WO2007128136A1 - A novel pilin glycoprotein from a group 4 pseudomonas aeruginosa strain - Google Patents
A novel pilin glycoprotein from a group 4 pseudomonas aeruginosa strain Download PDFInfo
- Publication number
- WO2007128136A1 WO2007128136A1 PCT/CA2007/000849 CA2007000849W WO2007128136A1 WO 2007128136 A1 WO2007128136 A1 WO 2007128136A1 CA 2007000849 W CA2007000849 W CA 2007000849W WO 2007128136 A1 WO2007128136 A1 WO 2007128136A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pilin
- linked
- group
- glycan
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/21—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/18—Testing for antimicrobial activity of a material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/38—Pseudomonas
- C12R2001/385—Pseudomonas aeruginosa
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/21—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Pseudomonadaceae (F)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/91091—Glycosyltransferases (2.4)
Definitions
- the present invention relates to a novel strain of Pseudomonas aeruginosa, glycans and glycopeptides associated with the pilin, enzymes involved in the glycosylation of pilins and agents that affect those enzymes.
- the invention also relates to antigens derived from the novel strain and their use in vaccines.
- Pseudomonas aeruginosa is a ubiquitous opportunistic Gram-negative pathogen that infects immunocompromised individuals and causes fatal pulmonary infections in patients with cystic fibrosis (7-10).
- virulence factors that allow P. aeruginosa to successfully establish infections are its polar type IV pili (T4P).
- T4P of P. aeruginosa are composed of monomeric subunits (pilins) encoded by pilA (18,16, 19, 20).
- a novel Group 4 strain has been identified that includes a pilin glycan that is a homo-oligomer of ⁇ -1,5,-linked D- arabinfuranose (D-Araf). This sugar is uncommon in prokaryotes, occurring mainly in the cell wall arabinogalactan and lipoarabinomannan polymers of mycobacteria.
- D-Arabinofuranose (D-Araf)-containing glycosides are key components of the unusual cell walls of mycobacteria, including the major human pathogens Mycobacterium tuberculosis, M. leprae and M. avium-intracellulare complex (MAC)(I, 2) where they connect waxy mycolic acids to the peptidoglycan skeleton (3).
- Biosynthesis of these polymers is essential for productive infection; for example, the effective anti-mycobacterial drug ethambutol inhibits specific arabinoglycosyltransferases (4).
- infections due to these organisms continue to increase, and resistance to the small pool of effective anti-mycobacterial agents has risen markedly in recent years (5, 6).
- Mycobacterial infections are a particularly serious problem in HIV infected individuals.
- Current vaccines, such as BCG are not highly effective.
- BCG is a live, attenuated vaccine and, as such, cannot be given to immunocompromised hosts, such as individuals infected with HIV.
- immunocompromised hosts such as individuals infected with HIV.
- the present invention provides a novel approach to address the need for new mycobacterial vaccines and therapeutics.
- the T4P pili are composed of monomeric subunits (pilins) encoded by the pilA gene. Glycosylation of the P. aeruginosa pilin is known to modify its physical properties and to affect pathogenicity.
- the pilin glycan from P. aeruginosa Pa5196 is shown to be composed of a repeating ⁇ (1 ⁇ 5) unit of arabinofuranose (Araf)- Further analysis by GC-MS demonstrated that the pilins are modified with D-Araf - containing oligosaccharides.
- D-Araf is a major component of mycobacterial cell walls where its biosynthetic pathway is an important therapeutic target, as demonstrated by the clinical utility of the anti-TB drug ethambutol that inhibits specific arabinosyltransferases of Mycobacterium tuberculosis.
- the present invention provides novel compositions, vaccines, therapeutics and methods for the diagnosis and treatment of mycobacterial infections based on similar biosynthetic pathways in P. aeruginosa and mycobacteria.
- Group 4 Pseudomonas aeruginosa strain characterized in that it is modified with a D- arabinofuranose glycan is provided.
- the glycoprotein is preferably isolated from the Group 4 strain, Pa5196.
- the glycoprotein is modified with a ⁇ -1 ,5-linked D- arabinofuranose glycan.
- t he glycan portion of the pilin glycoprotein is provided.
- the invention also provides fragments of a pilin glycoprotein.
- the glycopeptide may comprise an amino acid sequence selected from the group consisting of SEQ. ID. NO. 3, SEQ. ID NO. 4, SEQ ID. NO. 5 and SEQ. ID NO. 6.
- the invention also provides an immunogenic composition comprising a glycan or glycopeptide from a Group 4 Pseudomonas aeruginosa pilin and an excipient.
- the glycan is ⁇ -1,5-linked D-arabinofuranose.
- the immunogenic composition may further comprise an adjuvant.
- the immunogenic composition can be used to generate an antibody that is reactive to the glycan.
- Immunization of animals with glycosylated P. aeruginosa pilins has already been shown to raise antibodies to both the protein and glycan components. It is possible to culture genetically engineered bacterial host cells containing the genes encoding the structural components of Type IV pili from strain Pa5196 to be used as an antigenic preparation to stimulate protection against mycobacterial infections.
- An antibody that specifically reacts with a glycan from a Group 4 Pseudomonas aeruginosa pilin protein is also provided.
- the antibody is preferably a monoclonal antibody especially one that specifically recognizes ⁇ -1 ,5- linked D-arabinofuranose.
- Pseudomonas aeruginosa infection comprises reacting a test sample with an antibody that specifically recognizes ⁇ -1 ,5-linked D- arabinofuranose, wherein specific binding of the antibody to a component in the sample is indicative of infection.
- a method of diagnosing a mycobacterial infection comprises reacting a test sample with an antibody that specifically recognizes ⁇ -1,5-linked D-arabinofuranose, wherein specific binding of the antibody to a component in the sample is indicative of infection.
- the mycobacterial infection is typically caused by a pathogen selected from the group consisting of M. tuberculosis, M. leprae and M. avium.
- a vaccine for immunizing a human subject against a mycobacterial infection comprises an effective amount of an antigen consisting essentially of a glycan or glycopeptide from a Group 4 Pseudomonas aeruginosa pilin and a pharmaceutically acceptable carrier.
- the antigen is ⁇ -1 ,5-linked D-arabinofuranose.
- the antigen is a pilin protein subunit from strain Pa5196.
- the invention also provides a method for immunizing a human subject for the prevention or treatment of a mycobacterial infection.
- the method comprises administering a vaccine containing ⁇ -1,5-linked D-arabinofuranose or a pilin protein subunit from strain Pa5196.
- the assay comprises obtaining a biological sample and determining the amount of binding of an antibody that specifically binds to ⁇ -1 ,5-linked D-arabinofuranose to the sample.
- the invention also provides a kit for the diagnosis of a Group 4 Pseudomonas aeruginosa infection or a mycobacterial infection.
- the kit comprises an antibody that specifically binds to ⁇ -1,5-linked D-arabinofuranose, a control source of ⁇ -1 ,5-linked D-arabinofuranose and a secondary labelled antibody.
- the enzymes for biosynthesis of the pilin glycan from P. aeruginosa Pa5196 which is composed of repeating ⁇ (1 ⁇ 5) unit of arabinofuranose (Ara/) of the D-enantiomer of Araf are provided.
- These enzymes represent new drug targets for further exploitation as anti-TB drugs. Agents that interfere with the activity of the enzymes are also provided.
- a vaccine comprising an antigenic portion of the native pilin.
- the vaccine of the invention may be useful as a vaccine against Pseudomonas or against mycobacteria, particularly Mycobacterium tuberculosis Mycobacterium leprae or Mycobacterium avium.
- FIGURE 1A is a Western blot of Pa5196 pilins on different backgrounds
- FIGURE 1B illustrates results obtained when pilins are stained with
- FIGURE 2 illustrates the analysis of the intact Pa5196 pilin by ESi-MS;
- FIGURE 3 shows the identification of pilin glycopeptides by MS/MS;
- FIGURE 4 illustrates one feCID- MS/MS analysis of the T 55'79 glycopeptide
- FIGURE 5 shows a 1D 1 H spectrum (A) and a 1 H- 13 C HSQC spectrum
- FIGURE 6 is a series of Western blots showing immunological identity of the Pa5196 pilin glycan with sugars found in the Mycobacterial cell envelope;
- FIGURES 7A-D are models of exopolysaccharide biosynthesis in gram negative bacteria.
- FIGURE 8 is an SDS-PAGE gel demonstrating the TfpW protein is involved in attachment of glycans to Group 4 pilin proteins.
- the invention provides a novel bacterial strain, Pseudomonas aeruginosa strain Pa5196, for elucidation of biosynthesis pathways and analysis of D-Araf - containing oligosaccharides.
- This strain can be used as a model to study cell wall components of mycobacteria species.
- Strain Pa5196 is a rapidly growing Gram negative bacterium of low virulence that is highly amenable to genetic manipulation. Compared to mycobacteria which are slow-growing organisms and technically can be a difficult microorganism to culture and extract cell wall components, this novel strain of P. aeruginosa Pa5196 is fast growing, nonpathogenic and very easy to work with in the laboratory. Thus Pa5196 is an excellent model organism for the study of arabinosyltransferase pathways.
- Panel A shows LPS samples that were stained with silver (left) or detected via Western blot using antibodies against serotype 011 (right).
- Strains IATS 011 and PA103 both serotype 011) are positive controls; PAK (serotype 06) is a negative control.
- the wbpM mutant of Pa5196 lacks high molecular weight O antigen on silver stain and by Western blot.
- pilins from the indicated strains were detected with Coomassie (left) or with a fluorescent glycoprotein stain (right).
- M molecular weight markers, in kDa
- G glycoprotein controls, - non- glycosylated ( ⁇ -casein), + glycosylated (RNase B).
- Lane 1 strain 1244 (group I, glycosylated); lane 2, PAK (group II, non-glycosylated); lane 3, Pa5196 (group IV); lane 4, Pa5196 wbpM mutant). These results indicate that the glycan associated with these pili is not the 011 O unit.
- Figure 2 illustrates the analysis of the intact Pa5196 pilin by ESI-MS.
- the m/z value and charge state has been indicated for the most abundant ion in each of the multiply charged protein peak clusters.
- the reconstructed protein profile is shown in the inset.
- the interval between any 2 populations of proteins is 132 daltons, equivalent to the mass of a single pentose residue.
- Figure 3 shows the identification of pilin glycopeptides by MS/MS.
- Panel A shows a LC-MS/MS spectrum of the triply protonated T 55'79 glycopeptide ion at m/z 1080.8.
- the b and y fragment ions originate from fragmentation of the peptide backbone. Sequential neutral loss of pentose sugars from the doubly charged peptide ion is observed in the upper part of the MS/MS spectrum (indicated with a "P"). Oxonium ions corresponding to one and two pentoses were observed at m/z 133.1 and 265.1, respectively. This ion has 6 pentose residues and is the most abundant form of this glycopeptide.
- the protein fragments identified by nanoLC-MS/MS (-90% of the mature protein) are shown in regular font, and the two glycosylated tryptic peptides are underlined.
- the unmodified chymotryptic peptide 73 NATLVGKY 80 (SEQ. ID. NO. 5) overlaps both modified peptides.
- Two linked Cys residues are highlighted in grey, while the two Thr residues that are the most likely sites of modification are shown in reverse text.
- mF methyl-Phe.
- Figure 4 shows a feC ID-MS/MS analysis of the T 55"79 glycopeptide.
- Figure 5 shows a 1 D 1 H spectrum (A) and a 1 H- 13 C HSQC spectrum (B) of the O-linked pilin glycan from P. aeruginosa. Labeled in the HSQC spectrum are the resonances from the two ⁇ Araf moieties that give rise to the most prominent glycan- associated peaks. These results indicate that the glycan is O-linked to the pilin peptide fragments via C1 of ⁇ Araf.
- D-Araf is a very rare sugar in Gram-negative bacteria, found only as a component of a few O antigens 86 and in some Rhizobium nodulation factors 87 .
- D-Araf is a major and essential constituent of the cell envelopes of the Corynebacterineae, including the important human pathogens Mycobacterium tuberculosis, M. leprae and M. avium. These bacteria have an unusual cell envelope, with peptidoglycan-attached arabinogalactans and membrane-linked lipoarabinomannans capped with mycotic acids forming its outer layers 88 ' 89 .
- LAM lipoarabinomannan
- AG arabinogalactan
- tuberculosis obtained through the NIH-NIAID "Tuberculosis Vaccine Testing & Research Materials," contract with Colorado State University
- group 4 pilin glycans are immunologically, as well as chemically, identical to LAM arabinans.
- the converse experiment was also done by immunizing rabbits with group 4 pilins.
- the resulting serum recognizes cell wall material from M. smegmatis (a non-pathogenic mycobacterial species widely used as a model). The results of these experiments are shown in Figure 6.
- novel glycopeptides associated with the pili of strain Pa5196 provide novel antigens for the development of diagnostics and vaccines for Pseudomonas infections. Because of the structural and immunogenic similarity of the associated glycans to those that are important in the cell wall of mycobacteria, these glycans and glycopeptides also provide novel antigens for the development of mycobacterial diagnostics, vaccines and immunothereapeutics. While the glycans themselves are important antigenic targets, carbohydrate antigens generally exhibit poor immunogenicity unless coupled to a carrier. The glycan of the invention can be coupled to various carriers to enhance the immune response. The Pa5196 pilin glycopeptide provides a natural carrier for inducing immune responses to the glycan.
- An immunogenic composition of the invention may include additional adjuvants and excipients. The immunogenic composition may also include additional antigens.
- the present invention comprises an essentially pure form of at least one protein or peptide containing an amino acid sequence corresponding to at least one antigenic determinant of T4P, which peptide is capable of eliciting polyclonal antibodies against Corynebacterinae, such as Mycobacterium tuberculosis, Mycobacterium avium and Mycobacterium leprae as well as certain strains of Pseudomonas in mammals. These glycans and glycopeptides can be used to elicit antibodies that are useful in test kits for detecting the presence of mycobacteria and pseudomonas in biological samples.
- the peptides can have, for example, the amino acid sequences corresponding to SEQ ID. NOS. 3, 4, and 5 or any portion, variant or mutant thereof which retains immunogenicity.
- the present invention provides isolated Group 4 pili.
- the purified native pilin can be used to immunize mammals against diseases caused by mycobacteria.
- the various embodiments of the present invention have many applications in the fields of vaccination, diagnosis, and treatment of diseases caused by mycobacterial and pseudomonas infections, and the generation of immunological reagents.
- Immunogenic compositions suitable for use as vaccines, may be prepared from immunogenic Type 4 pili, purified glycoprotein, glycan, fragments or analogs thereof and/or synthetically or recombinantly prepared peptides corresponding to portions of the pilin.
- the immunogenic compositions are preferably prepared from glycoproteins of Group 4 Pseudomonas aeruginosa, particularly strain Pa5196.
- the immunogenic compositions preferably induce humoral and or cellular immune responses.
- a vaccine comprising the immunogenic composition preferably elicits an immune response which produces antibodies that are opsonizing or bactericidal.
- the antibodies preferably bind to mycobacterial cell wall components, in particular D- Araf and thereby inactivate the bacterium.
- Vaccines containing peptides are generally well known in the art, as exemplified by U.S. Pat. Nos. 4,601 ,903; 4,599,231 ; 4,599,230; and 4,596,792; all of which references are incorporated herein by reference.
- Vaccines may be prepared as injectables, as liquid solutions or emulsions.
- Type IV pilin, protein, fragments or analogs thereof or peptides may be mixed with physiologically-acceptable excipients.
- Excipients may include, water, saline, dextrose, glycerol, ethanol, and combinations thereof.
- the vaccine may further contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or adjuvants to enhance the effectiveness of the vaccines.
- Vaccines may be administered parenterally, by injection, subcutaneously or intramuscularly. Alternatively, mucosal modes of administration including suppositories and oral formulations may also be used. [0046]
- the vaccines are administered in a manner compatible with the dosage formulation, and in an amount that is therapeutically effective, protective and immunogenic.
- the quantity to be administered depends on the subject to be treated, including, for example, the capacity of the individual's immune system to synthesize antibodies, and if needed, to produce a cell-mediated immune response. Suitable dosage ranges are readily determinable by one skilled in the art and may be of the order of micrograms of the pilin glycopeptide, analog, fragment and/or peptides.
- the dosing regimen may include a single dose or may include an initial administration followed by booster doses.
- the dosage of the vaccine may also depend on the route of administration and varies according to the size of the host.
- the pili of strain Pa5196 comprise a glycoprotein that is modified with a ⁇ -1 ,5- linked d-arabinofuranose. Since this sugar is also found in the cell wall of mycobacteria, Pa5196 can be used to study the biosynthetic pathway and also to identify potential new therapeutics for the treatment of mycobacterial infections.
- EmbA, EmbB and EmbC Three membrane-bound arabinosyltransferase enzymes named EmbA, EmbB and EmbC (because they are the targets of the antituberculosis drug ethambutol) have been identified, and are proposed to catalyze the incorporation of D-Araf into ⁇ -1,2 and ⁇ -1 ,3-linked structures directly from the lipid carrier into the cell wall polymers 92"95 ; the enzyme(s) responsible for the ⁇ -1 ,5 linkage has not yet been identified.
- This biosynthetic mechanism is reminiscent of peptidoglycan synthesis, but different from those used by Gram-negative bacteria to synthesize homo- or heteropolysaccharides such as lipopolysaccharides (LPS).
- LPS lipopolysaccharides
- FIG. 7 illustrates models of exoploysaccharide biosynthesis in Gram-negative bacteria.
- the biosynthesis of heteropolymeric (panel A) and homopolymeric (panel C) glycans is shown (from Raetz and Whitfield, 2001).
- Heteropolymeric structures are synthesized from nucleotide sugar precursors as blocks (shown in red, while and blue circles) attached to the lipid carrier, undecaprenol phosphate, and are subsequently translocated to the periplasm where they are polymerized (for capsule or O antigens) and/or ligated to preformed acceptors including lipid A-core (for LPS) or the case of P. aeruginosa group 1 strains, the type IV pilins.
- lipid A-core for LPS
- P. aeruginosa group 1 strains the type IV pilins.
- Panel B shows the analogous process in Neisseria, where individual blocks of sugars are built on a lipid carrier on the cytoplasmic face of the inner membrane, translocated to the periplasm and ligated to the pilins by the glycosyltransferase, PgIL.
- synthesis typically begins with a priming sugar (shown in panel C as a red circle) that does not form part of the repeating unit. The entire polymer is made on the cytoplasic face of the inner membrane prior to translocation to the periplasm via an ABC trasporter (Wzm and Wzt in panel C).
- Panel D shows a proposed model for synthesis and attachment of the D-arainofuranose glycan to Pa5196 pilins.
- the present invention provides methods for identifying enzymes involved in nucleotide-sugar precursor biosynthesis; one or more arabinosyltransferases to initiate and extend the glycan chain on the lipid carrier (in yellow); an unknown translocation mechanism (the glycans appear to short to require a typical ABC transporter system); and potentially TfpW or a similar enzyme to mediate transfer of the completed glycan onto the pilin.
- synthesis of LPS by P In general terms, synthesis of LPS by P.
- aeruginosa begins with the generation of activated nucleotide sugar precursors, the first of which is attached to the undecaprenol phosphate lipid carrier on the cytoplasmic face of the inner membrane by a specific glycosyltransferase 96 . Subsequent precursor sugars are added to the first by additional glycosyltransferases, whose activities determine the specific linkage formed . The completed glycan must then be translocated to the periplasmic face of the membrane, where it is ligated to a pre-formed acceptor molecule through the action of a separate glycosyltransferase (ligase) 97 .
- ligase separate glycosyltransferase
- the ligase is the TfpO protein 77
- the PgIL pilin glycosyltransferase in Neisseria, the PgIL pilin glycosyltransferase. This precedent and its predicted topological similarity to TfpO, PgIL and the O-GlcNAc transferase, suggested that TfpW is responsible for attaching the arabinans to group 4 pilins.
- the mass of the pilin protein is reduced in the tfpW mutant. This indicates that the pilins are not modified with sugars in a tfpW mutant, suggesting that TfpW, possibly in concert with TfpX, is the protein responsible for attachment of the arabinose sugars to the pilin proteins.
- P. aeruginosa Pa5196 synthesizes D-Araf, generates linear ⁇ 1 ,5 linked oligomers of this sugar and covalently links these glycans to pilins which can be easily harvested from the cell surface in large quantities for analysis and for the production of immunogenic compositions.
- P. aeruginosa is of relatively low virulence, grows rapidly under a variety of conditions and is highly amenable to genetic manipulation.
- Pa5196 represents an excellent model strain for the elucidation of pathways for D-Araf biosynthesis and polymerization. This information can be used to identify new enzymatic targets for development of drugs to combat the enormous global burden of mycobacterial infections.
- P. aeruginosa strains were maintained as glycerol stocks at -80 C, and grown and maintained on Luria-Bertani agar (Difco).
- Strain 1244 (32) was a gift of P. Castric
- serotype 011 strain PA103 (43) was a gift of G. Pier
- the International Antigenic Typing Scheme (IATS) 011 strain was a gift of J. Lam
- strain PAK is a common lab strain
- strain Pa5196 was originally isolated from a nursing home resident (30). Pa5196 was determined to be serotype 011 by slide agglutination using monoclonal antibodies as described previously (54) and by PCR analysis with the primer set described by Raymond and colleagues (55).
- the amplicon was cloned into pEX18Ap, linearized with Pstl and ligated with a gentamicin resistance cassette released from pPS856 (58) with Pstl.
- the resulting knockout (59) gentamicin-resistant transformants were selected on LB agar containing 25 mg/L gentamicin.
- the mutation was verified by PCR using the above primers. Loss of the Pa5196 O antigen was confirmed by silver-stained SDS-PAGE and Western blot using rabbit polyclonal antisera to the 011 0 antigen (gift of Dr. J. Goldberg) as described previously (42, 56).
- Pilin proteins were isolated using the methods of Castric (32) with modifications. Bacteria were streaked onto LB agar plates in a grid pattern and grown overnight. For SDS-PAGE one plate was used per sample, for the glycan analysis 50-60 plates were used per sample. The bacteria were gently scraped from each plate using a sterile coverslip and resuspended in 2 mL sterile phosphate- buffered saline (PBS) per plate, then pili were sheared by vigorous vortexing for 1.5 min. The suspension was transferred to 2 x 1.5 mL microcentrifuge tubes and centrifuged for 5 min at maximum speed.
- PBS sterile phosphate- buffered saline
- the supernatant was transferred to a new tube and centrifuged for an additional 25 min at maximum speed at room temperature.
- 1M MgCI 2 was added to the supernatant to a final concentration of 0.1 M and the samples incubated at 4 ° C overnight. Samples were centrifuged at maximum speed in a microcentrifuge for 25 min at 4 C.
- pellets were resuspended in 2x SDS-PAGE loading dye (125 mM Tris, pH 6.8; 2% (w/v) 2-mercaptoethanol; 20% (v/v) glycerol; 0.001% (w/v) bromophenol blue; 4% (w/v) SDS), boiled for 5 minutes and resolved on a 15% 1 D-SDS-PAGE minigel with a pre-stained Benchmark Protein Ladder (Invitrogen). The protein bands were visualized using Colloidal Coomassie Blue.
- the pellets from 50-60 plates were pooled into 2ml_ of 5OmM NH 4 HCO 3 , pH 8.5.
- the suspension was dialyzed overnight using a dialysis cassette (10,000 Da cut-off; Pierce) at 4 ° C in a total volume of 4L of 5OmM NH 4 HCO 3 , pH 8.5.
- Type IV pilins from the group IV strain Pa5196 migrated more slowly than their predicted mass on SDS-polyacrylamide gels, suggesting that they were post-translationally modified (30).
- Pa5196 was determined to be serotype 011.
- the wbpM gene encoding a conserved dehydratase required for O-antigen biosynthesis (42, 43) was disrupted. While this mutation resulted in loss of the Pa5196 O antigen (Fig.
- pilins purified from wbpM knockout strain co-migrated with those of the Pa5196 parent strain (Fig. 1B), suggesting that they continued to be modified.
- Analysis of sheared pilin proteins by a fluorescent periodic acid/Schiff method confirmed that pilins from strains 1244 (group I), Pa5196 (group IV) and Pa5196 wbpMwGm, but not the unmodified pilins of strain PAK (group II), were glycosylated (Fig. 1B).
- Glycosylated pilins from Pa5196 were not recognized by the anti-011 sera (not shown), confirming that the glycan is not the O11 O unit.
- glycosylated and non-glycosylated protein standards were separated on 15% SDS- PAGE gels as described above with the PTM Marker (Sigma) containing glycosylated and non-glycosylated protein standards.
- Glycosylated proteins were detected using the GlycoProfile III Fluorescent Glycoprotein Detection Kit (Sigma) as prescribed by the manufacturer and visualized on a UV transilluminator.
- Alkylated proteins were in-gel digested overnight at 37 0 C with 200ng of trypsin (Promega) or chymotrypsin (Sigma) in 100 ⁇ L of 5OmM NH 4 HCO 3 .
- the bands were doubly digested by adding trypsin after chymotryptic digestion (same ratio) and repeating the overnight incubation.
- tryptic digestion was carried out on 20 ⁇ g of the original pilin extract, without the reduction/alkylation step using the same incubation conditions.
- NanoLC-MS/MS analysis was performed using a CapLC nanoHPLC system (Waters) coupled to the Q-TOF2 mass spectrometer. Approximately 0.2 ⁇ g of each proteolytic digest was resolved on a 75 ⁇ m-inner diameter x 150mm lnertsil ODS 3, 5 ⁇ m nano-HPLC column (Dionex/LC Packings, Sunnyvale, CA) using the following gradient conditions: 5-60% acetonitrile, 0.2% formic acid in 30 min; 60- 90% in 5 min. The mass spectrometer was set for automatic data-dependant MS/MS spectra acquisition on doubly, triply, and quadruply charged ions. All MS/MS spectra were examined manually for the presence of unusual modifications.
- NanoLC-MS/MS analysis was performed on a pilin tryptic digest and two glycopeptide MS/MS spectra are presented in Fig. 3. In both cases it was possible to identify the peptide sequence from the b and y peptide fragment ions in the MS/MS spectra ( 55 NAWPTLVAPTATPGAGQLNATLVGK 79 (SEQ. ID. NO. 3) and 80 YSSVDSTIASGYPNGQITVTMTQGK 104 (SEQ. ID. NO. 4), respectively). A series of ions corresponding to the sequential neutral loss of 132 Da were observed in the high m/z region of both MS/MS spectra, mirroring the glycoform pattern observed for the intact pilin.
- oxonium ions corresponding to 1 and 2 pentoses were observed at m/z 133 and 265, respectively, suggesting that the peptides were modified with glycan polymers consisting of 2 or more pentoses.
- the difference between the predicted and observed mass of the T 55'79 and ⁇ 80"104 glycopeptides corresponds to exactly 6 pentoses.
- MS/MS spectra were obtained for other glycoforms of these peptides (highlighted in the insets of Figure 3A and B), corresponding to the addition of 5-7 pentoses and occasionally as many as eight.
- OligoR3 resin (Applied Biosystems) packed into a gel loader tip in the manner described by Stensballe and coworkers (60).
- the peptides and glycopeptides were step-eluted from the resin by the sequential addition of 0-50% aqueous acetonitrile in increments of 5%.
- Each fraction was diluted 1 :1 with 50% methanol and 0.2% formic acid prior to loading into a Picotip Econo12 nano-emitter tip (New Objective, Woburn, MA).
- the fractions were screened for glycopeptides by nESI-MS/MS.
- the glycopeptides were further interrogated by nESI-MS/MS with front-end collision induced dissociation (nESI-feCID-MS/MS) as described previously (61).
- nESI-feCID-MS/MS front-end collision induced dissociation
- NMR experiments were carried out at 25 0 C on a Varian INOVA spectrometer operating at 600 MHz, using a cryogenically cooled probe (Varian Associates Inc., Palo Alto, CA). Standard two-dimensional homonuclear (COSY, TOCSY and NOESY) and 1 H- 13 C heteronuclear (HSQC and HMBC) spectra were acquired as described previously (63. 1 H and 13 C chemical shifts were referenced with respect to the methyl group of an internal acetone standard, appearing at 2.225 and 31.1 ppm, respectively. NMR data were processed using the software package TOPSPIN (Bruker Biospin, Billerica, MA).
- NMR characterization of the pilin glycan from P. aeruginosa demonstrated that it is composed of a repeating ⁇ (1 ⁇ 5) unit of arabinofuranose (Araf).
- a 1D 1 H spectrum of the glycan shows the presence of a major peak in the anomeric region at ⁇ 5.08 ppm (Fig. 5A).
- Anomeric protons from at least two distinct pentose units give rise to this peak (residues a and b in Table 1).
- the first corresponds to a terminal ⁇ Araf moiety (residue a), whereas the second corresponds to a sub-terminal ⁇ Araf unit that is glycosidically linked at the C5 position (residue b).
- a 1 H- 13 C HSQC spectrum (Fig. 5B) clearly shows that the H5 protons from residue b are shifted downfield in the carbon dimension compared to those from residue a as a result of its participation in a glycosidic bond at C5.
- Example 10 Determination of the enantiomeric form of the glvcan by GC-MS [0074] Both the pilin carbohydrate sample used for NMR analysis and 0.5 mg of D-Ara were derivatized according to the following protocol (64). The carbohydrates were lyophilized and dissolved in 200 ⁇ l_ of R-2-butanol plus 30 ⁇ l_ of acetyl chloride. The samples were incubated for 3 hr at 100°C and the solvents evaporated under a nitrogen stream. The dried samples were treated with 200 ⁇ l_ of pyridine plus 200 ⁇ l_ of acetic anhydride for 2 hr at 100 0 C and the solvents evaporated under a nitrogen stream.
- the samples were cleaned twice by addition and evaporation of toluene (0.5mL).
- a second batch of D-Ara was derivatized in a similar manner using a racemic mixture of R,S-2-butanol instead of R-2-butanol.
- the acetylated samples were dissolved by 50-200 ⁇ l_ of methylene chloride for GC-MS analysis on a Varian 3800 gas chromatography system coupled with a Saturn 2000 ion trap mass spectrometer operating in electron impact ionization mode.
- the analysis conditions were as follows: 2-3 ⁇ l_ injection, 1/25 split, inlet temperature 265°C; column DB 17MS, 30 m x 250 ⁇ m, 25 ⁇ m film thickness (Agilent, Palo Alto, CA), helium flow 1 mL/min; starting oven temperature 180 0 C, rising at 3.5°C/min to 260°C, then rising at 70°C/min to 280°C.
- the MS acquisition range was 40 to 650 m/z.
- Example 11 Immunogenic identity of the Pa5196 pilin glycan and Mycobacterium cell envelope.
- the Pa5196 antiserum recognizes the PAK pilin and flagellin, as well as the material corresponding to LAM and arabinogalactan in M. smegmatis, which runs as a smear in the 20-30 kDA range.
- the band marked with an asterisk is the pilin of Pa5196, while the band below is a cross-reacting contaminant that was also present in the preimmune sear of this rabbit (not shown).
- Figure 6 (bottom) is western bolt of a sheared surface preparation from strain PA7 that shows that its pilins react with both the anti-LAM antisera (center) and Pa5196 antisera (right).
- PA 7 makes far fewer pili than Pa5196 although similar amounts of flagella are present in both strains as seen on the SDS-PA gel, left.
- the reduced level of piliation is reflected in lower twitching motility (far right).
- the control PAO1 pilins are not recognized by either sear, although a faint cross-reaction with the flagellin can be seen in the anti-Pa5196 panel.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Communicable Diseases (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Toxicology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Oncology (AREA)
- Gastroenterology & Hepatology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Pseudomonas aeruginosa is a Gram negative bacterium that uses polar type IV pili to adhere to and rapidly colonize surfaces. There are five distinct alleles of the structural subunit, PilA. A novel Group IV strain, Pa5196, synthesizes a pilin glycan that is a linear oligosaccharide of five to eight alpha-1, 5-linked D-arabinofuranose (D-Araf) residues, covalently O-linked to the pilin via Thr. This sugar is rare in prokaryotes, but occurs in cell walls of mycobacteria where alpha-1,5-linked D-Araf chains link mycolic acids to peptidoglycan. The Pa5196 provides a model system of the pathways for biosynthesis of D-Araf and its polymerization into mycobacterial-like α1,5 linked oligomers as well as the enzymes involved. Novel vaccine formulations and methods are provided.
Description
A NOVEL PILIN GLYCOPROTEIN FROM A GROUP 4 PSEUDOMONAS AERUGINOSA STRAIN
FIELD OF THE INVENTION
[0001] The present invention relates to a novel strain of Pseudomonas aeruginosa, glycans and glycopeptides associated with the pilin, enzymes involved in the glycosylation of pilins and agents that affect those enzymes. The invention also relates to antigens derived from the novel strain and their use in vaccines.
BACKGROUND OF THE INVENTION
[0002] Pseudomonas aeruginosa is a ubiquitous opportunistic Gram-negative pathogen that infects immunocompromised individuals and causes fatal pulmonary infections in patients with cystic fibrosis (7-10). Among the virulence factors that allow P. aeruginosa to successfully establish infections are its polar type IV pili (T4P). The T4P of P. aeruginosa are composed of monomeric subunits (pilins) encoded by pilA (18,16, 19, 20). Unlike other strains, a novel Group 4 strain has been identified that includes a pilin glycan that is a homo-oligomer of α-1,5,-linked D- arabinfuranose (D-Araf). This sugar is uncommon in prokaryotes, occurring mainly in the cell wall arabinogalactan and lipoarabinomannan polymers of mycobacteria.
[0003] D-Arabinofuranose (D-Araf)-containing glycosides are key components of the unusual cell walls of mycobacteria, including the major human pathogens Mycobacterium tuberculosis, M. leprae and M. avium-intracellulare complex (MAC)(I, 2) where they connect waxy mycolic acids to the peptidoglycan skeleton (3). Biosynthesis of these polymers is essential for productive infection; for example, the effective anti-mycobacterial drug ethambutol inhibits specific arabinoglycosyltransferases (4). Unfortunately, infections due to these organisms continue to increase, and resistance to the small pool of effective anti-mycobacterial agents has risen markedly in recent years (5, 6). Mycobacterial infections are a particularly serious problem in HIV infected individuals. Current vaccines, such as BCG are not highly effective. In addition, BCG is a live, attenuated vaccine and, as such, cannot be given to immunocompromised hosts, such as individuals infected with HIV. Thus there is a need for new vaccines and therapeutics for the prevention of mycobacterial infections.
[0004] The absence of a tractable model organism for study of arabinoglycoside biosynthesis has impeded identification of key steps in the pathway that could be targets for the development of much needed antimycobacterial agents. The present invention provides a novel approach to address the need for new mycobacterial vaccines and therapeutics.
SUMMARY OF THE INVENTION
[0005] The T4P pili are composed of monomeric subunits (pilins) encoded by the pilA gene. Glycosylation of the P. aeruginosa pilin is known to modify its physical properties and to affect pathogenicity. The pilin glycan from P. aeruginosa Pa5196 is shown to be composed of a repeating α(1→5) unit of arabinofuranose (Araf)- Further analysis by GC-MS demonstrated that the pilins are modified with D-Araf - containing oligosaccharides. D-Araf is a major component of mycobacterial cell walls where its biosynthetic pathway is an important therapeutic target, as demonstrated by the clinical utility of the anti-TB drug ethambutol that inhibits specific arabinosyltransferases of Mycobacterium tuberculosis.
[0006] The present invention provides novel compositions, vaccines, therapeutics and methods for the diagnosis and treatment of mycobacterial infections based on similar biosynthetic pathways in P. aeruginosa and mycobacteria.
[0007] In one aspect of the invention, an isolated pilin glycoprotein from a
Group 4 Pseudomonas aeruginosa strain characterized in that it is modified with a D- arabinofuranose glycan is provided. The glycoprotein is preferably isolated from the Group 4 strain, Pa5196. The glycoprotein is modified with a α-1 ,5-linked D- arabinofuranose glycan.
[0008] In another aspect of the invention, t he glycan portion of the pilin glycoprotein is provided.
[0009] The invention also provides fragments of a pilin glycoprotein. The glycopeptide may comprise an amino acid sequence selected from the group consisting of SEQ. ID. NO. 3, SEQ. ID NO. 4, SEQ ID. NO. 5 and SEQ. ID NO. 6.
[0010] The invention also provides an immunogenic composition comprising a glycan or glycopeptide from a Group 4 Pseudomonas aeruginosa pilin and an excipient. In a preferred embodiment the glycan is α-1,5-linked D-arabinofuranose. The immunogenic composition may further comprise an adjuvant.
[0011] The immunogenic composition can be used to generate an antibody that is reactive to the glycan. Immunization of animals with glycosylated P. aeruginosa pilins has already been shown to raise antibodies to both the protein and glycan components. It is possible to culture genetically engineered bacterial host cells containing the genes encoding the structural components of Type IV pili from strain Pa5196 to be used as an antigenic preparation to stimulate protection against mycobacterial infections. An antibody that specifically reacts with a glycan from a Group 4 Pseudomonas aeruginosa pilin protein is also provided. The antibody is preferably a monoclonal antibody especially one that specifically recognizes α-1 ,5- linked D-arabinofuranose.
[0012] In another aspect of the invention a method of diagnosing a Group 4
Pseudomonas aeruginosa infection is provided. The method comprises reacting a test sample with an antibody that specifically recognizes α-1 ,5-linked D- arabinofuranose, wherein specific binding of the antibody to a component in the sample is indicative of infection.
[0013] In a further aspect of the invention, a method of diagnosing a mycobacterial infection is provided. The method comprises reacting a test sample with an antibody that specifically recognizes α-1,5-linked D-arabinofuranose, wherein specific binding of the antibody to a component in the sample is indicative of infection. The mycobacterial infection is typically caused by a pathogen selected from the group consisting of M. tuberculosis, M. leprae and M. avium.
[0014] In a further aspect of the invention, a vaccine for immunizing a human subject against a mycobacterial infection is provided. The vaccine comprises an effective amount of an antigen consisting essentially of a glycan or glycopeptide from a Group 4 Pseudomonas aeruginosa pilin and a pharmaceutically acceptable carrier. In a preferred embodiment, the antigen is α-1 ,5-linked D-arabinofuranose. In
another preferred embodiment, the antigen is a pilin protein subunit from strain Pa5196.
[0015] The invention also provides a method for immunizing a human subject for the prevention or treatment of a mycobacterial infection. The method comprises administering a vaccine containing α-1,5-linked D-arabinofuranose or a pilin protein subunit from strain Pa5196.
[0016] In another aspect an assay for the diagnosis of a Group 4
Pseudomonas aeruginosa infection or a mycobacterial infection is provided. The assay comprises obtaining a biological sample and determining the amount of binding of an antibody that specifically binds to α-1 ,5-linked D-arabinofuranose to the sample. The invention also provides a kit for the diagnosis of a Group 4 Pseudomonas aeruginosa infection or a mycobacterial infection. The kit comprises an antibody that specifically binds to α-1,5-linked D-arabinofuranose, a control source of α-1 ,5-linked D-arabinofuranose and a secondary labelled antibody.
[0017] In yet another aspect of the invention, the enzymes for biosynthesis of the pilin glycan from P. aeruginosa Pa5196, which is composed of repeating α(1→5) unit of arabinofuranose (Ara/) of the D-enantiomer of Araf are provided. These enzymes represent new drug targets for further exploitation as anti-TB drugs. Agents that interfere with the activity of the enzymes are also provided.
[0018] In yet another aspect of the invention, a vaccine comprising an antigenic portion of the native pilin is provided. The vaccine of the invention may be useful as a vaccine against Pseudomonas or against mycobacteria, particularly Mycobacterium tuberculosis Mycobacterium leprae or Mycobacterium avium.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIGURE 1A is a Western blot of Pa5196 pilins on different backgrounds;
[0020] FIGURE 1B illustrates results obtained when pilins are stained with
Coomassie Blue or a fluorescent glycoprotein stain;
[0021] FIGURE 2 illustrates the analysis of the intact Pa5196 pilin by ESi-MS;
[0022] FIGURE 3 shows the identification of pilin glycopeptides by MS/MS;
[0023] FIGURE 4 illustrates one feCID- MS/MS analysis of the T55'79 glycopeptide;
[0024] FIGURE 5 shows a 1D 1H spectrum (A) and a 1H-13C HSQC spectrum
(B) of the O-linked pilin glycan from P. aeruginosa;
[0025] FIGURE 6 is a series of Western blots showing immunological identity of the Pa5196 pilin glycan with sugars found in the Mycobacterial cell envelope;
[0026] FIGURES 7A-D are models of exopolysaccharide biosynthesis in gram negative bacteria; and
[0027] FIGURE 8 is an SDS-PAGE gel demonstrating the TfpW protein is involved in attachment of glycans to Group 4 pilin proteins.
DETAILED DESCRIPTION
[0028] The invention provides a novel bacterial strain, Pseudomonas aeruginosa strain Pa5196, for elucidation of biosynthesis pathways and analysis of D-Araf - containing oligosaccharides. This strain can be used as a model to study cell wall components of mycobacteria species. Strain Pa5196 is a rapidly growing Gram negative bacterium of low virulence that is highly amenable to genetic manipulation. Compared to mycobacteria which are slow-growing organisms and technically can be a difficult microorganism to culture and extract cell wall components, this novel strain of P. aeruginosa Pa5196 is fast growing, nonpathogenic and very easy to work with in the laboratory. Thus Pa5196 is an excellent model organism for the study of arabinosyltransferase pathways.
[0029] Using a combination of mutagenesis, SDS-PAGE, glycosylation staining, mass spectrometry and NMR spectroscopy, it was determined that the group 4 pilin was glycosylated at multiple positions, not with O-antigen units as in group 1 strains, but instead with a homopolymer of α-1,5-linked D-arabinofuranose (D-AraO- This is the first example of a bacterial protein modified with a homo-oligosaccharide. The results of exemplary experiments that led to these conclusions are shown in the attached figures.
[0030] Figure 1 demonstrates that Pa5196 pilins continue to be glycosylated in a wbpM mutant. Panel A shows LPS samples that were stained with silver (left) or detected via Western blot using antibodies against serotype 011 (right). Strains IATS 011 and PA103 (both serotype 011) are positive controls; PAK (serotype 06) is a negative control. The wbpM mutant of Pa5196 lacks high molecular weight O antigen on silver stain and by Western blot. In Panel B, pilins from the indicated strains were detected with Coomassie (left) or with a fluorescent glycoprotein stain (right). (M, molecular weight markers, in kDa; G, glycoprotein controls, - non- glycosylated (β-casein), + glycosylated (RNase B). Lane 1, strain 1244 (group I, glycosylated); lane 2, PAK (group II, non-glycosylated); lane 3, Pa5196 (group IV); lane 4, Pa5196 wbpM mutant). These results indicate that the glycan associated with these pili is not the 011 O unit.
[0031] Figure 2 illustrates the analysis of the intact Pa5196 pilin by ESI-MS.
The m/z value and charge state has been indicated for the most abundant ion in each of the multiply charged protein peak clusters. The reconstructed protein profile is shown in the inset. The interval between any 2 populations of proteins is 132 daltons, equivalent to the mass of a single pentose residue.
[0032] Figure 3 shows the identification of pilin glycopeptides by MS/MS.
Panel A shows a LC-MS/MS spectrum of the triply protonated T55'79 glycopeptide ion at m/z 1080.8. The b and y fragment ions originate from fragmentation of the peptide backbone. Sequential neutral loss of pentose sugars from the doubly charged peptide ion is observed in the upper part of the MS/MS spectrum (indicated with a "P"). Oxonium ions corresponding to one and two pentoses were observed at m/z 133.1 and 265.1, respectively. This ion has 6 pentose residues and is the most abundant form of this glycopeptide. However, glycoforms ranging from 3 to 7 pentoses were also observed as is demonstrated in the expanded LC-MS spectrum of triple-charged ions provided in the inset. Panel B shows a LC-MS/MS spectrum of the triply protonated T80"104 glycopeptide ion at m/z 1133.1. This ion also contains 6 pentoses and is the most abundant form of this glycopeptide. MS/MS analysis was performed on many of the other glycoforms observed by LC-MS (inset shows triple- charged ions). Panel C is a map of Pa5196 pilin following trypsin and/or chymotrypsin digestion and nanoLC-MS/MS. The protein fragments identified by
nanoLC-MS/MS (-90% of the mature protein) are shown in regular font, and the two glycosylated tryptic peptides are underlined. The unmodified chymotryptic peptide 73NATLVGKY80 (SEQ. ID. NO. 5) overlaps both modified peptides. Two linked Cys residues are highlighted in grey, while the two Thr residues that are the most likely sites of modification are shown in reverse text. mF, methyl-Phe. These results indicate that the glycans must be O-linked to Ser or Thr residues.
[0033] Figure 4 shows a feC ID-MS/MS analysis of the T55"79 glycopeptide.
The glycopeptides were fragmented by front-end collision-induced dissociation (orifice voltage = 80V) as they entered the mass spectrometer. MS/MS analysis was performed on the doubly protonated ion at m/z 1291.1 corresponding to the T55'79 peptide plus one pentose moiety. The observation of the pentose-modified y17 and yiβ fragment ions at m/z 1729.5 and 1799.5 (+P) confirmed that the site of modification is Thr 64 or Thr 66.
[0034] Figure 5 shows a 1 D 1H spectrum (A) and a 1H-13C HSQC spectrum (B) of the O-linked pilin glycan from P. aeruginosa. Labeled in the HSQC spectrum are the resonances from the two αAraf moieties that give rise to the most prominent glycan- associated peaks. These results indicate that the glycan is O-linked to the pilin peptide fragments via C1 of αAraf.
[0035] D-Araf is a very rare sugar in Gram-negative bacteria, found only as a component of a few O antigens86 and in some Rhizobium nodulation factors87. However, D-Araf is a major and essential constituent of the cell envelopes of the Corynebacterineae, including the important human pathogens Mycobacterium tuberculosis, M. leprae and M. avium. These bacteria have an unusual cell envelope, with peptidoglycan-attached arabinogalactans and membrane-linked lipoarabinomannans capped with mycotic acids forming its outer layers 88' 89. Both lipoarabinomannan (LAM) and arabinogalactan (AG) contain linear chains of α-1 ,5- linked D-Araf as well as branched α-1 ,2 and α-1 ,3 forms. Although arabinans are essential components of the mycobacterial cell wall and therefore excellent drug targets, their biosynthesis is not well understood. This knowledge gap is due in part to the challenges of working with very slow-growing, highly-pathogenic organisms and the fact that the polymers are part of a larger, highly complex cell wall structure, whose analysis requires laborious extraction and separation techniques88' 89. Using
antibodies raised against LAM from M. tuberculosis (obtained through the NIH-NIAID "Tuberculosis Vaccine Testing & Research Materials," contract with Colorado State University), it was demonstrated that the group 4 pilin glycans are immunologically, as well as chemically, identical to LAM arabinans. The converse experiment was also done by immunizing rabbits with group 4 pilins. The resulting serum recognizes cell wall material from M. smegmatis (a non-pathogenic mycobacterial species widely used as a model). The results of these experiments are shown in Figure 6.
[0036] The novel glycopeptides associated with the pili of strain Pa5196 provide novel antigens for the development of diagnostics and vaccines for Pseudomonas infections. Because of the structural and immunogenic similarity of the associated glycans to those that are important in the cell wall of mycobacteria, these glycans and glycopeptides also provide novel antigens for the development of mycobacterial diagnostics, vaccines and immunothereapeutics. While the glycans themselves are important antigenic targets, carbohydrate antigens generally exhibit poor immunogenicity unless coupled to a carrier. The glycan of the invention can be coupled to various carriers to enhance the immune response. The Pa5196 pilin glycopeptide provides a natural carrier for inducing immune responses to the glycan. An immunogenic composition of the invention may include additional adjuvants and excipients. The immunogenic composition may also include additional antigens.
[0037] The present invention comprises an essentially pure form of at least one protein or peptide containing an amino acid sequence corresponding to at least one antigenic determinant of T4P, which peptide is capable of eliciting polyclonal antibodies against Corynebacterinae, such as Mycobacterium tuberculosis, Mycobacterium avium and Mycobacterium leprae as well as certain strains of Pseudomonas in mammals. These glycans and glycopeptides can be used to elicit antibodies that are useful in test kits for detecting the presence of mycobacteria and pseudomonas in biological samples. The peptides can have, for example, the amino acid sequences corresponding to SEQ ID. NOS. 3, 4, and 5 or any portion, variant or mutant thereof which retains immunogenicity.
[0038] In another embodiment, the present invention provides isolated Group 4 pili. The purified native pilin can be used to immunize mammals against diseases caused by mycobacteria.
[0039] The various embodiments of the present invention have many applications in the fields of vaccination, diagnosis, and treatment of diseases caused by mycobacterial and pseudomonas infections, and the generation of immunological reagents.
[0040] Immunogenic compositions, suitable for use as vaccines, may be prepared from immunogenic Type 4 pili, purified glycoprotein, glycan, fragments or analogs thereof and/or synthetically or recombinantly prepared peptides corresponding to portions of the pilin. The immunogenic compositions are preferably prepared from glycoproteins of Group 4 Pseudomonas aeruginosa, particularly strain Pa5196.
[0041] The immunogenic compositions preferably induce humoral and or cellular immune responses.
[0042] A vaccine comprising the immunogenic composition preferably elicits an immune response which produces antibodies that are opsonizing or bactericidal. The antibodies preferably bind to mycobacterial cell wall components, in particular D- Araf and thereby inactivate the bacterium.
[0043] Vaccines containing peptides are generally well known in the art, as exemplified by U.S. Pat. Nos. 4,601 ,903; 4,599,231 ; 4,599,230; and 4,596,792; all of which references are incorporated herein by reference.
[0044] Vaccines may be prepared as injectables, as liquid solutions or emulsions. The Type IV pilin, protein, fragments or analogs thereof or peptides may be mixed with physiologically-acceptable excipients. Excipients may include, water, saline, dextrose, glycerol, ethanol, and combinations thereof. The vaccine may further contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or adjuvants to enhance the effectiveness of the vaccines.
[0045] Vaccines may be administered parenterally, by injection, subcutaneously or intramuscularly. Alternatively, mucosal modes of administration including suppositories and oral formulations may also be used.
[0046] The vaccines are administered in a manner compatible with the dosage formulation, and in an amount that is therapeutically effective, protective and immunogenic. The quantity to be administered depends on the subject to be treated, including, for example, the capacity of the individual's immune system to synthesize antibodies, and if needed, to produce a cell-mediated immune response. Suitable dosage ranges are readily determinable by one skilled in the art and may be of the order of micrograms of the pilin glycopeptide, analog, fragment and/or peptides. The dosing regimen may include a single dose or may include an initial administration followed by booster doses. The dosage of the vaccine may also depend on the route of administration and varies according to the size of the host.
[0047] The pili of strain Pa5196 comprise a glycoprotein that is modified with a α-1 ,5- linked d-arabinofuranose. Since this sugar is also found in the cell wall of mycobacteria, Pa5196 can be used to study the biosynthetic pathway and also to identify potential new therapeutics for the treatment of mycobacterial infections.
[0048] In mycobacteria, synthesis of the D-Araf precursor is thought to proceed via epimerization of D-ribose bound to the membrane-bound lipid carrier decaprenyl phophosphate90' 91, as no nucleotide-sugar intermediate has been identified despite exhaustive searches88. Three membrane-bound arabinosyltransferase enzymes named EmbA, EmbB and EmbC (because they are the targets of the antituberculosis drug ethambutol) have been identified, and are proposed to catalyze the incorporation of D-Araf into α-1,2 and α-1 ,3-linked structures directly from the lipid carrier into the cell wall polymers92"95; the enzyme(s) responsible for the α-1 ,5 linkage has not yet been identified. This biosynthetic mechanism is reminiscent of peptidoglycan synthesis, but different from those used by Gram-negative bacteria to synthesize homo- or heteropolysaccharides such as lipopolysaccharides (LPS). Figure 7 illustrates models of exoploysaccharide biosynthesis in Gram-negative bacteria. The biosynthesis of heteropolymeric (panel A) and homopolymeric (panel C) glycans is shown (from Raetz and Whitfield, 2001). Heteropolymeric structures are synthesized from nucleotide sugar precursors as blocks (shown in red, while and blue circles) attached to the lipid carrier, undecaprenol phosphate, and are subsequently translocated to the periplasm where they are polymerized (for capsule or O antigens) and/or ligated to preformed acceptors including lipid A-core (for LPS)
or the case of P. aeruginosa group 1 strains, the type IV pilins. Panel B shows the analogous process in Neisseria, where individual blocks of sugars are built on a lipid carrier on the cytoplasmic face of the inner membrane, translocated to the periplasm and ligated to the pilins by the glycosyltransferase, PgIL. In the case of homopolymers, synthesis typically begins with a priming sugar (shown in panel C as a red circle) that does not form part of the repeating unit. The entire polymer is made on the cytoplasic face of the inner membrane prior to translocation to the periplasm via an ABC trasporter (Wzm and Wzt in panel C). Panel D shows a proposed model for synthesis and attachment of the D-arainofuranose glycan to Pa5196 pilins.
[0049] The present invention provides methods for identifying enzymes involved in nucleotide-sugar precursor biosynthesis; one or more arabinosyltransferases to initiate and extend the glycan chain on the lipid carrier (in yellow); an unknown translocation mechanism (the glycans appear to short to require a typical ABC transporter system); and potentially TfpW or a similar enzyme to mediate transfer of the completed glycan onto the pilin. In general terms, synthesis of LPS by P. aeruginosa begins with the generation of activated nucleotide sugar precursors, the first of which is attached to the undecaprenol phosphate lipid carrier on the cytoplasmic face of the inner membrane by a specific glycosyltransferase96. Subsequent precursor sugars are added to the first by additional glycosyltransferases, whose activities determine the specific linkage formed . The completed glycan must then be translocated to the periplasmic face of the membrane, where it is ligated to a pre-formed acceptor molecule through the action of a separate glycosyltransferase (ligase)97. In the case of group 1 pilins, the ligase is the TfpO protein77, and in Neisseria, the PgIL pilin glycosyltransferase. This precedent and its predicted topological similarity to TfpO, PgIL and the O-GlcNAc transferase, suggested that TfpW is responsible for attaching the arabinans to group 4 pilins.
[0050] To test this hypothesis, a tfpW mutant was generated. Pilins from control and mutant bacteria were separated on a 12.5% SDS-PAGE gel. The tfpW mutant does not carry pBADGr but all of the comllementing genes are carried on the vector. The results are shown in Figure 8. The anti-Lam antibody was used at a 1 :400 dilution.
Even though there is a lot of preotein the NP + PiIA lane, it is less heavily stained. The results indicate that the process of glycan attachment is less efficient is this mutant. The smaller pilin do not exhibit staining with this antibody indicating that there is little or no clycan associated with them. As shown in Figure 8, the mass of the pilin protein is reduced in the tfpW mutant. This indicates that the pilins are not modified with sugars in a tfpW mutant, suggesting that TfpW, possibly in concert with TfpX, is the protein responsible for attachment of the arabinose sugars to the pilin proteins.
[0051] To complement this mutation, both tfpW and tfpX are required to restore the wild-type phenotype. This suggests that tfpX may also play a role on the attachment of glycans.
[0052] The identification of the protein involved in attachment of these glycans to pilin proteins opens the door to an entirely new class of therapeutic agents. These proteins are novel targets for interruption of the biosynthetic pathway. Compounds that block or inhibit the activity of these proteins will affect pilin formation in Group 4 Pseudomonas aeruginosa and will likely interfere with cell wall formation in mycobacteria. The invention therefore encompasses such proteins and inhibitors thereof. Glycoengineering techniques to attach the glycans to other proteins of therapeutic interest are also contemplated.
[0053] P. aeruginosa Pa5196 synthesizes D-Araf, generates linear α1 ,5 linked oligomers of this sugar and covalently links these glycans to pilins which can be easily harvested from the cell surface in large quantities for analysis and for the production of immunogenic compositions. Unlike mycobacteria, P. aeruginosa is of relatively low virulence, grows rapidly under a variety of conditions and is highly amenable to genetic manipulation. Thus, Pa5196 represents an excellent model strain for the elucidation of pathways for D-Araf biosynthesis and polymerization. This information can be used to identify new enzymatic targets for development of drugs to combat the enormous global burden of mycobacterial infections. As immunization of animals with glycosylated P. aeruginosa pilins has been shown to raise antibodies to both the protein and glycan components (33), the pilins of Pa5196 also have application as candidate vaccine antigens to generate anti-D-Arafantisera.
BIOLOGICAL DEPOSITS
[0054] Psuedomonas aeruginosa Pa5196 as described and referred to herein has been deposited with the International Depository Authority of Canada pursuant to the Budapest Treaty on May 7, 2007 as Accession No. 070507-1. Samples of the deposited microorganism will become available to the public upon grant of a patent based upon this patent application. The invention described and claimed herein is not to be limited in scope by microorganisms deposited, since the deposited embodiment is intended only as an illustration of the invention. Any equivalent or similar strains that encode similar or equivalent antigens as described in this application are within the scope of the invention.
[0055] The above disclosure generally describes the present invention. It is believed that one of ordinary skill in the art can, using the preceding description, make and use the compositions and practice the methods of the present invention. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely to illustrate preferred embodiments of the present invention and are not intended to limit the scope of the invention. Changes in form and substitution of equivalents are contemplated as circumstances may suggest or render expedient. Other generic configurations will be apparent to one skilled in the art. All journal articles and other documents such as patents or patent applications referred to herein are hereby incorporated by reference.
EXAMPLES
[0056] Although specific terms have been used in these examples, such terms are intended in a descriptive sense and not for purposes of limitation. Methods of biochemistry and chemistry referred to but not explicitly described in the disclosure and these examples are reported in the scientific literature and are well known to those skilled in the art.
Example 1. Bacterial strains and serotvpinα
[0057] P. aeruginosa strains were maintained as glycerol stocks at -80 C, and grown and maintained on Luria-Bertani agar (Difco). Strain 1244 (32) was a gift of P. Castric, serotype 011 strain PA103 (43) was a gift of G. Pier, the International Antigenic Typing Scheme (IATS) 011 strain was a gift of J. Lam, strain PAK is a
common lab strain, and strain Pa5196 was originally isolated from a nursing home resident (30). Pa5196 was determined to be serotype 011 by slide agglutination using monoclonal antibodies as described previously (54) and by PCR analysis with the primer set described by Raymond and colleagues (55).
Example 2. Generation of a wbpM mutant of Pa5196
[0058] Biosynthesis of the 011 O antigen requires the highly conserved dehydratase WbpM (42, 43, 56, 57). To generate an O-antigen mutant, primers wbpM-up (5'GAATTCCCTGGTGTTCAACTACTGGT) (SEQ. ID. NO. 1) and wbpM- down (5'GGGAAGCTTCACCGGCGGCCCCATGT) (SEQ. ID. NO. 2) were used to amplify an approximately 1.3 kb fragment of the wbpM gene from Pa5196. After digestion with EcoRI and Hindlll, the amplicon was cloned into pEX18Ap, linearized with Pstl and ligated with a gentamicin resistance cassette released from pPS856 (58) with Pstl. The resulting knockout (59) gentamicin-resistant transformants were selected on LB agar containing 25 mg/L gentamicin. The mutation was verified by PCR using the above primers. Loss of the Pa5196 O antigen was confirmed by silver-stained SDS-PAGE and Western blot using rabbit polyclonal antisera to the 011 0 antigen (gift of Dr. J. Goldberg) as described previously (42, 56).
Example 3. Pilin isolation
[0059] Pilin proteins were isolated using the methods of Castric (32) with modifications. Bacteria were streaked onto LB agar plates in a grid pattern and grown overnight. For SDS-PAGE one plate was used per sample, for the glycan analysis 50-60 plates were used per sample. The bacteria were gently scraped from each plate using a sterile coverslip and resuspended in 2 mL sterile phosphate- buffered saline (PBS) per plate, then pili were sheared by vigorous vortexing for 1.5 min. The suspension was transferred to 2 x 1.5 mL microcentrifuge tubes and centrifuged for 5 min at maximum speed. The supernatant was transferred to a new tube and centrifuged for an additional 25 min at maximum speed at room temperature. To precipitate the sheared proteins, 1M MgCI2 was added to the supernatant to a final concentration of 0.1 M and the samples incubated at 4° C overnight. Samples were centrifuged at maximum speed in a microcentrifuge for 25 min at 4 C. For SDS-PAGE and glycosylation staining, pellets were resuspended in 2x SDS-PAGE loading dye (125 mM Tris, pH 6.8; 2% (w/v) 2-mercaptoethanol; 20%
(v/v) glycerol; 0.001% (w/v) bromophenol blue; 4% (w/v) SDS), boiled for 5 minutes and resolved on a 15% 1 D-SDS-PAGE minigel with a pre-stained Benchmark Protein Ladder (Invitrogen). The protein bands were visualized using Colloidal Coomassie Blue. For mass spectrometry analysis of the intact protein, the pellets from 50-60 plates were pooled into 2ml_ of 5OmM NH4HCO3, pH 8.5. The suspension was dialyzed overnight using a dialysis cassette (10,000 Da cut-off; Pierce) at 4°C in a total volume of 4L of 5OmM NH4HCO3, pH 8.5.
[0060] Type IV pilins from the group IV strain Pa5196 migrated more slowly than their predicted mass on SDS-polyacrylamide gels, suggesting that they were post-translationally modified (30). Using a combination of slide agglutination with specific antisera and PCR with serotype-specific primers, Pa5196 was determined to be serotype 011. To determine whether the pilins of Pa5196 were modified with the 011 O-antigen unit, similar to the paradigm for group I strains, the wbpM gene encoding a conserved dehydratase required for O-antigen biosynthesis (42, 43) was disrupted. While this mutation resulted in loss of the Pa5196 O antigen (Fig. 1A), pilins purified from wbpM knockout strain co-migrated with those of the Pa5196 parent strain (Fig. 1B), suggesting that they continued to be modified. Analysis of sheared pilin proteins by a fluorescent periodic acid/Schiff method confirmed that pilins from strains 1244 (group I), Pa5196 (group IV) and Pa5196 wbpMwGm, but not the unmodified pilins of strain PAK (group II), were glycosylated (Fig. 1B). Glycosylated pilins from Pa5196 were not recognized by the anti-011 sera (not shown), confirming that the glycan is not the O11 O unit.
Example 4. Fluorescent Glycoprotein Detection
[0061] Pilins from P. aeruginosa strain PAK (non-glycosylated), 1244
(glycosylated), Pa5196, and the Pa5196 wbpM mutant were separated on 15% SDS- PAGE gels as described above with the PTM Marker (Sigma) containing glycosylated and non-glycosylated protein standards. Glycosylated proteins were detected using the GlycoProfile III Fluorescent Glycoprotein Detection Kit (Sigma) as prescribed by the manufacturer and visualized on a UV transilluminator.
Example 5. Mass Spectrometry analysis of the intact pilin
[0062] All mass spectra were acquired on a Q-TOF 2-hybrid quadrupole time of flight mass spectrometer (Waters). The dialyzed pilin solution was diluted 1:1 with
deionized water and infused at 1 μL/min into the electrospray ionization source. Protein mass spectra were recorded in the range of m/z 800 to 3000. The protein molecular weight profile was generated from the spectra using MaxEnt™(Waters).
[0063] As the pilin appeared to be modified with a novel glycan, its mass was determined by ESI-MS (Fig. 2). Multiple peaks ranging in mass from 16,584 to 17,244 Da were observed, larger than the predicted 15,109 Da mass of the mature pilin. The peaks were separated by exactly 132 Da, the mass of a pentose sugar residue, suggesting that the glycan modification(s) was composed entirely of pentoses. Top-down MS/MS analysis on the multiply charged ions of the pilin protein was performed (44) but no carbohydrate-related fragment ions were observed, likely because pentose sugars are neutral and do not easily hold a charge during the fragmentation process.
Example 6. Enzymatic digestion and nanoLC-MS/MS analysis of the pilin [0064] Pilin proteins were separated from contaminating flagellins by 12%
SDS-PAGE. Pilins were excised from the gels and destained using 100 mM ammonium bicarbonate in 30% acetonitrile. The destained gel pieces were washed extensively with deionized water, then dehydrated with acetonitrile. To reduce and block Cys residues, gel pieces were re-hydrated by the addition of 1OmM dithiothreitol (DTT) in 5OmM NH4HCO3, pH 8.5, incubated 1 hr at 56°C, washed once with 5OmM NH4HCO3, and incubated 1 hr in the dark at room temperature with 55mM iodoacetamide in 5OmM NH4HCO3. Alkylated proteins were in-gel digested overnight at 370C with 200ng of trypsin (Promega) or chymotrypsin (Sigma) in 100μL of 5OmM NH4HCO3. In some instances the bands were doubly digested by adding trypsin after chymotryptic digestion (same ratio) and repeating the overnight incubation. In addition, tryptic digestion was carried out on 20μg of the original pilin extract, without the reduction/alkylation step using the same incubation conditions.
[0065] NanoLC-MS/MS analysis was performed using a CapLC nanoHPLC system (Waters) coupled to the Q-TOF2 mass spectrometer. Approximately 0.2 μg of each proteolytic digest was resolved on a 75μm-inner diameter x 150mm lnertsil ODS 3, 5μm nano-HPLC column (Dionex/LC Packings, Sunnyvale, CA) using the following gradient conditions: 5-60% acetonitrile, 0.2% formic acid in 30 min; 60- 90% in 5 min. The mass spectrometer was set for automatic data-dependant MS/MS
spectra acquisition on doubly, triply, and quadruply charged ions. All MS/MS spectra were examined manually for the presence of unusual modifications.
[0066] NanoLC-MS/MS analysis was performed on a pilin tryptic digest and two glycopeptide MS/MS spectra are presented in Fig. 3. In both cases it was possible to identify the peptide sequence from the b and y peptide fragment ions in the MS/MS spectra (55NAWPTLVAPTATPGAGQLNATLVGK79 (SEQ. ID. NO. 3) and 80YSSVDSTIASGYPNGQITVTMTQGK104 (SEQ. ID. NO. 4), respectively). A series of ions corresponding to the sequential neutral loss of 132 Da were observed in the high m/z region of both MS/MS spectra, mirroring the glycoform pattern observed for the intact pilin. Furthermore, oxonium ions corresponding to 1 and 2 pentoses were observed at m/z 133 and 265, respectively, suggesting that the peptides were modified with glycan polymers consisting of 2 or more pentoses. The difference between the predicted and observed mass of the T55'79 and τ80"104 glycopeptides (Fig. 3A and B) corresponds to exactly 6 pentoses. MS/MS spectra were obtained for other glycoforms of these peptides (highlighted in the insets of Figure 3A and B), corresponding to the addition of 5-7 pentoses and occasionally as many as eight.
[0067] Analysis of all proteolytic digests (tryptic, chymotryptic and doubly digested) by nanoLC-MS/MS detected peptides/glycopeptides covering approximately 90% of the mature pilin protein was performed (Fig. 3C). Peptides from the C-terminal region of the pilin protein were detected only after the two disulfide-bonded Cys123 and Cys147 residues (14) were reduced and alkylated prior to proteolytic digestion. In every case, the only glycopeptides that were detected originated from the same region of the pilin covered by the two tryptic peptides described above. One of the chymotryptic peptides observed, 73NATLVGKY80 (SEQ. ID. NO. 5), overlaps the sequence of the T55'79 tryptic glycopeptide (Fig. 3C) but was itself not modified. Therefore, as the only possible site of N-linkage is unoccupied, the glycans must be O-linked to Ser or Thr residues.
Example 7. Fractionation of the enzymatic digests and analysis by nanoelectrosprav ionization - mass spectrometry (nESI-MS)
[0068] Approximately 10μg of each protein digest was loaded on 20μL of
OligoR3 resin (Applied Biosystems) packed into a gel loader tip in the manner described by Stensballe and coworkers (60). The peptides and glycopeptides were
step-eluted from the resin by the sequential addition of 0-50% aqueous acetonitrile in increments of 5%. Each fraction was diluted 1 :1 with 50% methanol and 0.2% formic acid prior to loading into a Picotip Econo12 nano-emitter tip (New Objective, Woburn, MA). The fractions were screened for glycopeptides by nESI-MS/MS. The glycopeptides were further interrogated by nESI-MS/MS with front-end collision induced dissociation (nESI-feCID-MS/MS) as described previously (61).
[0069] To further identify the site of pilin modification, tryptic peptides were screened by nESI-MS and the T55"79 glycopeptide was selected for further study by nESI-MS/MS with front-end collision induced dissociation (nESI-feCID-MS/MS). By increasing the orifice voltage from 30V to 80V, the glycopeptides were fragmented by feCID, and the doubly protonated fragment ion at m/z 1292.8, composed of the T55"79 peptide plus one pentose modification, was then analyzed by MS/MS (Fig. 4). A series of y fragment ions bearing the pentose modification were observed in the upper m/z region of this MS/MS spectrum, including Thr64 and Thr66 but not Thr59; therefore, the site of O-linkage in this peptide is either Thr64 and/or Thr66 (Figure 4). At this time, we are unable to determine which of these two sites (or a mixture of both) is occupied. While the adjacent T80'104 peptide is clearly glycosylated based on the data in Figure 3B, it proved difficult to obtain sufficient material for accurate nESI- feCID-MS/MS analysis.
Example 8. Glvcan purification for NMR analysis
[0070] Intact pilin samples were digested overnight at 370C with Proteinase K
(50:1 ratio of pilin to enzyme) in the presence of 2mM CaCb- An additional aliquot of Proteinase K was added (same ratio) and the sample was incubated at 370C for a further 24 hr. The final digest was applied in turn to a Biogel P4 and a P2 size exclusion column (Bio-Rad) as described previously (62). The eluate from the P2 column was collected in 2.5 ml_ fractions that were concentrated to 20 μL and analyzed by nanoESI-MS/MS as described above. Glycan-containing fractions were pooled and analyzed by NMR.
Example 9. NMR analysis of the pilin glvcan
[0071] Approximately 160 μg of column-purified pilin glycan was dissolved in
200 μL of D2O. NMR experiments were carried out at 250C on a Varian INOVA spectrometer operating at 600 MHz, using a cryogenically cooled probe (Varian
Associates Inc., Palo Alto, CA). Standard two-dimensional homonuclear (COSY, TOCSY and NOESY) and 1H-13C heteronuclear (HSQC and HMBC) spectra were acquired as described previously (63. 1H and 13C chemical shifts were referenced with respect to the methyl group of an internal acetone standard, appearing at 2.225 and 31.1 ppm, respectively. NMR data were processed using the software package TOPSPIN (Bruker Biospin, Billerica, MA).
[0072] NMR characterization of the pilin glycan from P. aeruginosa demonstrated that it is composed of a repeating α(1→5) unit of arabinofuranose (Araf). A 1D 1H spectrum of the glycan shows the presence of a major peak in the anomeric region at ~ 5.08 ppm (Fig. 5A). Anomeric protons from at least two distinct pentose units give rise to this peak (residues a and b in Table 1). The first corresponds to a terminal αAraf moiety (residue a), whereas the second corresponds to a sub-terminal αAraf unit that is glycosidically linked at the C5 position (residue b). A 1H-13C HSQC spectrum (Fig. 5B) clearly shows that the H5 protons from residue b are shifted downfield in the carbon dimension compared to those from residue a as a result of its participation in a glycosidic bond at C5. Through the acquisition of a 1H- 13C HMBC spectrum, the inter-glycosidic linkage pattern was determined, and we also confirmed that the glycan is O-linked to the pilin peptide fragments via C1 of αAraf. In support of our structural characterization of the glycan, the 13C chemical shift assignments for the αAraf units closely match values that have been previously reported for this monosaccharide (45).
[0073] There were further resonances in the spectra of the pilin glycan, likely belonging to additional αAraf units, but their intensity was significantly weaker than those of residues a and b. For instance, in the 1 D 1H spectrum (Fig. 5A), there is a minor peak at 5.13 ppm corresponding to the anomeric proton of a C5-linked αAraf moiety. The chemical shift of resonances for any given αAraf unit within an oligo- αAraf structure can change slightly depending on its position within the molecule, and the peak intensity will correspond to its relative population within the sample. The observation of αAraf units that give rise to weak peaks in the NMR spectra is reflective of the heterogeneity in the ensemble of pilin-linked oligosaccharides, which have variable numbers of repeating units as determined by MS analysis.
Example 10. Determination of the enantiomeric form of the glvcan by GC-MS
[0074] Both the pilin carbohydrate sample used for NMR analysis and 0.5 mg of D-Ara were derivatized according to the following protocol (64). The carbohydrates were lyophilized and dissolved in 200 μl_ of R-2-butanol plus 30 μl_ of acetyl chloride. The samples were incubated for 3 hr at 100°C and the solvents evaporated under a nitrogen stream. The dried samples were treated with 200 μl_ of pyridine plus 200 μl_ of acetic anhydride for 2 hr at 1000C and the solvents evaporated under a nitrogen stream. The samples were cleaned twice by addition and evaporation of toluene (0.5mL). A second batch of D-Ara was derivatized in a similar manner using a racemic mixture of R,S-2-butanol instead of R-2-butanol. The acetylated samples were dissolved by 50-200 μl_ of methylene chloride for GC-MS analysis on a Varian 3800 gas chromatography system coupled with a Saturn 2000 ion trap mass spectrometer operating in electron impact ionization mode. The analysis conditions were as follows: 2-3 μl_ injection, 1/25 split, inlet temperature 265°C; column DB 17MS, 30 m x 250 μm, 25 μm film thickness (Agilent, Palo Alto, CA), helium flow 1 mL/min; starting oven temperature 1800C, rising at 3.5°C/min to 260°C, then rising at 70°C/min to 280°C. The MS acquisition range was 40 to 650 m/z.
[0075] To determine whether the pilin glycan contained the L- or D-enantiomer of Araf, GC-MS spectra of D-Araf modified with R-2-butanol and with racemic R.S-2- butanol were acquired. Analysis of the alkylated Araf purified from the Pa5196 pilins gave a GC-MS spectrum similar to the alkylated R-2-butanol-D-Araf (not shown), confirming that the pilins are modified with D-Araf-containing oligosaccharides.
Example 11. Immunogenic identity of the Pa5196 pilin glycan and Mycobacterium cell envelope.
[0076] Sheared surface preparations of P. aeruginosa strains (containing pili and flagella) were separated on a 15% SDS-PA gel (left) with a whole cell lysate of M. smegmatis (M.sm). A duplicate gel was blotted to nitrocellulose and reacted with antibodies raised against M. tuberculosis LAM (center) or against Pa5196 pilins (with some flagellin contaminants; right). Strain 1244 is a group 1 strain, strain PAK is a group 2 strain. The results are shown in Figure 6 (top). The anti-LAM antisera recognizes the Pa5196 pilins but not its flagellins nor the pilins of 1244 or PAK. The Pa5196 antiserum recognizes the PAK pilin and flagellin, as well as the material
corresponding to LAM and arabinogalactan in M. smegmatis, which runs as a smear in the 20-30 kDA range. The band marked with an asterisk is the pilin of Pa5196, while the band below is a cross-reacting contaminant that was also present in the preimmune sear of this rabbit (not shown).
[0077] Figure 6 (bottom) is western bolt of a sheared surface preparation from strain PA7 that shows that its pilins react with both the anti-LAM antisera (center) and Pa5196 antisera (right). PA 7 makes far fewer pili than Pa5196 although similar amounts of flagella are present in both strains as seen on the SDS-PA gel, left. The reduced level of piliation is reflected in lower twitching motility (far right). The control PAO1 pilins are not recognized by either sear, although a faint cross-reaction with the flagellin can be seen in the anti-Pa5196 panel.
Table 1 : 1H and 13C chemical shift assignments for the two αAraf monomers that give rise to the dominant peaks in the NMR spectra of the pilin-associated glycan from P. aeruginosa.
Residue Atom Type δH (ppm) δC (ppm)
a 1 CH 5.08 108.3
2 CH 4.13 81.7
3 CH 3.95 77.3
4 CH 4.09 84.8
5 CH2 3.71 , 3.83 62.0
→5) b 1 CH 5.09 108.3
2 CH 4.13 81.7
3 CH 4.01 77.5
4 CH 4.21 83.1
5 CH2 3.80, 3.88 67.6
References
1. Daffe, M., McNeil, M. & Brennan, P. J. (1993) Carbohydr. Res. 249, 383-398.
2. Daffe, M., Brennan, P. J. & McNeil, M. (1990) J. Biol. Chem. 265, 6734-6743.
3. Brennan, P. J. (2003) Tuberculosis (Edinb) 83, 91-97.
4. Belanger, A. E., Besra, G. S., Ford, M. E., Mikusova, K., Belisle, J. T., Brennan, P. J. & Inamine, J. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11919-11924.
5. Myers, J. P. (2005) Curr. Opin. Infect. Dis. 18, 133-140.
6. Jogi, R. & Tyring, S. K. (2004) Dermatol. Ther. 17, 491-498.
7. Coleman, F. T., Mueschenborn, S., Meluleni, G., Ray, C, Carey, V. J., Vargas, S. O., Cannon, C. L., Ausubel, F. M. & Pier, G. B. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 1949-1954.
8. Costerton, J. W., Stewart, P. S. & Greenberg, E. P. (1999) Science 284, 1318- 1322.
9. Lyczak, J. B., Cannon, C. L. & Pier, G. B. (2000) Microbes Infect. 2, 1051-1060.
10. Lam, J., Chan, R., Lam, K. & Costerton, J. W. (1980) Infect. Immun. 28, 546-556.
11. Burrows, L. L. (2005) MoI. Microbiol. 57, 878-888.
12. Doig, P., Todd, T., Sastry, P. A., Lee, K. K., Hodges, R. S., Paranchych, W. & Irvin, R. T. (1988) Infect. Immun. 56, 1641-1646.
13. Giltner, C. L., van Schaik, E. J., Audette, G. F., Kao, D., Hodges, R. S., Hassett, D. J. & Irvin, R. T. (2006) MoI. Microbiol. 59, 1083-1096.
14. Lee, K. K., Sheth, H. B., Wong, W. Y., Sherburne, R., Paranchych, W., Hodges, R. S., Lingwood, C. A., Krivan, H. & Irvin, R. T. (1994) MoI. Microbiol. 11 , 705-713.
15. Saiman, L. & Prince, A. (1993) J. CHn. Invest. 92, 1875-1880.
16. Mattick, J. S. (2002) Annu. Rev. Microbiol. 56, 289-314.
17. O'Toole, G. A. & Kolter, R. (1998) MoI. Microbiol. 30, 295-304.
18. Strom, M. S. & Lory, S. (1986) J. Bacteriol. 165, 367-372.
19. Strom, M. S. & Lory, S. (1993) Annu. Rev. Microbiol. 47, 565-596.
20. Lu, H. M., Motley, S. T. & Lory, S. (1997) MoI. Microbiol. 25, 247-259.
21. Hood, B. L. & Hirschberg, R. (1995) Infect. Immun. 63, 3693-3696.
22. Thelin, K. H. & Taylor, R. K. (1996) Infect. Immun. 64, 2853-2856.
23. Tobe, T. & Sasakawa, C. (2002) Ce//. Microbiol. 4, 29-42.
24. Lepper, A. W., Atwell, J. L., Lehrbach, P. R., Schwartzkoff, C. L., Egerton, J. R. & Tennent, J. M. (1995) Vet. Microbiol. 45, 129-138.
25. Kennan, R. M., Dhungyel, O. P., Whittington, R. J., Egerton, J. R. & Rood, J. I. (2001 ) J. Bacteriol. 183, 4451-4458.
26. Liu, H., Kang, Y., Genin, S., Schell, M. A. & Denny, T. P. (2001 ) Microbiology 147, 3215-3229.
27. Hazes, B., Sastry, P. A., Hayakawa, K., Read, R. J. & Irvin, R. T. (2000) J. MoI. Biol. 299, 1005-1017.
28. Parge, H. E., Forest, K. T., Hickey, M. J., Christensen, D. A., Getzoff, E. D. & Tainer, J. A. (1995) Nature 378, 32-38.
29. Craig, L., Taylor, R. K., Pique, M. E., Adair, B. D., Arvai, A. S., Singh, M., Lloyd, S. J., Shin, D. S., Getzoff, E. D. & Yeager, M., et al. (2003) MoI. Cell 11 , 1 139-1150.
30. Kus, J. V., TuIMs, E., Cvitkovitch, D. G. & Burrows, L. L. (2004) Microbiology 150, 1315-1326.
31. Castric, P., Cassels, F. J. & Carlson, R. W. (2001 ) J. Biol. Chem. 276, 26479- 26485.
32. Castric, P. (1995) Microbiology 141 ( Pt 5), 1247-1254.
33. Comer, J. E., Marshall, M. A., Blanch, V. J., Deal, C. D. & Castric, P. (2002) Infect. Immun. 70, 2837-2845.
34. Benz, I. & Schmidt, M. A. (2002) MoI. Microbiol. 45, 267-276.
35. Forest, K. T., Dunham, S. A., Koomey, M. & Tainer, J. A. (1999) MoI. Microbiol. 31, 743-752.
36. Stimson, E., Virji, M., Barker, S., Panico, M., Blench, I., Saunders, J., Payne, G., Moxon, E. R., Dell, A. & Morris, H. R. (1996) Biochem. J. 316 ( Pt 1 ), 29-33.
37. Stimson, E., Virji, M., Makepeace, K., Dell, A., Morris, H. R., Payne, G., Saunders, J. R., Jennings, M. P., Barker, S. & Panico, M. (1995) MoI. Microbiol. 17, 1201 -1214.
38. Marceau, M. & Nassif, X. (1999) J. Bacteriol. 181 , 656-661.
39. Marceau, M., Forest, K., Beretti, J. L., Tainer, J. & Nassif, X. (1998) MoI. Microbiol. 27, 705-715.
40. Smedley, J. G. ,3rd, Jewell, E., Roguskie, J., Horzempa, J., Syboldt, A., Stolz, D. B. & Castric, P. (2005) Infect. Immun. 73, 7922-7931.
41. DiGiandomenico, A., Matewish, M. J., Bisaillon, A., Stehle, J. R., Lam, J. S. & Castric, P. (2002) MoI. Microbiol. 46, 519-530.
42. Burrows, L. L., Urbanic, R. V. & Lam, J. S. (2000) Infect. Immun. 68, 931-936.
43. Dean, C. R., Franklund, C. V., Retief, J. D., Coyne, M. J. ,Jr, Hatano, K., Evans, D. J., Pier, G. B. & Goldberg, J. B. (1999) J. Bacteriol. 181 , 4275-4284.
44. Schirm, M., Schoenhofen, I. C, Logan, S. M., Waldron, K. C. & Thibault, P. (2005) Anal. Chem. 77, 7774-7782.
45. Bock, K., Arnarp, J. & Lonngren, J. (1982) Eur. J. Biochem. 129, 171-178.
46. Craig, L., Pique, M. E. & Tainer, J. A. (2004) Nat. Rev. Microbiol. 2, 363-378.
47. Horzempa, J., Comer, J. E., Davis, S. A. & Castric, P. (2006) J. Biol. Chem. 281 , 1128-1136.
48. Gerwig, G. J., Kamerling, J. P., Vliegenthart, J. F., Morag, E., Lamed, R. & Bayer, E. A. (1993) J. Biol. Chem. 268, 26956-26960.
49. Rick, P. D. & Osborn, M. J. (1972) Proc. Natl. Acad. Sci. U. S. A. 69, 3756-3760.
50. Gunn, J. S. (2001 ) J. Endotoxin Res. 7, 57-62.
51. Galbraith, L. & Wilkinson, S. G. (2000) Carbohydr. Res. 323, 98-102.
52. Mergaert, P., Van Montagu, M., Prome, J. C. & Holsters, M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1551-1555.
53. Mikusova, K., Huang, H., Yagi, T., Holsters, M., Vereecke, D., D'Haeze, W., Scherman, M. S., Brennan, P. J., McNeil, M. R. & Crick, D. C. (2005) J. Bacteriol. 187, 8020-8025.
54. Ojeniyi, B., Lam, J. S., Hoiby, N. & Rosdahl, V. T. (1989) APMIS 97, 631-636.
55. Raymond, C. K., Sims, E. H., Kas, A., Spencer, D. H., Kutyavin, T. V., Ivey, R. G., Zhou, Y., Kaul, R., Clendenning, J. B. & Olson, M. V. (2002) J. Bacteriol. 184, 3614-3622.
56. Burrows, L. L., Charter, D. F. & Lam, J. S. (1996) MoI. Microbiol. 22, 481-495.
57. Creuzenet, C. & Lam, J. S. (2001) MoI. Microbiol. 41 , 1295-1310.
58. Hoang, T. T., Karkhoff-Schweizer, R. R., Kutchma, A. J. & Schweizer, H. P. (1998) Gene 212, 77-86.
59. Choi, K. H., Kumar, A. & Schweizer, H. P. (2006) J. Microbiol. Methods 64, 391- 397.
60. Stensballe, A., Andersen, S. & Jensen, O. N. (2001 ) Proteomics 1 , 207-222.
61. Voisin, S., Houliston, R. S., Kelly, J., Brisson, J. R., Watson, D., Bardy, S. L., Jarrell, K. F. & Logan, S. M. (2005) J. Biol. Chem. 280, 16586-16593.
62. Young, N. M., Brisson, J. R., Kelly, J., Watson, D. C, Tessier, L., Lanthier, P. H., Jarrell, H. C, Cadotte, N., St Michael, F. & Aberg, E., et al. (2002) J. Biol. Chem. 277, 42530-42539.
63. Gilbert, M., Brisson, J. R., Karwaski, M. F., Michniewicz, J., Cunningham, A. M., Wu, Y., Young, N. M. & Wakarchuk, W. W. (2000) J. Biol. Chem. 275, 3896-3906.
64. Vinogradov, E. V., Hoist, O., Thomas-Oates, J. E., Broady, K. W. & Brade, H. (1992) Eur. J. Biochem. 210, 491-498.
Claims
1. A isolated pilin glycoprotein from a Group 4 Pseudomomans aeruginosa strain characterized in that it is modified with a D-arabinofuranose glycan.
2. A glycoprotein according to claim 1 wherein the Group 4 strain is Pa5196.
3. A glycoprotein according to claim 1 that is modified with a α-1,5-linked D- arabinofuranose glycan.
4. The glycan portion of a glycoprotein as defined in any one of claims 1-3.
5. A glycopeptide according to claim 2 comprising an amino acid sequence seleceted from the group consisting of SEQ. ID. NO. 3, SEQ. ID NO. 4, SEQ ID. NO. 5 and SEQ. ID NO. 6.
6. An immunogenic composition comprising a glycan or glycopeptide from a Group 4 Pseudomonas aeruginosa pilin and an excipient.
7. An immunogenic composition according to claim 6 wherein the glycan is α-1 ,5- linked D-arabinofuranose.
8. An immunogenic composition according to claim 6 further comprising an adjuvant.
9. Use of an immunogenic composition as defined in claim 6 to generate an antibody that is reactive to the glycan.
10. An antibody that specifically reacts with a glycan from a Group 4 Pseudomonas aeruginosa pilin protein.
11. An antibody according to claim 10 that is a monoclonal antibody.
12. An antibody according to claim 11 wherein the monoclonal antibody specifically recognizes α-1 ,5-linked D-arabinofuranose.
13. A method of diagnosing a Group 4 Pseudomonas aeruginosa infection comprising reacting a test sample with an antibody as defined in claim 12, wherein specific binding of the antibody to a component in the sample is indicative of infection.
14. A method of diagnosing a mycobacterial infection comprising reacting a test sample with an antibody as defined in claim 12, wherein specific binding of the antibody to a component in the sample is indicative of infection.
15. A method according to claim 14 wherein the mycobacterial infection is caused by a pathogen selected from the group consisting of M. tuberculosis, M. leprae and M. avium.
16. A method according to claim 15 wherein the pathogen is M. tuberculosis.
17. A method according to claim 15 wherein the pathogen in M. leprae.
18. A method according to claim 15 wherein the pathogen is M. avium.
19. A vaccine for immunizing a human subject against a mycobacterial infection, said vaccine comprising an effective amount of an antigen consisting essentially of a glycan or glycopeptide from a Group 4 Pseudomonas aeruginosa pilin and a pharmaceutically acceptable carrier.
20. A vaccine according to claim 19 wherein the antigen is α-1,5-linked D- arabinofuranose.
21. A vaccine according to claim 19 wherein the antigen is a pilin protein subunit from strain Pa5196.
22. A method for immunizing a human subject for the prevention or treatment of a mycobacterial infection, said method comprising administering a vaccine as defined in any one of claims 19 to 21.
23. A method according to claim 22 wherein the vaccine is formulated for parenteral administration.
24. A method according to claim 22 wherein the vaccine is formulated for mucosal delivery.
25. An assay for the diagnosis of a Group 4 Pseudomonas aeruginosa infection or a mycobacterial infection, said assay comprising obtaining a biological sample and determining the amount of binding of an antibody that specifically binds to α-1 ,5- linked D-arabinofuranose to the sample.
26. A kit for the diagnosis of a Group 4 Pseudomonas aeruginosa infection or a mycobacterial infection, said kit comprising an antibody that specifically binds to α- 1 ,5-linked D-arabinofuranose, a control source of α-1 ,5-linked D-arabinofuranose and a secondary labelled antibody.
27. An immunogenic composition comprising a protein responsible for attachment of α-1 ,5-linked D-arabinofuranose to a peptide.
28. An inhibitor of a protein responsible for attachment of α-1 ,5-linked D- arabinofuranose to a peptide.
29. An inhibitor according to claim 28 wherein the protein is encoded by tfpW.
30. An inhibitor according to claim 28 wherein the protein is encoded by tfpX.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002547136A CA2547136A1 (en) | 2006-05-09 | 2006-05-09 | Novel strain of pseudomonas aeruginosa and related therapeutic components |
| CA2547136 | 2006-05-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2007128136A1 true WO2007128136A1 (en) | 2007-11-15 |
Family
ID=38663468
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2007/000849 Ceased WO2007128136A1 (en) | 2006-05-09 | 2007-05-09 | A novel pilin glycoprotein from a group 4 pseudomonas aeruginosa strain |
Country Status (2)
| Country | Link |
|---|---|
| CA (1) | CA2547136A1 (en) |
| WO (1) | WO2007128136A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010022462A3 (en) * | 2008-08-28 | 2010-04-29 | The University Of Queensland | Mutant bacterial glycoproteins and uses thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105287622B (en) * | 2015-10-23 | 2019-05-17 | 陕西省微生物研究所 | The method, target and application of NO accumulation to reduce the invasiveness of Pseudomonas aeruginosa |
-
2006
- 2006-05-09 CA CA002547136A patent/CA2547136A1/en not_active Abandoned
-
2007
- 2007-05-09 WO PCT/CA2007/000849 patent/WO2007128136A1/en not_active Ceased
Non-Patent Citations (6)
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010022462A3 (en) * | 2008-08-28 | 2010-04-29 | The University Of Queensland | Mutant bacterial glycoproteins and uses thereof |
| US9150621B2 (en) | 2008-08-28 | 2015-10-06 | The University Of Queensland | Mutant bacterial glycoproteins and uses thereof |
| AU2009287339B2 (en) * | 2008-08-28 | 2015-11-26 | The University Of Queensland | Mutant bacterial glycoproteins and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2547136A1 (en) | 2007-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1527080B1 (en) | Campylobacter glycans and glycopeptides | |
| Young et al. | Structure of the N-linked glycan present on multiple glycoproteins in the Gram-negative bacterium, Campylobacter jejuni | |
| Manning et al. | Molecular basis for O‐antigen biosynthesis in Vibrio cholerae O1: Ogawa‐Inaba switching | |
| Gilbert et al. | Heterologous expression of an immunogenic pneumococcal type 3 capsular polysaccharide in Lactococcus lactis | |
| Twine et al. | Flagellar glycosylation in Clostridium botulinum | |
| Posch et al. | Characterization and scope of S-layer protein O-glycosylation in Tannerella forsythia | |
| Harper et al. | A heptosyltransferase mutant of Pasteurella multocida produces a truncated lipopolysaccharide structure and is attenuated in virulence | |
| KR20150054800A (en) | Bioconjugates comprising modified antigens and uses thereof | |
| Gibson et al. | Characterization of a transposon Tn916-generated mutant of Haemophilus ducreyi 35000 defective in lipooligosaccharide biosynthesis | |
| Banerjee et al. | Implications of phase variation of a gene (pgtA) encoding a pilin galactosyl transferase in gonococcal pathogenesis | |
| Post et al. | Intracellular survival of Neisseria gonorrhoeae in male urethral epithelial cells: importance of a hexaacyl lipid A | |
| JP2014529396A (en) | Pasteurella vaccine | |
| Gallagher et al. | Glycosylation of the Arg-gingipains of Porphyromonas gingivalis and comparison with glycoconjugate structure and synthesis in other bacteria | |
| WO2007128136A1 (en) | A novel pilin glycoprotein from a group 4 pseudomonas aeruginosa strain | |
| AU5023500A (en) | Production of complex carbohydrates | |
| US7807181B2 (en) | Neisseria mutants, lipooligosaccharides and immunogenic compositions | |
| EP3215226A1 (en) | Synthetic antigen constructs against campylobacter jejuni | |
| EP1313771B1 (en) | Haemophilus influenzae lipopolysaccharide inner-core oligosaccharide epitopes as vaccines for the prevention of haemophilus influenzae infections | |
| US10364298B2 (en) | Clostridium difficile lipoteichoic acid and uses thereof | |
| EP1747262B1 (en) | Conserved inner core lipopolysaccharide epitopes as multi-species vaccine candidates | |
| JANN et al. | The O18 antigens (lipopolysaccharides) of Escherichia coli: Structural characterization of the O18A, O18A1, O18B and O18B1‐specific polysaccharides | |
| CN101014698A (en) | Conserved core lipopolysaccharide epitopes as diverse vaccine candidates | |
| Kelly et al. | Pseudomonas aeruginosa Glycosylation of | |
| WO2020249737A1 (en) | Rhamnose-polysaccharides | |
| Lukasiewicz et al. | Comparison of serological specificity of anti-endotoxin sera directed against whole bacterial cells and core oligosaccharide of Escherichia coli J5-tetanus toxoid conjugate*. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07719771 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 07719771 Country of ref document: EP Kind code of ref document: A1 |