WO2007112703A2 - Composición farmacéutica que comprende la proteína nmb0606 - Google Patents
Composición farmacéutica que comprende la proteína nmb0606 Download PDFInfo
- Publication number
- WO2007112703A2 WO2007112703A2 PCT/CU2007/000013 CU2007000013W WO2007112703A2 WO 2007112703 A2 WO2007112703 A2 WO 2007112703A2 CU 2007000013 W CU2007000013 W CU 2007000013W WO 2007112703 A2 WO2007112703 A2 WO 2007112703A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- pharmaceutical composition
- nmb0606
- composition according
- meningitidis
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/095—Neisseria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/22—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Neisseriaceae (F)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/14—Heterocyclic carbon compound [i.e., O, S, N, Se, Te, as only ring hetero atom]
- Y10T436/142222—Hetero-O [e.g., ascorbic acid, etc.]
- Y10T436/143333—Saccharide [e.g., DNA, etc.]
Definitions
- the present invention is related to the branch of medicine, particularly with the development of a pharmaceutical composition, of preventive or therapeutic application, which allows an increase in the quality of the immune response against vaccine antigens characteristic of diseases of diverse origin.
- Neisser ⁇ a meningitidis a Gram negative diplococcus whose only host is man, is the causative agent of meningococcal disease.
- this bacterium is found in the nasopharynx of people who are asymptomatic carriers, this being the most common route for their microbiological isolation.
- children under 2 years of age are the population most susceptible to contracting meningococcal meningitis, however, young adolescents and the population of older adults can also be affected.
- Meningococcal disease without treatment is fatal in the majority of affected individuals, and vaccination could prevent this situation by avoiding even bacterial colonization.
- capsular polysaccharides have been studied and evaluated as vaccine candidates.
- a tetravalent vaccine based on polysaccharides, which confers protection against Serogroups A, C, Y, and W-135 have been licensed in the United States.
- the antibodies that are generated after vaccination are serogroup-specific (Rosenstein N. et al. (2001). Meningococcal disease. N. Engl. J. Med 344: 1378-1388).
- Serogroup B unlike the rest, continues to be an important cause of endemic and epidemic meningococcal disease, largely due to the absence of effective vaccines against it.
- the serogroup B polysaccharide has a low immunogenicity, in addition to the potential risk that vaccines based on this compound can develop immunoiolerance and / or induce autoimmunity given its structural homology with oligosaccharide chains present in human fetal structures (Finne J. et al. (1987).
- An IgG monoclonal antibody to group B meningococci cross-reacts with developmentally regulated polysialic acid units of glycoproteins in neural and extraneural tissue. J. Immunol 138: 4402-4407).
- the development of vaccines against serogroup B has focused on the use of subcapsular antigens.
- the vaccine produced by the Finlay Institute in Cuba (commercially called VA-MENGOC-BC ® ) is produced from strain B: 4,7: P1,19,15 and is composed of a VME preparation of said strain and polysaccharide capsule isolated from serogroup C, adsorbed to aluminum hydroxide (Sierra GV e ⁇ al. 1991. Vaccine against group B Neisser ⁇ a meningitidis: protection trial and mass vaccination results in Cuba. NIPH Ann Dis. 14 (2): 195-210). This vaccine contributed to a rapid decline in the epidemic in Cuba (Rodr ⁇ guez AP, e ⁇ al. (1999). The epidemiological impact of antimeningococcal B vaccination in Cuba. Mem Insi Oswaldo Cruz.
- VME vaccines appear to be effective in the presentation of PME, arranged in their natural conformation, to allow the generation of bactericidal antibodies, at least in adolescents and adults. Antibody responses generated increased the opsonophagocytosis of the meningococcus.
- the precise formulation of the vaccines (for example: PME content, LPS content and the presence or absence of the adjuvant) has a significant impact on immunogenicity, there being large differences from one producer to another according to the strain and / or the methodology used (Lehmann AK, et al. (1991). Immunization against serogroup B meningococci. Opsonin response in vaccinees as measured by chemiluminescence. APMIS.
- VME vaccines have been more used than any other serogroup B vaccine and are useful in the context of outbreaks of the disease caused by a single type of strain.
- the immunogens responsible for cross-reactivity induced by this type of preparations have not been fully characterized, and many antigens present in these preparations remain to be identified.
- P1 protein is an antigen with a significant level of variability, which seems to undergo continuous variation between and during outbreaks (Jelfs J, et ai. (2000). Sequence Variation in the porA Gene of a Clone of Neisser ⁇ a meningi ⁇ idis during Epidemic Spread Clin Diagn Lab Immunol. 7 (3): 390-5). To this antigen are predominantly directed bactericidal antibodies after vaccination and after the disease. However, its variability makes it questionable that the protection product of the immunization with VME vaccines of a single strain (monovalent) is broad spectrum. To solve this problem, a VME vaccine in the Netherlands (RIVM) was developed that contained P1 of six different pathogenic isolates (van der Ley P and Poolman JT. (1992).
- VME vaccines The discrete cross-reactivity induced by VME vaccines has encouraged the search for an outer membrane antigen (or a group of antigens), which induces functional antibodies and is present in all strains of meningococcus. These antigens must be the basis for a truly universal meningococcal vaccine, which will eliminate the potential problem of capsular modification in pathogenic strains, after vaccination with polysaccharide. Due to the variability of the immunodominant protein P1, its use in a universal vaccine is limited and therefore other majority PMEs were considered candidates for a vaccine and many of them are in development. Some of those that have been included are: iron-regulated proteins (TbpA and B, FbpA and FetA), NspA and class 5 proteins (Opc).
- TbpB is part of the transferrin binding complex, together with TbpA.
- TbpA has a more important function in iron binding (Painter M, et al. (1998). Analysis of TbpA and TbpB functionality in defective mutants of Neisser ⁇ a meningitidis. J Med Microbio! 47 (9): 757 -60) and is a more effective immunogen than TbpB.
- the NspA protein a minor, highly conserved PME, has been discovered through a novel technique, which consists of using combinations of PME from different strains to immunize mice (Martin D, e ⁇ al. (1997). Highly conserveed Neisser ⁇ a meningitidis Surface Protein Confers Protection against Experimental Infection.
- NspA The comparison of genetically divergent NspA sequences showed that the protein is highly conserved (97% homology) (Cadieux N, et al. (1999). Bactericidal and Cross-Protective Activities of a Monoclonal Antibody Directed against Neisser ⁇ a meningitidis NspA Outer Membrane Protein I infected Immun 67 (9): 4955-9). The presence of NspA was detected by ELISA in 99.2% of the evaluated strains belonging to serogroups from A to Ia C, using monoclonal antibodies (Martin D, e ⁇ al. (1997). Highly conserveed Neisser ⁇ a meningitidis Surface Protein Confers Protection against Experimental Infection. J Exp Med 185 (7): 1173-83).
- NspA is a promising vaccine candidate capable of conferring protection against several serogroups
- a polyclonal mouse serum against the recombinant protein was not associated with the surface in 35% of serogroup B meningococcal strains, despite of the presence of the nspA gene in these organisms (Moe GR ef al. (1999). Differences in Surface Expression of NspA among Neisser ⁇ a meningi ⁇ idis Group B Strains. Infec ⁇ Immun 67 (11): 5664-75). Sequencing of the genome of Neisser ⁇ a meningitidis and its impact on vaccine development.
- Genome sequencing of MC58, a strain of meningococcus of serogroup B (Tettelin H, et al. (2000). Complete Genome Sequence of Neisser ⁇ a meningitidis Serogroup B Strain MC58. Science 287 (5459): 1809-15172), and of Z2491 , a strain of serogroup A (Parkhill J, et al. (2000). Complete DNA sequence of a serogroup A strain of Neisser ⁇ a meningitidis Z2491. Nature 404 (6777): 502-6173), were published during the year 2000. Availability DNA sequences have had a great influence on the investigation of a meningococcal vaccine.
- ORFs open reading frames
- This group of researchers identified 570 ORFs, amplified through the polymerase chain reaction and cloned them in Escher ⁇ chia coli, to allow the expression of fusion proteins with histidine tail or glutathione S-transferase (Pizza M, et al. (2000) Identification of Vaccine Candidates against Serogroup B Meningococcus by Whole-Genome Sequencing Science 287 (5459): 1816-20). 61% (350) of the selected ORFs were expressed successfully.
- compositions comprising a protein whose sequence is highly conserved, even between different genera of pathogenic microorganisms.
- the technical objective pursued with this invention is precisely the development of compositions capable of raising and / or extending the host's systemic and mucosal immune response against several pathogens, or against a broad spectrum of varieties thereof.
- pharmaceutical compositions, of a therapeutic or preventive nature which comprise the NMB0606 protein are reported. More particularly, the invention relates to pharmaceutical compositions for preventing or treating any infection caused by a bacterium of the Neisseria genus, comprising said protein.
- compositions comprising said antigen are useful for the prevention or treatment of diseases caused by N. meningitidis and N. gonorrhoeae.
- the object of the present invention is a pharmaceutical composition where the NMB0606 protein is present in a range between 0.5-100 ⁇ g / dose, in a pharmaceutically acceptable excipient.
- Said composition optionally comprises a vaccine adjuvant, capable of enhancing the immune response against the active ingredient, the NMB0606 protein.
- the pharmaceutical compositions comprising the NMB0606 protein also contain one or more antigens of a synthetic, recombinant or natural nature.
- the combined pharmaceutical compositions contain polysaccharide antigens, including bacterial polysaccharides. More particularly, the invention is refers to the capsular polysaccharides of N. meningitidis.
- the pharmaceutical composition of the present invention may contain protein-polysaccharide conjugates, whose polysaccharide component corresponds to a bacterial polysaccharide.
- the pharmaceutical composition comprising NMB0606 also contains antigens of a peptide nature, in order to broaden the protection spectrum of said composition.
- compositions of the present invention are administered parenterally, or mucosally, including oral administration.
- the NMB0606 protein can be used in combination or fused with other antigens.
- the protein acts as immunopotentiator or carrier of peptides, polysaccharides or other antigens of lower immunogenicity, in order to enhance the immune response against them.
- Example 11 illustrates that the aforementioned protein is capable of significantly raising antibody levels against a peptide derived from a viral antigen, once both molecules have been conjugated.
- the protective determinants for a given protein antigen are inserted into the sequence of the NMB0606 protein, in order to induce an increased immune response against them, giving rise to hybrid proteins that are part of A pharmaceutical composition
- the pharmaceutical compositions of the present invention may contain fragments of the NMB0606 protein, which are capable of generating in the host a protective response against meningococcus or another bacterium of the Neisseria genus, in the presence of pharmaceutically acceptable excipients.
- the pharmaceutical compositions contain mimotopes or mimetic peptides of the NMB0606 protein, in synthetic form or obtained by DNA technology recombinant.
- mimotope means any peptide that is capable of generating antibodies that combine with the NMB0606 protein, and in that way are capable of producing a protective response against Neisseria.
- a method for the diagnosis of the infection caused by bacteria of the Neisseria genus that comprises the detection of the NMB0606 protein, or its fragments, or of the gene coding for the NMB0606 protein, identified as Seq. ID. No 3, independently or in conjunction with other components, within a biological sample obtained from an individual.
- Vector pM238 used in the cloning and expression of the NMB0606 protein.
- Figure 2 Final construction obtained from the cloning of the nucleotide sequence corresponding to the NMB0606 gene in the vector pM238.
- Figure 3 Analysis by SDS-PAGE of the fractions obtained in the cell rupture; lane 1, rupture supernatant; lane 2, precipitate of rupture.
- PM molecular weight standard.
- Figure 4 Analysis of the purity of the different fractions of the purification process of the NMB0606 recombinant protein, by SDS-PAGE: Lane 1, supernatant of solubilization with 4M urea in carbonate-bicarbonate buffer; lane 2, fraction not adsorbed to the matrix; lane 3, fraction eluted with carbonate-bicarbonate buffer containing 20 mM Imidazole and 0.3 M NaCI; lane 4, fraction eluted with carbonate-bicarbonate buffer containing 100 mM Imidazole and 0.3 M NaCI (purified protein). PM: molecular weight standard. Figure 5.
- Antibody levels (IgG) against the recombinant protein NMB0606 obtained by immunizing mice with the same antigen adjuvant with Freund's Adjuvant (Freund), Aluminum hydroxide (Alum) or mixed with the serogroup C polysaccharide (PsC) of N. meningitidis, subcutaneously.
- the results obtained in an ELISA-type assay are represented, which were expressed as the inverse of the title, calculated as the dilution of the sample (mixture of sera) where the optical density of the preimmune serum sample is doubled.
- Figure 6 Recognition of antigenic determinants present in the PME of N. meningitidis, strain CU385 (serogroup B), using sera from mice immunized with the recombinant protein NMB0606 adjuvant with adjuvant of Freund (Freund), Aluminum hydroxide (Alum) or mixed with the serogroup C polysaccharide (PsC) subcutaneously. The results were expressed as the inverse of the title, calculated as the dilution of the serum where the optical density of the preimmune serum is doubled.
- Figure 7 Results of the search for similarity between the gene coding for the NMB0606 protein ("query") and the annotated sequences of the genomes of different serogroups of N.
- Antigens P1, class 1 protein of N. meningitidis strain B: 4: P1.15; P64k, N. meningitidis protein; TT, tetanus toxoid; HBsAg, surface antigen of the Hepatitis B virus.
- the results are represented as the absorbance (492nm) in an ELISA type assay.
- FIG 11. Recognition of the NMB0606 recombinant protein by sera from convalescent patients of meningococcal disease. As a negative control, sera from healthy donors were used. The results are represented as the absorbance (492nm) in an ELISA type test.
- Figure 12. Titles of JY1 anti-peptide antibodies corresponding to the sera of animals immunized with the free peptide (JY1), the recombinant protein (NMB0606) and the conjugate JY1-NMB0606.
- Peptides generated during digestion were extracted from the solution using microcolumns (ZipTips, Millipore, MA, E. U.) Prior to mass spectrometry analysis the peptides were eluted from the microcolumns with 60% acetonitrile solution and 1% formic acid and immediately the mixture was loaded into nano-needles (Protana, Denmark). Measurements were performed on a spectrometer hybrid mass with quadrupole and flight time (QTof-2 TM, Manchester, United Kingdom), equipped with an ionization source (nanoESI). Mass spectra were acquired in a range of m / z from 400 to 2000 in 0.98 seconds and using 0.02 seconds between each of the scans.
- Protein identification based on the MS / MS spectra was performed through the MASCOT program (Perkins DN, et al. (1999). Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20: 3551-3567 . http://www.matrixscience.com/). Search parameters included cysteine modification as well as possible oxidations and deamidations.
- Example 3 Cloning and expression in Escher ⁇ chia coli of the nmbO6O6 gene, coding for the NMB0606 protein of Neisser ⁇ a meningitidis.
- the vector pM238 was used. Said vector allows cloning using different restriction enzymes, and obtaining high levels of heterologous protein expression in the form of inclusion bodies in the cytoplasm of E. coli.
- the vector pM238 ( Figure 1) has the following main elements: tryptophan promoter, sequence corresponding to the N-terminal stabilizing segment of the P64k antigen of N. meningitidis strain CU385 (coding for 47 a), sequence coding for a tail of C-terminal histidine, sequence corresponding to the terminator of transcription of bacteriophage T4 and sequence corresponding to the gene that confers ampicillin resistance as a selection marker.
- this vector allows the selection of recombinants by means of the blue or white coloration of the colonies, product of the presence of the gene / acZ subunit alpha.
- oligonucleotides (0606U and 0606L) were designed to amplify the segment of said gene without the sequence encoding the signal peptide, using the genomic DNA of The strain B: 4: P1.19.15.
- 0606L 5 ' TTACCCGGGATCCACAATCGACTTTTGC 3 '
- the plasmid obtained was named pM NMB0606 for later use.
- the E. coli strain GC 366 was transformed by the chemical method with the plasmid pM NMB0606 ( Figure 2). The expression experiment was conducted in minimal M9 saline medium (Miller JH. (1972).
- Example 4 Evaluation of the immune response induced by the NMB0606 protein administered subcutaneously.
- mice To evaluate the immunogenicity of the NMB0606 protein, an immunization scheme was designed in mice, in which the protein adjuvant with aluminum hydroxide, Freund's adjuvant or combined with the serogroup C polysaccharide of N. meningitidis was administered. With these preparations mice were immunized
- mice Female Balb / c, 8 to 10 weeks old, which were divided into 3 groups of 8 mice each. Three immunizations were performed subcutaneously, separated by an interval of 7 days. The groups received a booster dose 45 days after the experiment began. Table 1 describes the composition administered to each group: Tablai Groups of Balb / C mice used for immunization.
- the antibody titers (IgG) against the recombinant protein and against antigens present in the bacterium were determined by an ELISA type test, in sera obtained after the booster dose.
- Figure 5 shows the antibody titers of each of the animals against the recombinant protein. From the second inoculation antibodies capable of recognizing the administered antigen (data not shown) are detected, although they were higher after the last inoculation. The immunological identification was also performed by Western blotting, detecting the recognition of the band corresponding to the protein (data not shown).
- the sera obtained after immunizing with the recombinant protein recognized antigenic determinants present in a PME preparation of strain CU385. These results are represented in Figure 6.
- Example 5 Characterization of the sequence of the gene coding for the NMB0606 protein in Neisseria meningitidis and Neisseria gonorrhoeae strains.
- a similarity search was carried out with the genomes of Neisseria meningitidis (serogroups A and B) and Neisseria gonorrhoeae recorded in the NCBI database (NC 003116.1 NC 003112.1, NC 002946) using the BLAST program (Altschul SF, et al. 1990. Basic local alignment search tool. J Mol Biol 215: 403-410.
- Figure 7 shows the results of the sequence comparison, for those sequences that produce a significant alignment in each of the genomes analyzed. These sequences have 100% identity in serogroup B, 99% identity in serogroup A, and 98% in the case of N. Gonorrhoeae, with the sequence of the gene coding for the NMB0606 protein obtained (No. Sequence identification: 3). Additionally, the nucleotide sequence of the gene in question was determined for 3 Cuban isolates (No.
- Example 6 Characterization of the immune response of a broad spectrum of action induced by the immunization of Balb / c mice with the NMB0606 protein.
- Example 7 Protection induced by murine sera generated against the NMB0606 protein in the infant rat model.
- Example 8 Immunogenicity of the NMB0606 protein in an animal model of neonatal immunization.
- an immunization experiment was carried out in neonatal OF1 mice.
- the immunization of mice 7 days old is considered a model that reproduces the characteristics of the humoral immune response in the human neonatal stage, for many antigens Therefore, 3 groups of mice (6 mice / group) were immunized, at 7, 10 and 14 days after birth.
- the mice of the first group, in each dose received 10 ⁇ g of the NMB0606 protein adjuvant with aluminum hydroxide (400 ⁇ g / dose).
- mice of the second group in each dose received 10 ⁇ g of the NMB0606 protein adjuvant with aluminum phosphate (400 ⁇ g / dose), while the mice of the third group only received 400 ⁇ g / dose of aluminum hydroxide without antigen.
- blood samples were obtained from the mice and the serum was analyzed by ELISA, to determine the levels of antibodies against the NMB0606 protein.
- the anti-NMB0606 antibody titers detected in the three groups of mice are shown below.
- Example 9 Generation of monoclonal antibodies against the NMB0606 protein, capable of mediating bactericidal activity against Neisseria meningitidis.
- mAbs monoclonal antibodies
- the immunization scheme was performed in Balb / c mice (H-2 d , female sex, 5-6 weeks) and had a total of 4 doses distributed as follows: on days 0, 15 and 30 of the scheme were inoculated 10 ⁇ g of the NMB0606 antigen per mouse (total volume 100 ⁇ l), administered subcutaneously, emulsified the first dose with Freund's Complete Adjuvant, and the remaining doses with Freund's Incomplete Adjuvant; on day 50, 10 ⁇ g of the antigen was administered per mouse in phosphate buffer solution (140 mM NaCI, 270 mM KCI, 1.5 mM KH 2 PO 4 , Na 2 HPO 4 x 2H 2 O 6.5 mM, pH 7.2), intraperitoneally .
- phosphate buffer solution 140 mM NaCI, 270 mM KCI, 1.5 mM KH 2 PO 4 , Na 2 HPO 4 x 2H 2 O 6.5 mM, pH 7.2
- Extractions were performed on days 0 and 45 of the scheme.
- I meningitidis performed a bactericidal assay.
- the bactericidal antibody titer was expressed as the reciprocal of the highest antibody dilution evaluated, capable of killing 50% or more of the bacteria; two of the generated mAbs (3F7 / 14 and 8C9 / 26) had bactericidal titres greater than 1: 128 against the strain Homologue B: 4: P1.19.15 and one (D6 / 34) greater than 1: 80.
- they had titers greater than 1: 64 against heterologous strains whose classifications are B: 15: P1.7,16 and C: 2a: P1.5, respectively.
- a SPOTScan type assay was performed. A series of overlapping peptides that cover the protein sequence were synthesized on a cellulose support and the membrane was incubated with a mixture of sera diluted 1: 100. The antigen-antibody reaction was detected by incubation with an alkaline murine-alkaline phosphatase conjugate, followed by the addition of a solution containing the Bromo-Chloro-Indolyl-Phosphate substrate. Several common antigenic regions present in the protein were observed, regardless of the preparation that was used in the immunization (data not shown).
- Example 11 Recognition of the NMB0606 protein by human sera.
- a battery of human sera, from convalescent individuals of the meningococcal disease was used in this study, which was carried out in an ELISA type trial.
- the plates were coated with the NMB0606 protein obtained by preparative electrophoresis (5 ⁇ g / ml). After blocking the plates with 3% skimmed milk powder in PBS with Tween-20, the sera were diluted (1: 50) in the same solution and incubated on the plates.
- the immunoassay continued as has been widely reported.
- As a negative control sera from healthy donors were used.
- a mixture of sera from vaccinated with recombinant vaccine against Hepatitis B (data not shown) was also used as an unrelated control.
- Figure 11 shows the results obtained with 5 convalescent sera in this test. As can be seen, the convalescent sera recognized the protein, which indicates that it is expressed during the meningococcal infection and that it is immunogenic.
- Example 12 NMB06Q6 protein as a carrier of a peptide.
- a synthetic peptide of 15 amino acid residues was conjugated thereto, derived from the V3 region of the gp120 protein of HIV-1, JY1 isolation.
- the conjugation was performed by the glutaraldehyde method.
- the free JY1 peptide, the recombinant protein NMB0606 and the conjugate JY1-NMB0606 was administered to adult mice in a 3 dose scheme, where the immunogens were emulsified with Freund's Adjuvant.
- serum samples were obtained from the immunized animals, which were analyzed by ELISA to determine the levels of anti-peptide antibodies.
- Example 13 Evaluation of the immune response induced by the NMB0606 protein, mucosally.
- mice To evaluate the immunogenicity of the NMB0606 protein by mucosal route, an immunization scheme was designed in mice, in which the protein encapsulated in liposomes or mixed with polysaccharide C of N. meningitidis was administered. Liposomes were obtained by the dehydration-rehydration method as previously described (Carménate T, et al. (2001).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2007234214A AU2007234214A1 (en) | 2006-03-31 | 2007-03-29 | Pharmaceutical composition containing the NMB0606 protein |
MX2008012665A MX2008012665A (es) | 2006-03-31 | 2007-03-29 | Composicion farmaceutica que comprende la proteina nmb0606. |
BRPI0709922-3A BRPI0709922A2 (pt) | 2006-03-31 | 2007-03-29 | composiÇço farmacÊutica contendo a proteÍna nmb0606 |
CA002647465A CA2647465A1 (en) | 2006-03-31 | 2007-03-29 | Pharmaceutical composition containing the nmb0606 protein |
EP07721809A EP2011509A2 (en) | 2006-03-31 | 2007-03-29 | Pharmaceutical composition containing the nmb0606 protein |
US12/295,198 US20100129387A1 (en) | 2006-03-31 | 2007-03-29 | Pharmaceutical composition containing the nmb0606 protein |
NO20084525A NO20084525L (no) | 2006-03-31 | 2008-10-28 | Farmasoytiske sammensetninger inneholdende NMB0606-protein |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CU2006-0075 | 2006-03-31 | ||
CU20060075A CU23575A1 (es) | 2006-03-31 | 2006-03-31 | Composición farmacéutica que comprende la proteína nmb0606 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2007112703A2 true WO2007112703A2 (es) | 2007-10-11 |
WO2007112703A3 WO2007112703A3 (es) | 2008-04-24 |
Family
ID=38535626
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CU2007/000013 WO2007112703A2 (es) | 2006-03-31 | 2007-03-29 | Composición farmacéutica que comprende la proteína nmb0606 |
Country Status (13)
Country | Link |
---|---|
US (1) | US20100129387A1 (es) |
EP (1) | EP2011509A2 (es) |
KR (1) | KR20080108576A (es) |
CN (1) | CN101448518A (es) |
AR (1) | AR060797A1 (es) |
AU (1) | AU2007234214A1 (es) |
BR (1) | BRPI0709922A2 (es) |
CA (1) | CA2647465A1 (es) |
CU (1) | CU23575A1 (es) |
MX (1) | MX2008012665A (es) |
NO (1) | NO20084525L (es) |
WO (1) | WO2007112703A2 (es) |
ZA (1) | ZA200808768B (es) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
MX2019002489A (es) | 2016-09-02 | 2019-10-21 | Sanofi Pasteur Inc | Vacuna contra neisseria meningitidis. |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2270174A1 (en) * | 1999-05-19 | 2011-01-05 | Novartis Vaccines and Diagnostics S.r.l. | Combination neisserial compositions |
GB0103424D0 (en) * | 2001-02-12 | 2001-03-28 | Chiron Spa | Gonococcus proteins |
CU23236A1 (es) * | 2003-12-03 | 2007-09-26 | Ct Ingenieria Genetica Biotech | PROTEINA NMB0928 Y SU USO EN FORMULACIONES FARMACéUTICAS P |
-
2006
- 2006-03-31 CU CU20060075A patent/CU23575A1/es unknown
-
2007
- 2007-03-29 EP EP07721809A patent/EP2011509A2/en not_active Withdrawn
- 2007-03-29 CA CA002647465A patent/CA2647465A1/en not_active Abandoned
- 2007-03-29 AR ARP070101323A patent/AR060797A1/es not_active Application Discontinuation
- 2007-03-29 US US12/295,198 patent/US20100129387A1/en not_active Abandoned
- 2007-03-29 AU AU2007234214A patent/AU2007234214A1/en not_active Abandoned
- 2007-03-29 MX MX2008012665A patent/MX2008012665A/es unknown
- 2007-03-29 BR BRPI0709922-3A patent/BRPI0709922A2/pt not_active IP Right Cessation
- 2007-03-29 CN CNA2007800182864A patent/CN101448518A/zh active Pending
- 2007-03-29 KR KR1020087026335A patent/KR20080108576A/ko not_active Application Discontinuation
- 2007-03-29 WO PCT/CU2007/000013 patent/WO2007112703A2/es active Search and Examination
-
2008
- 2008-10-14 ZA ZA200808768A patent/ZA200808768B/xx unknown
- 2008-10-28 NO NO20084525A patent/NO20084525L/no not_active Application Discontinuation
Non-Patent Citations (43)
Also Published As
Publication number | Publication date |
---|---|
US20100129387A1 (en) | 2010-05-27 |
AU2007234214A1 (en) | 2007-10-11 |
MX2008012665A (es) | 2008-10-13 |
NO20084525L (no) | 2008-11-28 |
BRPI0709922A2 (pt) | 2011-07-26 |
AR060797A1 (es) | 2008-07-16 |
CA2647465A1 (en) | 2007-10-11 |
CN101448518A (zh) | 2009-06-03 |
CU23575A1 (es) | 2010-09-30 |
KR20080108576A (ko) | 2008-12-15 |
EP2011509A2 (en) | 2009-01-07 |
ZA200808768B (en) | 2009-07-29 |
WO2007112703A3 (es) | 2008-04-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2007112702A2 (es) | Composición farmacéutica que comprende la proteína nmb0938 | |
ZA200604492B (en) | Protein NMB0928 and use thereof in pharmaceutical formulations | |
WO2007112703A2 (es) | Composición farmacéutica que comprende la proteína nmb0606 | |
WO2009000217A1 (es) | Composición farmacéutica que comprende la proteína nmb1796 | |
WO2007073705A2 (es) | Composiciones farmacéuticas que contienen la proteína nma0939 | |
WO2009056075A1 (es) | Composición farmacéutica que comprende la proteína nmb0873 | |
ES2334138T3 (es) | Proteina nmb1125 y uso de la misma en formulaciones farmaceuticas. | |
MX2008008580A (es) | Composiciones farmaceuticas que contienen la proteina nma0939 | |
MXPA06006267A (es) | Proteina nmbo928 y su uso en formulaciones farmaceuticas | |
MXPA06006266A (es) | Proteina nmb1125 y su uso en formulaciones farmaceuticas |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 200780018286.4 Country of ref document: CN |
|
DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2647465 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 571614 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2008/012665 Country of ref document: MX |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 8525/DELNP/2008 Country of ref document: IN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1020087026335 Country of ref document: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007234214 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007721809 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2007234214 Country of ref document: AU Date of ref document: 20070329 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12295198 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: PI0709922 Country of ref document: BR Kind code of ref document: A2 Effective date: 20080930 |
|
DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) |