WO2007124452A2 - Methods for expressing multiple sirna and shrna from a single vector - Google Patents
Methods for expressing multiple sirna and shrna from a single vector Download PDFInfo
- Publication number
- WO2007124452A2 WO2007124452A2 PCT/US2007/067138 US2007067138W WO2007124452A2 WO 2007124452 A2 WO2007124452 A2 WO 2007124452A2 US 2007067138 W US2007067138 W US 2007067138W WO 2007124452 A2 WO2007124452 A2 WO 2007124452A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- expression cassette
- gene
- sirna
- expression
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y502/00—Cis-trans-isomerases (5.2)
- C12Y502/01—Cis-trans-Isomerases (5.2.1)
- C12Y502/01008—Peptidylprolyl isomerase (5.2.1.8), i.e. cyclophilin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/20—Vector systems having a special element relevant for transcription transcription of more than one cistron
- C12N2830/205—Vector systems having a special element relevant for transcription transcription of more than one cistron bidirectional
Definitions
- RNA interference also called “RNA-mediated interference", abbreviated RNAi
- RNAi RNA-mediated interference
- RNAi pathway has evolved as a efficient mechanism of post-transcriptional gene silencing, associated with the regulation of developmental genes, genomic maintenance, and as a defense system against viral infection (Hamilton and Baulcombe 1999, Harmon 2002, He and Hannon 2004, Martinez et al. 2002, and McManus et al. 2002).
- RNAi pathway is initiated by the presence of double-stranded RNA (dsRNA) in the cell, which is cleaved into short double-stranded fragments of ⁇ 20 base pairs by the cytoplasmic Dicer (Kim et al. 2005, and Myers et al. 2003).
- dsRNA double-stranded RNA
- One of the two strands of each fragment known as the guide strand, is then incorporated into the RNA-induced silencing complex (RISC) that can induce cleavage of any mRNA capable of pairring with the RNA strand of the RISC (Dykxhoorn et al. 2003, Martinez et al. 2002, Meister and Tuschl 2004, and Yi et al. 2003).
- RISC RNA-induced silencing complex
- dsRNAs longer than 150bp can induce nonspecific gene silencing and apoptosis in mammalian cells due to the activation of the interferon and protein kinase K pathways (Bridge et al. 2003, and Jackson et al. 2003).
- introduction of 19-29b ⁇ dsRNA fragments into cells can in fact down-regulate or knock-out the expression of a specific gene without the complication of non-specific effects (Martinez et al. 2002).
- siRNA-expression plasmids or viral vectors (shRNA) from pol III promoters were subsequently shown to be as effective as synthetic siRNAs in the down-regulation of target mRNA and protein amounts (Kasim et al. 2004, and Paddison et al. 2002).
- shRNA viral vectors
- the rapid development of this method has made it technically possible to knock-down almost any known gene in an applicable organism (Castanotto et al. 2002, and Scherer and Rossi 2004).
- the pol III promoter is so far the most widely used promoter for vector-based siRNA silencing (Bridge et al. 2003, and Tran et al. 2003).
- genetically modified pol ⁇ promoters including promoters with tissue specificity and inducibility with small compounds like Tet, have also been found to be applicable to drive siRNA expression within different vector formats and compositions (Calegari et al. 2002, Caplen et al. 2001, Yuan et al. 2006, Briese et al. 2006, Ristevski 2005, Zeng et al. 2005, and Paddison et al. 2002).
- siRNA and shRNA sequences are equally potent in inducing the target gene's silencing (Berns et al. 2004, Dykxhoorn et al. 2003, Harmon 2002, and Mittal 2004).
- a number of algorithm-based softwares for designing siRNAs and shRNAs have been developed by scientists of academia and the bio tech industry. These are based on the best available knowledge of the silencing mechanisms of Dicer and RISC. Still, it is has been shown that the success rate of selecting a potent target site with over 70% gene silencing effects is generally around 25% (Dykxhoorn et al. 2003, and Tran et al. 2003).
- mutiple siRNAs or shRNAs have to be delivered to a specific target cell or organism for the alteration of its specific function or phenotype. Accordingly, development of a single vector (plasmid or viral) capable of expressing mutiple target siRNA and/or shRNAs would be applicable for the above said applications, including gene silencing of specific gene or one set of genes associated with a particular function, pathway, and phenotype. The present invections provides these and other applications. The applications for the multiple siRNA and shRNA delivery could be used in bioscience research, and for the development of novel therapeutic modalities.
- siRNAs and shRNAs Silencing of gene expression by siRNAs and shRNAs has become a powerful tool for functional genomic and therapeutic applications (McManus et al. 2002, Meister and Tuschl 2004, and U.S. Pat. No. 7,078,196).
- siRNAs and shRNAs are equally potent in the efficiency of target gene down regulation.
- about one out of four siRNAs and shRNAs designed with available algorithms can have the ability to knock-down target genes at 70% or more efficiency. This compromises many applications that require 90-95% specific gene down regulation to cause an affect.
- a single vector with the capability of delivering multi siRNAs and shRNAs would be advantageous.
- the pMultiRNAi developed here allows for the expression of 2, 3, 4, 5, 6, 7, 8 , or more identical or different siRNAs and shRNAs from a single vector.
- Each of the multiple siRNAs and shRNAs are cloned down stream of functional promoters, which could be arrayed at the different orientations, namely sequencial, divergent, and convengent configeration within a vector.
- functional promoters which could be arrayed at the different orientations, namely sequencial, divergent, and convengent configeration within a vector.
- RNA polymerase III promoters are well known to one of skill in the art.
- a suitable range of RNA polymerase III promoters can be found, for example, in Paule and White (2000), which is hereby incorporated by reference in its entirety.
- the definition of RNA polymerase III promoters also include any synthetic or engineered DNA fragment that can direct RNA polymerase III to transcribe its downstream RNA coding sequences.
- the most well-documented pol ⁇ i promoters that have been used in shRNAs are Hl and U6 promoters of human, mouse, bovine and rat origin (Borchert et al. 2006, and Lambeth et al. 2006).
- promoters including type II polymerase promoters, modified polymerase II promoter, constitutive pol II promoters, tissue specific promoters, and inducible promoters are also applicable to the above said applications (Yuan et al. 2006, Briese et al. 2006, Ristevski 2005, Zeng et al. 2005, and Tiscornia et al. 2004).
- the Polymerase II promoter/enhancer may be any promoter, enhancer or promoter/enhancer combination known to increase expression of a gene with which it is in a functional relationship.
- a “functional relationship” and “operably linked” mean, without limitation, that the transgene or RNA coding region is in the correct location and orientation with respect to the promoter and/or enhancer that expression of the gene will be affected when the promoter and/or enhancer is contacted with the appropriate molecules.
- the modified polymerase II type promoters can be ubiquitous CMV viral promoter, adenoviral major later promoter, and SV40 early region promoters.
- the RNA polymerase II (Pol II) promoter or promoters used as part of the vector can be inducible. Any suitable inducible Pol II promoter can be used with the methods of the invention. Particularly suited Pol II promoters include the tetracycline responsive promoters provided in Ohkawa and Taira (2000), and in Meissner et al. (2001), which are incorporated herein by reference.
- the vector used to express multiple siRNA and shRNA incorporate viral and non- viral vectors.
- the viral construct is a nucleotide sequence that comprises sequences necessary for the production of recombinant viral particles in a packaging cell (U.S. Pat. No. 7,195,916 and 6,555,107).
- the viral construct additionally comprises target RNA coding sequences that allow for the desired expression of siRNAs and shRNAs in the host.
- the viral construct may incorporate sequences from the genome of any known organism (Allocca et al. 2006, Schepelmann and Springer 2006, Woo et al. 2006, Harrop et al. 2006, and Kanzaki and Looney 2004).
- the sequences may be incorporated in their native form or may be modified in any way.
- the sequences may comprise insertions, deletions or substitutions, hi a preferred embodiment, the viral construct comprises sequences from a lentiviras genome, such as the HIV genome or the SIV genome (Abbas-Terki et al. 2002).
- the viral construct comprises sequences of a murine stem cell virus (MSCV).
- adenoviral genome adeno associated genome
- FIV genome adeno associated genome
- baculoviral genome HSV genome as well as all different hybrids derived from said viral vectors (Glauser et al. 2006, Reynolds et al. 1999, Bilbao et al. 1997, and U.S. Pat. No. 6,485,976; 6,333,030; and 7,052,904).
- any plasmids with or without stable selection drug marker can be used for the expression of multiple siRNA and shRNA simultaneously.
- the multiple siRNAs and shRNAs can be expressed transiently, or stably expressed after corresponding drug selection such as G418, Puromycin, Zeocin or Hygromycin.
- the designed siRNA and shRNA coding sequences can be cloned into viral and non- viral vectors using any suitable genetic engineering technique well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, as described in Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, N. Y. (1989)), Coffin et al. (Retroviruses. Cold Spring Harbor Laboratory Press, N. Y. (1997)) and "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford University Press, (2000)).
- the target siRNA and shRNA sites can be cloned into vectors by nucleic acid fusion and exchange technologies currently known in the art, including, Gateway, PCR in fusion, Cre-lox P, and Creator.
- the vectors with cloned multiple siRNAs and shRNAs are used to transduce host cells and organisms by transfections or microinjection for non- viral vectors and infection for viral vectors.
- Commonly used transfection techniques include calcium phosphate, DEAE-dextran, electroporation and microinjection and viral methods (Graham and van der Eb 1973, McCutchan et al. 1968, Chu. et al 1987, Fraley et al. 1980, and Capecchi 1980).
- a recent addition to this arsenal of techniques for the introduction of DNA into cells is the use of cationic liposomes (Feigner et al. 1987).
- Commercially available cationic lipid formulations are Tfx 50 (Promega), Lipofectamin2000 (Life Technologies), and DNAfectin (Applied Biological Materials Inc.).
- recombinant viral vectors incorporated with multiple siRNA and shRNA are co-transfected into packaging cells or cell lines, along with elements required for the packaging of recombinant viral particles.
- Recombinant viral particles collected from transfected cell supernatant are used to infect target cells or organisms for the expression of multiple siRNAs and shRNAs.
- the transduced cells or organisms are used for transient siRNA and shRNA expression or selected for stable expression.
- the pMultiRNAi vector can be used to transduce a wide range of the cells and organisms that can support the expression of siRNAs and shRNAs.
- the host cells include, without limitation, primary cells, immortalized cells, embryonic stem cells, and tumour-derived cells.
- the siRNA and shRNA expression can be transient or stable in host cells for functional analysis, assay development or therapeutic applications.
- These organisms could be, without limitation, nematode C, elegans, insects, fruit flies, frogs, fishes, mice, rats, and humans with disease orders (Bridge et al. 2003, Caplen et al. 2001, and Yang et al. 2000).
- siRNAs and shRNAs can be expressed to target different sites of the same mRNA for synergistic effects as demonstrated in the knockdown of CypA gene expression in mouse pl9 cells (example 2).
- Four shRNAs targeting the CypA gene were expressed in mouse pl9 cells, each with knockdown efficiency less than 75%.
- simultaneous expression of all four shRNAs from a single vector gives a near complete knockdown of more than 98%.
- pMultiRNAi to knock down the expression of abundantly expressed genes, such as GAPDH and others, wherein the amount siRNA and shRNA expressed from a single promoter is not enough to silence the target gene's expression. Increased expression of the same siRNA and shRNA from multiple promoters would be able to achieve much higher efficiency in down regulating a specific gene.
- siRNAs and shRNAs can be designed and expressed with each targeting one site of a different gene (Example 4). This is especially applicable to functions associated with redundant or compensation conferred by other genes. Furthermore, in the case of a virus like HIV or Influenza, where mutations in their key genes frequently occur, multiple siRNA and shRNA can be designed to target different possible mutant sequences.
- RNA-mediated interference can provide a direct causal links between specific genes and observed loss-of-function (LOF) phenotypes (Downward 2004, and Schwarz et al. 2003).
- the method of invention can be used for determining the function of a gene in a cell or organism, or even for modulating the function of a gene capable of mediating RNA interference.
- the cell is preferably a eukaryotic cell or a cell line (e.g. a plant cell or an animal cell, such as a mammalian cell, an embryonic cell, a pluripotent stem cell, a tumour cell, a teratocarcinoma cell or a virus-infected cell.
- the organism is preferably a eukaryotic organism, a plant or an animal, such as a mammal, particularly a human.
- the target gene to which the RNA molecule of this invention is directed may be associated with a pathological condition.
- the gene may be a pathogen- associated gene, such as a viral (U.S. Pat. No. 7,129,223), a tumour-associated or an autoimmune disease-associated gene.
- the gene is from HIV.
- the gene is expressed in a cancer cell.
- the target gene may also be a heterologous gene expressed in a recombinant cell or a genetically altered organism.
- a further subject matter of the invention is a eukaryotic cell or eukaryotic non- human organism exhibiting a target gene specific knockout phenotype comprising an at least partially deficient expression of at least one endogenous target gene where the said cell or organism is transfected with pMultiRNAi vectors capable of inhibiting the expression of one more multiple endogenous target genes.
- the phenotype of specific cells or organisms associated with the down regulation of a specific gene by pMultiRNAi can also used to develop assays, including high- throughput ones, which can then be applied in the development of novel diagnostic and therapeutic applications.
- pMultiRNAi the knockout phenotypes of human genes in cultured cells, which are assumed to be regulators of alternative splicing processes.
- these genes are particularly the members of the SR splicing factor family, e.g. ASF/SF2, SC35, SRp20, SRp40 or SRp55.
- the effect of SR proteins on the mRNA profiles of predetermined alternatively spliced genes, such as CD44 may be analysed.
- the analysis is carried out by high- throughput methods using oligonucleotide-based chips.
- stem cells with a specific gene knockdown can be used to the development of differentiated cells, tissues, organs or transgenic animals (Stein et al. 2003).
- the composition of these may then be used for diagnostic and therapeutic applications in human or veterinary medicine.
- the method and cell of the invention are also suitable in a procedure for identifying and/or characterizing pharmacological agents (e.g. identifying new pharmacological agents from a collection of test substances and/or characterizing mechanisms of action and/or side effects of known pharmacological agents).
- pharmacological agents e.g. identifying new pharmacological agents from a collection of test substances and/or characterizing mechanisms of action and/or side effects of known pharmacological agents.
- the present invention also relates to a system for identifying and/or characterizing pharmacological agents acting on at least one target protein comprising:
- test substance or a collection of test substances wherein pharmacological properties of said test substance or said collection are to be identified and/or characterized.
- system as described above preferably comprises:
- exogenous target nucleic acid coding for the target protein, or a variant or mutated form of the target protein, wherein said exogenous target nucleic acid differs from the endogenous target gene on the nucleic acid level, such that the expression of the exogenous target nucleic acid is substantially less inhibited by the double stranded RNA molecule than the expression of the endogenous target gene.
- pMultiRNAi vectors as a pharmaceutical composition
- the administration may be carried out by known methods, wherein drug siRNAs and shRNA are introduced into a desired target cell in vitro or in vivo (U.S. No 7,176,304 and 7,022,828).
- Commonly used gene transfer techniques include non-viral transfection reagents like Calcium-Phosphate or lipid based regents, as well as different kinds of viral vectors such recombinant lentiviral, adenoviral, retroviral, adeno-associate viral, and FIV vectors (U.S. Pat. No. 6,627,442).
- cells transduced with pMultiRNAi in vitro followed by the transfection of transduced cells back to animal or human for therapeutic applications, i.e. the so called cell therapy.
- the invention also relates to a pharmaceutical composition containing an active agent of at least one double-stranded RNA molecule as described above and a pharmaceutical carrier.
- the composition may be used for diagnostic and therapeutic applications in human or veterinary medicine.
- Fig. 1 Construction of a pMultiRNAi Vector. Hl and U6, human promoters; A, B, C and D, target sites for RNAi; Hl-A, U6-B, Hl-C AND U6-D, primers for PCR. (A) Construction of vector pMultiRNAi with two target sites. (B) Construction of vector pMultiRNAi with four target sites.
- Fig. 2 RNAi Silencing of CypA Gene Expression in Mouse pl9 Cells with a pMultiRNA Vector Targeting 4 Different Sites.
- the expression of CypA in transfected cells without a sequence has been taken as 100%, and expression of CypA was detected using Western blotting analysis.
- the expression of FKBP 12 was used as a control.
- Fig. 3 Synergistic effect of RNAi targeting multiple sites.
- the expression of CypA in transfected cells has been taken as 100%.
- the relative expression levels of CypA in RNAi vector-transfected cells are indicated.
- Fig. 4 Synergistic effect of RNAi on knocking down HIV expression. HIV expression is measured by the expression of the antigen p24, and transfection with no target sequence being the baseline of 100% expression of the antigen. It can be seen that individually different target sites have different total effects, but combined show the greatest knock down. Table 1. Synergistic effect of RNAi targeting multiple sites.
- target site refers to the sequence of nucleotides corresponding to the portion of the gene's coding mRNA where the cut will be made, preventing expression of the gene.
- “Knocking-down" a gene is the partial reduction in expression of a gene caused by RNAi.
- pMultiRNAi is the vectors of viral and non- viral based herein described containing a single or multiple paired promoters with each promoter being coupled to a target site.
- a “vector” is a composition that can transduce, transform or infect a cell, thereby causing the cell to express vector encoded nucleic acids and, optionally, proteins other than those native to the cell, or in a manner not native to the cell.
- a vector includes a nucleic acid (ordinarily RNA or DNA) to be expressed by the cell (a "vector nucleic acid”).
- a vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a retroviral particle, liposome, protein coating or the like.
- a “promoter” is an array of nucleic acid control sequences that directs transcription of a nucleic acid.
- a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
- a promoter also optionally includes distal enhancer or repressor elements that can be located as much as several thousand base pairs from the start site of transcription.
- a “constitutive” promoter is a promoter that is active under most environmental and developmental conditions.
- An “inducible” promoter is a promoter that is under environmental or developmental regulation.
- nucleic acid refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence optionally includes the complementary sequence thereof.
- operably linked refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
- a nucleic acid expression control sequence such as a promoter, or array of transcription factor binding sites
- a virus or vector "transduces" a cell when it transfers nucleic acid into the cell.
- Transfection is the process of introducing a non- viral vector into cells.
- Imagings is the process of introducing a viral vector into cells.
- Recombinant viral vectors represents vectors with nucleic acids of viral origin and can be assembled into viral particles that are infective, but replication-defective in target cells.
- a cell “supernatant” is the culture medium in which a cell is grown.
- the culture medium includes material from the cell, including, e.g., retroviral particles which bud off from the cell membrane and enter the culture medium.
- a “gene of interest” is a nucleic acid sequence that encodes a protein or other molecule that is desirable for integration in a host cell, hi one embodiment, the gene of interest encodes a protein or other molecule the expression of which is desired in the host cell. In this embodiment, the gene of interest is generally operatively linked to other sequences that are useful for obtaining the desired expression of the gene of interest, such as transcriptional regulatory sequences.
- An "RNA coding region” is a nucleic acid that can serve as a template for the synthesis of an RNA molecule, such as an siRNA. Preferably, the RNA coding region is a DNA sequence.
- siRNA small interfering RNA
- shRNA small interfering RNA
- the region of the gene or other nucleotide sequence over which there is homology is known as the "target region.”
- the siRNA is 19-29 nucleotides in length, in another embodiment it is 21-22 nucleotides in length.
- the siRNA may be a "hairpin” or stem-loop RNA molecule, comprising a sense region, a loop region and an antisense region complementary to the sense region.
- the siRNA comprises two distinct RNA molecules that are non-covalently associated to form a duplex.
- Target cell or "host cell” means a cell that is to be transformed using the methods and compositions of the invention.
- “Retroviruses” are viruses having an RNA genome.
- Lentivirus refers to a genus of retroviruses that are capable of infecting dividing and non-dividing cells.
- HIV human immunodeficiency virus: including HFV type 1, and HIV type 2
- FMV feline immunodeficiency virus
- BIV bovine immune deficiency virus
- SIV simian immunodeficiency virus
- hybrid virus refers to a virus having components from one or more other viral vectors, including element from non-retroviral vectors, for example, adenoviral-retroviral hybrids; adeno-retroviral hybrids; and adeno-lenti hybrids.
- RNA interference or silencing is broadly defined to include all posttranscriptional and transcriptional mechanisms of RNA mediated inhibition of gene expression, such as those described in P. D. Zamore Science 296, 1265 (2002).
- heterologous nucleic acid sequence or a “heterologous siRNA” is a relative term referring to a nucleic acid that is functionally related to another nucleic acid, such as two siRNA sequences, in a manner so that the two nucleic acid sequences are arranged in a different relationship to each other as compared to in nature.
- the heterologous nucleic acids can originate from the same gene or a different gene. Modification of the heterologous nucleic acid sequence may occur, e.g., by treating the nucleic acid with a restriction enzyme to generate a nucleic acid fragment that can be operably linked to a promoter or another regulatory element. Modification can also occur by techniques such as site-directed mutagenesis.
- an "expression cassette” refers to a series of specified nucleic acid elements that permit transcription of a nucleic acid in a target cell.
- the expression cassette includes a promoter and a heterologous nucleic acid that is transcribed, e.g., as an siRNA.
- Expression cassettes may also include, e.g., transcription termination signals and enhancer elements.
- Treating or preventing a disease state include methods of regulating gene expression for novel human and mammalian therapeutic applications, e.g., treatment of genetic diseases, cancer, fungal, protozoal, bacterial, and viral infection such as HIV, ischemia, vascular disease, arthritis, immunological disorders.
- Cancer refers to human cancers and carcinomas, sarcomas, adenocarcinomas, lymphomas, leukemias, etc., including solid and lymphoid cancers, kidney, breast, lung, bladder, colon, ovarian, prostate, pancreas, stomach, brain, head and neck, skin, uterine, testicular, glioma, esophagus, and liver cancer, including hepatocarcinoma, lymphoma, including B-acute lymphoblastic lymphoma, non-Hodgkin's lymphomas (e.g., Burkitt's, Small Cell, and Large Cell lymphomas) and Hodgkin's lymphoma, leukemia (including AML, ALL, and CML), and multiple myeloma.
- solid and lymphoid cancers including solid and lymphoid cancers, kidney, breast, lung, bladder, colon, ovarian, prostate, pancreas, stomach, brain, head and neck, skin, uter
- a “constitutive” promoter is a promoter that is active under most environmental and developmental conditions.
- An “inducible” promoter is a promoter that is active under certain environmental or developmental conditions. Tet-regulated systems and the RU-486 system can also be used to impart conditional small molecule control to a promoter (see, e.g., Gossen & Bujard, PNAS 89:5547 (1992); Oligino et al, Gene Ther. 5:491-496 (1998); Wang et al, Gene Ther. 4:432-441 (1997); Neering et al, Blood 88:1147-1155 (1996); and Rendahl et al, Nat. Biotechnol. 16:757-761 (1998)).
- nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 70% identity, preferably 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region of a target sequence, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection ⁇ see, e.g., NCBI web site or the like).
- sequences are then said to be “substantially identical.”
- This definition also refers to, or may be applied to, the compliment of a test sequence.
- the definition also includes sequences that have deletions and/or additions, as well as those that have substitutions.
- the preferred algorithms can account for gaps and the like.
- identity exists over a region that is at least about 19-29 amino acids or nucleotides in length.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- sequence algorithm program parameters Preferably, default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 19 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol.
- HSPs high scoring sequence pairs
- initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
- the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- terapéuticaally effective amount or dose or “therapeutically sufficient amount or dose” or “effective or sufficient amount or dose” herein is meant a dose that produces therapeutic effects for which it is administered.
- the exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques ⁇ see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).
- each pair of two functional promoters specifically Hl and U6 from human origin, ware engineered in a divergent opposite direction, which drives two shRNAs or siRNAs coding sequences in opposite directions.
- the same pair of transcriptional unit can be duplicated and arrayed in linked multiple pairs for the expression of 2, 3, 4, 5, 6, 7, 8, or more different or the same shRNAs and siRNAs target sites.
- a two-step construction strategy was used (Fig 1).
- the DNA fragments containing two promoters and two shRNA and siRNA sites was amplified by PCR.
- the amplified PCR products and host vector were digested with restriction enzymes, followed by electrophoresis of the digested DNA. After purification of the digested products, the PCR product fragment is ligated into the host vector. Following transformation, the expected recombinant clones were identified by PCR and analytic restriction digestion.
- the said cloning strategy can be applied to both viral and non- viral vectors.
- the non- viral vectors include plasmid with or without stable drug selection markers.
- the viral vectors include, not by way of limitation, adenoviral, retroviral, lentiviral, adeno- associate, HSV viral, adeno-retro hybrid, and adeno-lenti hybrid.
- Example 2. RNAi Silencing of CypA Gene Expression in Mouse pl9 Cells with a pMultiRNA Vector Targeting 4 Different Sites
- RNAi effect was examined for its targeting of four sites on the gene for CypA protein.
- Target sites were arbitrary lettered A, B, C and D, and were examined for their ability to knockdown the CypA gene in mouse pl9 cells by transfection.
- the cell lysates were isolated, and Western blotting analysis was performed to detect CypA expression.
- Each target site had a different level of inhibition on CypA when introduced by itself as the target site, but when all four sites were targeted simultaneously the inhibitory effect seen significantly increased.
- gene, FKBP 12 used as a control with no sites targeted saw no difference between normal expression and when the CypA targets were added. This proves that pMultiRNAi can function in gene silencing.
- RNAi efficiency 100% - X A % x XB% X X C % X XD%. This would make the theoretical efficiency of all four target working synergistically be 97.64% (100% - 27.19% x 38.41% x 36.71% x 61.71%), as the relative expression of CypA with target sequences A, B, C and D being 27.19%, 38.41%, 36.71%, and 61.71%, respectively.
- HIV infection One of the most attractive targets for gene therapy is HIV infection.
- the pandemic spread of HTV has driven an intense world- wide effort to unravel the molecular mechanisms and life cycle of these viruses.
- life cycle of HIVs provide many potential targets for inhibition by gene therapy, including cellular expression of transdominant mutant gag and env nucleic acids to interfere with virus entry, TAR (the binding site for tat, which is typically required for transactivation) decoys to inhibit transcription and trans activation, and RRE (the binding site for Rev; i.e., the Rev Response Element) decoys and transdominant Rev mutants to inhibit RNA processing.
- TAR the binding site for tat, which is typically required for transactivation
- RRE the binding site for Rev; i.e., the Rev Response Element
- RNAi inhibition on HIV-I replication was quantified in HeLa/CD4+ cells.
- HeLa/CD4+ cells were co-transfected using the HrV-l NL4.3 expression plasmid, pNL4.3, and one of the following RNAi vectors: pRNAi-NS, pRNAi-HrV-pol, pRNAi-HIV-gag, pRNAi-HIV-tat, pRNAi-HIV-env, or pMultiRNAi-HIV.
- Target sites for CypA are as follows:
- site A (5 ' -GACTTTACACGCCATAATGG- 3 ')
- site B (5 ' -GACCAAACACAAACGGTTCC-3')
- Target sites for HIV viral genes pol, gag, tat, and env are as follows:
- Adenoviral/retroviral vector chimeras a novel strategy to achieve high-efficiency stable transduction in vivo.
- RNA polymerase III transcribes human microRNAs. Nat Struct MoI Biol. 2006 Dec;13(12):1097-101.
- pWormgatePro enables promoter- driven knockdown by hairpin RNA interference of muscle and neuronal gene products in Caenorhabditis elegans. Invert Neurosci. 2006 Mar;6(l):5-12.
- Brummelkamp TR Bernards R, Agami R: A system for stable expression of short interfering RNAs in mammalian cells. Science 2002, 296:550-3.
- Dykxhoorn DM Novina CD, Sharp PA. Killing the messenger: short RNAs that silence gene expression. Nature Reviews Molecular Cell Biology. 2003;4(6):457 ⁇ 67.
- RNA interference is mediated by 21- and 22- nucleotide RNAs. Genes and Development. 2001;15(2):188-200.
- Hung CF Cheng TL, Wu RH, Teng CF, Chang WT.
- Paddison PJ Gaudy AA, Bernstein E, Hannon GJ, Conklin DS: Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 2002, 16:948-58.
- RNAi doublestranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 2000, 101:25-33.
- RNA polymerase II Use of RNA polymerase II to transcribe artificial microRNAs.Methods Enzymol. 2005;392:371-80.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- AIDS & HIV (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
This invention provides methods and vectors for the expression of multiple siRNAs and shRNAs of different target sites or the same site of any gene simultaneously from a single vector, both viral and non-viral. It can function in any cell or organism; down-regulating any mRNAs that share sequence homology of 70% or greater with the expressed siRNAs or shRNAs from the vector. In particular, the methods disclose a special array of promoters within a vector, making expression of multiple siRNAs and shRNAs possible. The invention can be used to knock-down or knock-out the expression of a single gene at the same or multiple sites or different genes of the same or different physiological and pathological pathways for the purpose of gene function analysis, assay development, and therapeutic applications.
Description
Methods for Expressing Multiple siRNA and shRNA from a Single Vector
Cross Reference to Related Applications
The present application is related to USSN 60/793,919, filed April 20, 2006, herein incorporated by reference in its entirety.
Background of the Invention
RNA interference (also called "RNA-mediated interference", abbreviated RNAi) is a mechanism for RNA-controlled regulation of gene expression in which double- stranded ribonucleic acid inhibits the expression of genes with complementary nucleotide sequences (Elbashir et al. 2001, Hamilton and Baulcombe 1999, and Zamore et al. 2000). Conserved in most eukaryotic organisms, the RNAi pathway has evolved as a efficient mechanism of post-transcriptional gene silencing, associated with the regulation of developmental genes, genomic maintenance, and as a defense system against viral infection (Hamilton and Baulcombe 1999, Harmon 2002, He and Hannon 2004, Martinez et al. 2002, and McManus et al. 2002).
The RNAi pathway is initiated by the presence of double-stranded RNA (dsRNA) in the cell, which is cleaved into short double-stranded fragments of ~20 base pairs by the cytoplasmic Dicer (Kim et al. 2005, and Myers et al. 2003). One of the two strands of each fragment, known as the guide strand, is then incorporated into the RNA-induced silencing complex (RISC) that can induce cleavage of any mRNA capable of pairring with the RNA strand of the RISC (Dykxhoorn et al. 2003, Martinez et al. 2002, Meister and Tuschl 2004, and Yi et al. 2003).
dsRNAs longer than 150bp can induce nonspecific gene silencing and apoptosis in mammalian cells due to the activation of the interferon and protein kinase K pathways (Bridge et al. 2003, and Jackson et al. 2003). However, introduction of 19-29bρ dsRNA fragments into cells can in fact down-regulate or knock-out the expression of a specific gene without the complication of non-specific effects (Martinez et al. 2002).
Syntheitic siRNAs were first introduced, and have been widely used for most early gene silencing experiments (Caplen et al. 2001, Elbashir et al. 2001, Hamilton et al. 1999, and Kim et al. 2005). siRNA-expression plasmids or viral vectors (shRNA) from pol III promoters (Hl and U6) were subsequently shown to be as effective as synthetic siRNAs in the down-regulation of target mRNA and protein amounts
(Kasim et al. 2004, and Paddison et al. 2002). The rapid development of this method has made it technically possible to knock-down almost any known gene in an applicable organism (Castanotto et al. 2002, and Scherer and Rossi 2004).
The pol III promoter is so far the most widely used promoter for vector-based siRNA silencing (Bridge et al. 2003, and Tran et al. 2003). However, genetically modified pol π promoters, including promoters with tissue specificity and inducibility with small compounds like Tet, have also been found to be applicable to drive siRNA expression within different vector formats and compositions (Calegari et al. 2002, Caplen et al. 2001, Yuan et al. 2006, Briese et al. 2006, Ristevski 2005, Zeng et al. 2005, and Paddison et al. 2002).
While different compositions exist, not all siRNA and shRNA sequences are equally potent in inducing the target gene's silencing (Berns et al. 2004, Dykxhoorn et al. 2003, Harmon 2002, and Mittal 2004). A number of algorithm-based softwares for designing siRNAs and shRNAs have been developed by scientists of academia and the bio tech industry. These are based on the best available knowledge of the silencing mechanisms of Dicer and RISC. Still, it is has been shown that the success rate of selecting a potent target site with over 70% gene silencing effects is generally around 25% (Dykxhoorn et al. 2003, and Tran et al. 2003). To obtain higher than 70% down- regulation effects, scientists often has to transduce target cells with much higher amount of siRNAs and shRNAs, which often increases the possibility of non-specific gene silencing effects, and in many cases, it is almost impossible to obtain down- regulation of gene expression of over 95% (Jackson et al. 2003, and Kim et al. 2005). This is especially true when the target genes are expressed abundently in target cells or organisms.
Most, if not all, of the functions and phenotypes associated with a specific cell or organism involve the expression of more than one gene (Downward 2004, and Lee et al. 2002). Obviously, mutiple siRNAs or shRNAs have to be delivered to a specific target cell or organism for the alteration of its specific function or phenotype. Accordingly, development of a single vector (plasmid or viral) capable of expressing mutiple target siRNA and/or shRNAs would be applicable for the above said applications, including gene silencing of specific gene or one set of genes associated with a particular function, pathway, and phenotype. The present invections provides
these and other applications. The applications for the multiple siRNA and shRNA delivery could be used in bioscience research, and for the development of novel therapeutic modalities.
Summary of the Invention
Silencing of gene expression by siRNAs and shRNAs has become a powerful tool for functional genomic and therapeutic applications (McManus et al. 2002, Meister and Tuschl 2004, and U.S. Pat. No. 7,078,196). Despite the well-documented successes in the application of these technologies, it is known that not all siRNAs and shRNAs from the same gene are equally potent in the efficiency of target gene down regulation. In general, about one out of four siRNAs and shRNAs designed with available algorithms can have the ability to knock-down target genes at 70% or more efficiency. This compromises many applications that require 90-95% specific gene down regulation to cause an affect. In another further embodiment, wherein the application requires knock down more than one target genes which are involved in a specific functional pathway or phenotype, a single vector with the capability of delivering multi siRNAs and shRNAs would be advantageous.
The pMultiRNAi developed here allows for the expression of 2, 3, 4, 5, 6, 7, 8 , or more identical or different siRNAs and shRNAs from a single vector. Each of the multiple siRNAs and shRNAs are cloned down stream of functional promoters, which could be arrayed at the different orientations, namely sequencial, divergent, and convengent configeration within a vector. When the resulting vector is delivered to a cell or organism, the corresponding siRNA and shRNA will be transcribed inside the cells.
In the embodiment of the invention, RNA polymerase III promoters are well known to one of skill in the art. A suitable range of RNA polymerase III promoters can be found, for example, in Paule and White (2000), which is hereby incorporated by reference in its entirety. The definition of RNA polymerase III promoters also include any synthetic or engineered DNA fragment that can direct RNA polymerase III to transcribe its downstream RNA coding sequences. To date, the most well-documented pol πi promoters that have been used in shRNAs are Hl and U6 promoters of human, mouse, bovine and rat origin (Borchert et al. 2006, and Lambeth et al. 2006).
Other promoters including type II polymerase promoters, modified polymerase II promoter, constitutive pol II promoters, tissue specific promoters, and inducible promoters are also applicable to the above said applications (Yuan et al. 2006, Briese et al. 2006, Ristevski 2005, Zeng et al. 2005, and Tiscornia et al. 2004). The Polymerase II promoter/enhancer may be any promoter, enhancer or promoter/enhancer combination known to increase expression of a gene with which it is in a functional relationship. A "functional relationship" and "operably linked" mean, without limitation, that the transgene or RNA coding region is in the correct location and orientation with respect to the promoter and/or enhancer that expression of the gene will be affected when the promoter and/or enhancer is contacted with the appropriate molecules.
The modified polymerase II type promoters can be ubiquitous CMV viral promoter, adenoviral major later promoter, and SV40 early region promoters. Further, the RNA polymerase II (Pol II) promoter or promoters used as part of the vector can be inducible. Any suitable inducible Pol II promoter can be used with the methods of the invention. Particularly suited Pol II promoters include the tetracycline responsive promoters provided in Ohkawa and Taira (2000), and in Meissner et al. (2001), which are incorporated herein by reference.
The vector used to express multiple siRNA and shRNA incorporate viral and non- viral vectors. The viral construct is a nucleotide sequence that comprises sequences necessary for the production of recombinant viral particles in a packaging cell (U.S. Pat. No. 7,195,916 and 6,555,107). hi one embodiment the viral construct additionally comprises target RNA coding sequences that allow for the desired expression of siRNAs and shRNAs in the host.
The viral construct may incorporate sequences from the genome of any known organism (Allocca et al. 2006, Schepelmann and Springer 2006, Woo et al. 2006, Harrop et al. 2006, and Kanzaki and Looney 2004). The sequences may be incorporated in their native form or may be modified in any way. For example, the sequences may comprise insertions, deletions or substitutions, hi a preferred embodiment, the viral construct comprises sequences from a lentiviras genome, such as the HIV genome or the SIV genome (Abbas-Terki et al. 2002). Another preferred embodiment, the viral construct comprises sequences of a murine stem cell virus
(MSCV). Other preferred embodiments include adenoviral genome, adeno associated genome, FIV genome, baculoviral genome, HSV genome as well as all different hybrids derived from said viral vectors (Glauser et al. 2006, Reynolds et al. 1999, Bilbao et al. 1997, and U.S. Pat. No. 6,485,976; 6,333,030; and 7,052,904).
In the embodiment of non- viral vectors, any plasmids with or without stable selection drug marker can be used for the expression of multiple siRNA and shRNA simultaneously. The multiple siRNAs and shRNAs can be expressed transiently, or stably expressed after corresponding drug selection such as G418, Puromycin, Zeocin or Hygromycin.
The designed siRNA and shRNA coding sequences can be cloned into viral and non- viral vectors using any suitable genetic engineering technique well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, as described in Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, N. Y. (1989)), Coffin et al. (Retroviruses. Cold Spring Harbor Laboratory Press, N. Y. (1997)) and "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford University Press, (2000)). In another preferred embodiment, the target siRNA and shRNA sites can be cloned into vectors by nucleic acid fusion and exchange technologies currently known in the art, including, Gateway, PCR in fusion, Cre-lox P, and Creator.
In the preferred embodiment, the vectors with cloned multiple siRNAs and shRNAs are used to transduce host cells and organisms by transfections or microinjection for non- viral vectors and infection for viral vectors. Commonly used transfection techniques include calcium phosphate, DEAE-dextran, electroporation and microinjection and viral methods (Graham and van der Eb 1973, McCutchan et al. 1968, Chu. et al 1987, Fraley et al. 1980, and Capecchi 1980). A recent addition to this arsenal of techniques for the introduction of DNA into cells is the use of cationic liposomes (Feigner et al. 1987). Commercially available cationic lipid formulations are Tfx 50 (Promega), Lipofectamin2000 (Life Technologies), and DNAfectin (Applied Biological Materials Inc.).
In the application of recombinant viral vectors, recombinant viral vectors incorporated with multiple siRNA and shRNA are co-transfected into packaging cells or cell lines,
along with elements required for the packaging of recombinant viral particles. Recombinant viral particles collected from transfected cell supernatant are used to infect target cells or organisms for the expression of multiple siRNAs and shRNAs. The transduced cells or organisms are used for transient siRNA and shRNA expression or selected for stable expression.
In the embodiment of host cells and organisms, the pMultiRNAi vector can be used to transduce a wide range of the cells and organisms that can support the expression of siRNAs and shRNAs. The host cells include, without limitation, primary cells, immortalized cells, embryonic stem cells, and tumour-derived cells. The siRNA and shRNA expression can be transient or stable in host cells for functional analysis, assay development or therapeutic applications. These organisms could be, without limitation, nematode C, elegans, insects, fruit flies, frogs, fishes, mice, rats, and humans with disease orders (Bridge et al. 2003, Caplen et al. 2001, and Yang et al. 2000).
In the embodiment of specific gene knockdown, multiple siRNAs and shRNAs can be expressed to target different sites of the same mRNA for synergistic effects as demonstrated in the knockdown of CypA gene expression in mouse pl9 cells (example 2). Four shRNAs targeting the CypA gene were expressed in mouse pl9 cells, each with knockdown efficiency less than 75%. However, simultaneous expression of all four shRNAs from a single vector gives a near complete knockdown of more than 98%. A further preferred embodiment of using pMultiRNAi to knock down the expression of abundantly expressed genes, such as GAPDH and others, wherein the amount siRNA and shRNA expressed from a single promoter is not enough to silence the target gene's expression. Increased expression of the same siRNA and shRNA from multiple promoters would be able to achieve much higher efficiency in down regulating a specific gene.
hi another embodiment of gene knockdown where multiple genes in the same or different pathways are associated with a specific function or living organism like virus, such as HIV; multiple siRNAs and shRNAs can be designed and expressed with each targeting one site of a different gene (Example 4). This is especially applicable to functions associated with redundant or compensation conferred by other genes. Furthermore, in the case of a virus like HIV or Influenza, where mutations in their key
genes frequently occur, multiple siRNA and shRNA can be designed to target different possible mutant sequences.
In the embodiment of applications of specific gene down regulation, RNA-mediated interference (RNAi) can provide a direct causal links between specific genes and observed loss-of-function (LOF) phenotypes (Downward 2004, and Schwarz et al. 2003). The method of invention can be used for determining the function of a gene in a cell or organism, or even for modulating the function of a gene capable of mediating RNA interference. The cell is preferably a eukaryotic cell or a cell line (e.g. a plant cell or an animal cell, such as a mammalian cell, an embryonic cell, a pluripotent stem cell, a tumour cell, a teratocarcinoma cell or a virus-infected cell. The organism is preferably a eukaryotic organism, a plant or an animal, such as a mammal, particularly a human.
The target gene to which the RNA molecule of this invention is directed may be associated with a pathological condition. For example, the gene may be a pathogen- associated gene, such as a viral (U.S. Pat. No. 7,129,223), a tumour-associated or an autoimmune disease-associated gene. In one embodiment, the gene is from HIV. In another embodiment, the gene is expressed in a cancer cell. The target gene may also be a heterologous gene expressed in a recombinant cell or a genetically altered organism. By modulating, particularly inhibiting, or determining the function of a gene, valuable information and therapeutic benefits in the agricultural, medical or veterinary medical fields may be obtained.
Thus, a further subject matter of the invention is a eukaryotic cell or eukaryotic non- human organism exhibiting a target gene specific knockout phenotype comprising an at least partially deficient expression of at least one endogenous target gene where the said cell or organism is transfected with pMultiRNAi vectors capable of inhibiting the expression of one more multiple endogenous target genes.
The phenotype of specific cells or organisms associated with the down regulation of a specific gene by pMultiRNAi can also used to develop assays, including high- throughput ones, which can then be applied in the development of novel diagnostic and therapeutic applications. For example, one may prepare the knockout phenotypes of human genes in cultured cells, which are assumed to be regulators of alternative splicing processes. Among these genes are particularly the members of the SR
splicing factor family, e.g. ASF/SF2, SC35, SRp20, SRp40 or SRp55. Further, the effect of SR proteins on the mRNA profiles of predetermined alternatively spliced genes, such as CD44, may be analysed. Preferably the analysis is carried out by high- throughput methods using oligonucleotide-based chips.
In the embodiment of embryotic stem cells, wherein stem cells with a specific gene knockdown can be used to the development of differentiated cells, tissues, organs or transgenic animals (Stein et al. 2003). The composition of these may then be used for diagnostic and therapeutic applications in human or veterinary medicine.
The method and cell of the invention are also suitable in a procedure for identifying and/or characterizing pharmacological agents (e.g. identifying new pharmacological agents from a collection of test substances and/or characterizing mechanisms of action and/or side effects of known pharmacological agents).
Thus, the present invention also relates to a system for identifying and/or characterizing pharmacological agents acting on at least one target protein comprising:
(a) a eukaryotic cell or a eukaryotic non-human organism capable of expressing at least one endogenous target gene coding for said target protein,
(b) at least one double-stranded RNA molecule capable of inhibiting the expression of said at least one endogenous target gene, and
(c) a test substance or a collection of test substances wherein pharmacological properties of said test substance or said collection are to be identified and/or characterized.
Further, the system as described above preferably comprises:
(d) at least one exogenous target nucleic acid coding for the target protein, or a variant or mutated form of the target protein, wherein said exogenous target nucleic acid differs from the endogenous target gene on the nucleic acid level, such that the expression of the exogenous target nucleic acid is substantially less inhibited by the double stranded RNA molecule than the expression of the endogenous target gene.
Other aspects of the invention comprise of administering pMultiRNAi vectors as a pharmaceutical composition (Abbas-Terki et al 2002, and Lee et al. 2002). The administration may be carried out by known methods, wherein drug siRNAs and shRNA are introduced into a desired target cell in vitro or in vivo (U.S. No 7,176,304
and 7,022,828). Commonly used gene transfer techniques include non-viral transfection reagents like Calcium-Phosphate or lipid based regents, as well as different kinds of viral vectors such recombinant lentiviral, adenoviral, retroviral, adeno-associate viral, and FIV vectors (U.S. Pat. No. 6,627,442).
In another aspect of application related to this, cells transduced with pMultiRNAi in vitro followed by the transfection of transduced cells back to animal or human for therapeutic applications, i.e. the so called cell therapy.
Thus, the invention also relates to a pharmaceutical composition containing an active agent of at least one double-stranded RNA molecule as described above and a pharmaceutical carrier. The composition may be used for diagnostic and therapeutic applications in human or veterinary medicine.
Brief Description of Figures
Fig. 1: Construction of a pMultiRNAi Vector. Hl and U6, human promoters; A, B, C and D, target sites for RNAi; Hl-A, U6-B, Hl-C AND U6-D, primers for PCR. (A) Construction of vector pMultiRNAi with two target sites. (B) Construction of vector pMultiRNAi with four target sites.
Fig. 2: RNAi Silencing of CypA Gene Expression in Mouse pl9 Cells with a pMultiRNA Vector Targeting 4 Different Sites. The expression of CypA in transfected cells without a sequence has been taken as 100%, and expression of CypA was detected using Western blotting analysis. The expression of FKBP 12 was used as a control.
Fig. 3: Synergistic effect of RNAi targeting multiple sites. The expression of CypA in transfected cells has been taken as 100%. The relative expression levels of CypA in RNAi vector-transfected cells (single site A, B, C, D and multiple site ABCD) are indicated.
Fig. 4: Synergistic effect of RNAi on knocking down HIV expression. HIV expression is measured by the expression of the antigen p24, and transfection with no target sequence being the baseline of 100% expression of the antigen. It can be seen that individually different target sites have different total effects, but combined show the greatest knock down.
Table 1. Synergistic effect of RNAi targeting multiple sites.
Detailed Description of the Invention
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention.
The "target site" refers to the sequence of nucleotides corresponding to the portion of the gene's coding mRNA where the cut will be made, preventing expression of the gene.
"Knocking-down" a gene is the partial reduction in expression of a gene caused by RNAi.
"Knocking-out" a gene is complete lack in expression of a gene cause by RNAi.
"pMultiRNAi" is the vectors of viral and non- viral based herein described containing a single or multiple paired promoters with each promoter being coupled to a target site.
A "vector" is a composition that can transduce, transform or infect a cell, thereby causing the cell to express vector encoded nucleic acids and, optionally, proteins other than those native to the cell, or in a manner not native to the cell. A vector includes a nucleic acid (ordinarily RNA or DNA) to be expressed by the cell (a "vector nucleic acid"). A vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a retroviral particle, liposome, protein coating or the like.
A "promoter" is an array of nucleic acid control sequences that directs transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements that can be located as much as several thousand base pairs from the start site of transcription.
A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is under environmental or developmental regulation.
The term "nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence optionally includes the complementary sequence thereof.
The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
A virus or vector "transduces" a cell when it transfers nucleic acid into the cell.
"Transfection" is the process of introducing a non- viral vector into cells.
"Infections" is the process of introducing a viral vector into cells.
"Recombinant viral vectors" represents vectors with nucleic acids of viral origin and can be assembled into viral particles that are infective, but replication-defective in target cells.
A cell "supernatant" is the culture medium in which a cell is grown. The culture medium includes material from the cell, including, e.g., retroviral particles which bud off from the cell membrane and enter the culture medium.
A "gene of interest" is a nucleic acid sequence that encodes a protein or other molecule that is desirable for integration in a host cell, hi one embodiment, the gene of interest encodes a protein or other molecule the expression of which is desired in the host cell. In this embodiment, the gene of interest is generally operatively linked to other sequences that are useful for obtaining the desired expression of the gene of interest, such as transcriptional regulatory sequences.
An "RNA coding region" is a nucleic acid that can serve as a template for the synthesis of an RNA molecule, such as an siRNA. Preferably, the RNA coding region is a DNA sequence.
A "small interfering RNA" or "siRNA" or "shRNA" is a double-stranded RNA molecule that is capable of inhibiting the expression of a gene with which it shares homology. The region of the gene or other nucleotide sequence over which there is homology is known as the "target region." In one embodiment the siRNA is 19-29 nucleotides in length, in another embodiment it is 21-22 nucleotides in length. In one embodiment the siRNA may be a "hairpin" or stem-loop RNA molecule, comprising a sense region, a loop region and an antisense region complementary to the sense region. In other embodiments the siRNA comprises two distinct RNA molecules that are non-covalently associated to form a duplex.
"Target cell" or "host cell" means a cell that is to be transformed using the methods and compositions of the invention.
"Retroviruses" are viruses having an RNA genome.
"Lentivirus" refers to a genus of retroviruses that are capable of infecting dividing and non-dividing cells. Several examples of lentiviruses include HIV (human immunodeficiency virus: including HFV type 1, and HIV type 2); feline immunodeficiency virus (FFV); bovine immune deficiency virus (BIV); and simian immunodeficiency virus (SIV).
A "hybrid virus" as used herein refers to a virus having components from one or more other viral vectors, including element from non-retroviral vectors, for example, adenoviral-retroviral hybrids; adeno-retroviral hybrids; and adeno-lenti hybrids.
The term "RNA interference or silencing" is broadly defined to include all posttranscriptional and transcriptional mechanisms of RNA mediated inhibition of gene expression, such as those described in P. D. Zamore Science 296, 1265 (2002).
A "heterologous nucleic acid sequence" or a "heterologous siRNA" is a relative term referring to a nucleic acid that is functionally related to another nucleic acid, such as two siRNA sequences, in a manner so that the two nucleic acid sequences are arranged in a different relationship to each other as compared to in nature. The heterologous nucleic acids can originate from the same gene or a different gene.
Modification of the heterologous nucleic acid sequence may occur, e.g., by treating the nucleic acid with a restriction enzyme to generate a nucleic acid fragment that can be operably linked to a promoter or another regulatory element. Modification can also occur by techniques such as site-directed mutagenesis.
An "expression cassette" refers to a series of specified nucleic acid elements that permit transcription of a nucleic acid in a target cell. Typically, the expression cassette includes a promoter and a heterologous nucleic acid that is transcribed, e.g., as an siRNA. Expression cassettes may also include, e.g., transcription termination signals and enhancer elements.
"Treating or preventing a disease state" include methods of regulating gene expression for novel human and mammalian therapeutic applications, e.g., treatment of genetic diseases, cancer, fungal, protozoal, bacterial, and viral infection such as HIV, ischemia, vascular disease, arthritis, immunological disorders.
"Cancer" refers to human cancers and carcinomas, sarcomas, adenocarcinomas, lymphomas, leukemias, etc., including solid and lymphoid cancers, kidney, breast, lung, bladder, colon, ovarian, prostate, pancreas, stomach, brain, head and neck, skin, uterine, testicular, glioma, esophagus, and liver cancer, including hepatocarcinoma, lymphoma, including B-acute lymphoblastic lymphoma, non-Hodgkin's lymphomas (e.g., Burkitt's, Small Cell, and Large Cell lymphomas) and Hodgkin's lymphoma, leukemia (including AML, ALL, and CML), and multiple myeloma.
A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is active under certain environmental or developmental conditions. Tet-regulated systems and the RU-486 system can also be used to impart conditional small molecule control to a promoter (see, e.g., Gossen & Bujard, PNAS 89:5547 (1992); Oligino et al, Gene Ther. 5:491-496 (1998); Wang et al, Gene Ther. 4:432-441 (1997); Neering et al, Blood 88:1147-1155 (1996); and Rendahl et al, Nat. Biotechnol. 16:757-761 (1998)).
The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 70% identity, preferably 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified
region of a target sequence, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection {see, e.g., NCBI web site or the like). Such sequences are then said to be "substantially identical." This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 19-29 amino acids or nucleotides in length.
For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 19 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl Acad. Sd. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection {see, e.g., Current Protocols in Molecular Biology (Ausubel et ah, eds. 1995 supplement)).
A preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al, Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al, J. MoI. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix {see Henikoff & Henikoff, Proc. Natl. Acad. Sd. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
By "therapeutically effective amount or dose" or "therapeutically sufficient amount or dose" or "effective or sufficient amount or dose" herein is meant a dose that produces therapeutic effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using
known techniques {see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).
Examples
The following examples are provided by of illustration only and not by way of limitation. Those of skill will readily recognize a variety of non-critical parameters, which are changed or modified to achieve essentially similar results in different applications.
Example 1. Construction of a pMultiRNAi Vector
In this specific array of pMultiRNAi vector, each pair of two functional promoters, specifically Hl and U6 from human origin, ware engineered in a divergent opposite direction, which drives two shRNAs or siRNAs coding sequences in opposite directions.
The same pair of transcriptional unit can be duplicated and arrayed in linked multiple pairs for the expression of 2, 3, 4, 5, 6, 7, 8, or more different or the same shRNAs and siRNAs target sites.
Specifically, a two-step construction strategy was used (Fig 1). In the first step, the DNA fragments containing two promoters and two shRNA and siRNA sites was amplified by PCR. The amplified PCR products and host vector were digested with restriction enzymes, followed by electrophoresis of the digested DNA. After purification of the digested products, the PCR product fragment is ligated into the host vector. Following transformation, the expected recombinant clones were identified by PCR and analytic restriction digestion.
The said cloning strategy can be applied to both viral and non- viral vectors. The non- viral vectors include plasmid with or without stable drug selection markers. The viral vectors include, not by way of limitation, adenoviral, retroviral, lentiviral, adeno- associate, HSV viral, adeno-retro hybrid, and adeno-lenti hybrid.
Example 2. RNAi Silencing of CypA Gene Expression in Mouse pl9 Cells with a pMultiRNA Vector Targeting 4 Different Sites
RNAi effect was examined for its targeting of four sites on the gene for CypA protein. Target sites were arbitrary lettered A, B, C and D, and were examined for their ability to knockdown the CypA gene in mouse pl9 cells by transfection. At 48hr, the cell lysates were isolated, and Western blotting analysis was performed to detect CypA expression. Each target site had a different level of inhibition on CypA when introduced by itself as the target site, but when all four sites were targeted simultaneously the inhibitory effect seen significantly increased. While gene, FKBP 12, used as a control with no sites targeted saw no difference between normal expression and when the CypA targets were added. This proves that pMultiRNAi can function in gene silencing.
Example 3. Synergistic effect of RNAi targeting multiple sites
After noting the above increase in silencing when four target sequences were used, the type of effect this was, was explored. It was believed that, if the effect was synergistic, the RNAi efficiency = 100% - XA% x XB% X XC% X XD%. This would make the theoretical efficiency of all four target working synergistically be 97.64% (100% - 27.19% x 38.41% x 36.71% x 61.71%), as the relative expression of CypA with target sequences A, B, C and D being 27.19%, 38.41%, 36.71%, and 61.71%, respectively. Then the experimental results were calculated, coming out to 98.08% making them significantly close to accept a synergistic effect as the cause (see further data to confirm this conclusion in the table). This proves that using the multiple target sequence sites in pMultiRNAi improves the efficiency of gene silencing in a synergistic manner.
Example 4. Down Regulation of Different Target Genes with Different siRNA and shRNA Sites.
One of the most attractive targets for gene therapy is HIV infection. The pandemic spread of HTV has driven an intense world- wide effort to unravel the molecular mechanisms and life cycle of these viruses. It is now clear that the life cycle of HIVs provide many potential targets for inhibition by gene therapy, including cellular expression of transdominant mutant gag and env nucleic acids to interfere with virus entry, TAR (the binding site for tat, which is typically required for transactivation)
decoys to inhibit transcription and trans activation, and RRE (the binding site for Rev; i.e., the Rev Response Element) decoys and transdominant Rev mutants to inhibit RNA processing. The application of viral and non- viral vectors capable of expressing multiple siRNAs and shRNAs targeting said multiple genes would be an effective way for the treatment of HIV virus replication.
hi the preferred embodiment, four different ShRNAs targeting our different HIV genes, pol, gag, env, and tat with pMultiRNAi were compared with a single shRNA. The efficiency of RNAi inhibition on HIV-I replication was quantified in HeLa/CD4+ cells. HeLa/CD4+ cells were co-transfected using the HrV-lNL4.3 expression plasmid, pNL4.3, and one of the following RNAi vectors: pRNAi-NS, pRNAi-HrV-pol, pRNAi-HIV-gag, pRNAi-HIV-tat, pRNAi-HIV-env, or pMultiRNAi-HIV. The levels of HIV-I were reduced to -15-30% in samples using a single targeting site, but were dramatically reduced to 4% in the samples using pMultiRNAi targeting (Fig. 3.), suggesting that multiple shRNAs care more effective than a single RNAi targeting site in inhibiting replication of HIV-I .
Sequences
1. Promoter sequence used for pMultiRNAi vector construction
Sequence of p2RNAi-donor (promoter region)
GTCGACTATTCCATGGGAAAGAGTGGTCTCATACAGAACTTATAAGATTCCCAAATC CAAAGACATTTCACGTTTATGGTGATTTCCCAGAACACATAGCGACATGCAAATATT GCAGGGCGCCACTCCCCTGTCCCTCACAGCCATCTTCCTGCCAGGGCGCACGCGCGC TGGGTGTTCCCGCCTAGTGACACTGGGCCCGCGATTCCTTGGGGATCCAAGGTCGGG CAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCT GTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAAT ACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTTAAAATTATGTTT TAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTT ATATATCTTGTGGAAAGGACGAAACACCGTCGAC
2. RNAi sequence for HIV and CypA genes
Target sites for CypA are as follows:
site A (5 ' -GACTTTACACGCCATAATGG- 3 '),
site B (5 ' -GACCAAACACAAACGGTTCC-3'),
site C (5 ' -GACAAAGTTCCAAAGACAGC-S ■ ), and
site D (5 ' -GACTGAATGGCTGGATGGCA-3').
Target sites for HIV viral genes pol, gag, tat, and env are as follows:
pol (5 • -TGCTCCTGTATCTAATAGAGC-S'),
gag (5 ' -GTTCTAGCTCCCTGCTTGCCC-S'),
tat (5 ' -CTGCTTGTACCAATTGCTATT-S'), and
env (5 ' -GATGTGGCAGGAAGTAGGAC-3').
References
Abbas-Terki T, Blanco-Bose W, D'eglon N, Pralong W, AebischerP. Lentiviral- mediated RNA interference. Human Gene Therapy. 2002;13(18):2197-2201.
Allen D, Kenna PF, Palfi A, McMahon HP, Millington-Ward S, O'reilly M, Humphries P, Farrar GJ. J Gene Med. 2007 Apr 2;9(4):287-298.
Allocca M, Tessitore A, Cotugno G, Auricchio A. AAV-mediated gene transfer for retinal diseases.Expert Opin Biol Ther. 2006 Dec;6(12): 1279-94. Review.
Berns, K., E.M. Hijmans, J. Mullenders, T.R. Brammelkamp, A. Velds, M. Heimerikx, R.M. Kerkhoven, M. Madiredjo, et al. A large-scale RNAi screen in human cells identifies new components of the p53 pathway. 2004. Nature 428:431- 437.
Bilbao G, Feng M, Rancourt C, Jackson WH Jr, Curiel DT. Adenoviral/retroviral vector chimeras: a novel strategy to achieve high-efficiency stable transduction in vivo.
FASEB J. 1997 Jul;l l(8):624-34. Review.
Borchert GM, Lanier W, Davidson BL. RNA polymerase III transcribes human microRNAs. Nat Struct MoI Biol. 2006 Dec;13(12):1097-101.
Brenz Verca MS, Weber P, Mayer C, Graf C, Refojo D, Kuhn R, Grummt I, Lutz B. Development of a species-specific RNA polymerase I-based shRNA expression vector. Nucleic Acids Res. 2007;35(2):el0.
Bridge AJ, Pebernard S, Ducraux A, Nicoulaz A-L, Iggo R. Induction of an interferon response by RNAi vectors in mammaliancells. Nature Genetics. 2003;34(3):263-264.
Briese M, Esmaeili B, Johnson NM, Sattelle DB. pWormgatePro enables promoter- driven knockdown by hairpin RNA interference of muscle and neuronal gene products in Caenorhabditis elegans. Invert Neurosci. 2006 Mar;6(l):5-12.
Brummelkamp TR, Bernards R, Agami R: A system for stable expression of short interfering RNAs in mammalian cells. Science 2002, 296:550-3.
Calegari F, Haubensak W, Yang D, Huttner WB, Buchholz F. Tissue-specific RNA interference in postimplantation mouse embryos with endoribonuclease-prepared short interfering RNA. Proceedings of the National Academy of Sciences of the United States of America. 2002;99(22): 14236-14240.
Caplen, N.J., S. Parrish, F. Imani, A. Fire, and R.A. Morgan. Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc. Natl Acad. Sci. 2001. 98:9742-9747.
Castanotto, D., H. Li, and JJ. Rossi. Functional siRNA expression from transfected PCR products. RNA 2002. 8:1454-1460.
Downward J. Use of RNA interference libraries to investigate oncogenic signalling in mammalian cells. Oncogene. 2004;23 (51):8376-8383.
Dykxhoorn DM, Novina CD, Sharp PA. Killing the messenger: short RNAs that silence gene expression. Nature Reviews Molecular Cell Biology. 2003;4(6):457^67.
Elbashir SM, Lendeckel W, Tuschl T. RNA interference is mediated by 21- and 22- nucleotide RNAs. Genes and Development. 2001;15(2):188-200.
Fritsch L, Martinez LA, Sekhri R, Naguibneva I, Gerard M, Vandromme M, Schaeffer L, Harel-Bellan A. Conditional gene knock-down by CRE-dependent short interfering RNAs. EMBO Rep. 2004 Feb;5(2): 178-82.
Glauser DL, Ackeraiann M, Saydam O, Fraefel C. Chimeric herpes simplex virus/adeno-associated virus amplicon vectors Curr Gene Ther. 2006 Jun;6(3):315-24. Review.
Hamilton AJ, Baulcombe DC: A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 1999, 286:950-2.
Hannon GJ. RNA interference. Nature. 2002;418(6894):244-251.
Harrop R, John J, Carroll MW. Recombinant viral vectors: cancer vaccines. Adv Drug Deliv Rev. 2006 Oct l;58(8):931-47. Epub 2006 Aug 16. Review.
He L, Hannon GJ. MicroRNAs: small RNAs with a big role in gene regulation. Nature Reviews Genetics. 2004;5(7):522-531.
Hung CF, Cheng TL, Wu RH, Teng CF, Chang WT. A novel bidirectional expression system for simultaneous expression of both the protein-coding genes and short hairpin RNAs in mammalian cells. Biochem Biophys Res Commun. 2006 Jan 27;339(4): 1035-42.
Jackson AL, Bartz SR, Schelter J, et al. Expression profiling reveals off-target gene regulation by RNAi. Nature Biotechnology. 2003;21(6):635-637.
Kanzaki LI, Looney DJ. Feline immunodeficiency virus: a concise review. Front Biosci. 2004 Jan l;9:370-7. Review.
Kasim, V., M. Miyagishi, and K. Taira. Control of siRNA expression using the Cre- loxP recombination system. Nucleic Acids Res. 2004. 32:e66.
Kim D-H, Behlke MA, Rose SD, Chang M-S, Choi S, Rossi JJ. Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy. Nature Biotechnology. 2005;23(2):222-226.
Lambeth LS, Wise TG, Moore RJ, Muralitharan MS, Doran TJ. Comparison of bovine RNA polymerase III promoters for short hairpin RNA expression. Anim Genet. 2006 Aug;37(4):369-72.
Lee NS, Dohjima T, Bauer G, et al. Expression of small interfering RNAs targeted against HIV-I rev transcripts in human cells. Nature Biotechnology. 2002;20(5):500- 505.
Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. MicroRNA genes are transcribed by RNA polymerase II. EMBO J. 2004 Oct 13;23(20):4051-60.
Martinez J, Patkaniowska A, Urlaub H, L"uhrmann R, Tuschl T. Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell. 2002; 110(5):563-574.
McManus, M.T., B.B. Haines, CP. Dillon, CE. Whitehurst, L. van Parijs, J. Chen, and P.A. Sharp. Small interfering RNA-mediated gene silencing in T lymphocytes. J. Immunol. 2002. 169:5754-5760.
Meister, G. and T. Tuschl. Mechanisms of gene silencing by double-stranded RNA. Nature 2004.431:343-349.
Mittal, V. Improving the efficiency of RNA interference in mammals. Nat. Rev. Genet. 2004. 5:355-365.
Myers, J. W., J.T. Jones, T. Meyer, and J.E. Ferrell, Jr. Recombinant Dicer efficiently converts large dsRNAs into siRNAs suitable for gene silencing. Nat. Biotechnol. 2003. 21:324-328.
Paddison PJ, Gaudy AA, Bernstein E, Hannon GJ, Conklin DS: Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 2002, 16:948-58.
Paddison PJ, Caudy AA, Hannon GJ: Stable suppression of gene expression by RNAi in mammalian cells. Proc Natl Acad Sci USA 2002, 99:1443-8.
Paul CP, Good PD, Winer I, Engelke DR. Effective expression of small interfering RNA in human cells. Nature Biotechnology. 2002;20(5):505-508.
Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS, Khvorova A. Rational siRNA design for RNA interference. Nature Biotechnology. 2004;22(3):326-330.
Reynolds PN, Feng M, Curiel DT. Chimeric viral vectors—the best of both worlds? MoI Med Today. 1999 Jan;5(l):25-31. Review.
Ristevski S. Making better transgenic models: conditional, temporal, and spatial approaches. MoI Biotechnol. 2005 Feb;29(2): 153-63. Review.
Schepelmann S, Springer CJ. Viral vectors for gene-directed enzyme prodrug therapy. Curr Gene Ther. 2006 Dec;6(6):647-70. Review
Scherer L, Rossi JJ. RNAi applications in mammalian cells. BioTechniques. 2004;36(4):557-561.
Schwarz DS, Hutv'agner G, Du T, Xu Z, Aronin N, Zamore PD. Asymmetry in the assembly of the RNAi enzyme complex. Cell. 2003; 115(2): 199-208.
Sen G, Wehrman TS, Myers JW, Blau HM. Restrictionenzyme-generated siRNA (REGS) vectors and libraries. Nature Genetics. 2004;36(2): 183-189.
Sijen T, Fleenor J, Simmer F, et al. On the role of RNA amplification in dsRNA- triggered gene silencing. Cell. 2001;107(4): 465^-76.
Stein, P., P. Svoboda, and R.M. Schultz. Transgenic RNAi in mouse oocytes: a simple and fast approach to study gene function. Dev. Biol. 2003. 256:187-193.
Tiscornia G, Tergaonkar V, Galimi F, Verma IM. CRE recombinase-inducible RNA interference mediated by lentiviral vectors. Proc Natl Acad Sci U S A. 2004 May l l;101(19):7347-51.
Tran N, Cairns MJ, Dawes IW, Arndt GM: Expressing functional siRNAs in mammalian cells using convergent transcription. BMC Biotechnol 2003, 3:21.
Woo CY, Osada T, Clay TM, Lyerly HK, Morse MA. Recent clinical progress in virus-based therapies for cancer.Expert Opin Biol Ther. 2006 Nov;6(l 1):1123-34. Review.
Xia, H., Q. Mao, H.L. Paulson, and B. L. Davidson. siRNA-mediated gene silencing in vitro and in vivo. Nat. Biotechnol. 2002. 20:1006-1010.
Yang D, Lu H, Erickson JW. Evidence that processed small dsRNAs may mediate sequence-specific mRNA degradation during RNAi in Drosophila embryos. Current Biology. 2000;10(19):l 191-1200.
Yi R, Qin Y, Macara IG, Cullen BR. Exportin-5 mediates the nuclear export of pre- microRNAs and short hairpin RNAs. Genes and Development. 2003;17(24):3011— 3016.
Yuan J, Wang X, Zhang Y, Hu X, Deng X, Fei J, Li N. shRNA transcribed by RNA Pol U promoter induce RNA interference in mammalian cell. MoI Biol Rep. 2006 Mar;33(l):43-9.
Zamore PD, Tuschl T, Sharp PA, Bartel DP: RNAi: doublestranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 2000, 101:25-33.
Zeng Y, Cai X, Cullen BR. Use of RNA polymerase II to transcribe artificial microRNAs.Methods Enzymol. 2005;392:371-80.
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
Claims
1. An isolated expression cassette comprising two or more promoters for expression of two or more heterologous siRNA sequences, the cassette comprising a first promoter operably linked to a nucleic acid encoding a first siRNA and a second promoter operably linked to a second nucleic acid encoding a second siRNA, wherein the first and second siRNAs are heterologous, and wherein the first and second siRNA sequences comprise a complementary portion of about 19-29 nucleotides in length to a gene, the complementary portion which has at least 70% identity over its length to a corresponding target site of the gene, the expression of which gene is to be down- regulated by the siRNA.
2. The expression cassette of claim 1, further comprising a third promoter operably linked to a third nucleic acid encoding a third siRNA.
3. The expression cassette of claim 2, further comprising a fourth promoter operably linked to a fourth nucleic acid encoding a fourth siRNA.
4. The expression cassette of claim 3, further comprising a fifth promoter operably linked to a fifth nucleic acid encoding a fifth siRNA.
5. The expression cassette of claim 4, further comprising a sixth promoter operably linked to a sixth nucleic acid encoding a sixth siRNA.
6. The expression cassette of claim 5, further comprising a seventh promoter operably linked to a seventh nucleic acid encoding a seventh siRNA.
7. The expression cassette of claim 6, further comprising an eighth promoter operably linked to an eighth nucleic acid encoding an eighth siRNA.
8. The expression cassette of claim 1, wherein the promoters are the same.
9. The expression cassette of claim 1, wherein the promoters are different.
10. The expression cassette of claim 1, wherein the promoter is conditional.
11. The expression cassette of claim 1 , wherein the promoter is constitutive.
12. The expression cassette of claim 1, wherein the promoters are independently selected from the group consisting of pol II and pol HI promoters.
13. The expression cassette of claim 12, wherein the pol III promoter is selected from the group consisting of Hl and U6.
14. The expression cassette of claim 12, wherein the pol II promoter is selected from the group consisting of S V40 early region promoter, CMV promoter, and adenovirus major late promoter.
15. The expression cassette of claim 1, wherein the first and second promoters are oriented back to back so that the first and second siRNAs are divergently transcribed.
16. The expression cassette of claim 1, wherein the heterologous siRNA sequences are from the same gene.
17. The expression cassette of claim 1, wherein the heterologous siRNA sequences are from the different genes.
18. The expression cassette of claim 1, wherein the gene is expressed in a cancer cell.
19. The expression cassette of claim 1 , wherein the gene is expressed by a virus.
20. The expression cassette of claim 19, wherein the virus is HIV.
21. The expression cassette of claim 20, wherein the gene is selected from the group consisting of gag, pol, tat, and env.
22. A vector comprising the expression cassette of claim 1.
23. The vector of claim 22, selected from the group consisting of a plasmid, a retroviral vector, an adenoviral vector and a lentiviral vector.
24. A host cell comprising the vector of claim 22.
25. The host cell of claim 24, wherein the cell is a mammalian cell.
26. The host cell of claim 25, wherein the cell is a human cell.
27. A method of treating of preventing a disease state in a subject, the method comprising the step of administering a therapeutically effective amount of a vector comprising an expression cassette of claim 1 to a subject in need thereof, wherein the heterologous siRNAs are expressed in the subject.
28. The method of claim 27, wherein the disease state is selected from the group consisting of genetic diseases, cancer, fungal infection, protozoal infection, bacterial infection, viral infection, ischemia, vascular disease, arthritis, and immunological disorders.
29. The method of claim 29, wherein the disease state is cancer.
30. The method of claim 30, wherein the cancer is selected from the group consisting of kidney, breast, lung, bladder, colon, ovarian, prostate, pancreas, stomach, brain, head and neck, skin, uterine, testicular, glioma, esophagus, and liver cancer, including hepatocarcinoma, lymphoma, including B-acute lymphoblastic lymphoma, non-Hodgkin's lymphomas (e.g., Burkitt's, Small Cell, and Large Cell lymphomas) and Hodgkin's lymphoma, leukemia (including AML, ALL, and CML), and multiple myeloma.
31. The method of claim 29, wherein the disease state is viral infection.
32. The method of claim 31, wherein the virus is selected from the group consisting of HIV-I, HIV-2, HTLV-I, HTLV-2, hepatitis A, hepatitis B, hepatitis C, herpes simplex virus, and influenza virus.
33. The method of claim 27, wherein the subject is a human.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US79391906P | 2006-04-20 | 2006-04-20 | |
| US60/793,919 | 2006-04-20 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007124452A2 true WO2007124452A2 (en) | 2007-11-01 |
| WO2007124452A3 WO2007124452A3 (en) | 2008-12-04 |
Family
ID=38625783
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2007/067138 Ceased WO2007124452A2 (en) | 2006-04-20 | 2007-04-20 | Methods for expressing multiple sirna and shrna from a single vector |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2007124452A2 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113661173A (en) * | 2019-03-29 | 2021-11-16 | 豪夫迈·罗氏有限公司 | Method for generating cells expressing FcRn by targeted integration of multiple expression cassettes in defined tissue format |
| US20230095695A1 (en) * | 2020-02-14 | 2023-03-30 | Apellis Pharmaceuticals, Inc. | Rnas for complement inhibition |
| US12221609B2 (en) | 2018-09-21 | 2025-02-11 | University Of Connecticut | Compositions and methods to restore paternal UBE3A gene expression in human Angelman syndrome |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002343792A1 (en) * | 2001-11-28 | 2003-06-10 | Center For Advanced Science And Technology Incubation, Ltd. | siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE-KNOCKDOWN CELLS AND THE LIKE USING THE SAME |
-
2007
- 2007-04-20 WO PCT/US2007/067138 patent/WO2007124452A2/en not_active Ceased
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12221609B2 (en) | 2018-09-21 | 2025-02-11 | University Of Connecticut | Compositions and methods to restore paternal UBE3A gene expression in human Angelman syndrome |
| CN113661173A (en) * | 2019-03-29 | 2021-11-16 | 豪夫迈·罗氏有限公司 | Method for generating cells expressing FcRn by targeted integration of multiple expression cassettes in defined tissue format |
| JP2022526556A (en) * | 2019-03-29 | 2022-05-25 | エフ.ホフマン-ラ ロシュ アーゲー | A method for producing FcRn-expressing cells by target-oriented integration of multiple expression cassettes having a predetermined configuration. |
| JP7250950B2 (en) | 2019-03-29 | 2023-04-03 | エフ. ホフマン-ラ ロシュ アーゲー | Methods for generating FcRn-expressing cells by targeted integration of multiple expression cassettes of defined configuration |
| CN113661173B (en) * | 2019-03-29 | 2024-10-01 | 豪夫迈·罗氏有限公司 | Method for generating cells expressing FcRn by targeted integration of multiple expression cassettes in a defined tissue format |
| US12466872B2 (en) | 2019-03-29 | 2025-11-11 | Hoffmann-La Roche Inc. | Method for the generation of an FCRN expressing cell by targeted integration of multiple expression cassettes in a defined organization |
| US20230095695A1 (en) * | 2020-02-14 | 2023-03-30 | Apellis Pharmaceuticals, Inc. | Rnas for complement inhibition |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2007124452A3 (en) | 2008-12-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2524569C (en) | A method of regulating gene expression | |
| Cheng et al. | RNA interference and human disease | |
| Lambeth et al. | Short hairpin RNA-mediated gene silencing | |
| US8927519B2 (en) | Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules | |
| US20080293142A1 (en) | Multiple shRNA Expression Vectors and Methods of Construction | |
| EP1462525B1 (en) | siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE KNOCKDOWN CELL OR THE LIKE USING THE SAME | |
| KR101324390B1 (en) | Multi-cistronic shRNA expression cassette for silencing single or multiple target genes | |
| KR20040072643A (en) | siRNA expression system and method for producing functional gene knock-down cell using the system | |
| JP2006505288A (en) | Allele-specific RNA interference | |
| Asada et al. | Downregulation of Dicer expression by serum withdrawal sensitizes human endothelial cells to apoptosis | |
| Feng et al. | A multifunctional lentiviral-based gene knockdown with concurrent rescue that controls for off-target effects of RNAi | |
| Kittler et al. | RNA interference: gene silencing in the fast lane | |
| EP2087115B1 (en) | Blocking of gene expression in eukaryotic cells | |
| CN108342363A (en) | It co-expresses anti-MSLN Chimeric antigen receptors and immunologic test point inhibits the transgenosis lymphocyte and application thereof of molecule | |
| CN103656674B (en) | Application of human eIF5B gene and related medicine thereof | |
| WO2007124452A2 (en) | Methods for expressing multiple sirna and shrna from a single vector | |
| CN107523569A (en) | The purposes and its related drugs of PDCD1 genes | |
| RU2410430C2 (en) | Methods and compositions for inhibiting expression of p2x7 receptor | |
| Hernández-Hoyos et al. | Analysis of T-cell development by using short interfering RNA to knock down protein expression | |
| Peng et al. | shRNA driven by Pol II/T7 dual-promoter system effectively induce cell-specific RNA interference in mammalian cells | |
| CN113913423A (en) | Application of human CFAP65 gene and related product | |
| Li et al. | An artificial small RNA editor by chimeric dsRNase with RNA binding protein | |
| Forte et al. | An effective method for adenoviral‐mediated delivery of small interfering RNA into mesenchymal stem cells | |
| Teusner et al. | Down-regulation of rhodopsin gene expression by AAV-vectored short interfering RNA | |
| CN105648042B (en) | Uses of Human YEATS4 Gene and Related Drugs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07761056 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 07761056 Country of ref document: EP Kind code of ref document: A2 |