WO2007117048A1 - Inhibitors against g6pd enzyme for treating and preventing oxidative stress and/or inflammatory related diseases and method for screening the same - Google Patents

Inhibitors against g6pd enzyme for treating and preventing oxidative stress and/or inflammatory related diseases and method for screening the same Download PDF

Info

Publication number
WO2007117048A1
WO2007117048A1 PCT/KR2006/001306 KR2006001306W WO2007117048A1 WO 2007117048 A1 WO2007117048 A1 WO 2007117048A1 KR 2006001306 W KR2006001306 W KR 2006001306W WO 2007117048 A1 WO2007117048 A1 WO 2007117048A1
Authority
WO
WIPO (PCT)
Prior art keywords
g6pd
oxidative stress
treating
expression
preventing
Prior art date
Application number
PCT/KR2006/001306
Other languages
French (fr)
Inventor
Jae Bum Kim
Ji Young Park
Original Assignee
Seoul National University Industry Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University Industry Foundation filed Critical Seoul National University Industry Foundation
Priority to PCT/KR2006/001306 priority Critical patent/WO2007117048A1/en
Publication of WO2007117048A1 publication Critical patent/WO2007117048A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/26—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase
    • C12Q1/32—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase involving dehydrogenase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01049—Glucose-6-phosphate dehydrogenase (1.1.1.49)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Definitions

  • the present invention relates to inhibitors against glucose-6-phosphate dehydrogenase (hereinafter, referred to as "G6PD” for preventing and/or treating oxidative stress and/or inflammatory related diseases, including insulin resistance, type II diabetes, cardiovascular diseases and arteriosclerosis; and methods for screening the inhibitors therefor.
  • G6PD glucose-6-phosphate dehydrogenase
  • arteriosclerosis is caused by oxidation of low-density lipoproteins (LDL) in the plasma.
  • LDL low-density lipoproteins
  • probucol as a cholesterol decreasing medicine exhibiting an antioxidative activity exhibits effectiveness for arteriosclerosis.
  • G6PD Glucose-6-phosphate dehydrogenase
  • PPP pentose phosphate pathway
  • G6PD is highly expressed in the adipocytes of several obese animal models and its overexpression in the adipocytes provoked the dysregulation of lipid metabolism and adipocytokine expression, resulting in insulin resistance (Park, J. et al., MoI. Cell Biol., 25: 5146 ⁇ 5159, 2005).
  • G6PD in adipocytes might be actively involved in the pathogenesis of metabolic disorders such as obesity and insulin resistance, and that the increase in G6PD in adipocytes might play a causative role in the development of metabolic disorders.
  • the present inventors encouraged to investigate whether G6PD overexpression in adipocytes affects oxidative stress, inflammatory signals and macrophage gene expression, thus mediating metabolic disorders.
  • RNAs small interfering RNAs
  • chemical G6PD inhibitor especially dehy- droepiandrosterone (DHEA) has been screened and confirmed to treat and/or prevent oxidative stress and/or inflammatory related diseases effectively.
  • DHEA dehy- droepiandrosterone
  • the object of the present invention is to provide inhibitors against G6PD enzyme or its expression for preventing and/or treating oxidative stress and/or inflammatory related diseases, including insulin resistance, type II diabetes, cardiovascular diseases and arteriosclerosis.
  • the other object of the present invention is to provide a method for screening the inhibitors and a screening kit therefor.
  • compositions for treating and/or preventing oxidative stress and/or inflammatory related diseases which comprises a therapeutically effective amount of one or more inhibitors of G6PD or its expression.
  • the present invention provides a method for screening an agent for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises steps: (1) cultivating a cell by adding an inhibitor into culture medium; (2) measuring the enzymatic activity of G6PD; and/or (3) evaluating the expression level of G6PD enzyme.
  • the present invention provides a kit for screening an agent for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises: (1) an expression vector containing G6PD gene; (2) a gene expression system comprising buffer reagents, enzymes and probes; and (3) a device for analyzing data.
  • the present invention provides a method for treating and/or preventing oxidative stress related and/or inflammatory diseases by using the composition comprising a therapeutically effective amount of one or more inhibitors of G6PD or its expression.
  • inhibitor is meant that a material directly or indirectly reduce the expression of a target protein and/or reduce the activity of a target protein.
  • expression vector genetically engineered plasmid or virus, derived from, for example, a bacteriophage, adenovirus, retrovirus, poxvirus, herpesvirus, or artificial chromosome, that is used to transfer an G6PD coding sequence, operably linked to a promoter, into a host cell, such that the encoded G6PD is expressed within the host cell.
  • operably linked is meant that a gene and one or more regulatory sequence are connected in such way as to permit gene expression when the appropriate molecule
  • terapéuticaally-effective amount is meant an amount of inhibitor of G6PD or its expression that, when administered to a patient, inhibits a biological activity modulated by inhibitor of G6PD or its expression.
  • FIG. 1 depicts the schematic diagram of G6PD-induced insulin resistance and chronic inflammation in adipocytes
  • FIG. 2 depicts the induction of G6PD expression in 3T3-L1 adipocytes
  • NADPH producing enzymes including G6PD, ME and IDH under high glucose challenge
  • FIG. 3 depicts the correlation of G6PD activities with the adipocyte differentiation and ROS accumulation during adipogenesis;
  • FIG. 4 depicts the oxidative stress stimulated by G6PD overexpression in adipocytes;
  • FIG. 5 depicts the mRNA expression of pro- and antioxidative enzymes by G6PD overexpression in primary rat hepatocytes
  • FIG. 6 depicts NF- ⁇ B signals activated by adipogenic G6PD overexpression
  • FIG. 7 depicts the effects of inhibitors of NF- ⁇ B and G6PD enzyme on the expression of inflammatory genes and pro-oxidative enzymes;
  • FIG. 8 depicts the macrophage gene expression involved in chronic inflammation affected by G6PD overexpression
  • FIG. 9 depicts the G6PD mRNA expression in mouse tissue and adipocytes by
  • G6PD-induced insulin resistance and chronic inflammation in adipocytes may be proceeded.
  • obesity-induced G6PD overexpression stimulates oxidative stresses by increasing the expression of pro-oxidative enzymes, which is closely linked with NF- ⁇ B signals and their target gene expression including cytokines, inflammatory signals and macrophage specific genes. These signals lead to metabolic disorders such as insulin resistance and chronic inflammation.
  • the present invention provides a composition for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises a therapeutically effective amount of one or more inhibitors of glucose-6-phosphate dehydrogenase (G6PD) or its expression.
  • G6PD glucose-6-phosphate dehydrogenase
  • the composition of the present invention can be used to treat and/or prevent an oxidative stress related disease selected among insulin resistance, type II diabetes, cardiovascular diseases, arteriosclerosis and the like.
  • the composition for treating and/or preventing an oxidative and/or inflammatory stress related disease is comprised of the inhibitor reducing the enzymatic activity of G6PD. More preferably, the composition of the present invention is comprised of dehydroepiandrosterone (DHEA) and its derivatives.
  • DHEA dehydroepiandrosterone
  • the present invention provides a composition comprised of the inhibitor reducing the expression of G6PD enzyme for treating and/or preventing an oxidative stress and/or inflammatory related disease.
  • the inhibitor can be selected from small interfering RNAs (siRNAs) of SEQ ID NO: 1 ⁇ 6 and preferably, siRNAs of SEQ ID NO: 5 - 6.
  • the oligonucleotides that are designed from Oligoengine tools to reduce the expression of G6PD enzyme and are constructed to create the recombinant vectors.
  • pSUPER-retro-siRNA-G6PD-2i Three recombinant constructs of the present invention have been named as pSUPER-retro-siRNA-G6PD-2i, pSUPER-retro-siRNA-G6PD-5i and pSUPER-retro-siRNA-G6PD-l Ii respectively.
  • the present invention provides a method for screening an inhibitor of
  • G6PD enzyme or its expression to treat oxidative stress and/or inflammatory related disease which comprises steps: (1) cultivating a cell by adding an inhibitor into culture medium; (2) measuring the enzymatic activity of G6PD; and/or (3) evaluating the expression level of G6PD enzyme.
  • one or more recombinant vectors containing G6PD gene in the method for screening an inhibitor of G6PD enzyme or its expression, one or more recombinant vectors containing G6PD gene; one or more gene expression systems comprising a recombinant cell transfected with the recombinant vector; their standard groups; enzymes; reagents and the like can be used, especially in the Step (1).
  • the recombinant vector can be an adenoviral vector, retroviral vector or the like and more preferably, AdG6PD.
  • the recombinant cell transfected with the recombinant vector can be AdG6PD-infected adipocyte.
  • the present invention provides a kit for screening an inhibitor of G6PD enzyme or its expression to treat oxidative stress and/or inflammatory related disease, which comprises: (1) an expression vector containing G6PD gene; (2) a gene expression system; and (3) a device for analyzing data.
  • the kit for screening an inhibitor of G6PD enzyme or its expression one or more expression vectors containing G6PD gene; and one or more gene expression systems comprising a recombinant cell transfected with the recombinant vector; their standard groups; enzymes; probes; reagents and the like can be included.
  • the recombinant expression vector can be an adenoviral vector, retroviral vector or the like and more preferably, AdG6PD.
  • the recombinant cell transfected with the recombinant vector can be AdG6PD-infected adipocyte.
  • the present invention provides a method for treating and/or preventing oxidative stress related and/or inflammatory diseases targeting to G6PD enzyme, including insulin resistance, type II diabetes, cardiovascular diseases, arteriosclerosis and the like by using the compositions of the present invention.
  • one or more commonly used components such as vehicle can be added through a conventional procedure.
  • the substance of the present invention can be provided as the main pharmacologically active components in an oral dosage form including, but not limited to, tablets, capsules, caplets, gelcaps, liquid solutions, suspensions or elixirs, powders, lozenges, micronized particles and osmotic delivery systems; or in a parenteral dosage form including unit administration or several times administration.
  • the dosage of the substance of the invention will vary, depending on factors such as severity of obesity or diabetes, age, sex, physical condition, administration period, administration method, discharge ratio and body weight of the patient, diet, etc.
  • the daily dose can be preferable in 0 ⁇
  • composition of the present invention can be administered solely or in a combination with operation, hormone treatment, drug and biological controller.
  • oligonucleotides used to create pSUPER-Retro-siRNAG6PD were designed from Oligoengine tools (http://www.oligoengine.com). Three sets of mouse G6PD siRNA oligonucleotides are positioned at 279 ⁇ 297, 546 ⁇ 564 and 1149 ⁇ 1167 nucleotides downstream from the transcription start site of mouse G6PD cDNA.
  • pSUPER-retro-siRNA-G6PD-2i (279 ⁇ 297)
  • pSUPER-retro-siRNA-G6PD-5i (546 ⁇ 564)
  • pSUPER-retro-siRNA-G6PD-lli (1149 ⁇ 1167), respectively.
  • siRNA sequences were as follows (See Sequence list):
  • DMEM fetal bovine serum
  • BCS bovine calf serum
  • 3T3-F442A cells were maintained in DMEM containing 10% BCS and were differentiated into adipocytes by addition of the medium with 10% FBS and insulin (5 D/ml) when the cells were confluent.
  • cDNAs used as probes were G6PD, 6PGD, ME, IDH, ADDl/SREBPlc, FAS, PPAR ⁇ C/EBP ⁇ aP2, HSL and 36B4.
  • blots were hybridized with a cDNA probe for human acidic ribosomal protein, 36B4.
  • G6PD mRNA was highly expressed in adipose tissues. Also, kidney, lung and spleen expressed moderate levels of G6PD mRNA. mRNAs of 6PGD, ME and IDH, other NADPH producing enzymes, were abundantly expressed in adipose tissues, although their tissue distributions were not the same. Compared to pre-adipocytes such as 3T3-F442A and 3T3-L1, differentiated adipocytes prominently expressed G6PD mRNA, which was increased during adi- pogenesis (See FIG. 9). Therefore, it is confirmed that G6PD play important roles in Ii- pogenesis or adipogenesis in fat cells.
  • FIG. 2 depicts the induction of G6PD expression in 3T3-L1 adipocytes.
  • FIG. 2A il- lustrates mRNA expression of NADPH producing enzymes including G6PD, ME and IDH under high glucose challenge.
  • the 3T3-L1 adipocytes were incubated for 12h with low glucose (5 mM) or high glucose (25 mM).
  • FIG. 2B illustrates the induction of G6PD mRNA by insulin, cytokines, and endotoxin. After a 12 h-starvation period, the cells were treated with high levels of insulin (5 D/ml), TNFa(IO ng/ml), and LPS (1 D/ml) for 6 h.
  • G6PD activities are correlated with the degree of adipocyte differentiation and ROS accumulation during adipogenesis.
  • 3T3-L1 cells were induced into adipocytes and analyzed for the levels of adipogenesis, and ROS accumulation by Oil red O staining (top) and the NBT assay (middle), respectively.
  • G6PD activities (bottom) were measured at the same time.
  • Nitrite was measured using the Griess reaction (Tsai, K. et al., FEBS Lett., 436: 411
  • the fluo rescence of DCF-DA was measured by a fluorescence microscope (Olympus) at an excitation wavelength of 488 nm and emission wavelength range of 515-540 nm.
  • Luminol (5 ⁇ M) was used for the quantitative measurement of the cellular ROS.
  • Chemiluminescence of luminol was determined using a luminometer (Berthold, LB9501) for 3 min.
  • FIG. 4 depicts the G6PD overexpression in adipocytes stimulating oxidative stresses.
  • FIG. 4A illustrates mRNA expression of pro- and antioxidative enzymes by G6PD overexpression.
  • the 3T3-L1 adipocytes were infected with AdMock or AdGoPD.
  • Total RNA was isolated and analyzed by Q-PCR for iNOS, NADPH oxidase (gp91phox, p22phox, p67phox, p47phox, and p40phox), SOD, and GPx. Results are represented as mean ⁇ S.E. of three independent experiments performed in duplicate.
  • ROS accumulation in G6PD-overexpressing adipocytes AdMock- or AdG6PD-infected 3T3-L1 adipocytes were either treated with or without TNF ⁇ (5 ng/ ml). TNF ⁇ was used as a positive control for ROS accumulation.
  • TNF ⁇ was used as a positive control for ROS accumulation.
  • ROS production was detected for 30 min with DCF-DA (10 ⁇ M), which generates a fluorescent signal that is visualized by a fluorescence microscope.
  • FlG. 4C quantitative measurements of ROS accumulation in adipocytes were carried out by measuring the chemiluminescence of luminol (5 ⁇ M) for 3 min. Results are represented as mean ⁇ S.E. of three independent experiments performed in triplicate.
  • FIG. 4D illustrates NO accumulation in G6PD-overexpressing adipocytes.
  • Cultured media of AdMock- or AdG6PD-infected adipocytes were used for measurement of NO concentration. Results are represented as mean ⁇ S.E. of six independent experiments performed in triplicate. **, p ⁇ 0.001 vs. AdMock control by t-test.
  • G6PD overexpression in primary rat hepatocytes Primary rat hepatocytes were isolated and infected with AdMock or AdGoPD. Total RNA was isolated and analyzed by Q-PCR for iNOS, NADPH oxidase (gp91phox, p22phox, p67phox, p47phox, and p40phox), SOD, and GPx. Results are represented as mean ⁇ S.E. of two independent experiments performed in duplicate.
  • adipogenic G6PD overexpression promotes the pro- oxidative pathways rather than the antioxidative pathways and might be linked with the increase in ROS production in the fat tissues of obese subjects.
  • Nuclear extracts from the 3T3-L1 adipocytes were isolated as described in a previous report with minor modifications (Sadowski, H. B. and Gilman, M. Z., Nature, 362: 79 ⁇ 83, 1993) and used for the EMSA.
  • the target DNA sequences of NF- ⁇ B used as probes are as follows (only one strand is shown):
  • Double-stranded oligonucleotides were end-labeled with [ ⁇ - 32 P] ATP and T4 polynucleotide kinase.
  • the nuclear extracts were mixed with radiolabeled probes (1 pmol/30,000 cpm) in reaction buffer [4 mM Tris (pH 7.9), 23 mM HEPES, 66 mM NaCl, 5 mM MgCl , 0.7 mM EDTA, 1 mM dithiothreitol, 14% (v/v) glycerol and 4 D of poly (dl-dC)]. After incubation for 25 min at room temperature, the samples were loaded onto a native polyacrylamide gel (4%).
  • FIG. 6 depicts adipogenic G6PD overexpression activating NF- ⁇ B signals.
  • FIG. 6A illustrates 3T3-L1 adipocytes were infected with AdMock or AdG6PD. Nuclear extracts were isolated and analyzed by immunoblotting with antibodies against p65 and p50. Adipocytes treated with TNF ⁇ (5 ng/ml) were used as the positive control. 3T3-L1 adipocytes were infected with AdMock or AdG6PD. After infection, the cells were either treated with or without TNF ⁇ (5 ng/ml) for 1 h. In FIG.
  • FIG. 6B cytosolic extracts of adipocytes were used for immunoblotting with antibodies against IKK ⁇ IKB ⁇ and ⁇ -tubulin.
  • FIG. 6C nuclear extracts were used for EMSA to determine NF- ⁇ B activity.
  • N.S. stands for non-specific DNA-protein complex.
  • FIG. 6D illustrates the regulation of NF- ⁇ B target gene expression in G6PD-overexpressing adipocytes. 3T3-L1 adipocytes were infected with AdMock or AdG6PD. The total cell lysates were subjected to immunoblotting with antibodies against iNOS, adiponectin, and C/ EBP ⁇ ⁇ -Tubulin was used as the loading control.
  • IL6 MCP-I, cyclooxygenase-2 (COX-2), resistin, and chemokine receptor 2 (CCR2), that are associated with insulin resistance, and inflammation were investigated.
  • G6PD-overexpressing adipocytes the expression of these pro-inflammatory genes was evidently increased (See FlG. 7A).
  • FlG. 7 depicts the effects of inhibitors of NF- ⁇ B and G6PD on the expression of inflammatory genes and pro-oxidative enzymes.
  • 3T3-L1 adipocytes were infected with AdMock or AdG6PD.
  • NF- ⁇ B inhibitors BAY 11-7082 (3.3 ⁇ M) and rosiglitazone (1 ⁇ M); the antioxidant, NAC (10 ⁇ M); and the G6PD inhibitor, DHEA (100 ⁇ M) were used to treat the AdG6PD-infected 3T3-L1 adipocytes.
  • Total RNA was isolated and analyzed for the expression of each mRNA by Q-PCR.
  • FlG. 7A mRNA levels of pro-inflammatory genes including TNF ⁇ IL6, MCPl, COX2, resistin, and CCR2.
  • HG. 7A mRNA levels of pro-inflammatory genes including TNF ⁇ IL6, MCPl, COX2, resistin, and CCR2.
  • mRNA levels of pro-oxidative enzymes such as iNOS and NADPH oxidase (gp91phox, p22phox and p47phox) were determined. Results are represented as mean ⁇ S.E. of two independent experiments performed in duplicate.
  • NF- ⁇ B inhibitors such as rosiglitazone and BAY
  • DHEA dehydroepiandrosterone
  • LPS lipopolysaccharide
  • BAY 11-7082 (BAY) and N-Acetyl-L-cysteine (NAC) were purchased from Calbiochem.
  • hTNF ⁇ was purchased from R&D Systems.
  • G6PD inhibitor were also observed in the regulation of expression of the pro-oxidative enzymes iNOS and NADPH oxidase in the G6PD-overexpressing adipocytes (See FlG. 7B). As a consequence, it is suggested that NF- ⁇ B activation by the G6PD-overexpressing adipocytes would elevate oxidative stress and inflammatory signals.
  • 3T3-L1 preadipocytes were grown to confluence in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% bovine calf serum (Gibco BRL). At two days after confluence (day 0), differentiation of the 3T3-L1 cells was induced in DMEM containing 10% FBS, methylisobutylxanthine (500 ⁇ M), dexamethasone (1 ⁇ M) and insulin (5 D/ml) for 48 h. Then, culture medium was changed on alternate days with DMEM containing 10% FBS and 5 ⁇ g/ml insulin. Peritoneal macrophages were isolated from C57BL/6 mice.
  • mice were injected with sterile fluid thioglycollate medium (1 - 2 ml) intraperitoneally. After four days, the peritoneal cells were harvested and washed with PBS containing 3 mM EDTA. Primary macrophages were cultured with in DMEM containing 10% FBS to allow cell adherence. The nonadherent cells were removed by washing with PBS, and the adherent macrophages were refed with DMEM containing 10% FBS or adipocyte culture supernatants (conditioned media).
  • the 3T3-L1 cells were differentiated on glass coverslips and infected with the indicated adenovirus. After two days, the cells were cocultured with THP-I monocytes and nonadherent THP-I cells were removed by washing with PBS. The THP-I cells adhered to the 3T3-L1 cells were fixed with cold methanol, permeabilized with 0.5% Triton X-100, and incubated with PBS containing 3% BAS for blocking. Subsequently, the cells were incubated with the CD68 monoclonal antibody (DakoCytomation Corp.) at RT for 1 h and washed with 0.1% PBST. They were then incubated at RT with TRITC-conjugated secondary antibodies. The coverslips were rinsed and placed on a slide glass with mounting solution containing DAPI. The cells were visualized using a fluorescence microscope (Olympus).
  • FlG. 8 depicts G6PD overexpression affecting macrophage gene expressions involved in chronic inflammation.
  • FlG. 5 A supernatants from control or G6PD-overexpressing adipocytes were harvested and used to treat primary peritoneal macrophages of C57BL/6 (B6) mice.
  • the relative amounts of each mRNA for iNOS, TNF ⁇ CD36, SR-A, resistin, IL6, CCR2, and COX2 were analyzed by Q-PCR. Results are represented as mean +S.E. of two independent experiments performed in duplicate. THP-I monocyte recruitment onto adipose tissues was enhanced by G6PD over- expression.
  • THP-I monocytes were cocultured with either AdMock- or AdGoPD infected adipocytes for 2 days.
  • the nonadherent monocytes were removed by washing and the monocytes attached onto the adipocytes (black arrows) were determined from microscopic images (B) and were immunostained with anti-CD68 antibody (C).
  • a metabolic change in adipocytes by G6PD overexpression would provide a certain milieu that promotes the recruitment of circulating macrophages onto adipose tissue and induces macrophage differentiation in the fat tissues of obese subjects.
  • mice treated with G6PD enzyme inhibitor of the present invention were improved in their symptoms remarkably. Therefore, the G6PD enzyme inhibitors are approved to be effective and nontoxic as a therapeutic agent for treatment oxidative stress and/or inflammatory related diseases in the present invention.
  • the present invention provides inhibitors against glucose-6-phosphate dehydrogenase or its expression for preventing and treating oxidative stress and/or inflammatory related diseases, and methods for screening the inhibitors therefor.
  • the pharmaceutical composition comprising a G6PD inhibitor of the present invention can be administered efficiently to relieve oxidative stresses and chronic inflammation closely associated with metabolic disorders including insulin resistance, type II diabetes, cardiovascular diseases and arteriosclerosis. Further, the method and the kit for screening an inhibitor of G6PD enzyme or its expression of the present invention can be applied widely to develop novel drugs for preventing and treating oxidative stress and/or inflammatory related diseases.
  • SEQ ID NO: 1 G6PD-2i-sense
  • SEQ ID NO: 2 G6PD-2i-antisense
  • SEQ ID NO: 3 G6PD-5i-sense
  • SEQ ID NO: 4 G6PD-5i-antisense
  • SEQ ID NO: 6 G6PD-1 li-antisense
  • SEQ ID NO: 8 G6PD-sense
  • SEQ ID NO: 9 G6PD-antisense
  • SEQ ID NO: 12 IDH-sense
  • SEQ ID NO: 14 TNF ⁇ -sense
  • SEQ ID NO: 15 TNF ⁇ -antisense
  • SEQ ID NO: 16 IL6-sense
  • SEQ ID NO: 17 IL6-antisense
  • SEQ ID NO: 18 Resistin-sense
  • SEQ ID NO: 19 Resistin-antisense
  • SEQ ID NO: 20 MCP-1-sense
  • SEQ ID NO: 21 MCP-1-antisense
  • SEQ ID NO: 22 CCR2-sense
  • SEQ ID NO: 24 iNOS-sense
  • SEQ ID NO: 26 gp91 ⁇ hox-sense
  • SEQ ID NO: 27 gp91phox-antisense
  • SEQ ID NO: 28 p67phox-sense
  • SEQ ID NO: 29 p67phox-antisense
  • SEQ ID NO: 30 p47phox-sense
  • SEQ ID NO: 31 p47phox-antisense
  • SEQ ID NO: 32 p40phox-sense
  • SEQ ID NO: 33 p40phox-antisense
  • SEQ ID NO: 34 p22phox-sense
  • SEQ ID NO: 35 p22phox-antisense
  • SEQ ID NO: 36 Cu,Zn-SOD-sense
  • SEQ ID NO: 37 Cu,Zn-SOD-sense
  • SEQ ID NO: 38 GPx-sense
  • SEQ ID NO: 39 GPx-antisense
  • SEQ ID NO: 40 COX2-sense
  • SEQ ID NO: 41 COX2-antisense
  • SEQ ID NO: 43 CD36-antisense
  • SEQ ID NO: 44 SR-A-sense
  • SEQ ID NO: 45 SR-A-antisense
  • SEQ ID NO: 46 Cyclophilin-sense
  • SEQ ID NO: 47 Cyclophilin-antisense
  • SEQ ID NO: 48 GAPDH-sense
  • SEQ ID NO: 49 GAPDH-antisense

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to inhibitors against glucose-6-phosphate dehydrogenase for preventing and treating oxidative stress related diseases, and methods and kits for screening the same. The pharmaceutical composition comprising a G6PD inhibitor of the present invention can relieve oxidative stresses and chronic inflammation closely associated with metabolic disorders including insulin resistance, type II diabetes, cardiovascular diseases and arteriosclerosis.

Description

Description INHIBITORS AGAINST G6PD ENZYME FOR TREATING AND
PREVENTING OXIDATIVE STRESS AND/OR INFLAMMATORY RELATED DISEASES AND METHOD FOR
SCREENING THE SAME
Technical Field
[1] The present invention relates to inhibitors against glucose-6-phosphate dehydrogenase (hereinafter, referred to as "G6PD" for preventing and/or treating oxidative stress and/or inflammatory related diseases, including insulin resistance, type II diabetes, cardiovascular diseases and arteriosclerosis; and methods for screening the inhibitors therefor.
[2]
Background Art
[3] In recent years, adverse effects of oxidative stresses in vivo on diseases have been made clear. The most popular theory is that arteriosclerosis is caused by oxidation of low-density lipoproteins (LDL) in the plasma. This theory is that oxidized LDL causes foaming of macrophages to cause arteriosclerosis. Also, the theory is strongly supported by the fact that probucol as a cholesterol decreasing medicine exhibiting an antioxidative activity exhibits effectiveness for arteriosclerosis.
[4] Besides, the effect of oxidative stress on carcinogenesis, cerebral ischemia, hepatopathy and the like may have affirmative reports. Furthermore, there have been reports on many diseases such as diabetes, nervous diseases, renal diseases, hepatic cirrhosis, arthritis, retinopathy of prematurity, ocular uveitis, retinal rust disease, senile cataract, side-effect failures due to radiation therapy, asbestos diseases, bronchial failures due to smoking, anticancer drug side-effect failures, cerebral edema, pulmonary edema, foot edema, cerebral infarction, hemolytic anemia, progeria, spilepsy, Alzheimer disease, Down syndrome, Parkinson disease, Behect's disease, Crohn's disease, Kawasaki disease, Weber-Christian disease, collagen disease, progressive systemic sclerosis, herpetic dermatitis, immune deficiency syndrome, and the like.
[5] Although the active oxygen species causing the oxidative stress are originally necessary and essential for biological defense, high oxidative stresses often exist due to reductions of in-vivo antioxidative substances with changes in eating habits or increases in amount of lipids which easily produce release sources of free radicals. According to many researches, it is thought that the oxidative stress acts as triggers or worsening factors of many diseases.
[6] In obese patients, adipose tissues exhibit increased oxidative stress, which is a major contributor to metabolic disorders such as insulin resistance, type 2 diabetes, cardiovascular disease, and atherosclerosis (Furukawa, S. et al., J. Clin. Invest., 114: 1752 ~ 1761, 2004; Evans, J. et al., Endocr. Rev., 23: 599 ~ 622, 2002; Moreno, P. R. and Fuster, V., J. Am. Coll. Cardiol., 44: 2293 ~ 2300, 2004). It has been reported that antioxidant drugs, including αlipoic acid and mimetics of SOD or catalase, improve diabetic complications by reducing oxidative stress. In addition, several drugs for cardiovascular disease or type 2 diabetes such as statin and thiazolidinedione also decrease the intracellular ROS. Thus, it is very likely that obesity-related oxidative stress is closely associated with metabolic disorders.
[7] Glucose-6-phosphate dehydrogenase (G6PD) is the first rate-limiting enzyme of pentose phosphate pathway (PPP), one of the intracellular sources of NADPH generation and highly conserved in most mammalian species (Kletzien, R. F. et al., Faseb J. 8: 174-181, 1994). It has been previously reported that NADPH produced by G6PD is required for both the production of ROS, including superoxide anions and nitric oxide and the elimination of these ROS via glutathione peroxidase and catalase, in different cell types (Spolarics, Z., J. Nutr., 129: 105 ~ 108, 1999).
[8] Recently, the present inventors revealed that G6PD is highly expressed in the adipocytes of several obese animal models and its overexpression in the adipocytes provoked the dysregulation of lipid metabolism and adipocytokine expression, resulting in insulin resistance (Park, J. et al., MoI. Cell Biol., 25: 5146 ~ 5159, 2005).
[9] Further, it appears that the G6PD in adipocytes might be actively involved in the pathogenesis of metabolic disorders such as obesity and insulin resistance, and that the increase in G6PD in adipocytes might play a causative role in the development of metabolic disorders. Thus, the present inventors encouraged to investigate whether G6PD overexpression in adipocytes affects oxidative stress, inflammatory signals and macrophage gene expression, thus mediating metabolic disorders.
[10] Therefore, the present inventors have tried to exploit the action of G6PD enzyme and screened inhibitors of G6PD enzyme or its expression that can be used to prevent and/or treat oxidative stress and/or inflammatory related diseases. In detail, small interfering RNAs (hereinafter, referred to as "siRNAs") that can suppress the G6PD expression have been designed. Further, chemical G6PD inhibitor, especially dehy- droepiandrosterone (DHEA) has been screened and confirmed to treat and/or prevent oxidative stress and/or inflammatory related diseases effectively.
[11] Hence, the present inventors has been developed novel therapeutic compositions comprising an effective amount of one or more inhibitors of G6PD enzyme or its expression, methods for screening inhibitors of G6PD or its expression and kits for screening the same and completed the invention successfully. [12]
Disclosure of Invention Technical Problem
[13] The object of the present invention is to provide inhibitors against G6PD enzyme or its expression for preventing and/or treating oxidative stress and/or inflammatory related diseases, including insulin resistance, type II diabetes, cardiovascular diseases and arteriosclerosis.
[14] In addition, the other object of the present invention is to provide a method for screening the inhibitors and a screening kit therefor.
[15]
Technical Solution
[16] In order to achieve the above-mentioned objects, the present invention provides compositions for treating and/or preventing oxidative stress and/or inflammatory related diseases, which comprises a therapeutically effective amount of one or more inhibitors of G6PD or its expression.
[17] In addition, the present invention provides a method for screening an agent for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises steps: (1) cultivating a cell by adding an inhibitor into culture medium; (2) measuring the enzymatic activity of G6PD; and/or (3) evaluating the expression level of G6PD enzyme.
[18] In addition, the present invention provides a kit for screening an agent for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises: (1) an expression vector containing G6PD gene; (2) a gene expression system comprising buffer reagents, enzymes and probes; and (3) a device for analyzing data.
[19] In addition, the present invention provides a method for treating and/or preventing oxidative stress related and/or inflammatory diseases by using the composition comprising a therapeutically effective amount of one or more inhibitors of G6PD or its expression.
[20]
[21] Definitions
[22] By "nhibitor" is meant that a material directly or indirectly reduce the expression of a target protein and/or reduce the activity of a target protein.
[23] By "expression vector" is meant genetically engineered plasmid or virus, derived from, for example, a bacteriophage, adenovirus, retrovirus, poxvirus, herpesvirus, or artificial chromosome, that is used to transfer an G6PD coding sequence, operably linked to a promoter, into a host cell, such that the encoded G6PD is expressed within the host cell. [24] By "operably linked" is meant that a gene and one or more regulatory sequence are connected in such way as to permit gene expression when the appropriate molecule
(e.g., transcriptional activator proteins) are bound to the regulatory sequences. [25] [26] By "therapeutically-effective amount" is meant an amount of inhibitor of G6PD or its expression that, when administered to a patient, inhibits a biological activity modulated by inhibitor of G6PD or its expression. [27]
Brief Description of the Drawings [28] The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which; [29] FIG. 1 depicts the schematic diagram of G6PD-induced insulin resistance and chronic inflammation in adipocytes;
[30] FIG. 2 depicts the induction of G6PD expression in 3T3-L1 adipocytes;
[31] A. NADPH producing enzymes including G6PD, ME and IDH under high glucose challenge
[32] B. Influence of insulin, cytokines, and endotoxin.
[33] FIG. 3 depicts the correlation of G6PD activities with the adipocyte differentiation and ROS accumulation during adipogenesis; [34] FIG. 4 depicts the oxidative stress stimulated by G6PD overexpression in adipocytes;
[35] A. mRNA expression of pro- and antioxidative enzymes by G6PD overexpression
[36] B and C. Ros accumulation in G6PD-overexpressing adipocytes
[37] D. NO accumulation in G6PD-overexpressing adipocytes
[38] FIG. 5 depicts the mRNA expression of pro- and antioxidative enzymes by G6PD overexpression in primary rat hepatocytes;
[39] FIG. 6 depicts NF-κB signals activated by adipogenic G6PD overexpression;
[40] A. 3T3-L1 adipocytes were infected with AdMock or AdG6PD
[41] B. Cytosolic extracts of adipocytes were used for immunoblotting with antibodies against IKKβ IκBαand β-tubulin [42] C. Nuclear extracts of adipocytes were used for EMSA to determine NF-κB activity [43] D. Regulation of NF-κB target gene expression in G6PD-overexpressing adipocytes [44] FIG. 7 depicts the effects of inhibitors of NF-κB and G6PD enzyme on the expression of inflammatory genes and pro-oxidative enzymes;
[45] A. Pro-inflammatory genes including TNFα IL6, MCPl, COX2, resistin, and
CCR2
[46] B. Pro-oxidative enzymes including iNOS and NADPH oxidase
[47]
[48] FIG. 8 depicts the macrophage gene expression involved in chronic inflammation affected by G6PD overexpression;
[49] A. Each mRNA for iNOS, TNFα CD36, SR-A, resistin, IL6, CCR2, and COX2
[50] B and C. THP-I monocyte recruitment
[51] FIG. 9 depicts the G6PD mRNA expression in mouse tissue and adipocytes by
Northern blot analysis;
[52]
Best Mode for Carrying Out the Invention
[53] Hereinafter, the present invention will be described more clearly as follows.
[54] As illustrated in FIG. 1, G6PD-induced insulin resistance and chronic inflammation in adipocytes may be proceeded. In detail, obesity-induced G6PD overexpression stimulates oxidative stresses by increasing the expression of pro-oxidative enzymes, which is closely linked with NF-κB signals and their target gene expression including cytokines, inflammatory signals and macrophage specific genes. These signals lead to metabolic disorders such as insulin resistance and chronic inflammation.
[55] The present invention provides a composition for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises a therapeutically effective amount of one or more inhibitors of glucose-6-phosphate dehydrogenase (G6PD) or its expression. The composition of the present invention can be used to treat and/or prevent an oxidative stress related disease selected among insulin resistance, type II diabetes, cardiovascular diseases, arteriosclerosis and the like.
[56] Preferably, the composition for treating and/or preventing an oxidative and/or inflammatory stress related disease is comprised of the inhibitor reducing the enzymatic activity of G6PD. More preferably, the composition of the present invention is comprised of dehydroepiandrosterone (DHEA) and its derivatives.
[57] It is natural that any kind of substances that suppress the G6PD enzymatic activity directly and/or indirectly can adopted for the G6PD inhibitor of the present invention.
[58] In addition, the present invention provides a composition comprised of the inhibitor reducing the expression of G6PD enzyme for treating and/or preventing an oxidative stress and/or inflammatory related disease. Preferably, the inhibitor can be selected from small interfering RNAs (siRNAs) of SEQ ID NO: 1 ~ 6 and preferably, siRNAs of SEQ ID NO: 5 - 6.
[59] In the present invention, the oligonucleotides that are designed from Oligoengine tools to reduce the expression of G6PD enzyme and are constructed to create the recombinant vectors.
[60] In detail, three sets of mouse G6PD siRNA oligonucleotides are positioned at 279 ~
297, 546 ~ 564 and 1149 ~ 1167 nucleotides downstream from the transcription start site of mouse G6PD cDNA. Three recombinant constructs of the present invention have been named as pSUPER-retro-siRNA-G6PD-2i, pSUPER-retro-siRNA-G6PD-5i and pSUPER-retro-siRNA-G6PD-l Ii respectively.
[61] It is natural that any kind of recombinant vectors using above-mentioned oligonucleotides to regulate the enzymatic activity and the gene expression of G6PD can be within the scope of the present invention, if used to treat and/or prevent oxidative stress and/or inflammatory related diseases.
[62] In addition, the present invention provides a method for screening an inhibitor of
G6PD enzyme or its expression to treat oxidative stress and/or inflammatory related disease, which comprises steps: (1) cultivating a cell by adding an inhibitor into culture medium; (2) measuring the enzymatic activity of G6PD; and/or (3) evaluating the expression level of G6PD enzyme.
[63] In the method for screening an inhibitor of G6PD enzyme or its expression, one or more recombinant vectors containing G6PD gene; one or more gene expression systems comprising a recombinant cell transfected with the recombinant vector; their standard groups; enzymes; reagents and the like can be used, especially in the Step (1).
[64] Preferably, the recombinant vector can be an adenoviral vector, retroviral vector or the like and more preferably, AdG6PD. Preferably, the recombinant cell transfected with the recombinant vector can be AdG6PD-infected adipocyte.
[65] In addition, the present invention provides a kit for screening an inhibitor of G6PD enzyme or its expression to treat oxidative stress and/or inflammatory related disease, which comprises: (1) an expression vector containing G6PD gene; (2) a gene expression system; and (3) a device for analyzing data.
[66] In the kit for screening an inhibitor of G6PD enzyme or its expression, one or more expression vectors containing G6PD gene; and one or more gene expression systems comprising a recombinant cell transfected with the recombinant vector; their standard groups; enzymes; probes; reagents and the like can be included. Preferably, the recombinant expression vector can be an adenoviral vector, retroviral vector or the like and more preferably, AdG6PD. Preferably, the recombinant cell transfected with the recombinant vector can be AdG6PD-infected adipocyte.
[67] In addition, the present invention provides a method for treating and/or preventing oxidative stress related and/or inflammatory diseases targeting to G6PD enzyme, including insulin resistance, type II diabetes, cardiovascular diseases, arteriosclerosis and the like by using the compositions of the present invention.
[68] Depending on the desired uses of substance according to the present invention, one or more commonly used components such as vehicle can be added through a conventional procedure.
[69] The substance of the present invention can be provided as the main pharmacologically active components in an oral dosage form including, but not limited to, tablets, capsules, caplets, gelcaps, liquid solutions, suspensions or elixirs, powders, lozenges, micronized particles and osmotic delivery systems; or in a parenteral dosage form including unit administration or several times administration.
[70] The dosage of the substance of the invention will vary, depending on factors such as severity of obesity or diabetes, age, sex, physical condition, administration period, administration method, discharge ratio and body weight of the patient, diet, etc.
[71] In the composition of the present invention, the daily dose can be preferable in 0 ~
1,000 D/kg and more preferable in 10 ~ 100 D/kg.
[72] The pharmaceutical composition of the present invention can be administered solely or in a combination with operation, hormone treatment, drug and biological controller.
[73]
[74] EXAMPLES
[75] Practical and presently preferred embodiments of the present invention are illustrated as shown in the following Examples.
[76] However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.
[77]
[78] <Example 1> Preparation of siRNAs of G6PD
[79] The sequences of oligonucleotides used to create pSUPER-Retro-siRNAG6PD were designed from Oligoengine tools (http://www.oligoengine.com). Three sets of mouse G6PD siRNA oligonucleotides are positioned at 279 ~ 297, 546 ~ 564 and 1149 ~ 1167 nucleotides downstream from the transcription start site of mouse G6PD cDNA. Three constructs were referred as pSUPER-retro-siRNA-G6PD-2i (279 ~ 297), pSUPER-retro-siRNA-G6PD-5i (546 ~ 564) and pSUPER-retro-siRNA-G6PD-lli (1149 ~ 1167), respectively.
[80] The siRNA sequences were as follows (See Sequence list):
[81] (1) SEQ K) NO: 1 : G6PD-2i-sense,
[82] 5'GATCCCCGAAAGACCTAAGCTGGAGGTTCAAGAGACCTCCAGCTT AG-
GTCTTTCTTTTTGGAAA-3'
[83] (2) SEQ ID NO: 2: G6PD-2i-antisense, [84] 5'AGCTTTTCCAAAAAGAAAGACCTAAGCTGGAGGTCTCTTGAACCT
CCAGCTTAGGTCTTTCGGG-3';
[85] (3) SEQ K) NO: 3: G6PD-5i-sense,
[86] 5'GATCCCCCTGTCGAACCACATCTCCTTTCAAGAGAAGGAGATGTGGTT
CGACAGTTTTTGGAAA-S'
[87] (4) SEQ K) NO: 4: G6PD-5i-antisense,
[88] 5'AGCTTTTCCAAAAACTGTCGAACCACATCTCCTTCTCTTGAAAGG AGATGTGGTTCGACAGGGG-3'
[89] (5) SEQ K) NO: 5: G6PD-1 li-antisense,
[90] 5'GATCCCCCAGTGCAAGCGTAATGAGCTTCAAGAGAGCTCATTACG
CTTGCACTGTTTTTGGAAA-3'
[91] (6) SEQ K) NO: 6: G6PD-1 li-antisense,
[92] 5'AGCTTTTCCAAAAACAGTGCAAGCGTAATGAGCTCTCTTGAAGCT CATTACGCTTGCACTGGGG-3'
[93] These oligonucleotides were annealed and then cloned into pSUPER-Retro vector
(OligoEngine). The DNA constructs were used to produce G6PD siRNA retrovirus. siRNA experiments were performed as described by the manufacturer's protocols (OligoEngine).
[94]
[95] <Example 2> Expression of G6PD mRNA in mouse tissue and adipocyte
[96]
[97] (1) Cell culture.
[98] 3T3-L1 cells were grown to confluence in Dulbecco's modifided Eagle's medium
(DMEM) supplemented with 10% bovine calf serum (BCS, Gibco BRL). Differentiation of 3T3-L1 cells was induced as described previously. Briefly, after two days of post-confluence, 3T3-L1 cells were incubated with DMEM containing 10% fetal bovine serum (FBS, Gibco BRL), 3-isobutyl-l-methylxanthine (500 μM), dex- amethasone (1 μM) and insulin (5 D/ml) for 48 h. Culture medium was changed every other day with DMEM containing 10% FBS and insulin (5 D/ml).
[99] 3T3-F442A cells were maintained in DMEM containing 10% BCS and were differentiated into adipocytes by addition of the medium with 10% FBS and insulin (5 D/ml) when the cells were confluent.
[100]
[101] (2)Northern blot analysis
[102] Total RNA was isolated with TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer's protocol. Then, each RNA was denatured in formamide and formaldehyde, and separated by electrophoresis on formaldehyde- containing agarose gels. After electrophoresis, RNA was transferred to nylon membrane (Schleicher and Schuell, Germany), which was cross-linked with UV and hybridized with DNA probes. DNA probes were labeled by random priming method using the Klenow fragment of DNA polymerase I (Takara, Japan) and [α-32P]dCTP (Amer sham-Pharmacia). cDNAs used as probes were G6PD, 6PGD, ME, IDH, ADDl/SREBPlc, FAS, PPARγ C/EBPα aP2, HSL and 36B4. In order to normalize RNA loading, blots were hybridized with a cDNA probe for human acidic ribosomal protein, 36B4.
[103]
[104] (3)Measurement
[105] Above all, in order to examine the tissue distribution of G6PD mRNA, Northern blot analysis was preformed. As shown in FIG. 9, G6PD mRNA was highly expressed in adipose tissues. Also, kidney, lung and spleen expressed moderate levels of G6PD mRNA. mRNAs of 6PGD, ME and IDH, other NADPH producing enzymes, were abundantly expressed in adipose tissues, although their tissue distributions were not the same. Compared to pre-adipocytes such as 3T3-F442A and 3T3-L1, differentiated adipocytes prominently expressed G6PD mRNA, which was increased during adi- pogenesis (See FIG. 9). Therefore, it is confirmed that G6PD play important roles in Ii- pogenesis or adipogenesis in fat cells.
[106]
[107] <Example 3> Examination of G6PD mRNA under diabetic conditions
[108] (1) Quantitative RT-PCR
[109] Total RNA was isolated with Trizol (Invitrogen Life Technologies). cDNA was synthesized using the Superscript First Strand Synthesis System (Invitrogen Life Technologies). Real time RT-PCR was performed on iCycler Real-time PCR Detection System (Bio-Rad) using SYBR Green I (BioWhittaker Molecular Applications) with each primer set shown in SEQ ID NO: 8 ~ SEQ ID NO: 49 (See Sequence list). The relative values of each mRNA were normalized with the levels of cyclophilin or GAPDH mRNA.
[110] In order to investigate the increase of G6PD mRNA in diabetes, 3T3-L1 adipocytes were exposed to several conditions associated with metabolic disorders, and then, G6PD mRNA levels were examined by real-time quantitative PCR (Q-PCR). As shown in FIG. 2A, the G6PD mRNA expression was significantly increased by high glucose treatment, while the other NADPH-producing enzymes such as malic enzyme (ME) and isocitrate dehydrogenase (IDH) were only marginally affected. Similarly, high levels of insulin, TNFα and LPS remarkably elevated G6PD mRNA in adipocytes (See FIG. 2B), imply that in metabolic disorders, adipocytes would promote G6PD expression.
[Ill] FIG. 2 depicts the induction of G6PD expression in 3T3-L1 adipocytes. FIG. 2A il- lustrates mRNA expression of NADPH producing enzymes including G6PD, ME and IDH under high glucose challenge. The 3T3-L1 adipocytes were incubated for 12h with low glucose (5 mM) or high glucose (25 mM). FIG. 2B illustrates the induction of G6PD mRNA by insulin, cytokines, and endotoxin. After a 12 h-starvation period, the cells were treated with high levels of insulin (5 D/ml), TNFa(IO ng/ml), and LPS (1 D/ml) for 6 h.
[112] As depicted in FIG. 3, in 3T3-L1 adipocytes, G6PD activities are correlated with the degree of adipocyte differentiation and ROS accumulation during adipogenesis. 3T3-L1 cells were induced into adipocytes and analyzed for the levels of adipogenesis, and ROS accumulation by Oil red O staining (top) and the NBT assay (middle), respectively. G6PD activities (bottom) were measured at the same time.
[113]
[114] <Example 4> Examination of pro-oxidative enzymes and oxidative stress elevated by overexpression of G6PD in adipocytes
[115] (1 )Measurement of cellular nitrite and ROS levels
[116] Nitrite was measured using the Griess reaction (Tsai, K. et al., FEBS Lett., 436: 411
-414, 1998). Culture media (100 D) were collected and incubated with an equal volume of Griess reagent for 10 min at room temperature. The nitrite concentration was determined from the absorbance measured at 550 nm using sodium nitrite as the standard. Cellular ROS was measured using 2,7-dichlorodihydrofluorescein diacetate (DCF-DA) and luminol (Molecular Probes, Inc). The 3T3L1 adipocytes were washed with PBS and incubated in the dark for 30 min with DCF-DA (10 μM). The fluo rescence of DCF-DA was measured by a fluorescence microscope (Olympus) at an excitation wavelength of 488 nm and emission wavelength range of 515-540 nm. Luminol (5 μM) was used for the quantitative measurement of the cellular ROS. Chemiluminescence of luminol was determined using a luminometer (Berthold, LB9501) for 3 min.
[117] In order to examine pro-oxidative enzymes and oxidative stress elevated by over- expression of G6PD in adipocytes, the pro- or antioxidative signaling by this was measured. In the G6PD-overexpressing adipocytes infected with a G6PD adenovirus (AdG6PD), the mRNA levels of pro-oxidative enzymes including iNOS and NADPH oxidase components (gp91phox, p22phox p67phox, p47phox, and p40phox) were elevated, while those of the antioxidative enzymes including superoxide dismutase (SOD) and glutathione peroxidase (GPx) were slightly increased or not altered (See FIG. 4A).
[118] FIG. 4 depicts the G6PD overexpression in adipocytes stimulating oxidative stresses. FIG. 4A illustrates mRNA expression of pro- and antioxidative enzymes by G6PD overexpression. The 3T3-L1 adipocytes were infected with AdMock or AdGoPD. Total RNA was isolated and analyzed by Q-PCR for iNOS, NADPH oxidase (gp91phox, p22phox, p67phox, p47phox, and p40phox), SOD, and GPx. Results are represented as mean ±S.E. of three independent experiments performed in duplicate. ROS accumulation in G6PD-overexpressing adipocytes, AdMock- or AdG6PD-infected 3T3-L1 adipocytes were either treated with or without TNFα(5 ng/ ml). TNFα was used as a positive control for ROS accumulation. In FlG. 4B, ROS production was detected for 30 min with DCF-DA (10 μM), which generates a fluorescent signal that is visualized by a fluorescence microscope. In FlG. 4C, quantitative measurements of ROS accumulation in adipocytes were carried out by measuring the chemiluminescence of luminol (5 μM) for 3 min. Results are represented as mean ±S.E. of three independent experiments performed in triplicate. *, p<0.005 vs. AdMock control by t-test. FlG. 4D illustrates NO accumulation in G6PD-overexpressing adipocytes. Cultured media of AdMock- or AdG6PD-infected adipocytes were used for measurement of NO concentration. Results are represented as mean ±S.E. of six independent experiments performed in triplicate. **, p<0.001 vs. AdMock control by t-test.
[119] As depicted in FlG. 5, mRNA expression of pro- and antioxidative enzymes by
G6PD overexpression in primary rat hepatocytes. Primary rat hepatocytes were isolated and infected with AdMock or AdGoPD. Total RNA was isolated and analyzed by Q-PCR for iNOS, NADPH oxidase (gp91phox, p22phox, p67phox, p47phox, and p40phox), SOD, and GPx. Results are represented as mean ±S.E. of two independent experiments performed in duplicate.
[120] As a result, it is suggested that adipogenic G6PD overexpression promotes the pro- oxidative pathways rather than the antioxidative pathways and might be linked with the increase in ROS production in the fat tissues of obese subjects.
[121] Further, in order to verify these observations, the levels of cellular ROS and nitric oxide (NO) in G6PD-overexpressing adipocytes were directly determined. Compared with a mock adenovirus (AdMock) control, the AdG6PD-infected adipocytes increased cellular ROS (See HG. 4B and C) and NO (See HG. 4D). Consequently, it is confirmed that the NADPH generated by G6PD in adipocytes primarily contributes to the production of oxidative stress, which might cause pro-inflammatory response and insulin resistance.
[122]
[123] <Example 5> Examination of NF- KB signaling stimulated by increased G6PD expression in adipocytes
[124]
[ 125] ( 1 ) Electrophoretic mobility shift assay (EMSA)
[126] Nuclear extracts from the 3T3-L1 adipocytes were isolated as described in a previous report with minor modifications (Sadowski, H. B. and Gilman, M. Z., Nature, 362: 79 ~ 83, 1993) and used for the EMSA. The target DNA sequences of NF-κB used as probes are as follows (only one strand is shown):
[127] (7) SEQ K) NO: 7:
[128] 5'-AGTTGAGGGGACTTTCCCAGGC-S'
[129] Double-stranded oligonucleotides were end-labeled with [γ-32P] ATP and T4 polynucleotide kinase. The nuclear extracts were mixed with radiolabeled probes (1 pmol/30,000 cpm) in reaction buffer [4 mM Tris (pH 7.9), 23 mM HEPES, 66 mM NaCl, 5 mM MgCl , 0.7 mM EDTA, 1 mM dithiothreitol, 14% (v/v) glycerol and 4 D of poly (dl-dC)]. After incubation for 25 min at room temperature, the samples were loaded onto a native polyacrylamide gel (4%).
[130] In order to examine whether G6PD overexpression in adipocytes alters NF-κB signaling and its target gene expression, the 3T3-L1 adipocytes were infected with AdMock or AdG6PD and subjected to Western blot analysis. As compared with AdMock, the AdG6PD-infected adipocytes demonstrated increased expression of the p65 subunits of NF-κB in the nuclear fraction (See FIG. 6A).
[131] FIG. 6 depicts adipogenic G6PD overexpression activating NF-κB signals. FIG. 6A illustrates 3T3-L1 adipocytes were infected with AdMock or AdG6PD. Nuclear extracts were isolated and analyzed by immunoblotting with antibodies against p65 and p50. Adipocytes treated with TNFα(5 ng/ml) were used as the positive control. 3T3-L1 adipocytes were infected with AdMock or AdG6PD. After infection, the cells were either treated with or without TNFα(5 ng/ml) for 1 h. In FIG. 6B, cytosolic extracts of adipocytes were used for immunoblotting with antibodies against IKKβ IKB α and β-tubulin. In FIG. 6C, nuclear extracts were used for EMSA to determine NF-κB activity. N.S. stands for non-specific DNA-protein complex. FIG. 6D illustrates the regulation of NF-κB target gene expression in G6PD-overexpressing adipocytes. 3T3-L1 adipocytes were infected with AdMock or AdG6PD. The total cell lysates were subjected to immunoblotting with antibodies against iNOS, adiponectin, and C/ EBPα β-Tubulin was used as the loading control.
[132] At this moment, TNFα treatment was used as a positive control for the activation of
NF-κB signaling (See FIG. 6A). In addition, the level of inhibitory KB (IκB)α which is an inhibitor of NF-κB, was reduced and that of IKB kinase β (IKKβ) was slightly increased by G6PD overexpression as compared with the mock control (See FIG. 6B). These effects were augmented by TNFαtreatment.
[133] In order to confirm these results, the nuclear extracts of the 3T3-L1 adipocytes infected with either AdMock or AdG6PD were examined for the DNA-binding activity of NF-κB. As a result, it is observed that the DNA-binding activity of NF-κB was greatly increased in the G6PD-overexpressing adipocytes (See FIG. 6C). [134] Since the NF-κB signaling was stimulated in the G6PD-overexpressing adipocytes, the expression levels of NF-κB targets were measured. As shown in FlG. 6D, iNOS was significantly elevated in the G6PD-overexpressing adipocytes, whereas adiponectin and C/EBPαwere decreased. Similar results were obtained on treatment with TNFα (See FlG. 6D). Consequently, it is implied that the oxidative stress produced by G6PD overexpression in adipocytes would, at least in part, cause insulin resistance and/or inflammatory signals by activating NF-κB.
[135]
[136] <Example 6> Examination of pro-inflammatory gene expression enhanced by
G6PD expression in adipocytes
[137] The mRNA expression profiles of several pro-inflammatory genes including TNFα
IL6, MCP-I, cyclooxygenase-2 (COX-2), resistin, and chemokine receptor 2 (CCR2), that are associated with insulin resistance, and inflammation were investigated. In G6PD-overexpressing adipocytes, the expression of these pro-inflammatory genes was evidently increased (See FlG. 7A). FlG. 7 depicts the effects of inhibitors of NF-κB and G6PD on the expression of inflammatory genes and pro-oxidative enzymes. 3T3-L1 adipocytes were infected with AdMock or AdG6PD. NF-κB inhibitors, BAY 11-7082 (3.3 μM) and rosiglitazone (1 μM); the antioxidant, NAC (10 μM); and the G6PD inhibitor, DHEA (100 μM) were used to treat the AdG6PD-infected 3T3-L1 adipocytes. Total RNA was isolated and analyzed for the expression of each mRNA by Q-PCR. In FlG. 7A, mRNA levels of pro-inflammatory genes including TNFα IL6, MCPl, COX2, resistin, and CCR2. In HG. 7B, mRNA levels of pro-oxidative enzymes such as iNOS and NADPH oxidase (gp91phox, p22phox and p47phox) were determined. Results are represented as mean ±S.E. of two independent experiments performed in duplicate.
[138]
[139] In addition, pretreatment with NF-κB inhibitors, such as rosiglitazone and BAY
11-7082, and the antioxidant N-Acetyl-L-cysteine (NAC) as well as the G6PD inhibitor, dehydroepiandrosterone (DHEA) substantially reduced the effects of G6PD on pro-inflammatory gene expression (See FlG. 7A). At this moment, salicylate, dehydroepiandrosterone (DHEA) and lipopolysaccharide (LPS) were purchased from Sigma. BAY 11-7082 (BAY) and N-Acetyl-L-cysteine (NAC) were purchased from Calbiochem. hTNFα was purchased from R&D Systems.
[140] The efficacies of these drugs, i.e., the NF-κB inhibitors, the antioxidant, and the
G6PD inhibitor were also observed in the regulation of expression of the pro-oxidative enzymes iNOS and NADPH oxidase in the G6PD-overexpressing adipocytes (See FlG. 7B). As a consequence, it is suggested that NF-κB activation by the G6PD-overexpressing adipocytes would elevate oxidative stress and inflammatory signals.
[141]
[142] <Example 7> Examination of macrophage-specific gene expression affected by adipogenic G6PD overexpression
[143]
[ 144] ( 1 ) Cell culture and macrophage isolation
[145] 3T3-L1 preadipocytes were grown to confluence in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% bovine calf serum (Gibco BRL). At two days after confluence (day 0), differentiation of the 3T3-L1 cells was induced in DMEM containing 10% FBS, methylisobutylxanthine (500 μM), dexamethasone (1 μM) and insulin (5 D/ml) for 48 h. Then, culture medium was changed on alternate days with DMEM containing 10% FBS and 5 μg/ml insulin. Peritoneal macrophages were isolated from C57BL/6 mice. The mice were injected with sterile fluid thioglycollate medium (1 - 2 ml) intraperitoneally. After four days, the peritoneal cells were harvested and washed with PBS containing 3 mM EDTA. Primary macrophages were cultured with in DMEM containing 10% FBS to allow cell adherence. The nonadherent cells were removed by washing with PBS, and the adherent macrophages were refed with DMEM containing 10% FBS or adipocyte culture supernatants (conditioned media).
[146] (2) Immunocy tochemistry
[147] The 3T3-L1 cells were differentiated on glass coverslips and infected with the indicated adenovirus. After two days, the cells were cocultured with THP-I monocytes and nonadherent THP-I cells were removed by washing with PBS. The THP-I cells adhered to the 3T3-L1 cells were fixed with cold methanol, permeabilized with 0.5% Triton X-100, and incubated with PBS containing 3% BAS for blocking. Subsequently, the cells were incubated with the CD68 monoclonal antibody (DakoCytomation Corp.) at RT for 1 h and washed with 0.1% PBST. They were then incubated at RT with TRITC-conjugated secondary antibodies. The coverslips were rinsed and placed on a slide glass with mounting solution containing DAPI. The cells were visualized using a fluorescence microscope (Olympus).
[148] Adipocytes secrete various adipocytokines that regulate whole body energy homeostasis by acting on other tissues, including the brain, liver, muscles and macrophages (Kahn, B. B. and Flier, J. S., J. Clin. Invest., 106: 473 ~ 481, 2000). Recently, the interactions between adipose tissues and peripheral macrophages have been implicated in the insulin resistance and inflammatory signals observed in obesity (Weisberg, S. P. et al., J. Clin. Invest., 112: 1796 ~ 1808, 2003). However, the identity of the molecular linkers of this interaction was largely unknown. The observation that the increase in G6PD expression in adipocytes promoted oxidative stress and pro- inflammatory signals led to the examination of the effects of adipogenic G6PD over- expression on macrophage biology. Peritoneal macrophages were incubated with su- pernatants (conditioned media) from adipocyte cultures infected with either AdMock or AdGoPD. Total RNA was isolated from these macrophages and analyzed for gene expression. Interestingly, the mRNA expression of macrophage genes including iNOS, TNFα CD36, SR-A, IL6, CCR2 and COX-2 that are responsible for the inflammatory signals and macrophage differentiation was enhanced by the supernatants from G6PD-overexpressing adipocytes (See FlG. 8A), indicating that certain molecules secreted from the G6PD-overexpressing adipocytes modulate the pro-inflammatory signals as well as the macrophage-specific gene expression.
[149] FlG. 8 depicts G6PD overexpression affecting macrophage gene expressions involved in chronic inflammation. In FlG. 5 A, supernatants from control or G6PD-overexpressing adipocytes were harvested and used to treat primary peritoneal macrophages of C57BL/6 (B6) mice. The relative amounts of each mRNA for iNOS, TNFα CD36, SR-A, resistin, IL6, CCR2, and COX2 were analyzed by Q-PCR. Results are represented as mean +S.E. of two independent experiments performed in duplicate. THP-I monocyte recruitment onto adipose tissues was enhanced by G6PD over- expression. THP-I monocytes were cocultured with either AdMock- or AdGoPD infected adipocytes for 2 days. The nonadherent monocytes were removed by washing and the monocytes attached onto the adipocytes (black arrows) were determined from microscopic images (B) and were immunostained with anti-CD68 antibody (C).
[150] Next, in order to elucidate whether the G6PD overexpression in adipocytes promotes the recruitment of macrophages onto the adipose tissue, AdMock- and AdG6PD-infected 3T3-L1 cells were incubated with human monocytes THP-I. Surprisingly, it is observed that more THP-I cells were actively recruited to the G6PD-overexpressing adipocytes as compared with the control adipocytes (See FlG. 8B and C). As a result, it is suggested that a metabolic change in adipocytes by G6PD overexpression would provide a certain milieu that promotes the recruitment of circulating macrophages onto adipose tissue and induces macrophage differentiation in the fat tissues of obese subjects.
[151]
[152] <Example 8> Application of G6PD enzyme inhibitor for treatment in animal models
[153] In order to examine the therapeutic use of G6PD enzyme inhibitor, several substances including DHEA were administered into experimental mice suffering from oxidative stress related diseases.
[154] As a result, it is verified that mice treated with G6PD enzyme inhibitor of the present invention were improved in their symptoms remarkably. Therefore, the G6PD enzyme inhibitors are approved to be effective and nontoxic as a therapeutic agent for treatment oxidative stress and/or inflammatory related diseases in the present invention.
[155]
Industrial Applicability
[156] As illustrated and confirmed above, the present invention provides inhibitors against glucose-6-phosphate dehydrogenase or its expression for preventing and treating oxidative stress and/or inflammatory related diseases, and methods for screening the inhibitors therefor.
[157] The pharmaceutical composition comprising a G6PD inhibitor of the present invention can be administered efficiently to relieve oxidative stresses and chronic inflammation closely associated with metabolic disorders including insulin resistance, type II diabetes, cardiovascular diseases and arteriosclerosis. Further, the method and the kit for screening an inhibitor of G6PD enzyme or its expression of the present invention can be applied widely to develop novel drugs for preventing and treating oxidative stress and/or inflammatory related diseases.
[158] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention.
[159] Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.
[160]
Sequence Listing
[161] SEQ ID NO: 1 : G6PD-2i-sense,
[162] 5'-GATCCCCGAAAGACCTAAGCTGGAGGTTCAAGAGACCTCCAGCTT
AGGTCTTTCTTTTTGGAAA-S'
[163] SEQ ID NO: 2: G6PD-2i-antisense,
[164] 5'-AGCTTTTCCAAAAAGAAAGACCTAAGCTGGAGGTCTCTTGAACCT
CCAGCTTAGGTCTTTCGGG-3';
[165] SEQ ID NO: 3: G6PD-5i-sense,
[166] 5'-GATCCCCCTGTCGAACCACATCTCCTTTCAAGAGAAGGAGATGTGGTT
CGACAGTTTTTGGAAA-3'
[167] SEQ ID NO: 4: G6PD-5i-antisense,
[168] 5'-AGCTTTTCCAAAAACTGTCGAACCACATCTCCTTCTCTTGAAAGG AGATGTGGTTCGACAGGGG-3' [169] SEQ ID NO: 5: G6PD-1 li-antisense,
[170] 5'-GATCCCCCAGTGCAAGCGTAATGAGCTTCAAGAGAGCTCATTACG
CTTGCACTGTTTTTGGAAA-S'
[171] SEQ ID NO: 6: G6PD-1 li-antisense,
[172] 5'-AGCTTTTCCAAAAACAGTGCAAGCGTAATGAGCTCTCTTGAAGCT
CATTACGCTTGCACTGGGG-3'
[173] SEQ ID NO: 7:
[174] 5'-AGTTGAGGGGACTTTCCCAGGC-S'
[175] SEQ ID NO: 8: G6PD-sense,
[176] 5'-CTGGAACCGCATCATAGTGGAG-S'
[177] SEQ ID NO: 9: G6PD-antisense
[178] 5'-CCTGATGATCCCAAATTCATCAAAATAG-S'
[179] SEQ ID NO: 10: ME-sense
[ 180] 5'-AATTAAGAATTTCGAACGACTGAACTCTG-S'
[181] SEQ ID NO: 11 : ME-antisense
[ 182] 5'-TCGTTAAATGTGCAATACTTGTTTCGATAC-S'
[183] SEQ ID NO: 12: IDH-sense
[ 184] 5'-AAAGATGCTGCAGAGGCTATAAAGAAATA-S'
[ 185] SEQ ID NO: 13 : ME-antisense
[ 186] 5'-CCTCCCTCGGACTTCATAGCTTGGGCCAC-S'
[187] SEQ ID NO: 14: TNFα-sense
[188] 5'-CCAGACCCTCACTAGATCA-S'
[189] SEQ ID NO: 15: TNFα-antisense
[190] 5'-CACTTGGTGGTTTGCTACGAC-S'
[191] SEQ ID NO: 16: IL6-sense
[192] 5'-AGTTGCCTTCTTGGGACTGA-S'
[193] SEQ ID NO: 17: IL6-antisense
[194] 5'-TCCACGATTTCCCAGAGAAC-S'
[195] SEQ ID NO: 18: Resistin-sense
[196] 5'-ATGAAGAACCTTTCATTTC-S'
[197] SEQ ID NO: 19: Resistin-antisense
[198] 5'-AGTCAGGAAGCGACCTG-S'
[199] SEQ ID NO: 20: MCP-1-sense
[200] 5'-AGGTCCCTGTCATGCTTCTG-S'
[201] SEQ ID NO: 21 : MCP-1-antisense
[202] 5'-TCTGGACCCATTCCTTCTTG-S'
[203] SEQ ID NO: 22: CCR2-sense
[204] 5'-AGAGAGCTGCAGCAAAAAGG-S' [205] SEQ ID NO: 23: CCR2-antisense
[206] 5'-GGAAAGAGGCAGTTGCAAAG-S'
[207] SEQ ID NO: 24: iNOS-sense
[208] 5'-AATCTTGGAGCGAGTTGTGG-S'
[209] SEQ ID NO: 25: iNOS-antisense
[210] 5'-CAGGAAGTAGGTGAGGGCTTG-S'
[211] SEQ ID NO: 26: gp91ρhox-sense
[212] 5'-TTGGGTCAGCACTGGCTCTG-S'
[213] SEQ ID NO: 27: gp91phox-antisense
[214] 5'-TGGCGGTGTGCAGTGCTATC-S'
[215] SEQ ID NO: 28: p67phox-sense
[216] 5'-CTGGCTGAGGCCATCAGACT-S'
[217] SEQ ID NO: 29: p67phox-antisense
[218] 5'-AGGCCACTGCAGAGTGCTTG-S'
[219] SEQ ID NO: 30: p47phox-sense
[220] 5'-GATGTTCCCCATTGAGGCCG-S'
[221] SEQ ID NO: 31 : p47phox-antisense
[222] 5'-GTTTCAGGTCATCAGGCCGC-S'
[223] SEQ ID NO: 32: p40phox-sense
[224] 5'-GCCGCTATCGCCAGTTCTAC-S'
[225] SEQ ID NO: 33: p40phox-antisense
[226] 5'-GCAGGCTCAGGAGGTTCTTC-S'
[227] SEQ ID NO: 34: p22phox-sense
[228] 5'-GTCCACCATGGAGCGATGTG-S'
[229] SEQ ID NO: 35: p22phox-antisense
[230] 5'-CAATGGCCAAGCAGACGGTC-S'
[231] SEQ ID NO: 36: Cu,Zn-SOD-sense
[232] 5'-CAGCATGGGTTCCACGTCCA-S'
[233] SEQ ID NO: 37: Cu,Zn-SOD-sense
[234] 5'-CACATTGGCCACACCGTCCT-S'
[235] SEQ ID NO: 38: GPx-sense
[236] 5'-GGGCAAGGTGCTGCTCATTG-S'
[237] SEQ ID NO: 39: GPx-antisense
[238] 5'-AGAGCGGGTGAGCCTTCTCA-S'
[239] SEQ ID NO: 40: COX2-sense
[240] 5'-AGAAGGAAATGGCTGCAGAA-S'
[241] SEQ ID NO: 41 : COX2-antisense
[242] 5'-GCTCGGCTTCCAGTATTGAG-S' [243] SEQ ID NO: 42: CD36-sense
[244] 5'-GAGCAACTGGTGGATGGTTT-S'
[245] SEQ ID NO: 43: CD36-antisense
[246] 5'-GCAGAATCAAGGGAGAGCAC-S'
[247] SEQ ID NO: 44: SR-A-sense
[248] 5'-CTGGACAAACTGGTCCACCT-S'
[249] SEQ ID NO: 45: SR-A-antisense
[250] 5'-TCCCCTTCTCTCCCTTTTGT-S'
[251] SEQ ID NO: 46: Cyclophilin-sense
[252] 5'-CAGACGCCACTGTCGCTTT-S'
[253] SEQ ID NO: 47: Cyclophilin-antisense
[254] 5'-TGTCTTTGGAACTTTGTCTGCAA-S'
[255] SEQ ID NO: 48: GAPDH-sense
[256] 5'-TGCACCACCAACTGCTTAG-S'
[257] SEQ ID NO: 49: GAPDH-antisense
[258] 5'-GGATGCAGGGATGATGTTC-S'

Claims

Claims
[1] A composition for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises a therapeutically effective amount of one or more inhibitors of glucose-6-phosphate dehydrogenase (G6PD) or its expression.
[2] The composition for treating and/or preventing an oxidative stress and/or inflammatory related disease according to claim 1, wherein the inhibitor can reduce the enzymatic activity of G6PD.
[3] The composition for treating and/or preventing an oxidative stress and/or inflammatory related disease according to claim 2, wherein the effective component of the inhibitor can be dehydroepiandrosterone (DHEA) and its derivatives.
[4] The composition for treating and/or preventing an oxidative stress and/or inflammatory related disease according to claim 1, wherein the inhibitor can reduce the expression of G6PD enzyme.
[5] The composition for treating and/or preventing an oxidative stress and/or inflammatory related disease according to claim 4, wherein the inhibitor can be selected from small interfering RNAs (siRNAs) of SEQ ID NO: 1 ~ 6 and preferably, siRNAs of SEQ ID NO: 5 ~ 6.
[6] The composition for treating and/or preventing an oxidative stress and/or inflammatory related disease according to claim 1 to claim 5, wherein the oxidative stress related disease can be one or more selected among insulin resistance, type π diabetes, cardiovascular diseases and/or arteriosclerosis.
[7] A method for screening an agent for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises steps: (1) cultivating a cell by adding an inhibitor into culture medium; (2) measuring the enzymatic activity of G6PD; and/or (3) evaluating the expression level of G6PD enzyme.
[8] The method for screening an agent according to claim 7, wherein one or more expression vectors containing G6PD gene; and one or more gene expression systems comprising a recombinant cell transfected with the recombinant vector, preferably AdG6PD-infected adipocyte, their standard groups, enzymes and reagents: are used in the step (1).
[9] A kit for screening an agent for treating and/or preventing an oxidative stress and/or inflammatory related disease, which comprises: (1) an expression vector containing G6PD gene; (2) a gene expression system comprising a recombinant cell, enzymes, reagents, and probes; and (3) a device for analyzing data.
[10] The kit for screening an agent for treating and/or preventing an oxidative stress and/or inflammatory related disease according to claim 9, wherein one or more expression vectors containing G6PD gene; and one or more gene expression systems comprising a recombinant cell transfected with the recombinant vector, preferably AdG6PD-infected adipocyte, their standard groups and reagents are included.
PCT/KR2006/001306 2006-04-10 2006-04-10 Inhibitors against g6pd enzyme for treating and preventing oxidative stress and/or inflammatory related diseases and method for screening the same WO2007117048A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2006/001306 WO2007117048A1 (en) 2006-04-10 2006-04-10 Inhibitors against g6pd enzyme for treating and preventing oxidative stress and/or inflammatory related diseases and method for screening the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2006/001306 WO2007117048A1 (en) 2006-04-10 2006-04-10 Inhibitors against g6pd enzyme for treating and preventing oxidative stress and/or inflammatory related diseases and method for screening the same

Publications (1)

Publication Number Publication Date
WO2007117048A1 true WO2007117048A1 (en) 2007-10-18

Family

ID=38581311

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2006/001306 WO2007117048A1 (en) 2006-04-10 2006-04-10 Inhibitors against g6pd enzyme for treating and preventing oxidative stress and/or inflammatory related diseases and method for screening the same

Country Status (1)

Country Link
WO (1) WO2007117048A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009067489A1 (en) 2007-11-20 2009-05-28 Lankenau Institute For Medical Research Disulfide chemotherapeutic agents and methods of use thereof
WO2013078216A1 (en) * 2011-11-21 2013-05-30 Advanced Liquid Logic Inc Glucose-6-phosphate dehydrogenase assays
US8466197B2 (en) 2010-12-14 2013-06-18 Genmedica Therapeutics Sl Thiocarbonates as anti-inflammatory and antioxidant compounds useful for treating metabolic disorders
US8575217B2 (en) 2009-03-16 2013-11-05 Genmedica Therapeutics Sl Anti-inflammatory and antioxidant conjugates useful for treating metabolic disorders
WO2018093856A1 (en) * 2016-11-16 2018-05-24 Gupte Sachin A Inhibitors of glucose-6-phosphate dehydrogenase for treating cardiovascular and pulmonary conditions
WO2019023264A1 (en) * 2017-07-25 2019-01-31 The Board Of Trustees Of The Leland Stanford Junior University Glucose-6-phosphate dehydrogenase (g6pd)-modulating agents and methods of treating g6pd deficiency

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
MARIA C. ET AL.: "Polyol pathway activation and glutathione redox status in non-insulin-dependent diabetic patients", METABOLISM, vol. 46, no. 10, October 1997 (1997-10-01), pages 1194 - 1198 *
PARK J. ET AL.: "Overexpression of glucose-6-phosphate dehydrogenase is associated with lipid dysregulation and insulin resistance in obesity", MOLECULAR AND CELLULAR BIOLOGY, vol. 25, no. 12, June 2005 (2005-06-01), pages 5146 - 5157 *
SCHWARTZ A.G. ET AL.: "Dehydroepiandrosterone, glucose-6-phosphate dehydrogenase, and longevity", AGEING RESEARCH REVIEWS, vol. 3, no. 2, April 2004 (2004-04-01), pages 171 - 187 *
SUZANNE G. ET AL.: "Epiandrosterone and Dehydroepiandrosterone affect glucose oxidation and interleukin-1 beta effects in pancreatic islets", ENDOCRINOLOGY, vol. 137, no. 8, 1996, pages 3375 - 3385 *
WILMANSKI J. ET AL.: "Augmented IL-10 production and redox-dependent signaling pathways in glucose-6-phosphate dehydrogenase-deficient mouse peritoneal macrophages", JOURNAL OF LEUKOCYTE BIOLOGY, vol. 78, July 2005 (2005-07-01), pages 85 - 94 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009067489A1 (en) 2007-11-20 2009-05-28 Lankenau Institute For Medical Research Disulfide chemotherapeutic agents and methods of use thereof
US8575217B2 (en) 2009-03-16 2013-11-05 Genmedica Therapeutics Sl Anti-inflammatory and antioxidant conjugates useful for treating metabolic disorders
US8466197B2 (en) 2010-12-14 2013-06-18 Genmedica Therapeutics Sl Thiocarbonates as anti-inflammatory and antioxidant compounds useful for treating metabolic disorders
WO2013078216A1 (en) * 2011-11-21 2013-05-30 Advanced Liquid Logic Inc Glucose-6-phosphate dehydrogenase assays
US10731199B2 (en) 2011-11-21 2020-08-04 Advanced Liquid Logic, Inc. Glucose-6-phosphate dehydrogenase assays
WO2018093856A1 (en) * 2016-11-16 2018-05-24 Gupte Sachin A Inhibitors of glucose-6-phosphate dehydrogenase for treating cardiovascular and pulmonary conditions
WO2019023264A1 (en) * 2017-07-25 2019-01-31 The Board Of Trustees Of The Leland Stanford Junior University Glucose-6-phosphate dehydrogenase (g6pd)-modulating agents and methods of treating g6pd deficiency

Similar Documents

Publication Publication Date Title
Jung et al. β-aminoisobutyric acid attenuates LPS-induced inflammation and insulin resistance in adipocytes through AMPK-mediated pathway
Han et al. Hypoxia inducible factor‐1 promotes liver fibrosis in nonalcoholic fatty liver disease by activating PTEN/p65 signaling pathway
Keuper et al. An inflammatory micro-environment promotes human adipocyte apoptosis
Yamaguchi et al. Adipose tissue NAD+ biology in obesity and insulin resistance: From mechanism to therapy
Cremonini et al. (-)-Epicatechin improves insulin sensitivity in high fat diet-fed mice
Park et al. Increase in glucose-6-phosphate dehydrogenase in adipocytes stimulates oxidative stress and inflammatory signals
Pektas et al. Dietary fructose activates insulin signaling and inflammation in adipose tissue: modulatory role of resveratrol
Zhang et al. Adipose mTORC1 suppresses prostaglandin signaling and beige adipogenesis via the CRTC2-COX-2 pathway
Savage et al. Reversal of diet-induced hepatic steatosis and hepatic insulin resistance by antisense oligonucleotide inhibitors of acetyl-CoA carboxylases 1 and 2
Steinberg et al. Tumor necrosis factor α-induced skeletal muscle insulin resistance involves suppression of AMP-kinase signaling
Talior et al. Increased glucose uptake promotes oxidative stress and PKC-δ activation in adipocytes of obese, insulin-resistant mice
Perkins et al. Blockade of nitric oxide formation down‐regulates cyclooxygenase‐2 and decreases PGE2 biosynthesis in macrophages
Castaño et al. Cardiotrophin-1 eliminates hepatic steatosis in obese mice by mechanisms involving AMPK activation
Pandey et al. Molecular mechanisms of tumor necrosis factor‐α‐mediated plasminogen activator inhibitor‐1 expression in adipocytes
Mukherjee et al. The role of reactive oxygen species in TNFα-dependent expression of the receptor for advanced glycation end products in human umbilical vein endothelial cells
Begriche et al. β‐Aminoisobutyric acid prevents diet‐induced obesity in mice with partial leptin deficiency
Ge et al. Fisetin supplementation prevents high fat diet-induced diabetic nephropathy by repressing insulin resistance and RIP3-regulated inflammation
Lin et al. Enhanced expression of glucose transporter-1 in vascular smooth muscle cells via the Akt/tuberous sclerosis complex subunit 2 (TSC2)/mammalian target of rapamycin (mTOR)/ribosomal S6 protein kinase (S6K) pathway in experimental renal failure
Tian et al. Leptin-mediated inflammatory signaling crucially links visceral fat inflammation to obesity-associated β-cell dysfunction
WO2007117048A1 (en) Inhibitors against g6pd enzyme for treating and preventing oxidative stress and/or inflammatory related diseases and method for screening the same
Araki et al. N-acetylcysteine attenuates TNF-α induced changes in secretion of interleukin-6, plasminogen activator inhibitor-1 and adiponectin from 3T3-L1 adipocytes
Li et al. Sodium tanshinone IIA sulfonate ameliorates hepatic steatosis by inhibiting lipogenesis and inflammation
Lin et al. Aerobic exercise decreases chemerin/CMKLR1 in the serum and peripheral metabolic organs of obesity and diabetes rats by increasing PPARγ
Dias et al. Blockade of kinin B1 receptor reverses plasma fatty acids composition changes and body and tissue fat gain in a rat model of insulin resistance
Zhang et al. LncRNA TUG1 reduces inflammation and enhances insulin sensitivity in white adipose tissue by regulating miR-204/SIRT1 axis in obesity mice

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 06747335

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 1020087027541

Country of ref document: KR

122 Ep: pct application non-entry in european phase

Ref document number: 06747335

Country of ref document: EP

Kind code of ref document: A1