blagosklonny et al., 1996; Neckers, 2002; Workman and Kaye, 2002; Beliakoff and Whitesell, 2004; Harris et al., 2004; Jez et al., 2003; Lee et ai., 2004) and the development of high-throughput screening assays (Carreras et al., 2003; Rowlands et ai., 2004).
- Hsp90 inhibitors include compound classes such as ansamycins, macrolides, purines, pyrazoles, coumarin antibiotics and others (for review see Bagatell and Whitesell, 2004; Chiosis et ai., 2004 and references therein).
- the benzenoid ansamycins are a broad class of chemical structures characterised by an aliphatic ring of varying length joined either side of an aromatic ring structure.
- Naturally occurring ansamycins include: macbecin and 18,21 -dihydromacbecin (also known as macbecin I and macbecin Il respectively) (1 & 2; Tanida et ai., 1980), geldanamycin (3; DeBoer ef a/., 1970; DeBoer and Dietz, 1976; WO 03/106653 and references therein), and the herbimycin family (4; 5, 6, Omura et ai., 1979, Iwai et ai., 1980 and Shibata et ai, 1986a, WO 03/106653 and references therein).
- herbimycin C, 6 R 1 OCH 3
- R 2 H
- a ⁇ samyci ⁇ s were originally identified for their antibacterial and antiviral activity, however, recently their potential utility as anticancer agents has become of greater interest (Beliakoff and Whitesell, 2004). Many Hsp90 inhibitors are currently being assessed in clinical trials (Csermely and Soti, 2003; Workman, 2003). In particular, geldanamycin has nanomolar potency and apparent specificity for aberrant protein kinase dependent tumour cells (Chiosis et al., 2003; Workman, 2003).
- Hsp90 inhibitors enhances the induction of tumour cell death by radiation and increased cell killing abilities (e.g. breast cancer, chronic myeloid leukaemia and non-small cell lung cancer) by combination of Hsp90 inhibitors with cytotoxic agents has also been demonstrated (Neckers, 2002; Beliakoff and Whitesell, 2004).
- the potential for anti-angiogenic activity is also of interest: the Hsp90 client protein HIF-1 ⁇ plays a key role in the progression of solid tumours (Hur et al., 2002; Workman and Kaye, 2002; Kaur et a/., 2004).
- Hsp90 inhibitors also function as immunosuppressants and are involved in the complement-induced lysis of several types of tumour cells after Hsp90 inhibition (Sreedhar et al., 2004). Treatment with Hsp90 inhibitors can also result in induced superoxide production (Sreedhar et al., 2004a) associated with immune cell-mediated lysis (Sreedhar et al., 2004).
- Hsp90 inhibitors as potential anti-malaria drugs has also been discussed (Kumar et al., 2003).
- geldanamycin interferes with the formation of complex glycosylated mammalian prion protein PrP c (Winklhofer et al., 2003).
- ansamycins are of interest as potential anticancer and anti-B-cell malignancy compounds, however the currently available ansamycins exhibit poor pharmacological or pharmaceutical properties, for example they show poor water solubility, poor metabolic stability, poor bioavailability or poor formulation ability (Goetz et al., 2003; Workman 2003; Chiosis 2004). Both herbimycin A and geldanamycin were identified as poor candidates for clinical trials due to their strong hepatotoxicity (review Workman, 2003) and geldanamycin was withdrawn from Phase I clinical trials due to hepatotoxicity (Supko et al., 1995; WO 03/106653).
- Geldanamycin was isolated from culture filtrates of Streptomyces hygroscopicus and shows strong activity in vitro against protozoa and weak activity against bacteria and fungi. In 1994 the association of geldanamycin with Hsp90 was shown (Whitesell et al., 1994). The biosynthetic gene cluster for geldanamycin was cloned and sequenced (Allen and Ritchie, 1994; Rascher et al., 2003; WO 03/106653). The DNA sequence is available under the NCBI accession number AY179507. The isolation of genetically engineered geldanamycin producer strains derived from S. hygroscopicus subsp.
- duamyceticus JCM4427 and the isolation of 4,5- dihydro-7-O-descarbamoyl-7-hydroxygeldanamycin and 4,5-dihydro-7-O-descarbamoyl-7- hydroxy-17-O-demethylgeldanamycin were described recently (Hong et al., 2004).
- geldanamycin By feeding geldanamycin to the herbimycin producing strain Streptomyces hygroscopicus AM-3672 the compounds 15-hydroxygeldanamycin, the tricyclic geldanamycin analogue KOSN-1633 and methyl-geldanamycinate were isolated (Hu et al., 2004).
- S. hygroscopicus K279-78 is S. hygroscopicus NRRL 3602 containing cosmid pKOS279-78 which has a 44 kbp insert which contains various genes from the herbimycin producing strain Streptomyces hygroscopicus AM-3672 (Hu et al., 2004).
- ansamycin antibiotic herbimycin A was isolated from the fermentation broth of Streptomyces hygroscopicus strain No. AM-3672 and named according to its potent herbicidal activity.
- the antitumour activity was established by using cells of a rat kidney line infected with a temperature sensitive mutant of Rous sarcoma virus (RSV) for screening for drugs that reverted the transformed morphology of the these cells (for review see Uehara, 2003).
- RSV Rous sarcoma virus
- Herbimycin A was postulated as acting primarily through the binding to Hsp90 chaperone proteins but the direct binding to the conserved cysteine residues and subsequent inactivation of kinases was also discussed (Uehara, 2003).
- 18,21 -Dihydromacbecin is characterized by containing the dihydroquinone form of the nucleus.
- TAN-420A to E were identified from producer strains belonging to the genus Streptomyces (7-11 , EP 0 1 10 710).
- a further Hsp90 inhibitor, distinct from the chemically unrelated benzoqumone ansamycins is Radicicol (monorden) which was originally discovered for its antifungal activity from the fungus Monospo ⁇ um bonorden (for review see Uehara, 2003) and the structure was found to be identical to the 14-membered macrolide isolated from Nectria radicicola. In addition to its antifungal, antibacterial, anti-protozoan and cytotoxic activity it was subsequently identified as an inhibitor of Hsp90 chaperone proteins (for review see Uehara, 2003; Schulte et al., 1999). The anti-angiogenic activity of radicicol (Hur et al., 2002) and semi-synthetic de ⁇ vates thereof (Kurebayashi et al., 2001 ) has also been described.
- geldanamycin was derivatised on the 17-posit ⁇ on to create 17-geldanamycin amides, carbamates, ureas and 17-arylgeldanamycin (Le Brazidec et al., 2003).
- a library of over sixty 17-alkylamino-17-demethoxygeldanamycin analogues has been reported and tested for their affinity for Hsp90 and water solubility (Tian et al , 2004).
- a further approach to reduce the toxicity of geldanamycin is the selective targeting and delivering of an active geldanamycin compound into malignant cells by conjugation to a tumour-targeting monoclonal antibody (Mandler et al., 2000).
- 17-AAG requires the use of a solubilising carrier (e.g. Cremophore®, DMSO-egg lecithin), which itself may result in side-effects in some patients (Hu et al., 2004).
- a solubilising carrier e.g. Cremophore®, DMSO-egg lecithin
- ansamycin class of Hsp90 inhibitors bear the common structural moiety: the benzoquinone which is a Michael acceptor that can readily form covalent bonds with nucleophiles such as proteins, glutathione, etc.
- the benzoquinone moiety also undergoes redox equilibrium with dihydroquinone, during which oxygen radicals are formed, which give rise to further unspecific toxicity (Dikalov et al., 2002).
- treatment with gelda ⁇ amycin can result in induced superoxide production (Sreedhar et al., 2004a).
- novel ansamycin derivatives which may have utility in the treatment of cancer and / or B-cell malignancies, preferably such ansamycins have improved water solubility, an improved pharmacological profile and/or reduced side-effect profile for administration.
- the present invention discloses novel ansamycin analogues generated by biotransformation and optionally genetic engineering of the parent producer strain.
- novel 18,21-didesoxymacbecin analogues which generally have improved pharmaceutical properties compared with the presently available ansamycins; in particular they are expected show improvements in respect of one or more of the following properties: activity against different cancer sub-types, toxicity, water solubility, metabolic stability, bioavailability and formulation ability.
- the 18,21- didesoxymacbecin analogues show improved bioavailability.
- non-natural starter units have been fed to a macbecin producing strain, optionally in combination with targeted inactivation or deletion of the genes responsible for the post-PKS modifications of macbecin in order to produce novel macbecin analogues formed by incorporation of a non-natural starter unit.
- novel macbecin analogues formed by incorporation of a starter unit which results in a benzene moiety which is either not substituted in the 17, 18 and 21 positions or which is substituted in some or all of these positions by fluorine.
- the genes or regulators responsible for starter unit biosynthesis may be manipulated by targeted inactivation or deletion or modified by other means such as exposing cells to UV radiation and selection of the phenotype indicating that starter unit biosynthesis has been disrupted.
- the optional targeting of the post-PKS genes may occur via a variety of mechanisms, e.g. by integration, targeted deletion of a region of the macbecin cluster including all or some of the post-PKS genes optionally followed by insertion of gene(s) or other methods of rendering the post-PKS genes or their encoded enzymes non-functional e.g. chemical inhibition, site-directed mutagenesis or mutagenesis of the cell for example by the use of UV radiation.
- the present invention provides 18,21-didesoxymacbecin analogues, methods for the preparation of these compounds, and methods for the use of these compounds in medicine or as intermediates in the production of further compounds.
- the present invention provides analogues of macbecin which are lacking the usual starter unit, and which have instead incorporated a starter unit which results in 18,21-didesoxymacbecin analogues which are either not substituted in the 17, 18 and 21 positions or which are substituted in some or all of these positions by fluorine.
- the present invention provides 18,21 -didesoxymacbecin analogues according to the formula (I) below, or a pharmaceutically acceptable salt thereof:
- Ri represents H, OH, OMe
- R 2 represents H or Me
- R 3 represents H or CONH 2
- R 4 and R 5 either both represent H or together they represent a bond (i.e. C4 to C5 is a double bond)
- R 6 represents H or F
- R 7 represents H or F
- R 8 represents H or F.
- 18,21-didesoxymacbecin analogues are also referred to herein as "compounds of the invention", such terms are used interchangeably herein.
- the invention embraces all stereoisomers of the compounds defined by structure (I) as shown above.
- the present invention provides 18,21-didesoxymacbecin analogues such as compounds of formula (I) or a pharmaceutically acceptable salt thereof, for use as a pharmaceutical.
- analogue means one analogue or more than one analogue.
- analogue(s) refers to chemical compounds that are structurally similar to another but which differ slightly in composition (as in the replacement of one atom by another or in the presence or absence of a particular functional group).
- homologue(s) refers a homologue of a gene or of a protein encoded by a gene disclosed herein from either an alternative macbecin biosynthetic cluster from a different macbecin producing strain or a homologue from an alternative ansamycin biosynthetic gene cluster e.g. from geldanamycin, herbimycin or reblastatin.
- Such homologue(s) encode a protein that performs the same function of can itself perform the same function as said gene or protein in the synthesis of macbecin or a related ansamycin polyketide.
- such homologue(s) have at least 40% sequence identity, preferably at least 60%, at least 70%, at least 80%, at least 90% or at least 95% sequence identity to the sequence of the particular gene disclosed herein (Table 3, SEQ ID NO: 1 1 which is a sequence of all the genes in the cluster, from which the sequences of particular genes may be deduced). Percentage identity may be calculated using any program known to a person of skill in the art such as BLASTn or BLASTp, available on the NCBI website.
- cancer refers to a benign or malignant new growth of cells in skin or in body organs, for example but without limitation, breast, prostate, lung, kidney, pancreas, brain, stomach or bowel.
- a cancer tends to infiltrate into adjacent tissue and spread (metastasise) to distant organs, for example to bone, liver, lung or the brain.
- cancer includes both metastatic tumour cell types, such as but not limited to, melanoma, lymphoma, leukaemia, fibrosarcoma, rhabdomyosarcoma, and mastocytoma and types of tissue carcinoma, such as but not limited to, colorectal cancer, prostate cancer, small cell lung cancer and non-small cell lung cancer, breast cancer, pancreatic cancer, bladder cancer, renal cancer, gastric cancer, gliobastoma, primary liver cancer and ovarian cancer.
- B-cell malignancies includes a group of disorders that include chronic lymphocytic leukaemia (CLL), multiple myeloma, and non-Hodgkin's lymphoma (NHL).
- bioavailability refers to the degree to which or rate at which a drug or other substance is absorbed or becomes available at the site of biological activity after administration. This property is dependent upon a number of factors including the solubility of the compound, rate of absorption in the gut, the extent of protein binding and metabolism etc.
- tests for bioavailability that would be familiar to a person of skill in the art are for example described in Egorin et a/. (2002).
- water solubility refers to solubility in aqueous media, e.g. phosphate buffered saline (PBS) at pH 7.3.
- PBS phosphate buffered saline
- An exemplary water solubility assay is given in the Examples below.
- macbecin producing strain refers to strains, for example wild type strains as exemplified by A pretiosum and A mirum, which produce macbecin when cultured under suitable conditions, for example when fed the natural starter feed 3-amino-5- hydroxybenzoic acid.
- post-PKS genes(s) refers to the genes required for post- polyketide synthase modifications of the polyketide, for example but without limitation monooxygenases, O-methyltransferases and carbamoyltransferases.
- these modifying genes include mbcM, mbcN, mbcP, mbcMTI, mbcMT2 and mbcP450.
- starter unit biosynthesis gene(s) refers to the genes required for the production of the starter unit naturally incorporated, 3-amino-5-hydroxybenzoic acid (AHBA). Specifically, in the macbecin system these starter unit biosynthesis genes include AHk (AHBA kinase), Adh (aDHQ dehydrogenase), AHs (AHBA synthase), OX (oxidoreductase), PH (Phosphatase). Other strains that produce AHBA also contain AHBA biosynthesis genes.
- the pharmaceutically acceptable salts of compounds of the invention include conventional salts formed from pharmaceutically acceptable inorganic or organic acids or bases as well as quaternary ammonium acid addition salts. More specific examples of suitable acid salts include hydrochloric, hydrobromic, sulfuric, phosphoric, nitric, perchloric, fumaric, acetic, propionic, succinic, glycolic, formic, lactic, maleic, tartaric, citric, palmoic, malonic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, fumaric, toluenesulfonic, methanesulfonic, naphthalene-2-sulfonic, benzenesulfonic hydroxynaphthoic, hydroiodic, malic, steroic, tannic and the like.
- acids such as oxalic, while not in themselves pharmaceutically acceptable, may be useful in the preparation of salts useful as intermediates in obtaining the compounds of the invention and their pharmaceutically acceptable salts.
- suitable basic salts include sodium, lithium, potassium, magnesium, aluminium, calcium, zinc, N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N-methylglucamine and procaine salts.
- References hereinafter to a compound according to the invention include both compounds of formula (I) and their pharmaceutically acceptable salts.
- Figure 1 Representation of the biosynthesis of macbecin showing the first putative enzyme free intermediate, pre-macbecin and the post-PKS processing to macbecin.
- the list of PKS processing steps in the figure is not intended to represent the order of events.
- the following abbreviations are used for particular genes in the cluster: ALO - AHBA loading domain; ACP - Acyl Carrier Protein; KS - ⁇ -ketosynthase; AT - acyl transferase; DH - dehydratase; ER - enoyl reductase; KR - ⁇ -ketoreductase.
- Figure 2 Depiction of the sites of post-PKS processing of pre-macbecin to give macbecin.
- Figure 3 Diagrammatic representation of generation of the engineered strain BIOT-3806 in which plasmid pLSS308 was integrated into the chromosome by homologous recombination resulting in mbcM gene disruption.
- Figure 4 Diagrammatic representation of the construction of the in-frame deletion of mbcM described in example 2.
- Figure 5 A - shows the sequence of the PCR product PCRwv308, SEQ ID NO: 16 B - shows the sequence of the PCR product PCRwv309, SEQ ID NO: 19
- Figure 6 A - shows the DNA sequence resulting from the in-frame deletion of 502 amino acids in mbcM as described in example 3 (SEQ ID NO: 20 and 21 ), Key: 1-21 bp encodes 3' end of the phosphatase of 3-amino-5-hydroxybenzoic acid biosynthesis, 136-68 bp encodes mbcM deletion protein, 161 -141 bp encodes 3' end of mbcF.
- B shows the amino acid sequence of the protein (SEQ ID NO: 22).
- FIG. 7 Diagrammatic representation of the generation of an Actinosynnema pretiosum strain in which the mbcP, mbcP450, mbcMTI and mbcMT2 genes have been deleted in frame.
- Figure 8 Sequence of the amplified PCR product 1 +2a (SEQ ID NO: 25)
- Figure 9 Sequence of the amplified PCR product 3b+4 (SEQ ID NO: 28)
- Figure 10 Structures of the compounds(14-20) produced in the Examples.
- the present invention provides 18,21-didesoxymacbecin analogues, as set out above, methods for the preparation of these compounds, methods for the use of these compounds in medicine and the use of these compounds as intermediates or templates for further semisynthetic derivatisation or derivatisation by biotransformation methods.
- Ri represents H or OH.
- R 1 represents H.
- R 1 represents OH.
- R 2 represents H.
- R 3 represents CONH 2
- R 4 and R 5 together represent a bond.
- R 4 and R 5 each represent H.
- R 6 , R 7 and R 8 all represent hydrogen.
- R 6 , R 7 and R 8 do not all represent hydrogen.
- R 1 represents H
- R 2 represents H
- R 3 represents CONH 2
- R 4 and R 5 each represent H.
- R 1 represents OH
- R 2 represents H
- R 3 represents CONH 2 and R 4 and R 5 each represent H.
- R 1 represents H
- R 2 represents H
- R 3 represents CONH 2
- R 4 and R 5 each represent H
- R 6 , R 7 and Rs each represent H.
- R 1 represents OH
- R 2 represents H
- R 3 represents CONH 2
- R 4 and R 5 each represent H
- R 6 , R 7 and R 8 each represent H.
- R 1 represents H
- R 2 represents H
- R 3 represents CONH 2
- R 4 and R 5 each represent H
- R 6 represents F
- R 7 and R 8 each represent H.
- Ri represents OH, R 2 represents H, R 3 represents CONH 2 , R 4 and R 5 each represent H, R 6 represents F and R 7 and R 8 each represent H.
- Ri represents H, R 2 represents H, R 3 represents CONH 2 , R 4 and R 5 each represent H, R 6 represents H, R 7 represents F and R 8 represents H.
- R 1 represents OH
- R 2 represents H
- R 3 represents CONH 2
- R 4 and R 5 each represent H
- R 6 represents H
- R 7 represents F
- R 8 represents H.
- R 1 represents H
- R 2 represents H
- R 3 represents CONH 2
- R 4 and R 5 each represent H
- R 6 and R 7 each represent F
- R 8 represents H, for example as represented in the following structure
- R 1 represents OH
- R 2 represents H
- R 3 represents CONH 2
- R 4 and R 5 each represent H
- R 6 and R 7 each represent F
- R 8 represents H.
- R 1 represents H
- R 2 represents H
- R 3 represents CONH 2
- R 4 and R 5 each represent H
- R 6 , R 7 and R 8 each represent F.
- the present invention also provides for the use of an 18,21-didesoxymacbecin analogue as a substrate for further modification either by biotransformation or by synthetic chemistry.
- the present invention provides an 18,21-didesoxymacbecin analogue for use as a medicament.
- the present invention provides an 18,21 - didesoxymacbecin analogue for use in the treatment of cancer, B-cell malignancies, malaria, fungal infection, diseases of the central nervous system and neurodegenerative diseases, diseases dependent on angiogenesis, autoimmune diseases and/or as a prophylactic pre- treatment for cancer.
- the present invention provides for the use of an 18,21 - didesoxymacbecin analogue in the manufacture of a medicament.
- the present invention provides for the use of an 18,21 -didesoxymacbecin analogue in the manufacture of a medicament for the treatment of cancer, B-cell malignancies, malaria, fungal infection, diseases of the central nervous system and neurodegenerative diseases, diseases dependent on angiogenesis, autoimmune diseases and/or as a prophylactic pre-treatment for cancer.
- the present invention provides a method of treatment of cancer, B- cell malignancies, malaria, fungal infection, diseases of the central nervous system and neurodegenerative diseases, diseases dependent on angiogenesis, autoimmune diseases and/or a prophylactic pre-treatment for cancer, said method comprising administering to a patient in need thereof a therapeutically effective amount of an 18,21-didesoxymacbecin analogue.
- compounds of the invention may be expected to be useful in the treatment of cancer and/or B-cell malignancies.
- Compounds of the invention may also be effective in the treatment of other indications for example, but not limited to malaria, fungal infection, diseases of the central nervous system and neurodegenerative diseases, diseases dependent on angiogenesis, autoimmune diseases such as rheumatoid arthritis or as a prophylactic pre-treatment for cancer.
- Diseases of the central nervous system and neurodegenerative diseases include, but are not limited to, Alzheimer's disease, Parkinson's disease, Huntington's disease, prion diseases, spinal and bulbar muscular atrophy (SBMA) and amyotrophic lateral sclerosis (ALS).
- Diseases dependent on angiogenesis include, but are not limited to, age-related macular degeneration, diabetic retinopathy and various other ophthalmic disorders, atherosclerosis and rheumatoid arthritis.
- Autommune diseases include, but are not limited to, rheumatoid arthritis, multiple sclerosis, type I diabetes, systemic lupus erythematosus and psoriasis,
- atient embraces human and other animal (especially mammalian) subjects, preferably human subjects. Accordingly the methods and uses of the 18,21-didesoxymacbecin analogues of the invention are of use in human and veterinary medicine, preferably human medicine.
- the aforementioned compounds of the invention or a formulation thereof may be administered by any conventional method for example but without limitation they may be administered parenterally (including intravenous administration), orally, topically (including buccal, sublingual or transdermal), via a medical device (e.g. a stent), by inhalation, or via injection (subcutaneous or intramuscular).
- the treatment may consist of a single dose or a plurality of doses over a period of time.
- a compound of the invention Whilst it is possible for a compound of the invention to be administered alone, it is preferable to present it as a pharmaceutical formulation, together with one or more acceptable diluents or carriers.
- a pharmaceutical composition comprising a compound of the invention together with one or more pharmaceutically acceptable diluents or carriers.
- the diluents(s) or carrier(s) must be "acceptable” in the sense of being compatible with the compound of the invention and not deleterious to the recipients thereof. Examples of suitable carriers are described in more detail below.
- the compounds of the invention may be administered alone or in combination with other therapeutic agents. Co-administration of two (or more) agents may allow for significantly lower doses of each to be used, thereby reducing the side effects seen. It might also allow resensitisation of a disease, such as cancer, to the effects of a prior therapy to which the disease has become resistant.
- a pharmaceutical composition comprising a compound of the invention and a further therapeutic agent together with one or more pharmaceutically acceptable diluents or carriers.
- the present invention provides for the use of a compound of the invention in combination therapy with a second agent eg a second agent for the treatment of cancer or B-cell malignancies such as a cytotoxic or cytostatic agent.
- a compound of the invention is co-administered with another therapeutic agent e.g. a therapeutic agent such as a cytotoxic or cytostatic agent for the treatment of cancer or B-cell malignancies.
- a therapeutic agent such as a cytotoxic or cytostatic agent for the treatment of cancer or B-cell malignancies.
- cytotoxic agents such as alkylating agents and mitotic inhibitors (including topoisomerase Il inhibitors and tubulin inhibitors).
- Other exemplary further agents include DNA binders, antimetabolites and cytostatic agents such as protein kinase inhibitors and tyrosine kinase receptor blockers.
- Suitable agents include, but are not limited to, methotrexate, leukovorin, prenisone, bleomycin, cyclophosphamide, 5-fluorouracil, paclitaxel, docetaxel, vincristine, vinblastine, vinorelbine, doxorubicin (adriamycin), tamoxifen, toremifene, megestrol acetate, anastrozole, goserelin, anti- HER2 monoclonal antibody (e.g. trastuzumab, trade name HerceptinTM), capecitabine, raloxifene hydrochloride, EGFR inhibitors (e.g.
- gefitinib trade name Iressa ®, erlotinib, trade name TarcevaTM , cetuximab, trade name ErbituxTM
- VEGF inhibitors e.g. bevacizumab, trade name AvastinTM
- proteasome inhibitors e.g. bortezomib, trade name VelcadeTM
- chemotherapeutics such as cisplatin, cytarabine, cyclohexylchloroethylnitrosurea, gemcitabine, Ifosfamid, leucovorin, mitomycin, mitoxantone, oxaliplatin, taxanes including taxol and vindesine; hormonal therapies ; monoclonal antibody therapies such as cetuximab (anti-EGFR); protein kinase inhibitors such as dasatinib, lapatinib; histone deacetylase (HDAC) inhibitors such as vorinostat; angiogenesis inhibitors such as sunitinib, sorafenib, lenalidomide; mTOR inhibitors such as temsirolimus; and imatinib, trade name Glivec ®. Additionally, a compound of the invention may be administered in combination with other therapies including, but not limited to, radiotherapy or surgery.
- the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (compound of the invention) with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- the compounds of the invention will normally be administered orally or by any parenteral route, in the form of a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form.
- a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form.
- the compositions may be administered at varying doses.
- the compounds of the invention can be administered orally, buccally or sublingually in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed- or controlled-release applications.
- Such tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatine and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included. Solid compositions of a similar type may also be employed as fillers in gelatine capsules.
- excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine
- disintegrants such as starch (preferably corn, potato or tapioca starch),
- Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.
- the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerine, and combinations thereof.
- a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g. povidone, gelatine, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (e.g. sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent.
- Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
- the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethylcellulose in varying proportions to provide desired release profile.
- Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion.
- the active ingredient may also be presented as a bolus, electuary or paste.
- Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatine and glycerine, or sucrose and acacia; and mouth-washes comprising the active ingredient in a suitable liquid carrier.
- formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.
- compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, impregnated dressings, sprays, aerosols or oils, transdermal devices, dusting powders, and the like.
- These compositions may be prepared via conventional methods containing the active agent.
- they may also comprise compatible conventional carriers and additives, such as preservatives, solvents to assist drug penetration, emollient in creams or ointments and ethanol or oleyl alcohol for lotions.
- Such carriers may be present as from about 1 % up to about 98% of the composition. More usually they will form up to about 80% of the composition.
- a cream or ointment is prepared by mixing sufficient quantities of hydrophilic material and water, containing from about 5- 10% by weight of the compound, in sufficient quantities to produce a cream or ointment having the desired consistency.
- compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time.
- the active agent may be delivered from the patch by iontophoresis.
- compositions are preferably applied as a topical ointment or cream.
- the active agent may be employed with either a paraffinic or a water-miscible ointment base.
- the active agent may be formulated in a cream with an oil-in-water cream base or a water-in-oil base.
- fluid unit dosage forms are prepared utilizing the active ingredient and a sterile vehicle, for example but without limitation water, alcohols, polyols, glycerine and vegetable oils, water being preferred.
- the active ingredient depending on the vehicle and concentration used, can be either suspended or dissolved in the vehicle.
- the active ingredient can be dissolved in water for injection and filter sterilised before filling into a suitable vial or ampoule and sealing.
- agents such as local anaesthetics, preservatives and buffering agents can be dissolved in the vehicle.
- the composition can be frozen after filling into the vial and the water removed under vacuum.
- the dry lyophilized powder is then sealed in the vial and an accompanying vial of water for injection may be supplied to reconstitute the liquid prior to use.
- Parenteral suspensions are prepared in substantially the same manner as solutions, except that the active ingredient is suspended in the vehicle instead of being dissolved and sterilization cannot be accomplished by filtration.
- the active ingredient can be sterilised by exposure to ethylene oxide before suspending in the sterile vehicle.
- a surfactant or wetting agent is included in the composition to facilitate uniform distribution of the active ingredient.
- a pharmaceutical composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. 5,399,163; U.S. 5,383,851 ; U.S. 5,312,335; U.S. 5,064,413; U.S. 4,941 ,880; U.S. 4,790,824; or U.S. 4,596,556.
- a needleless hypodermic injection device such as the devices disclosed in U.S. 5,399,163; U.S. 5,383,851 ; U.S. 5,312,335; U.S. 5,064,413; U.S. 4,941 ,880; U.S. 4,790,824; or U.S. 4,596,556.
- Examples of well-known implants and modules useful in the present invention include : US 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; US 4,486,194, which discloses a therapeutic device for administering medicaments through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.
- the dosage to be administered of a compound of the invention will vary according to the particular compound, the disease involved, the subject, and the nature and severity of the disease and the physical condition of the subject, and the selected route of administration.
- the appropriate dosage can be readily determined by a person skilled in the art.
- the compositions may contain from 0.1 % by weight, preferably from 5-60%, more preferably from 10-30% by weight, of a compound of invention, depending on the method of administration. It will be recognized by one of skill in the art that the optimal quantity and spacing of individual dosages of a compound of the invention will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the age and condition of the particular subject being treated, and that a physician will ultimately determine appropriate dosages to be used. This dosage may be repeated as often as appropriate. If side effects develop the amount and/or frequency of the dosage can be altered or reduced, in accordance with normal clinical practice.
- Macbecin can be considered to be biosynthesised in two stages. In the first stage the core-
- PKS genes assemble the macrolide core by the repeated assembly of simple carboxylic acid precursors to give a polyketide chain which is then cyclised to form the first enzyme-free intermediate "pre-macbecin", see Figure 1.
- a series of "post-PKS" tailoring enzymes e.g. P450 monooxygenases, methyltransferases, FAD-dependent oxygenases and a carbamoyltra ⁇ sferase
- the 18,21-didesoxymacbecin analogues may be biosynthesised in a similar manner.
- the present invention provides a method of producing 18,21- didesoxymacbecin analogues said method comprising: a) providing a first host strain that produces macbecin or an analogue when cultured under appropriate conditions b) feeding a non-natural starter acid to said strain c) culturing said strain under suitable conditions for the production of 18,21- didesoxymacbecin analogues; and d) optionally isolating the compounds produced.
- the method may additionally comprise the step of: e) deleting or inactivating one or more of the starter unit biosynthesis genes, or a homologue thereof, said step usually occurring prior to step c) and/or the method may additionally comprise the step of: f) deleting or inactivating one or more post-PKS genes, said step usually occurring prior to step c).
- a host strain that produces macbecin or an analogue thereof is meant a strain that produces macbecin or those analogues of macbecin particularly 18,21- didesoxymacbecin analogues that are embraced by the definitions of Ri-R 8 when cultured under appropriate conditions.
- Appropriate conditions (and suitable conditions in step (c)) include the provision of a suitable starter feed and growth media of suitable composition (which will be known to a skilled person or may be determined by methods known per se).
- the non-natural starter feed is a substituted benzoic acid (not being 3-amino-5- hydroxy-benzoic acid which is the natural starter acid).
- the non-natural starter feed is 3-amino- benzoic acid wherein the benzene ring is optionally substituted by one to three fluorine atoms.
- non-natural starter acid feed is 3-aminobenzoic acid.
- non-natural starter acid feed is 5-amino-2- fluorobenzoic acid. In another suitable embodiment the non-natural starter acid feed is 5-amino-3- fluorobenzoic acid.
- non-natural starter acid feed is 5-amino-2,3-di- fluorobenzoic acid.
- non-natural starter acid feed is 5-amino-2,3,6-tri- fluorobenzoic acid.
- non-natural starter units that could be fed to the host strain to produce the same compound(s) for example, but not limited to, the methyl ester, the ethyl ester, the N-acetyl-cysteamine thioester of the substituted benzoic acid and the diketide analogue of the biosynthetic intermediate activated appropriately for incorporation for example as the N-acetyl-cysteamine thioester.
- the host strain is a macbecin producing strain.
- the host strain is an engineered strain based on a macbecin producing strain in which one or more of the starter unit biosynthetic genes have been deleted or inactivated.
- the host strain is an engineered strain based on a macbecin producing strain in which one or more of the post-PKS genes have been deleted or inactivated.
- the host strain may be an engineered strain based on a macbecin producing strain in which mbcM and optionally further post-PKS genes have been deleted or inactivated.
- the host strain may be an engineered strain based on a macbecin producing strain in which mbcM has been deleted or inactivated.
- the host strain may be an engineered strain based on a macbecin producing strain in which mbcM, mbcMTI, mbcMT2, mbcP and mbcP450 have been deleted or inactivated.
- the one or more starter unit biosynthetic genes and/or post-PKS genes will be deleted or inactivated selectively.
- one or more starter unit biosynthetic genes or post-PKS genes are inactivated in said engineered strain by integration of DNA into the gene(s) such that functional protein is not produced.
- one or more of said starter unit biosynthetic genes or post-PKS genes are deleted in said engineered strain by making a targeted deletion or deletions.
- one or more starter unit biosynthetic genes or post-PKS genes are inactivated in said engineered strain by site-directed mutagenesis.
- a macbecin producing host strain is subjected to mutagenesis, chemical or LJV, and a modified strain is selected in which one or more of the starter unit biosynthetic enzymes or post-PKS enzymes are not functional.
- the present invention also encompasses mutations of the regulators controlling the expression of one or more of the starter unit biosynthetic genes or post-PKS genes, a person of skill in the art will appreciate that deletion or inactivation of a regulator may have the same outcome as deletion or inactivation of the gene.
- an engineered strain in which one or more genes has been deleted or inactivated is complemented by one or more of the post PKS genes from a heterologous PKS cluster including, but not limited to the clusters directing the biosynthesis of rifamycin, ansamitocin, geldanamycin or herbimycin.
- a method of selectively deleting or inactivating a post PKS gene comprises: (i) designing degenerate oligos based on homologue(s) of the gene of interest (e.g. from the rifamycin, geldanamycin or herbimycin biosynthetic clusters and/or other available sequences) and isolating the internal fragment of the gene of interest from a suitable macbecin producing strain by using these primers in a PCR reaction, (ii) integrating a plasmid containing this fragment into either the same, or a different macbecin producing strain followed by homologous recombination, which results in the disruption of the targeted gene, (iii) culturing the strain thus produced under conditions suitable for the production of the macbecin analogues, i.e.
- the macbecin-producing strain in step (i) is Actinosynnema mirum (A. mirum).
- the macbecin-producing strain in step (ii) is Actinosynnema pretiosum (A. pretiosum).
- an equivalent strain may be achieved using alternative methods to that described above, e.g.:
- ⁇ Degenerate oligos may be used to amplify the gene of interest from any macbecin producing strain for example, but not limited to A. pretiosum, or A. mirum
- Different degenerate oligos may be designed which will successfully amplify an appropriate region of the post-PKS gene, or a homologue thereof, from a macbecin producer, or strain producing a homologue thereof.
- the sequence of the gene of the A. pretiosum strain may be used to generate the oligos which may be specific to the gene of -A. pretiosum and then the internal fragment may be amplified from any macbecin producing strain e.g A. pretiosum or A. mirum.
- the sequence of the gene of the A. pretiosum strain may be used along with the sequence of homologous genes to generate degenerate oligos to the gene of A. pretiosum and then the internal fragment may be amplified from any macbecin producing strain e.g A. pretiosum or A. mirum.
- Figure 2 shows the activity of the post-PKS genes in the macbecin biosynthetic cluster. A person of skill in the art would thus be able to identify which additional post-PKS genes would need to be deleted or inactivated in order to arrive at a strain that will produce the compound(s) of interest.
- 18,21-Didesoxymacbecin analogues may be screened by a number of methods, as described herein, and in the circumstance where a single compound shows a favourable profile a strain can be engineered to make this compound preferably. In the unusual circumstance when this is not possible, an intermediate can be generated which is then biotransformed to produce the desired compound.
- the present invention provides novel macbecin analogues generated by the selected deletion or inactivation of one or more post-PKS genes from the macbecin PKS gene cluster.
- the present invention relates to novel 18,21-didesoxymacbecin analogues produced by feeding a non-natural starter unit to a macbecin producing strain, optionally combined with the selected deletion or inactivation of one or more post-PKS genes, from the macbecin PKS gene cluster.
- the term "deleted or inactivated" as used herein encompasses any method by which the gene product is rendered non-functional including but not limited to: deletion of the gene in its entirety, deletion of part of the gene, inactivation by insertion into the target gene, site-directed mutagenesis which results in the gene either not being expressed or being expressed to produce inactive protein, mutagenesis of the host strain which results in the gene either not being expressed or being expressed to produce inactive protein (e.g. by radiation or exposure to mutagenic chemicals, protoplast fusion or transposon mutagenesis).
- an active gene product can be impaired chemically with inhibitors, for example metapyrone (alternative name 2-methyl-1 ,2-di(3-pyridyl-1 -propanone), EP 0 627 009) and ancymidol are inhibitors of oxygenases and these compounds can be added to the production medium to generate analogues.
- sinefungin is a methyl transferase inhibitor that can be used similarly but for the inhibition of methyl transferase activity in vivo (McCammon and Parks, 1981 ).
- all of the post-PKS genes may be deleted or inactivated and then one or more of the genes may then be reintroduced by complementation (e.g. at an attachment site, on a self-replicating plasmid or by insertion into a homologous region of the chromosome).
- the present invention relates to methods for the generation of 18,21 -didesoxymacbecin analogues, said method comprising: a) providing a first host strain that produces macbecin when cultured under appropriate conditions b) optionally selectively deleting or inactivating all the post-PKS genes, c) feeding a non-natural starter unit to said strain d) culturing said modified host strain under suitable conditions for the production of 18,21-didesoxymacbecin analogues; and e) optionally isolating the compounds produced.
- one or more of the deleted post-PKS genes are reintroduced.
- 1 or more of the post-PKS genes selected from the group consisting of mbcM, mbcN, mbcP, mbcMTI, mbcMT2 and mbcP450 are reintroduced.
- 2 or more of the post-PKS genes selected from the group consisting of mbcM, mbcN, mbcP, mbcMTI, mbcMT2 and mbcP450 are reintroduced.
- 3 or more of the post-PKS genes selected from the group consisting of mbcM, mbcN, mbcP, mbcMTI, mbcMT2 and mbcP450 are reintroduced.
- 4 or more of the post-PKS genes selected from the group consisting of mbcM, mbcN, mbcP, mbcMTI, mbcMT2 and mbcP450 are reintroduced.
- post-PKS genes selected from the group consisting of mbcM, mbcN, mbcP, mbcMTI, mbcMT2 and mbcP450 are reintroduced.
- genes from other PKS biosynthetic clusters such as but not limited to the geldanamycin or herbimycin pathways can be introduced appropriately.
- the present invention relates to methods for the generation of 18,21 -didesoxymacbecin analogues, said method comprising: a) providing a first host strain that produces macbecin when cultured under appropriate conditions b) selectively deleting or inactivating mbcM, c) feeding a non-natural starter unit to said strain d) culturing said modified host strain under suitable conditions for the production of 18,21-didesoxymacbecin analogues; and e) optionally isolating the compounds produced.
- the present invention relates to methods for the generation of 18,21 -didesoxymacbecin analogues, said method comprising: a) providing a first host strain that produces macbecin when cultured under appropriate conditions b) selectively deleting or inactivating mbcM and mbcP450 c) optionally selectively deleting or inactivating further post-PKS genes d) feeding a non-natural starter unit to said strain e) culturing said modified host strain under suitable conditions for the production of 18,21-didesoxymacbecin analogues; and f) optionally isolating the compounds produced.
- the present invention relates to methods for the generation of 18,21 -didesoxymacbecin analogues, said method comprising: a) providing a first host strain that produces macbecin when cultured under appropriate conditions b) selectively deleting or inactivating mbcM, mbcMTI, mbcMT2, mbcP and mbcP450 c) optionally selectively deleting or inactivating further post-PKS genes or starter unit biosynthesis genes d) feeding a non-natural starter unit to said strain e) culturing said modified host strain under suitable conditions for the production of 18,21-didesoxymacbecin analogues; and f) optionally isolating the compounds produced.
- polyketide gene clusters may be expressed in heterologous hosts (Pfeifer and Khosla, 2001 ). Accordingly, the present invention includes the transfer of the macbecin biosynthetic gene cluster, with or without resistance and regulatory genes, either otherwise complete or containing deletions, into a heterologous host. Alternatively, the complete macbecin biosynthetic cluster can be transferred into a heterologous host, with or without resistance and regulatory genes, and it can then be manipulated by the methods described herein to delete or inactivate one or more of the post-PKS genes or starter unit biosynthesis genes.
- a preferred host cell strain is a prokaryote, more preferably an actinomycete or Escherichia coli, still more preferably include, but are not limited to Actinosynnema mirum (A. mirum), Actinosynnema pretiosum subsp. pretiosum (A. pretiosum), S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var.
- Streptomyces tsukubaensis Streptomyces coelicolor
- Streptomyces lividans Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces rimosus, Streptomyces albus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Streptomyces albus,
- Micromonospora sp. Micromonospora ghseorubida, Amycolatopsis mediterranei or Actinoplanes sp. N902-109. Further examples include Streptomyces hygroscopicus subsp. geldanus and Streptomyces violaceusniger.
- the entire biosynthetic cluster is transferred.
- the entire PKS is transferred without any of the associated starter unit biosynthesis genes and/or post-PKS genes.
- the entire macbecin biosynthetic cluster is transferred and then manipulated according to the description herein.
- the 18,21-didesoxymacbecin analogue(s) of the present invention may be further processed by biotransformation with an appropriate strain.
- the appropriate strain either being an available wild type strain for example, but without limitation Actinosynnema mirum, Actinosynnema pretiosum subsp. pretiosum, S. hygroscopicus, S. hygroscopicus sp..
- an appropriate strain may be engineered to allow biotransformation with particular post-PKS enzymes for example, but without limitation, those encoded by mbcM, mbcN, mbcP, mbcMT2, mbcP450 (as defined herein), gdmN, gdmM, gdmL, gdmP, (Rascher et at., 2003) the geldanamycin O-methyl transferase, hbmN, hbmL, hbmP, (Rascher et al., 2005) herbimycin O-methyl transferases and further herbimycin mono- oxygenases, asm7, asm10, asm11, asm12, asm19 and asm21 (Cassady et al., 2004, Spiteller et al., 2003).
- post-PKS enzymes for example, but without limitation, those encoded by mbcM, mbcN, mbcP,
- sequences are not in the public domain it is routine to those skilled in the art to acquire such sequences by standard methods.
- sequence of the gene encoding the geldanamycin O-methyl transferase is not in the public domain, but one skilled in the art could generate a probe, either a heterologous probe using a similar O-methyl transferase, or a homologous probe by designing degenerate primers from available homologous genes to carry out Southern blots on a geldanamycin producing strain and thus acquire this gene to generate biotransformation systems.
- the strain may have had one or more of its native polyketide clusters deleted, either entirely or in part, or otherwise inactivated, so as to prevent the production of the polyketide produced by said native polyketide cluster.
- Said engineered strain may be selected from the group including, for example but without limitation, Actinosynnema mirum, Actinosynnema pretiosum subsp. pretiosum, S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var.
- the process for preparation of the 18,21-didesoxymacbecin analogues of the invention as described above is substantially or entirely biosynthetic, it is not ruled out to produce or interconvert 18,21-didesoxymacbecin analogues of the invention by a process which comprises standard synthetic chemical methods.
- the gene cluster was sequenced from Actinosynnema pretiosum subsp. pretiosum however, a person of skill in the art will appreciate that there are alternative strains which produce macbecin, for example but without limitation Actinosynnema mirum.
- an engineered strain based on a macbecin producing strain in which mbcM and optionally further post-PKS genes have been deleted or inactivated particularly such an engineered strain in which mbcM has been deleted or inactivated or such an engineered strain in which mbcM, mbcMTI, mbcMT2, mbcP and mbcP450 have been deleted or inactivated.
- the macbecin producing strain is A pretiosum or A mirum.
- An engineered strain based on a macbecin producing strain in which mbcM and optionally further post-PKS genes and/or starter unit biosynthesis genes have been deleted or inactivated particularly such an engineered strain in which mbcM has been deleted or inactivated or such an engineered strain in which mbcM, mbcMTI, mbcMT2, mbcP and mbcP450 have been deleted or inactivated.
- the macbecin producing strain is A pretiosum or A mirum.
- Compounds of the invention are advantageous in that they may be expected to have one or more of the following properties: tight binding to Hsp90, fast on-rate of binding to Hsp90, good activity against one or more different cancer sub-types compared with the parent compound; good toxicological profile such as good hepatotoxicity profile, good nephrotoxicity, good cardiac safety; good water solubility; good metabolic stability; good formulation ability; good bioavailability; good pharmacokinetic or pharmacodynamic properties such as tight binding to Hsp90, fast on-rate of binding to Hsp90 and/or good brain pharmacokinetics; good cell uptake; and low binding to erythrocytes.
- the fermentation medium (Medium 2, see below and US 4,315,989 and US 4,187,292) was inoculated with 2.5% - 10% of the seed culture and incubated with shaking between 200 and 300 rpm with a 5 or 2.5 cm throw at 26 0 C for six days except where otherwise indicated in the examples. The culture was then harvested for extraction.
- Apramycin was added when appropriate after autoclaving to give a final concentration of 50 mg/L.
- Mobile phase A water + 0.1 % formic acid
- mobile phase B acetonitrile + 0.1 % formic acid.
- UV spectra were recorded between 190 and 400 nm, with extracted chromatograms taken at 210, 254 and 276 nm. Mass spectra were recorded between 100 and 1500 amu.
- NMR spectra were recorded on a Bruker Advance 500 spectrometer at 298 K operating at 500 MHz and 125 MHz for 1 H and 13 C respectively. Standard Bruker pulse sequences were used to acquire 1 H- 1 H COSY, APT, HMBC and HMQC spectra. NMR spectra were referenced to the residual proton or standard carbon resonances of the solvents in which they were run.
- LCMS method 2 chromatography was achieved over a Phenomenex HyperClone Ci 8 -BDS column (4.6 x 150 mm, 3 micron particle size) eluting with a gradient of water + 0.1 % formic acid:acetonitrile + 0.1 % formic acid, (90:10) to (0:100), at 1 mL/min over 20 min. Purity was assessed by MS and at multiple wavelengths (210, 254 & 276 nm). All compounds were >95% pure at all wavelengths. Purity was finally confirmed by inspection of the 1 H and 13 C NMR spectra.
- Water solubility may be tested as follows: A 10 mM stock solution of the 18,21 - didesoxymacbecin analogue is prepared in 100% DMSO at room temperature. Triplicate 0.01 mL aliquots are made up to 0.5 mL with either 0.1 M PBS, pH 7.3 solution or 100% DMSO in amber vials. The resulting 0.2 mM solutions are shaken in the dark, at room temperature on an IKA® vibrax VXR shaker for 6 h, followed by transfer of the resulting solutions or suspensions into 2 imL Eppendorf tubes and centrifugation for 30 min at 13200 rpm. Aliquots of the supernatant fluid are then analysed by LCMS method 1 as described above.
- Oncotest cell lines were established from human tumor xenografts as described by Roth ef al., (1999). The origin of the donor xenografts was described by Fiebig et al., (1999). Other cell lines were either obtained from the NCI (DU145, MCF-7) or purchased from DSMZ, Braunschweig, Germany.
- a modified propidium iodide assay was used to assess the effects of the test compound(s) on the growth of human tumour cell lines (Dengler et al., (1995)).
- cells were harvested from exponential phase cultures by trypsinization, counted and plated in 96 well flat-bottomed microtitre plates at a cell density dependent on the cell line (5 - 10.000 viable cells/well). After 24 h recovery to allow the cells to resume exponential growth, 0.010 mL of culture medium (6 control wells per plate) or culture medium containing the 18,21 -didesoxymacbecin analogue was added to the wells. Each concentration was plated in triplicate. Compounds were applied in five concentrations (100; 10; 1 ; 0.1 and 0.01 ⁇ g/ml).
- cell culture medium with or without test compound was replaced by 0.2 mL of an aqueous propidium iodide (Pl) solution (7 mg/L).
- Pl propidium iodide
- cells may be permeabilized by freezing the plates. After thawing the plates, fluorescence was measured using the Cytofluor 4000 microplate reader (excitation 530 nm, emission 620 nm), giving a direct relationship to the total number of viable cells. Growth inhibition may be expressed as treated/control x 100 (% T/C). This can be plotted as a graph of %T/C against concentration of test compound applied, which can then be used to calculate the concentration necessary to inhibit cell growth by 70% (IC 70 ).
- IC 70 concentration necessary to inhibit cell growth by 70%
- Genomic DNA was isolated from Actinosynnema pretiosum (ATCC 31280) and Actinosynnema mirum (DSM 43827, ATCC 29888) using standard protocols described in Kieser et al. , (2000). DNA sequencing was carried out by the sequencing facility of the Biochemistry Department, University of Cambridge, Tennis Court Road, Cambridge CB2 1 QW using standard procedures.
- the DIG-labelled gdmN DNA fragment was used as a heterologous probe. Using the gdmN generated probe and genomic DNA isolated from A. pretiosum 21 12 an approximately 8 kb EcoRI fragment was identified in Southern blot analysis. The fragment was cloned into Litmus 28 applying standard procedures and transformants were identified by colony hybridization. The clone p3 was isolated and the approximately 7.7 kb insert was sequenced. DNA isolated from clone p3 was digested with EcoRI and EcoRI/Sacl and the bands at around 7.7 kb and at about 1.2 kb were isolated, respectively. Labelling reactions were carried out according to the manufacturers' protocols.
- Cosmid libraries of the two strains named above were created using the vector SuperCos 1 and the Gigapack III XL packaging kit (Stratagene) according to the manufacturers' instructions. These two libraries were screened using standard protocols and as a probe, the DIG-labelled fragments of the 7.7 kb EcoRI fragment derived from clone p3 were used. Cosmid 52 was identified from the cosmid library of A. pretiosum and submitted for sequencing to the sequencing facility of the Biochemistry Department of the University of Cambridge. Similarly, cosmid 43 and cosmid 46 were identified from the cosmid library of A. mirum. All three cosmids contain the 7.7 kb EcoRI fragment as shown by Southern Blot analysis. An around 0.7 kbp fragment of the PKS region of cosmid 43 was amplified using primers
- BIOSG124 ⁇ '-CCCGCCCGCGCGCGAGCGGCGCGTGGCCGCCCGAGGGC-S' SEQ ID NO: 3
- BIOSG125 5'- GCGTCCTCGCGCAGCCACGCCACCAGCAGCTCCAGC-3' SEQ ID NO: 4
- sequence information of cosmid 52 was also used to create probes derived from DNA fragments amplified by primers BIOSG130 5'- CCAACCCCGCCGCGTCCCCGGCCGCGCCGAACACG-3' (SEQ ID NO: 5) and BIOSG131 5'- GTCGTCGGCTACGGGCCGGTGGGGCAGCTGCTGT-5' (SEQ ID NO: 6) as well as
- Example 2 Generation of strain BIOT-3806: an Actinosynnema pretiosum strain in which the gdmM homologue mcbM has been interrupted by insertion of a plasmid.
- plasmid pLSS308 The DNA sequences of the gdmM gene from the geldanamycin biosynthetic gene cluster of Streptomyces hygroscopicus strain NRRL 3602 (AY179507) and orf19 from the rifamycin biosynthetic gene cluster of Amycolatopsis mediterranei (AF040570 AF040571 ) were aligned using VectorNTI sequence alignment program. This alignment identified regions of homology that were suitable for the design of degenerate oligos that were used to amplify a fragment of the homologous gene from Actinosynnema mirum (BIOT-3134; DSM43827; ATCC29888). The degenerate oligos are:
- FPLS1 5': ccscgggcgnycngsttcgacngygag 3'; (SEQ ID NO: 12)
- the template for PCR amplification was Actinosynnema mirum cosmid 43.
- the generation of cosmid 43 is described in Example 1 above.
- Oligos FPLS 1 and FPLS3 were used to amplify the internal fragment of a gdmM homologue from Actinosynnema mirum in a standard PCR reaction using cosmid 43 as the template and Taq DNA polymerase.
- the resultant 793 bp PCR product was cloned into pUC19 that had been linearised with Sma ⁇ , resulting in plasmid pLSS301. It was postulated that the amplified sequence is from the mcbM gene of the macbecin cluster of A. mirum.
- Plasmid pLSS301 was digested with EcoRI/H/ndlll and the fragment cloned into plasmid pKC1 132 (Bierman et al., 1992) that had been digested with EcoR ⁇ IHind ⁇ .
- the resultant plasmid, designated pLSS308, is apramycin resistant and contains an internal fragment of the A. mirum mbcM gene.
- pretiosum 2.2 Transformation of Actinosvnnema pretiosum subsp. pretiosum
- Escherichia coli ET12567 harbouring the plasmid pUZ8002 was transformed with pLSS308 by electroporation to generate the E. coli donor strain for conjugation.
- This strain was used to transform Actinosynnema pretiosum subsp. pretiosum by vegetative conjugation (Matsushima et al., 1994).
- Exconjugants were plated on Medium 4 and incubated at 28 0 C. Plates were overlayed after 24 h with 50 mg/L apramycin and 25 mg/L nalidixic acid. As pLSS308 is unable to replicate in Actinosynnema pretiosum subsp.
- any apramycin resistant colonies were anticipated to be transformants that contained plasmid integrated into the mbcM gene of the chromosome by homologous recombination via the plasmid borne mcbM internal fragment ( Figure 3). This results in two truncated copies of the mbcM gene on the chromosome. Transformants were confirmed by PCR analysis and the amplified fragment was sequenced. Colonies were patched onto Medium 4 (with 50 mg/L apramycin and 25 mg/L nalidixic acid).
- a 6 mm circular plug from each patch was used to inoculate individual 50 mL falcon tubes containing 10 mL seed medium (variant of Medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate) plus 50 mg/L apramycin. These seed cultures were incubated for 2 days at 28 0 C, 200 rpm with a 5 cm throw. These were then used to inoculate (5% v/v) fermentation medium (Medium 2) and were grown at 28 0 C for 24 hours and then at 26 0 C for a further 5 days. Metabolites were extracted from these according to the standard protocol described above. Samples were assessed for production of macbecin analogues by HPLC using the standard protocol described above.
- the productive isolate selected was designated BIOT-3806.
- BIOT-3870 an Actinosynnema pretiosum strain in which the gdmM homologue mbcM has an in-frame deletion.
- Oligos BV145 SEQ ID NO: 14
- BV146 SEQ ID NO: 15
- a 5' extension was designed in each oligo to introduce restriction sites to aid cloning of the amplified fragment ( Figure 4).
- the amplified PCR product (PCRwv308, SEQ ID NO: 16, Figure 5A) encoded 33 bp of the 3' end of mbcM and a further 1368 bp of downstream homology. This 1421 bp fragment was cloned into pUC19 that had been linearised with Smal, resulting in plasmid pWV308.
- BVl 45 ATATACTAGTCACGTCACCGGCGCGGTGTCCGCGGACTTCGTCAACG
- BVl 46 ATATCCTAGGCTGGTGGCGGACCTGCGCGCGCGGTTGGGGTG
- Oligos BV147 (SEQ ID NO: 17) and BV148 (SEQ ID NO: 18) were used to amplify a 1423 bp region of DNA from Actinosynnema pretiosum (ATCC 31280) in a standard PCR reaction using cosmid 52 (from example 1 ) as the template and Pfu DNA polymerase.
- a 5' extension was designed in each oligo to introduce restriction sites to aid cloning of the amplified fragment ( Figure 4).
- the amplified PCR product (PCRwv309, SEQ ID NO: 19, Figure 5B) encoded 30 bp of the 5' end of mbcM and a further 1373 bp of upstream homology. This 1423 bp fragment was cloned into pUC19 that had been linearised with Sma ⁇ , resulting in plasmid pWV309.
- Xbal (SEQ ID NO: 18) The products PCRwv308 and PCRwv309 were cloned into pUC19 in the same orientation to utilise the Pst ⁇ site in the pUC19 polylinker for the next cloning step.
- the 1443 bp Av ⁇ /Pst ⁇ fragment from pWV309 was cloned into the 4073 bp Av ⁇ IPst ⁇ fragment of pWV308 to make pWV310.
- pWV310 therefore contained a Spe ⁇ IXba ⁇ fragment encoding DNA homologous to the flanking regions of mbcM fused at an A v ⁇ site.
- This 2816 bp Spe ⁇ IXba ⁇ fragment was cloned into pKC1 132 (Bierman et al., 1992) that had been linearised with Spe ⁇ to create pVW320.
- pretiosum 3.3 Transformation of Actinosvnnema pretiosum subsp. pretiosum
- Escherichia coli ET12567 harbouring the plasmid pUZ8002 was transformed with pWV320 by electroporation to generate the E. coli donor strain for conjugation.
- This strain was used to transform Actinosynnema pretiosum subsp. pretiosum by vegetative conjugation (Matsushima et al, 1994).
- Exconjugants were plated on Medium 4 and incubated at 28 0 C. Plates were overlayed after 24 h with 50 mg/L apramycin and 25 mg/L nalidixic acid. As pWV320 is unable to replicate in Actinosynnema pretiosum subsp.
- pretiosum apramycin resistant colonies were anticipated to be transformants that contained plasmid pWV320 integrated into the chromosome by homologous recombination via one of the plasmid borne mbcM flanking regions of homology.
- One strain resulting from homologous integration in the upstream region (designated BIOT-3831 ) was chosen for screening for secondary crosses.
- One strain resulting from homologous integration in the downstream region (BIOT-3832) was also chosen for screening for secondary crosses.
- the mutant strain encodes an mbcM protein with an in-frame deletion of 502 amino acids ( Figure 6A, SEQ ID NOs: 20 and 21 ; Figure 6B shows the encoded protein sequence, SEQ ID NO: 22). mbcM deletion mutants were patched onto Medium 4 and grown at 28 0 C for four days.
- a 6 mm circular plug from each patch was used to inoculate individual 50 ml_ falcon tubes containing 10 ml_ seed medium (adapted from medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate). These seed cultures were incubated for 2 days at 28 0 C, 200 rpm with a 2 inch throw.
- Extracts of the fermentation described in Example 3.4 were generated and assayed by LCMS as described in General Methods using LCMS method 1. No macbecin was observed and two new major components were observed. The compounds displayed the physiochemical characteristics shown in Table 5 below:
- Protoplasts were generated from BIOT-3872 using a method adapted from Weber and Losick 1988 with the following media alterations; Actinosynnema pretiosum cultures were grown on ISP2 plates (medium 3) for 3 days at 28 0 C and a 5 mm 2 scraping used to inoculate 40 ml of ISP2 broth supplemented with 2 ml of sterile 10% (w/v) glycine in water.
- Protplasts were generated as described in Weber and Losick 1988 and then regenerated on R2 plates (R2 recipe - Sucrose 103 g, K 2 SO 4 0.25 g, MgCI 2 .6H 2 O 10.12 g, Glucose 10 g, Difco Casaminoacids 0.1 g, Difco Bacto agar 22 g, distilled water to 800 ml_, the mixture was sterilised by autoclaving at 121 0 C for 20 minutes.
- BIOT- 3870 also named WV4a-33 was observed to produce 14 and 15 at significantly higher levels than the parent strain and was selected for use in future experiments.
- Example 4 Feeding to WV4a-33 to generate 4,5-dihydro-11 -O-desmethyl-15- desmethoxy-18,21 -didesoxymacbecin
- a 6 mm circular plug was used to inoculate individual 50 imL falcon tubes containing 10 mL seed medium (adapted from medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate). These seed cultures were incubated for 65 hours at 28 0 C, 200 rpm with a 2 inch throw.
- seed medium adapted from medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate.
- modified production medium adapted from medium 2 - 5% glycerol, 1 % corn steep solids, 2% yeast extract, 2% potassium dihydrogen phosphate, 0.5% magnesium chloride, 0.1 % calcium carbonate media is left to sediment for 2- 60 days and the top layer is taken as the production medium
- 0.1 mL of a 200 mM feed stock solution (3-aminobenzoic acid dissolved in methanol) was added to each falcon tube to give a final feed concentration of 2 mM. Tubes were incubated for a further 6 days at 26 0 C.
- seed cultures were used to inoculate medium 2. Analysis of these cultures (see below) showed that identical compounds were produced in both types of production media but higher titres were observed when using the modified media.
- Extracts of the fermentation described in example 2.7 were generated and assayed by LCMS as described in General Methods.
- the compounds 14 and 15 were produced as expected.
- a new compound 16 was clearly observed which could not be seen in extracts of any fermentations that were not fed 3-aminobenzoic acid. 16 eluted later than either 14 or 15 and had the physiochemical characteristics described in Table 6 below.
- WV4a-33 was patched onto MAM plates (medium 4) and grown at 28 0 C for three days.
- Two 6 mm circular plugs were used to inoculate 250 ml conical shake flasks containing 30 mL seed medium (adapted from medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate).
- Six flasks were inoculated. These seed cultures were incubated for 65 hours at 28 0 C, 200 rpm with a 1 inch throw.
- the cultures were pooled (approximately 1 .4 I ) and the falcon tubes were washed (each with 7 ml of water).
- the washing liquid was pooled (approximately 1.4 I).
- the pooled cultures and washing liquids were used for isolation of 4,5-dihydro-11 -O-desmethyl-15-desmethoxy-18,21- didesoxymacbecin (approximately 3 L in total).
- the seed cultures were used to inoculate 30 ml of modified production medium (3 ml) followed by the same incubation and feeding regime as described above (final feed concentration of 2 mM).
- the flasks were incubated in a 2 inch throw shaker. Production levels were estimated by LCMS as being approximately between 50% and 90% of those measured for the falcon tube production cultures.
- BIOT-3870 was patched onto MAM plates (medium 4) and grown at 28 0 C for three days.
- a 6 mm circular plug was used to inoculate individual 50 ml_ falcon tubes containing 10 ml. seed medium (adapted from medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate). These seed cultures were incubated for 65 hours at 28 0 C, 200 rpm with a 2 inch throw.
- the fermentation broth ( ⁇ 3 L) was extracted two times with an equal volume of ethyl acetate (EtOAc). The organic extracts were combined and the solvent removed in vacuo at
- BIOT-3870 was patched onto MAM plates (medium 4) and grown at 28 0 C for three days.
- a 6 mm circular plug was used to inoculate individual 50 mL falcon tubes containing 10 mL seed medium (adapted from medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate). These seed cultures were incubated for 65 hours at 28 0 C, 200 rpm with a 2 inch throw.
- BIOT-3870 was patched onto MAM plates (medium 4) and grown at 28 0 C for three days.
- Two 6 mm circular plugs were used to inoculate 250 ml conical shake flasks containing 30 mL seed medium (adapted from medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate).
- Six flasks were inoculated. These seed cultures were incubated for 65 hours at 28°C, 200 rpm with a 1 inch throw.
- the cultures were pooled (approximately 1.4 L) and the falcon tubes were washed (each with 7 mL of water).
- the washing liquid was pooled (approximately 1.4 L).
- the pooled cultures and washing liquids were used for isolation of 4,5-dihydro-1 1-O-desmethyl-15- desmethoxy-18-fluoro-18,21 -didesoxymacbecin see below. 7.4 Isolation and characterisation 4,5-dihvdro-11 -O-desmethyl-15-desmethoxy -18-fluoro- 18,21 -didesoxymacbecin, 18
- the fermentation broth ( ⁇ 3 L) was extracted two times with an equal volume of EtOAc. The organic extracts were combined and the solvent removed in vacuo at 40°C to yield 3.4 g of an oily residue. This residue was then chromatographed over Silica gel 60 (30 x 2.5 cm column) with a stepped gradient from 100% CHCI 3 to CHCI 3 :MeOH (96:4) and collecting fractions of approx. 250 ml_. The fractions were monitored by analytical HPLC. Fractions containing 18 were combined and solvent removed in vacuo at 40°C to yield 528 mg of semi-pure 18.
- This semi-pure material was further purified by reversed-phase HPLC over a Phenomenex-Luna Ci 8 - BDS column (21.2 x 250 mm, 5 micron particle size) eluting with a gradient of wate ⁇ acetonitrile, (77:23) to (20:80), over 25 min at a flow rate of 21 mL/min. 18 eluted at 20 min and the relevant fractions were combined, the solvent removed at reduced pressure to yield 18 as a white powder (224 mg). NMR data acquired in d 6 -acetone were entirely consistent with the reported structure.
- Example 8 Generation of 4,5-dihydro-11 -O-desmethyl-15-desmethoxy-18,21 -didesoxy- 17,18,21 -trifluoromacbecin by feeding 5-amino-2,3,6-tri-fluorobenzoic acid to BIOT-3870
- BIOT-3870 was patched onto MAM plates (medium 4) and grown at 28 0 C for three days.
- a 6 mm circular plug was used to inoculate individual 50 mL falcon tubes containing 10 ml. seed medium (adapted from medium 1 - 2% glucose, 3% soluble starch, 0.5% corn steep solids, 1 % soybean flour, 0.5% peptone, 0.3% sodium chloride, 0.5% calcium carbonate). These seed cultures were incubated for 65 hours at 28 0 C, 200 rpm with a 2 inch throw.
- Oligos Is4del1 SEQ ID NO: 23
- Is4del2a SEQ ID NO: 24
- a 5' extension was designed in oligo Is4del2a to introduce an Avr ⁇ site to aid cloning of the amplified fragment ( Figure 7).
- the amplified PCR product (1 +2a, Figure 8 SEQ ID NO: 25) encoded 196 bp of the 3' end of mbcMT2 and a further 1393 bp of downstream homology. This 1595 bp fragment was cloned into pUC19 that had been linearised with Sma ⁇ , resulting in plasmid pLSS1 +2a.
- Is4del1 (SEQ ID NO: 23) 5' - GGTCACTGGCCGAAGCGCACGGTGTCATGG - 3'
- Is4del2a (SEQ ID NO: 24) 5' - CCTAGGCGACTACCCCGCACTACTACACCGAGCAGG - 3'
- the products 1 +2a and 3b+4 were cloned into pUC19 to utilise the H/ndlll and BamYW sites in the pUC19 polylinker for the next cloning step.
- the 1621 bp Av ⁇ IHin ⁇ fragment from pLSS1 +2a and the 1543 bp Av ⁇ IBamH ⁇ fragment from pLSS3b+4 were cloned into the 3556 bp /-//ndlll/SamHI fragment of pKC1132 to make pLSS315.
- pLSS315 therefore contained a /-//ndlll/SamHI fragment encoding DNA homologous to the flanking regions of the desired four ORF deletion region fused at an Av ⁇ site ( Figure 7).
- BIOT-3870 with pLSS315 Escherichia coli ET12567, harbouring the plasmid pUZ8002 was transformed with pLSS315 by electroporation to generate the E. coli donor strain for conjugation.
- This strain was used to transform BIOT-3870 by vegetative conjugation (Matsushima et al, 1994).
- Exconjugants were plated on MAM medium (1 % wheat starch, 0.25% corn steep solids, 0.3% yeast extract, 0.3% calcium carbonate, 0.03% iron sulphate, 2% agar) and incubated at 28°C. Plates were overlayed after 24 h with 50 mg/L apramycin and 25 mg/L nalidixic acid.
- BIOT-3870:pLSS315 Three primary transformants of BIOT-3870:pLSS315 were selected for subculturing to screen for secondary crosses.
- ISP2 inoculate 30 ml. of ISP2 (0.4% yeast extract, 1 % malt extract, 0.4% dextrose, not supplemented with antibiotic) in a 250 ml conical flask. Cultures were grown for 2-3 days then subcultured (5% inoculum) into 30 ml_ of ISP2 in a 250 ml conical flask.
- Example 3.6 After 4-5 rounds of subculturing the cultures were protoplasted as described in Example 3.6, the protoplasts were serially diluted, plated on regeneration media (see Example 3.6) and incubated at 28 0 C for four days. Single colonies were then patched in duplicate onto MAM media containing apramycin and onto MAM media containing no antibiotic and the plates were incubated at 28 0 C for four days. Seven patches derived from clone no 1 (no 32 -37) and four patches derived from clone no3 (no 38 -41 ) that grew on the no antibiotic plate but did not grow on the apramycin plate were re-patched onto +/- apramycin plates to confirm that they had lost the antibiotic marker. Production of macbecin analogues was carried out as described in the General
- Yeast Hsp90 was dialysed against 20 mM Tris pH 7.5 containing 1 mM EDTA and 5 mM NaCI and then diluted to 0.008 mM in the same buffer, but containing 2% DMSO.
- the test compounds were dissolved in 100% DMSO at a concentration of 50 mM and subsequently diluted to 0.1 mM in the same buffer as for Hsp90 with 2% DMSO.
- Heats of interaction were measured at 3O 0 C on a MSC system (Microcal), with a cell volume of 1.458 imL 10 aliquots of 0.027 ml_ of 0.100 mM of each test compound were injected into 0.008 mM yeast Hsp90.
- Heats of dilution were determined in a separate experiment by injecting the test compound into buffer containing 2% DMSO, and the corrected data fitted using a nonlinear least square curve-fitting algorithm (Microcal Origin) with three floating variables: stoichiometry, binding constant and change in enthalpy of interaction. The results are shown below in Table 10.
- Example 11 Biological data - In vitro evaluation of anticancer activity of 18,21 - didesoxymacbecin analogues
- test compounds for anticancer activity in a panel of human tumour cell lines in a monolayer proliferation assay was carried out as described in the general methods using a modified propidium iodide assay.
- Hsp90 binds and regulates the ligand-inducible ⁇ subunit of eukaryotic translation initiation factor kinase Gcn2. MoI Cell Biol 19:8422-8432.
- yeast Hsp1 10 family member, Sse1 is an yeast Hsp1 10 family member
- Escherichia coli to Saccharopolyspora spinosa effects of chromosomal insertions on macrolide
- Herbimycin A Chemical modification of Herbimycin A: synthesis and in vivo antitumor activities of halogenated and other related derivatives of herbimycin A. The Journal of Antibiotics, 39(3), pp415-423.
- HSP90 interacts with RAR1 and
- SGT1 SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc. Natl. Acad. Sci. USA 20:1 1777-1 1782.
- 17-Demethoxy analogue antagonize the action of cisplatin in human colon adenocarcinoma cells: differential caspase activation as a basis of interaction. Cancer Research 63: 3241-3246.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Neurosurgery (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Immunology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Other In-Based Heterocyclic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (16)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002651558A CA2651558A1 (en) | 2006-05-09 | 2007-05-09 | Novel compounds |
EP07728928A EP1928837A2 (en) | 2006-05-09 | 2007-05-09 | 18,21-didesoxymacbecin derivatives for the treatment of cancer |
AU2007247121A AU2007247121A1 (en) | 2006-05-09 | 2007-05-09 | 18,21-didesoxymacbecin derivatives for the treatment of cancer |
JP2009508383A JP2009536181A (en) | 2006-05-09 | 2007-05-09 | 18,21-didesoxymacbecin derivatives for cancer treatment |
US12/296,542 US20090253667A1 (en) | 2006-05-09 | 2007-05-09 | 18 ,21-Didesoxymacbecin Derivatives for the Treatment of Cancer |
MX2008014278A MX2008014278A (en) | 2006-05-09 | 2007-05-09 | 18,21-didesoxymacbecin derivatives for the treatment of cancer. |
BRPI0711093-6A BRPI0711093A2 (en) | 2006-05-09 | 2007-05-09 | compound, pharmaceutical composition, use of a compound, methods for treating a disease, and for producing a compound, engineered strain, and use of an engineered strain |
CA002669054A CA2669054A1 (en) | 2006-11-09 | 2007-11-09 | 18, 21-didesoxymacbecin derivatives for the treatment of cancer |
JP2009535816A JP2010509307A (en) | 2006-11-09 | 2007-11-09 | 18,21-didesoxymacbecin derivatives for the treatment of cancer |
AU2007319015A AU2007319015A1 (en) | 2006-11-09 | 2007-11-09 | 18, 21-didesoxymacbecin derivatives for the treatment of cancer |
EP07824892A EP2079700A1 (en) | 2006-11-09 | 2007-11-09 | 18, 21-didesoxymacbecin derivatives for the treatment of cancer |
PCT/GB2007/050680 WO2008056189A1 (en) | 2006-11-09 | 2007-11-09 | 18, 21-didesoxymacbecin derivatives for the treatment of cancer |
KR1020097009594A KR20090078822A (en) | 2006-11-09 | 2007-11-09 | 18,21-didesoxymacbecin derivatives for the treatment of cancer |
MX2009004777A MX2009004777A (en) | 2006-11-09 | 2007-11-09 | 18, 21-didesoxymacbecin derivatives for the treatment of cancer. |
US12/513,983 US20110160175A1 (en) | 2006-09-11 | 2007-11-09 | 18,21-Didesoxymacbecin Derivatives for the Treatment of Cancer |
BRPI0718562-6A2A BRPI0718562A2 (en) | 2006-11-09 | 2007-11-09 | COMPOUND, PROCESS FOR PREPARING AND GENERATING MACBECINE ANALOG, MACBECINE ANALOG, PHARMACEUTICAL COMPOSITION, USE OF MACBECINE ANALOG, AND, ENGINEERED CEPA. |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB0609132.6 | 2006-05-09 | ||
GBGB0609132.6A GB0609132D0 (en) | 2006-05-09 | 2006-05-09 | Novel compounds and methods for their production |
GB0616637A GB0616637D0 (en) | 2006-08-22 | 2006-08-22 | Novel compounds and methods for their production |
GB0616637.5 | 2006-08-22 | ||
GB0622341.6 | 2006-11-09 | ||
GBGB0622341.6A GB0622341D0 (en) | 2006-11-09 | 2006-11-09 | Novel compounds and methods for their preparation |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2007128829A2 true WO2007128829A2 (en) | 2007-11-15 |
WO2007128829A3 WO2007128829A3 (en) | 2008-01-03 |
Family
ID=38476939
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2007/054476 WO2007128829A2 (en) | 2006-05-09 | 2007-05-09 | 18,21-didesoxymacbecin derivatives for the treatment of cancer |
Country Status (9)
Country | Link |
---|---|
US (1) | US20090253667A1 (en) |
EP (1) | EP1928837A2 (en) |
JP (1) | JP2009536181A (en) |
KR (1) | KR20090005376A (en) |
AU (1) | AU2007247121A1 (en) |
BR (1) | BRPI0711093A2 (en) |
CA (1) | CA2651558A1 (en) |
MX (1) | MX2008014278A (en) |
WO (1) | WO2007128829A2 (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008056189A1 (en) * | 2006-11-09 | 2008-05-15 | Biotica Technology Limited | 18, 21-didesoxymacbecin derivatives for the treatment of cancer |
WO2008104812A2 (en) * | 2007-03-01 | 2008-09-04 | Biotica Technology Limited | C21-de0xy ansamycin derivatives as antitumor agents |
CN101869138A (en) * | 2010-05-28 | 2010-10-27 | 江苏省农业科学院 | High-efficiency protection liquid for storage of microcapsule leaven |
US7855192B2 (en) | 2007-01-26 | 2010-12-21 | Kosan Biosciences, Inc. | Macrolactams by engineered biosynthesis |
WO2011004132A1 (en) | 2009-07-10 | 2011-01-13 | Sanofi-Aventis | Novel hsp90-inhibiting indole derivatives, compositions containing said derivatives, and use thereof |
WO2011027081A2 (en) | 2009-09-03 | 2011-03-10 | Sanofi-Aventis | Novel derivatives of 5,6,7,8-tetrahydroindolizine inhibiting hsp90, compositions containing same, and use thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007074347A1 (en) * | 2005-12-24 | 2007-07-05 | Biotica Technology Ltd. | 21-deoxymacbecin analogues useful as antitumor agents |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005009345A2 (en) * | 2003-06-13 | 2005-02-03 | Kosan Biosciences, Inc. | 2-desmethyl ansamycin compounds |
-
2007
- 2007-05-09 EP EP07728928A patent/EP1928837A2/en not_active Withdrawn
- 2007-05-09 WO PCT/EP2007/054476 patent/WO2007128829A2/en active Application Filing
- 2007-05-09 CA CA002651558A patent/CA2651558A1/en not_active Abandoned
- 2007-05-09 JP JP2009508383A patent/JP2009536181A/en not_active Abandoned
- 2007-05-09 MX MX2008014278A patent/MX2008014278A/en not_active Application Discontinuation
- 2007-05-09 AU AU2007247121A patent/AU2007247121A1/en not_active Abandoned
- 2007-05-09 US US12/296,542 patent/US20090253667A1/en not_active Abandoned
- 2007-05-09 KR KR1020087027545A patent/KR20090005376A/en not_active Application Discontinuation
- 2007-05-09 BR BRPI0711093-6A patent/BRPI0711093A2/en not_active IP Right Cessation
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007074347A1 (en) * | 2005-12-24 | 2007-07-05 | Biotica Technology Ltd. | 21-deoxymacbecin analogues useful as antitumor agents |
Non-Patent Citations (1)
Title |
---|
SHEN Y ET AL: "Geldanamycin derivative inhibition of HGF/SF-mediated Met tyrosine kinase receptor-dependent urokinase-plasminogen activation" BIOORGANIC & MEDICINAL CHEMISTRY, ELSEVIER SCIENCE LTD, GB, vol. 13, no. 16, 15 August 2005 (2005-08-15), pages 4960-4971, XP004971300 ISSN: 0968-0896 * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008056189A1 (en) * | 2006-11-09 | 2008-05-15 | Biotica Technology Limited | 18, 21-didesoxymacbecin derivatives for the treatment of cancer |
US7855192B2 (en) | 2007-01-26 | 2010-12-21 | Kosan Biosciences, Inc. | Macrolactams by engineered biosynthesis |
WO2008104812A2 (en) * | 2007-03-01 | 2008-09-04 | Biotica Technology Limited | C21-de0xy ansamycin derivatives as antitumor agents |
WO2008104812A3 (en) * | 2007-03-01 | 2008-10-30 | Biotica Tech Ltd | C21-de0xy ansamycin derivatives as antitumor agents |
WO2011004132A1 (en) | 2009-07-10 | 2011-01-13 | Sanofi-Aventis | Novel hsp90-inhibiting indole derivatives, compositions containing said derivatives, and use thereof |
WO2011027081A2 (en) | 2009-09-03 | 2011-03-10 | Sanofi-Aventis | Novel derivatives of 5,6,7,8-tetrahydroindolizine inhibiting hsp90, compositions containing same, and use thereof |
CN101869138A (en) * | 2010-05-28 | 2010-10-27 | 江苏省农业科学院 | High-efficiency protection liquid for storage of microcapsule leaven |
Also Published As
Publication number | Publication date |
---|---|
AU2007247121A1 (en) | 2007-11-15 |
US20090253667A1 (en) | 2009-10-08 |
EP1928837A2 (en) | 2008-06-11 |
KR20090005376A (en) | 2009-01-13 |
CA2651558A1 (en) | 2007-11-15 |
BRPI0711093A2 (en) | 2011-08-23 |
MX2008014278A (en) | 2008-11-26 |
JP2009536181A (en) | 2009-10-08 |
WO2007128829A3 (en) | 2008-01-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20090209494A1 (en) | 21-deoxymacbecin analogues useful as antitumor agents | |
US20090253667A1 (en) | 18 ,21-Didesoxymacbecin Derivatives for the Treatment of Cancer | |
US20100068203A1 (en) | 17-Oxymacbecin Derivatives and Their Use in the Treatment of Cancer and/or B-Cell Malignancies | |
US20110160175A1 (en) | 18,21-Didesoxymacbecin Derivatives for the Treatment of Cancer | |
EP1973883B1 (en) | Novel compounds and methods for their production | |
US20090117127A1 (en) | Novel Compounds and Methods for Their Production | |
US20090209507A1 (en) | 15-O-Desmethylmacbecin Derivatives and Their Use in the Treatment of Cancer or B-Cell Malignancies | |
US20110091452A1 (en) | 4,5-Dihydromacbecin Derivatives and Their Use in the Treatment of Cancer or B-Cell Malignancies | |
US20090298804A1 (en) | Novel Compounds and Methods for Their Production | |
US20100210597A1 (en) | C21-Deoxy Ansamycin Derivatives as Antitumor Agents | |
EP2079700A1 (en) | 18, 21-didesoxymacbecin derivatives for the treatment of cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200780016558.7 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07728928 Country of ref document: EP Kind code of ref document: A2 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007728928 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2007728928 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007247121 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 4125/KOLNP/2008 Country of ref document: IN |
|
ENP | Entry into the national phase |
Ref document number: 2007247121 Country of ref document: AU Date of ref document: 20070509 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2651558 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2008/014278 Country of ref document: MX Ref document number: 2009508383 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1020087027545 Country of ref document: KR |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12296542 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: PI0711093 Country of ref document: BR Kind code of ref document: A2 Effective date: 20081029 |