WO2007109441A2 - Polypeptides having endoglucanase activity and polynucleotides encoding same - Google Patents

Polypeptides having endoglucanase activity and polynucleotides encoding same Download PDF

Info

Publication number
WO2007109441A2
WO2007109441A2 PCT/US2007/063710 US2007063710W WO2007109441A2 WO 2007109441 A2 WO2007109441 A2 WO 2007109441A2 US 2007063710 W US2007063710 W US 2007063710W WO 2007109441 A2 WO2007109441 A2 WO 2007109441A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
identity
sequence
mature polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/063710
Other languages
French (fr)
Other versions
WO2007109441A3 (en
Inventor
Paul Harris
Kristian Bertel Romer Morkeberg Krogh
Elena Vlasenko
Soren Flensted Lassen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Novozymes Inc
Original Assignee
Novozymes AS
Novozymes Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=38523152&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2007109441(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Novozymes AS, Novozymes Inc filed Critical Novozymes AS
Priority to DK07758275.7T priority Critical patent/DK1999257T3/en
Priority to US12/293,735 priority patent/US8143482B2/en
Priority to BRPI0708949A priority patent/BRPI0708949B1/en
Priority to AT07758275T priority patent/ATE513907T1/en
Priority to EP07758275A priority patent/EP1999257B1/en
Publication of WO2007109441A2 publication Critical patent/WO2007109441A2/en
Publication of WO2007109441A3 publication Critical patent/WO2007109441A3/en
Anticipated expiration legal-status Critical
Priority to US13/399,588 priority patent/US8288615B2/en
Priority to US13/597,121 priority patent/US8614079B2/en
Priority to US13/959,577 priority patent/US9428742B2/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase

Definitions

  • the present invention reiates to isolated poiy peptides having endogiucanase activity and isolated polynucleotides encoding the polypeptides.
  • the invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as weii as methods for producing and using the polypeptides.
  • Celiobiohydrolase Il is a 1,4-D-giucan ceilobiohydrolase ⁇ E.G.
  • CeSiobiose is a water-solubie beta-1,4-Sinked dim ⁇ r of gfucose. 8eta-g!ucosidases hydrolyze c ⁇ iSofaiose to glucose.
  • ceSlulosic feedstocks into ethanol has the advantages of the ready availability of large amounts of feedstock, the desirability of avoiding burning or land filling the materials, and the cleanliness of the ethanol fuel Wood, agricultural residues, herbaceous crops, and municipal solid wastes have been considered as feedstocks for ethanol production. These materials primarily consist of cellulose, h ⁇ miceiluSose, and Signin, Once the cellulose is converted to glucose, the glucose is easily fermented by yeast into ethanol.
  • endogiucanases having improved properties, such as improved hydrolysis rate, better thermal stability, reduced adsorption to lignin, and ability to hydroSyze non-cellulosic components of biomass, such as hemicellul ⁇ se, in addition to hydrolyzing cellulose.
  • Endogiucanases with a broad range of side activities on hemiceli ⁇ lose can be especially beneficial for improving the overall hydrolysis yield of complex, hemie ⁇ llulose-rich biomass substrates.
  • the present invention relates to isolated polypeptides having ⁇ ndogSucanase activity selected from the group consisting of: ⁇ a ⁇ a polypeptide comprising an amino acid sequence which has at least
  • polypeptide which is encoded by a polynucleotide which hybridizes under at least high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or (iii) a fuli-length complementary strand of (i) or (ii);
  • polypeptide which is encoded by a polynucleotide having at least 80% identity with the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO; 9, at least 85% identity with the mature polypeptide coding sequence of SEQ ID NO: 5, or at least 75% identity with the mature polypeptide coding sequence of SEQ ID NO: 7; and
  • the present invention also relates to isolated polynucleotides encoding polypeptides having endoglucanase activity, selected from the group consisting of:
  • a polynucleotide encoding a polypeptide comprising an amino acid sequence which has at least 80% identity with the mature polypeptide of SEQ ID NO: 4 or SEQ SD NO: 10, at least 85% identity with the mature polypeptide of SEQ ID NO: 6, or at least 75% identity with the mature polypeptide of SEQ ID NO: 8;
  • a polynucleotide which hybridizes under at least high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO; 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, ⁇ ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ SD NO: 3 or SEQ SD NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or (iii) a complementary strand of (i) or (ii);
  • the mature polypeptide is amino acids 17 to 389 of SEQ ID NO: 1
  • the mature polypeptide is amino acids 16 to 397 of
  • the mature polypeptide is amino acids 22 to 429 of SEQ ID NO: 8.
  • the mature polypeptide is amino acids 25 to 421 of SEQ ID NO: 10
  • the mature polypeptide coding sequence is nucleotides 87 to 1185 of SEQ SD NO: 3.
  • the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO:
  • the mature polypeptide coding sequence is nucleotides 77 to 1300 of SEQ ID NO: 7. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 73 to 1468 of SEQ ID NO: 9.
  • the present invention also relates to nucleic acid constructs, recombinant expression vectors, recombinant host cells comprising the polynucleotides, and methods of producing a polypeptide having endogiucanase activity.
  • the present invention also relates to methods of inhibiting the expression of a polypeptide in a ceil, comprising administering to the cell or expressing in the cell a double- stranded RNA ⁇ dsRNA ⁇ molecule, wherein the dsRNA comprises a subsequence of a polynucleotide of the present invention.
  • the present also relates to such a double- stranded inhibitory RNA ⁇ dsRNA) molecule, wherein optionally the dsRNA is an siRNA or an mi RNA molecule.
  • the present invention also relates to methods of using the polypeptides having endogiucanase activity in the conversion of DCiulose to glucose and various substances.
  • the present invention also relates to plants comprising an isolated polynucleotide encoding such a polypeptide having endogiucanase activity.
  • the present invention also relates to methods for producing such a polypeptide having endogiucanase activity, comprising: (a) cultivating a transgenic plant or a piant ceil comprising a polynucleotide encoding such a polypeptide having endogiucanase activity under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • the present invention further relates to nucleic acid constructs comprising a gene encoding a protein, wherein the gene is operably linked to a nucleotide sequence encoding a signal peptide comprising or consisting of amino acids 1 to 16 of SEQ ID NQ; 4, amino acids 1 to 15 of SEQ ID NO: 6, amino acids 1 to 21 of SEQ ID NO: 8, or amino acids 1 to 16 of SEQ ID NO: 10 and a second nucleotide sequence encoding a propeptide comprising or consisting of amino acids 17 to 24 of SEQ ID NO: 10, wherein the gene is foreign to the first and second nucleotide sequences
  • Figure 1 shows a restriction map of pC!C1 ⁇ l
  • Figure 2 shows the genomic DNA sequence and the deduced amino acid sequence of a Myceliophthora thermophita CBS 1 17.65 endogl ⁇ canase (SEQ ID NOs: 3 and 4, respectively).
  • Figure 3 shows a restriction map of pA2C161.
  • Figure 4 shows a restriction map of pC!C453.
  • Figure 5 shows a restriction map of pA2C453.
  • Figure 8 shows the cDNA sequence and the deduced amino acid sequence of a basidiomycete CBS 495.95 endoglucanase (SEQ ID NOs: 5 and 6, respectively).
  • Figure 7 shows a restriction map of pC!C486.
  • Figure 8 shows a restriction map of pA2C486.
  • Figure 9 shows the cDNA sequence and the deduced amino acid sequence of a basidiomycete CBS 494.95 endoglucanase (SEQ ID NOs: 7 and 8, respectively).
  • Figures 1OA and 1OB show the genomic DNA sequence and the deduced amino acid sequence of a Peni ⁇ ffium bmsilianum strain SBT 20888 endogiucanase (SEQ ID NOs: 9 and 10, respectiveSy).
  • Figure 11 shows a restriction map of pKBK03.
  • Figure 12 shows a restriction map of pPBCelSC.
  • Figure 13 shows the specific activity of the Penicillium brasilianum !BT 20888 CEL5C endogiucanase at different pH values and 5O 0 C (n ⁇ 2).
  • Figure 14 shows the specific activity of the Penicillium brasilianum iBT 20888
  • Figure 16 shows the reiative activity on PASC (2 mg/mi) as a function of temperature for basidiomycete CBS 494.95 and basidiomycete CBS 495.95 at pH 5.0
  • Figure 17 shows the relative conversion of PASC (2 mg/ml) as a function of temperature after 45 hours of hydrolysis with basidiomycete CBS 494.95 and basidiomycete CBS 495.95 (0.5 mg protein per g of PASC) ai pH 5.0.
  • Figure 18 shows a comparison of endoglucanases from Mycetiophthora thermophila CBS 117.65, basidiomycete CBS 494.95, basidiomycete CBS 495.95, and Tiichoderma reesei for production of reducing sugars from beta-giucan (1% w/v) after 2- hour hydrolysis reaction at pH 5.5 and 60 0 C.
  • Figure 19 shows a comparison of endoglucanases from Myceliophthora thermoph ⁇ a CBS 117.65, basidiomycete CBS 494.95, basidiomycete CBS 495.95, and Trichoderma reesei for production of reducing sugars from beta-giucan (1% w/v ⁇ after 2- hour hydrolysis reaction at pH 5.5 and 60 0 C.
  • Endoglucanase activity is defined herein as an endo-1,4-beta-D-glucan 4-giuca ⁇ ohydro!ase (E.G. No, 3.2.1,4) which catalyses the endohydrolysis of 1,4-beta-D-giycosidic linkages in cellulose, ceSSuiose derivatives (such as carboxymethyl cellulose and hydroxyethyi cellulose), liche ⁇ in, beta-1,4 bonds in mixed beta-1 ,3 glucans such as cereaS beta-D-giucans or xyioglucans, and other plant material containing DCiuSosic components.
  • endogiucanase activity is determined using carboxymethy! criui ⁇ se (CMC) hydrolysis according to the procedure of Gh ⁇ se, 1987, Pure and AppL Chem, 59: 257-268.
  • CMC carboxymethy!
  • the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward one or more substrates seiected from the group consisting of xylan, xyloglucan, arabinoxylan, 1,4-beta-D- mannan, and gaiactomannan.
  • the activity of the polypeptides having endogiucanase activity on these poSy saccharide substrates is determined as percent of the substrate hydrolyz ⁇ d to reducing sugars after incubating the substrate (5 mg per ml) with a polypeptide having endogiucanase activity of the present invention (5 mg protein per g of substrate) for 24 hours with intermittent stirring at pH 5.0 (50 mM sodium acetate) and 5C 1 C.
  • Reducing sugars in hydrolysis mixtures are determined by the p-hydroxybenzoic acid hydrazide (PHBAH) assay,
  • the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward xylan.
  • the polypeptides of the present invention having endogiucanase activity further have enzyme activity toward xyioglucan.
  • the polypeptides of the present invention having endogiucanase activity further have enzyme activity toward arabiooxylan.
  • the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward 1 ,4-beta-D-mannan.
  • the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward gaiactomannan.
  • polypeptides of the present invention having endoglucanase activity further have enzyme activity toward xyian, xylog!ucan ; arabinoxylan, 1 ,4-beta-D-mannan, and/or gaiactomannan.
  • the polypeptides of the present invention have at ieast 20%, preferabSy at least 40%, more preferabiy at least 50%, more preferably at ieast 80%, more preferably at least 70%, more preferably at least 80%, even more preferabiy at least 90%, most preferably at least 95%, and even most preferably at ieast 100% of the endoglucanase activity of mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10.
  • Family 5 glycoside hydrolase or Family GH5 The term "Family 5 glycoside hydrolase” or “Famiiy GH5" is defined herein as a polypeptide falling into the glycoside hydrolase Family 5 according to Henrissat B., 1991 A classification of giycosyi hydrolases based on amino-acid sequence similarities, Biochem. J. 280: 309-316, and Henrissat 8., and Bairoch A., 1996, Updating the sequence- based classification of giycosyi hydrolases, Biochem, J. 318: 695-896.
  • Isolated polypeptide refers to a polypeptide which is at least 20% pure, preferably at ieast 40% pure, more preferabiy at ieast 80% pure, even more preferably at least 80% pure, most preferabiy at least 90% pure, and even most preferably at least 95% pure, as determined by SDS-PAGE.
  • substantially pure polypeptide denotes herein a polypeptide preparation which contains at most 10%, preferably at most 8%, more preferably at most 8%, more preferably at most 5%, more preferabiy at most 4%, more preferably at most 3%, even more preferably at most 2%.
  • the substantially pure polypeptide is at least 92% pure, preferably at ieast 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferabiy at least 97% pure, more preferably at ieast 98% pure, even more preferably at least 99%, most preferabiy at least 99.5% pure, and even most preferably 100% pure by weight of the tota! polypeptide material present in the preparation.
  • polypeptides of the present invention are preferably in a substantially pure form.
  • the polypeptides are in "essentially pure form", Le., that the polypeptide preparation is essentially free of other polypeptide materia! with which it is natively or recombinant ⁇ associated. This can be accomplished, for example, by preparing the poiypeptide by means of well-known recombinant methods or by ciassica! purification methods.
  • substantially pure polypeptide is synonymous with the terms “isolated polypeptide” and '"polypeptide in isolated form.”
  • Mature polypeptide The term “mature polypeptide” is defined herein as a polypeptide having endogSucanase activity that is in its final form following translation and any post-translationa! modifications, such as N-terminal processing, C-terminal truncation, giycosyiation, etc.
  • Mature polypeptide coding sequence The term “mature polypeptide coding sequence” is defined herein as a nucleotide sequence that encodes a mature polypeptide having endoglucanase activity.
  • Identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity”.
  • the degree of identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch : 1970 : J. MoI Biol. 48. 443-453) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0 5, and the EBLOSUM62 matrix.
  • the output of Needle labeled longest identity is used as the percent identity and is calculated as follows:
  • the degree of identity between two nucleotide sequences is determined using the Needleman-Wunsch algorithm ⁇ Needleman and Wunsch, 1970, J. MoI. Biol. 48: 443-453 ⁇ as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5. and the EDNAFULL matrix.
  • the output of Needle labeled "longest identity" is used as the percent identity and is calculated as follows:
  • homologous sequence is defined herein as a predicted protein which gives an E value ⁇ or expectancy score) of less than 0.001 in a fasta search (Pearson, W.R., 1999, in Bioinformatics Methods and Protocols, S. Misener and S. A, Kraw ⁇ tz, ⁇ d, pp. 185-219) with the mature endogSucanase of SEQ ID NO: 4, SEQ SD NO; 8, SEQ ID NO: 8, or SEQ SD NO: 10.
  • Polypeptide fragment is defined herein as a polypeptide having one or more amino acids deleted from the amino and/or carboxy! terminus of the mature polypeptide of SEQ SD NO: 4, SEQ ID NO: 6, SEQ SD NO: 8, or SEQ SD NO. 10; or a homologous sequence thereof, wherein the fragment has endoglucanase activity, in a preferred aspect, a fragment contains at ieast 295 amino acid residues, more preferably at least 315 amino acid residues, and most preferably at ieast 335 amino acid residues of the mature polypeptide of SEQ SD NQ: 4 or a homologous sequence thereof.
  • a fragment contains at ieast 320 amino acid residues, more preferabiy at least 340 amino acid residues, and most preferably at ieast 380 amino acid residues of the mature polypeptide of SEQ ID NO: 6 or a homologous sequence thereof, in another preferred aspect, a fragment contains at least 325 amino acid residues, more preferably at least 345 amino acid residues, and most preferabiy at ieast 385 amino acid residues of the mature polypeptide of SEQ iD NO: 8 or a homoSogous sequence thereof, in another preferred aspect, a fragment contains at ieast 335 amino acid residues, more preferabiy at least 355 amino acid residues, and most preferabiy at least 375 amino acid residues of the mature polypeptide of SEQ !
  • Subsequence is defined herein as a nucleotide sequence having one or more nucleotides deleted from the 5' and/or 3' end of the mature polypeptide coding sequence of SEQ ID NO; 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ iD NO: S: or a homologous sequence thereof; wherein the subsequence encodes a polypeptide fragment having endogiucanase activity, in a preferred aspect, a subsequence contains at ieast 885 nucleotides, more preferably at least 945 nucleotides, and most preferabiy at ieast 1005 nucleotides of the mature polypeptide coding sequence of SEQ.
  • a subsequence contains at ieast 960 nucleotides, more preferably at ieast 1020 nucleotides, and most preferabiy at ieast 1080 nucleotides of the mature polypeptide coding sequence of SEQ ID NO; 5 or a homoiogous sequence thereof.
  • a subsequence contains at least 975 nucleotides, more preferably at least 1035 nucleotides, and most preferabiy at least 1095 nucleotides of the mature polypeptide coding sequence of SEQ !D NO: 7 or a homoiogous sequence thereof.
  • a subsequence contains at least 1005 nucleotides, more preferabiy at least 1065 nucleotides, and most preferabiy at least 1125 nucleotides of the mature polypeptide coding sequence of SEQ ID NO: 9 or a homologous sequence thereof.
  • Allelic variant denotes herein any of two or more alternative forms of a gene occupying the same chromosoma! locus, Allelic variation arises naturally through mutation, and may result in polymorphism within populations, Gene mutations can be silent (no change in the encoded polypeptide ⁇ or may encode polypeptides having altered amino acid sequences.
  • An aiielic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
  • Isolated polynucleotide refers to a polynucleotide which is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, most preferably af least 90% pure, and even most preferably at least 95% pure, as determined by agarose electrophoresis.
  • substantially pure polynucleotide refers to a polynucleotide preparation free of other extraneous or unwanted nucleotides and in a form suitable for use within genetically engineered protein production systems.
  • a substantially pure polynucleotide contains at most 10%, preferably at most 8%, more preferabiy at most 6%, more preferably at most 5%, more preferabiy at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferabiy at most 0.5% by weight of other polynucleotide material with which it is natively or recombinantSy associated.
  • a substantially pure polynucleotide may, however, include naturaiiy occurring 5' and 3' untranslated regions, such as promoters and terminators.
  • the substantially pure polynucleotide is at least 90% pure, preferabiy at Seast 92% pure, more preferabiy at least 84% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99% : and even most preferably at least 99,5% pure by weight.
  • polynucleotides of the present invention are preferably in a substantially pure form, In particular, it is preferred that the polynucleotides disciosed herein are in "essentially pure form", Le., that the polynucleotide preparation is essentially free of other polynucleotide material with which it is natively or recombinantiy associated.
  • the term '"substantially pure polynucleotide is synonymous with the terms “isolated polynucleotide” and "poiynucleotid ⁇ in isolated form.”
  • the polynucleotides may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof, Coding sequence:
  • coding sequence means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product.
  • the boundaries of the coding sequence are generaSiy determined by an open reading frame, which usua ⁇ y begins with the ATG start codon or alternative start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG, and TGA.
  • the coding sequence may be a DNA, cDWA, or recombinant nucleotide sequence.
  • Mature polypeptide coding sequence The term "mature polypeptide coding sequence” is defined herein as a nucleotide sequence that encodes a mature polypeptide having endogiucanase activity.
  • cDISiA The term "cDNA” is defined herein as a DNA molecule which can be prepared by reverse transcription from a mature, spiiced. mRNA moiecuie obtained from a eukaryotic cell. cDNA Sacks intron sequences that are usually present in the corresponding genomic DNA.
  • nucleic acid construct refers to a nucSeic acid molecule, either singie- or doubi ⁇ -strand ⁇ d. which is isoiated from a naturaily occurring gene or which is modified to contain segments of nucleic acids in a manner that wouSd not otherwise exist in nature.
  • nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.
  • control sequences is defined herein to include all components, which are necessary or advantageous for the expression of a polynucleotide encoding a polypeptide of the present invention.
  • Each contra! sequence may be native or foreign to the nucleotide sequence encoding the polypeptide or native or foreign to each other.
  • Such contro! sequences include, but are not limited to, a leader, polyadenyiation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the contro! sequences include a promoter, and transcriptional and transiational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ⁇ gation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.
  • operably linked denotes herein a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the poiy nucleotide sequence such that the contro! sequence directs the expression of the coding sequence of a polypeptide, Expression;
  • expression includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-tra ⁇ scriptional modification, translation, post-translatio ⁇ al modification, and secretion.
  • Expression vector is defined herein as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide of the present invention, and which is operabiy linked to additional nucleotides that provide for its expression.
  • host cell includes any cell type which is susceptibie to transformation, transfection, transduction, and the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
  • Modification means herein any chemical modification of the polypeptide consisting of the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6 r SEQ ID NQ; 8, or SEQ ID NO; 10; or a homologous sequence thereof; as well as genetic manipulation of the DNA encoding such a polypeptide.
  • the modification can be substitutions, deletions and/or insertions of one or more amino acids as we!! as replacements of one or more amino acid side chains.
  • the term ''artificial variant means a polypeptide having endoglucanase activity produced by an organism expressing a modified nucleotide sequence of the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NQ: 9; or a homologous sequence thereof.
  • the modified nucleotide sequence is obtained through human intervention by modification of the nucleotide sequence disclosed in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO' 7, or SEQ ID NO: 9; or a homologous sequence thereof
  • the present invention relates to isolated polypeptides comprising an amino acid sequence which has a degree of identity to the mature poiypeptide of
  • SEQ SD NO: 4 SEQ ID NO: 6 : SEQ ID NO: 8, or SEQ SD NO: 10, of at least 60% : preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 96%, 97%, 98%, or 99%, which have endoglucanase activity (hereinafter "homologous polypeptides").
  • the homologous polypeptides have an amino acid sequence which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even most preferably by one amino acid fraro the mature poiypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10,
  • a polypeptide of the present invention preferably comprises the amino acid sequence of SEQ ID NO: 4 or an aiieiic variant thereof; or a fragment thereof that has endoglucanase activity.
  • a poiypeptide comprises the amino acid sequence of SEQ ID NO: 4.
  • a polypeptide comprises the mature polypeptide of SEQ ID NO: 4.
  • a poiypeptide comprises amino acids 17 to 389 of SEQ ID NO: 4, or an aileiic variant thereof; or a fragment thereof that has endogiucanase activity
  • a polypeptide comprises amino acids 17 to 389 of SEQ ID NO; 4.
  • a polypeptide consists of the amino acid sequence of SEQ ID NO: 4 or an allelic variant thereof; or a fragment thereof that has endoglucanase activity
  • a poiypeptide consists of the amino acid sequence of SEQ ID NO: 4.
  • a poiypeptide consists of the mature poiypeptide of SEQ ID NO: 4.
  • a poiypeptide consists of amino acids 17 to 389 of SEQ ID NO: 4 or an allelic variant thereof; or a fragment thereof that has endogiucanase activity.
  • a polypeptide consists of amino acids 17 to 389 of SEQ ID NO; 4.
  • a polypeptide of the present invention preferably aiso comprises the amino acid sequence of SEQ ID NO: 6 or an aSSeiic variant thereof; or a fragment thereof that has endoglucanase activity.
  • a poiypeptide comprises the amino acid sequence of SEQ ID NO: 6.
  • a polypeptide comprises the mature polypeptide of SEQ ID NO: 6,
  • a poiypeptide comprises amino acids 18 to 397 of SEQ SD NO: 8, or an aileiic variant thereof; or a fragment thereof that has endogiucanase activity
  • a polypeptide comprises amino acids 18 to 397 of SEQ ID NO: 6.
  • a polypeptide consists of the amino add sequence of SEQ SD NO. 6 or an allelic variant thereof; or a fragment thereof that has endoglucanase activity
  • a poiypeptide consists of the amino acid sequence of SEQ ID NO: 6.
  • a poiypeptide consists of the mature polypeptide of SEQ ID NO: 6.
  • a poiypeptide consists of amino acids 18 to 397 of SEQ ID NO; 8 or an allelic variant thereof; or a fragment thereof that has endogiucanase activity.
  • a polypeptide consists of amino acids 16 to 397 of SEQ SD NO: 6.
  • a polypeptide of the present invention preferably also comprises the amino acid sequence of SEQ ID NO: 8 or an aiieSic variant thereof; or a fragment thereof that has endoglucanase activity.
  • a polypeptide comprises the amino acid sequence of SEQ ID NO: 8.
  • a polypeptide comprises the mature polypeptide of SEQ ID NO: 8,
  • a poiypeptide comprises amino acids 22 to 429 of SEQ SD NO: 8, or an aSleiic variant thereof; or a fragment thereof that has endogiucanase activity
  • a polypeptide comprises amino acids 22 to 429 of SEQ ID NQ: 8.
  • a polypeptide consists of the amino add sequence of SEQ SD NO: 8 or an allelic variant thereof; or a fragment thereof that has endoglucanase activity.
  • a poiypeptide consists of the amino acid sequence of SEQ ID NO: 8.
  • a poiypeptide consists of the mature polypeptide of SEQ. ID NO: 8.
  • a poiypeptide consists of amino acids 22 to 429 of SEQ ID NO: 8 or an allelic variant thereof; or a fragment thereof that has endogiucanase activity.
  • a polypeptide consists of amino acids 22 to 429 of SEQ ID NO: 8.
  • a polypeptide of the present invention preferably aiso comprises the amino acid sequence of SEQ SD NQ: 10 or an allelic variant thereof; or a fragment thereof that has endoglucanase activity.
  • a poiypeptide comprises the amino acid sequence of SEQ SD NO: 10.
  • a polypeptide comprises the mature polypeptide of SEQ ID NQ: 10.
  • a poiypeptide comprises amino acids 25 to 421 of SEQ SD NO: 10, or an aSleiic variant thereof; or a fragment thereof that has endogSucanase activity
  • a polypeptide comprises amino acids 25 to 421 of SEQ ID NO: 10.
  • a polypeptide consists of the amino acid sequence of SEQ ID NO; 10 or an allelic variant thereof; or a fragment thereof that has endogSucanase activity,
  • a polypeptide consists of the amino acid sequence of SEQ ID NG: 10,
  • a poiypeptide consists of the mature polypeptide of SEQ ID NO: 1
  • a poiypeptide consists of amino acids 25 to 421 of SEQ ID NO: 10 or an aiSeiic variant thereof; or a fragment thereof that has endoglucanase activity.
  • a poiypeptide consists of amino acids 25 to 421 of SEQ ID NO; 10.
  • the present invention relates to isolated poiypeptides having endoglucanase activity which are encoded by poSynudeotides which hybridize under very low stringency conditions, preferabiy Saw stringency conditions, more preferabiy medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NQ; 5, SEQ ID NO: 7, or SEQ SD NO; 9, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ iD NO: 3 or SEQ iD NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, (iii) a subsequence of (i) or (ii ⁇ : or (iv) a complementary strand of (i), (ii), or (iii) (J, Sambrook,
  • a subsequence of the mature polypeptide coding sequence of SEQ ID NO: 3 ; SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9 contains at least 100 contiguous nucleotides or preferably at least 200 contiguous nucleotides. Moreover, the subsequence may encode a poiypeptide fragment which has endoglucanase activity, in a preferred aspect, the mature polypeptide coding sequence is nucleotides 67 to 1185 of SEQ ID NO: 3. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO: 5.
  • the mature poiypeptide coding sequence is nucleotides 77 to 1300 of SEQ iD NO: 7. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 73 to 1488 of SEQ ID NO: 9.
  • the complementary strand is the fuii-iength complementary strand of the mature polypeptide coding sequence of SEQ SD NO: 3, SEQ SD NO: 5, SEQ SD NO: 7, or SEQ ID NO; 9.
  • the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ. SD NO: 7, or SEQ ID NO: 9; or a subsequence thereof; as well as the amino acid sequence of SEQ ID NQ: 4, SEQ ID NQ: 6 ; SEQ ID NQ: 8, or SEQ ID NO: 10; or a fragment thereof; may be used to design a nucleic acid probe to identify and clone DNA encoding polypeptides having endoglucanase activity from strains of different genera or species according to methods well known in the art.
  • probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, foiiowing standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein.
  • Such probes can be considerably shorter than the entire sequence, but shouid be at least 14 : preferably at least 25 : more preferably at least 35, and most preferably at Seast 70 nucleotides in length. It is, however, preferred that the nucleic acid probe is at Seast 100 nucleotides in length.
  • the nucleic acid probe may be at least 200 nucleotides, preferably at Seast 300 nucleotides, more preferably at least 400 nucleotides, or most preferably at least 500 nucleotides in length. Even longer probes may be used, e.g., nucieic acid probes which are at least 600 nucleotides, at least preferably at least 700 nucleotides, more pref ⁇ rabiy at least 800 nucleotides, or most preferably at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with 32 p j j_j 35 g I 3 J 0 IJ 05 or av ⁇ din). Such probes are encompassed by the present invention.
  • a genomic DNA or cDNA library prepared from such other organisms may, therefore, be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide having endoglucanase activity.
  • Genomic or other DNA from such other organisms may be separated by agarose or poiyacryiamide gel electrophoresis, or other separation techniques, DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material,
  • the carrier material is preferably used in a Southern blot.
  • hybridization indicates that the nucleotide sequence hybridizes to a labeled nucleic acid probe corresponding to the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9; the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7; its complementary strand; or a subsequence thereof; under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film.
  • the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 3. In another preferred aspect, the nucleic acid probe is nucleotides 67 to 1185 of SEQ ID NO: 3. In another preferred aspect, the nucleic acid probe is a polynucleotide sequence which encodes the polypeptide of SEQ ID NO: 4, or a subsequence thereof. In another preferred aspect, the nucleic acid probe is SEQ ID NO; 3.
  • the nucleic acid probe is the polynucleotide sequence contained in plasmid pC!C161 which is contained in E, coli NRRL B-30902, wherein the polynucleotide sequence thereof encodes a polypeptide having endoglucanase activity.
  • the nucleic acid probe is the mature polypeptide coding region contained in plasmid pC!C161 which is contained in £ cofi NRRL 8-30902,
  • the nucleic add probe is the mature polypeptide coding sequence of SEQ ID NO: 5.
  • the nucleic acid probe is nucleotides 84 to 1229 of SEQ ID NO: 5.
  • the nucleic acid probe is a polynucleotide sequence which encodes the polypeptide of SEQ ID NO: 6, or a subsequence thereof.
  • the nucieic acid probe is SEQ ID NO; 5.
  • the nucleic acid probe is the polynucleotide sequence contained in plasmid pC!C453 which is contained in E.
  • the nucleic acid probe is the mature polypeptide coding region contained in plasmid ⁇ CIC453 which is contained in E. cod NRRL 8-30903,
  • the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 7.
  • the nucleic acid probe is nucleotides 77 to 1300 of SEQ ID NO; 7.
  • the nucieic acid probe is a polynucleotide sequence which encodes the polypeptide of SEQ SD NO: 8, or a subsequence thereof.
  • the nucleic acid probe is SEQ ID NO; 7.
  • the nucleic acid probe is the polynucleotide sequence contained in plasmid pCIC48 ⁇ which is contained in E.
  • the nucieic acid probe is the mature polypeptide coding region contained in plasmid pCiC488 which is contained in £ coif NRRL 8-30904.
  • the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 9.
  • the nucleic acid probe is nucleotides 73 to 1468 of SEQ ID NO: 9, in another preferred aspect, the nucieic acid probe is a polynucleotide sequence which encodes the polypeptide of SEQ ID NO: 10, or a subsequence thereof.
  • the nucleic acid probe is SEQ ID NO: 9.
  • the nucleic acid probe is the polynucleotide sequence contained in plasmid pPBCeiSC which is contained in E.
  • colt NRRL B- 30900N wherein the polynucleotide sequence thereof encodes a polypeptide having endoglucanase activity.
  • the nucleic acid probe is the mature polypeptide coding region contained in piasmid pPBCel ⁇ C which is contained in E. colt NRRL B-30900N.
  • very low to very high stringency conditions are defined as prehybridization and hybridization at 42 15 C in 5X SSPE, 0.3% SDS 1 200 ⁇ g/mi sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formamide for medium and medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures for 12 to 24 hours optimally.
  • the carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS preferably at least at 45X (very Sow stringency), more preferably at least at 5OX (Sow stringency), more preferably at least at 55"C (medium stringency), more preferably at least at 60"C (medium-high stringency), even more preferably at least at 65X (high stringency), and most preferably at least at 7OX (very high stringency).
  • stringency conditions are defined as prehybricfeation, hybridization, and washing post-hybridization at about 5°C to about 1OX b ⁇ iow the calculated T m using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCI, 0.09 M Tris-HCi pH 7.6, 6 mM EDTA, 0.5% NP-40, 1X Denhardt's solution, 1 mSvl sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures for 12 to 24 hours optimally.
  • the carrier material is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5X to 10X below the calculated T, n .
  • the present invention relates to isolated polypeptides encoded by polynucleotides comprising or consisting of nucleotide sequences which have a degree of identity to the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ SD NO: 9 of at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferabiy at least 80%, more preferabiy at least 85%, more preferably at Seast 90%, even more preferably at least 95%, and most preferabiy at ieast 97% identity, which encode an active polypeptide.
  • the mature poSypeptide coding sequence is nucleotides 67 to 1185 of SEQ SD NO: 3.
  • the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO: 5.
  • the mature polypeptide coding sequence is nucleotides 77 to 1300 of SEQ ID NO: 7.
  • the mature polypeptide coding sequence is nucleotides 73 to 1468 of SEQ ID NO: 9. See polynucleotide section herein.
  • the present invention relates to artificial variants comprising a substitution, deletion, and/or insertion of one or more amino acids of the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO; 10; or a homologous sequence thereof.
  • amino acid changes are of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein: small deletions, typically of one to about 30 amino acids; small amino- or carboxyS-terminaS extensions, such as an amino-termina! methionine residue; a small linker peptide of up to about 20-25 residues; or a smal! extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.
  • conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids ⁇ phenylalanine, tryptophan and tyrosine), and smali amino acids (glycine, alanine, serine, threonine and methionine).
  • Amino acid substitutions which do not generaily alter specific activity are known in the art and are described, for example, by H. Neurath and R. L Hill, 1979, in, The Proteins, Academic Press, New York.
  • the most commonly occurring exchanges are Ala/Ser, Val/ll ⁇ , Asp/Glu, Thr/S ⁇ r, Ala/Gly, ASa/Thr, S ⁇ r/Asn, Aia/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lie, Leu/Val, Ala/Glu, and Asp/Gly.
  • non-standard amino acids such as 4-hydroxyproline, 6- ⁇ /-methy! lysine, 2-aminoisobutyric acid, isovaline, and alpha-methyl serine
  • a limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids may be substituted for amino acid residues.
  • "Unnatural amino acids” have been modified after protein synthesis, and/or have a chemical structure in their side chain(s) different from that of the standard amino acids.
  • Unnatural amino acids can be chemicaily synthesized, and preferably, are commercially available, and include pipecolic acid, thiazolidine carboxylic acid, dehydroproiine, 3- and 4-methyl ⁇ roSine, and 3,3-dimethylproSine.
  • amino acid changes are of such a nature that the physico- chemical properties of the polypeptides are altered.
  • amino acid changes may improve the thermal stability of the polypeptide, aiter the substrate specificity, change the pH optimum, and the like.
  • Essential amino acids in the parent polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). in the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (;.e,, endogiucanase activity) to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et a/., 1996, J, Biol, Chem. 271: 4699-4708.
  • the active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoafftnity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, d ⁇ Vos et a/., 1992, Science 255: 306-312; Smith et a/., 1992, J. MoL BioL 224: 899-904: WSodaver et a/., 1992, FEBS Lett 309: 59-64.
  • the identities of essential amino acids can also be inferred from analysis of identities with polypeptides which ar& reiated to a poiy peptide according to the invention.
  • Single or multiple amino acid substitutions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Oison and Sauer, 1988, Science 241 ⁇ . 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad, Sd. USA 86: 2152-2156; WO 95/17413; or WO 95/22625.
  • Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochem. 30: 10832-10837; U.S. Patent No.
  • Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cioned, mutagenized polypeptides expressed by host cells (Ness et a/., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host ceils and rapidly seq ⁇ enced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest and can be applied to polypeptides of unknown structure.
  • the total number of amino acid substitutions, deletions and/or insertions of the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10, such as amino acids 17 to 389 of SEQ ID NO: 2, amino acids 16 to 397 of SEQ ID NO: 6, amino acids 22 to 429 of SEQ ID NO: 8, or amino acids 25 to 421 of SEQ ID NO: 10, is 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 8, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
  • a polypeptide of the present invention may be obtained from microorganisms of any genus.
  • the term '"obtained from” as used herein in connection with a given source shall mean that the polypeptide encoded by a nucleotide sequence is produced by the source or by a strain in which the nucleotide sequence from the source has been inserted.
  • the polypeptide obtained from a given source is secreted extracellulariy.
  • a polypeptide having endogSucanase activity of the present invention may be a bacterial polypeptide.
  • the polypeptide may be a gram positive bacteria!
  • polypeptide such as a Bacillus, Streptococcus, Streptomyces, Staphylococcus, Enterococcus, Lactobacillus,. Lactococcus, Clostridium, Geobacillus, or Oceanobacillus polypeptide having [enzyme] activity, or a Gram negative bacterial polypeptide such as an E. co//, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium Fusobacterium, llyobacter, Neisseria, or Ureaplasma polypeptide having endogiucanase activity.
  • the polypeptide is a Bacillus alkal ⁇ philus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans. Bacillus ciausii, Bacillus coagulans, Bacillus ⁇ rmus, Bacillus lautus. Bacillus lentus, Bacillus licheniformis, Bacillus megatenum. Bacillus pumilus, Bacillus stearothermophiius, Bacillus subtilis, or Bacillus thuringietisis polypeptide having endogiucanase activity.
  • the polypeptide is a Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uteris, or Streptococcus equi subsp. Zooepidemicus polypeptide having endogi ⁇ canase activity.
  • the polypeptide is a Streptomyces achromogenes, Streptomyces av ⁇ rmitiiis, Streptomyces coelicolor, Strepiomyces g ⁇ seus. or Streptomyces lividans polypeptide having endogiucanase activity.
  • a polypeptide having endogiucanase activity of the present invention may also be a fungai polypeptide, and more preferably a yeast polypeptide such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yatrowia polypeptide having endogiucanase activity; or more preferably a filamentous fungal polypeptide such as an Acremonium, Aspergillus, Aureobastdium, Chrysosporium, Cryptococcus, Fiiibasidi ⁇ m. Fusaiium, Humicola, Magnaporthe, Mucor, Myceliophthora.
  • yeast polypeptide such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yatrowia polypeptide having endogiucanase activity
  • a filamentous fungal polypeptide such as an Acremonium, Aspergillus, Au
  • Neocailimastix Neurospora, Pae ⁇ lomyces, Penicilii ⁇ m, Pimmyces, Schizophyllum, Talaromyc ⁇ s, Thetrnoascus, Thielavia, Tolypoclad ⁇ urn, or T ⁇ choderma polypeptide having endogiucanase activity.
  • the polypeptide is a Saccha ⁇ myces carfsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyven, Saccharomyces norbensis, or Saccharomyces ovlformis polypeptide having endogiucanase activity.
  • the polypeptide is an Aspergillus acuteatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium keratinophilum, Chrysosporium lucknow ⁇ ns ⁇ , Chrysosporium tmpicutn, Chi ⁇ sosporium merdanum, Chrysosporium mops, Chrysosponutn pannicola, Chrysosponutn queenslandicum, Chrysosporium zonatum, Fusarium bactndioides, Fusarium cereaiis, Fusarium crookwellense, Fusarium culmorum, Fusarium grammear ⁇ m, Fusarium graminum, Fusarium heterosporum, Fu
  • Thieiavia fimeti Thieiavia microsporia, Thieiavia ovispora, Thieiavia peruviana, Thieiavia spededonium, Thieiavia setosa, Thieiavia subthermophifa, Thieiavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Ttichod ⁇ rma r ⁇ S ⁇ i, or Trichoderma vi ⁇ de polypeptide having endoglueanas ⁇ activity.
  • the polypeptide is a Peniciilium brasitianum, Peniciilium camembertii, Peniciilium caps ⁇ tatum, Penlciltlum chrysogenum, Peniciilium citmonigrum, Peniciiiium citrinum, Penicilliumclaviforme, Peniciilium coryiophiium,.
  • Penicilii ⁇ m crustosum Peniciiiium digitatum, Peniciilium ⁇ xpansum, Peniciilium funiculosum, Peniciilium glabrum, Peniciilium gmnulatum, Peniciiiium griseofulvum, Peniciiiium islandicum, Peniciiiium italicum, Peniciilium janthmelfum, Peniciilium fividum, Peniciiiium megasporum, Peniciiiium m ⁇ linii, Peniciilium notatum, Peniciilium oxalicum, Peniciilium pub ⁇ rulum, Peniciilium purpumscens, Peniciilium pu ⁇ urogenum, Peniciilium roquef ⁇ rtii, Peniciilium rugulosum, Peniciilium spinul ⁇ sum, Peniciilium waksmanii t or Peniciilium sp. polypeptide having e ⁇ cloglucanase activity.
  • the polypeptide is a Myceiiophthora thermophila polypeptide, and most preferably a Myceiiophthora thermophila CBS 111.65 polypeptide, e.g., the polypeptide of SEQ ID NO: 4, or the mature poiypeptide thereof.
  • the poiypeptide is a basidiomycete CBS 495.95 poiypeptide, e.g., the polypeptide of SEQ ID NO: 6, or the mature polypeptide thereof.
  • the polypeptide is a basidiomycete CBS 495.95 poiypeptide, e.g., the polypeptide of SEQ ID NO: 6, or the mature polypeptide thereof.
  • the polypeptide is a basidiomycete CBS 495.95 poiypeptide, e.g., the polypeptide of SEQ ID NO: 6, or the mature polypeptide thereof.
  • the polypeptide is a basidiomycete CBS 495.95 poiypeptide, e.g., the polypeptide of SEQ ID NO: 6, or the mature polypeptide thereof.
  • the polypeptide is a basidiomycete CBS 495.95 poiypeptide, e.g., the polypeptide of SEQ ID NO: 6, or the mature polypeptide thereof.
  • polypeptide e.g., the polypeptide of SEQ ID NO: 8, or the mature polypeptide thereof.
  • the poiypeptide is a Peniciilium bmsilianum polypeptide, and most preferably a Peniciilium brasilianurn IBT 20888 polypeptide, e.g., the polypeptide of SEQ ID NO: 10, or the mature poiypeptide thereof.
  • poiy peptides may be identified and obtained from other sources including microorganisms isoiated from nature (e.g., soil, composts, wafer, etc.) using the above-mentioned probes. Techniques for isolating microorganisms from naturai habitats are weli known in the art. The polynucleotide may then be obtained by similarly screening a genomic or cDNA library of such a microorganism.
  • the polynucleotide can be isolated or cloned by utilizing techniques which are well known to those of ordinary skill in the art (see, e.g., Sambrook et a!., 1989, supra).
  • Polypeptides of the present invention also include fused polypeptides or d ⁇ avabSe fusion polypeptides in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof.
  • a fused polypeptide is produced by fusing a nucleotide sequence (or a portion thereof) encoding another polypeptide to a nucleotide sequence (or a portion thereof) of the present invention.
  • Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fused polypeptide is under control of the same promoter(s) and terminator.
  • a fusion polypeptide can further comprise a cleavage site. Upon secretion of the fusion protein, the site is cleaved releasing the polypeptide having endogiucanase activity from the fusion protein.
  • cieavage sites include, but are not limited to, a Kex2 site which encodes the dipeptide Lys-Arg (Martin et a/., 2003, J. /net Microbiol. Biotechnof. 3: 568- 76; Svetina et at, 2000, J. Biotechnol. 76: 245-251; Rasmussen- Wilson et ai., 1997, Appl. Environ. Microbiol.
  • the present invention aiso reiates to an isolated polynucleotide comprising or consisting of a nucleotide sequence which encodes a polypeptide of the present invention having endoglucanase activity.
  • the nucleotide sequence comprises or consists of SEQ ID NO: 3.
  • the nucleotide sequence comprises or consists of the sequence contained in plasmid ⁇ CIC161 which is contained in E. colt NRRL B-30902.
  • the nucleotide sequence comprises or consists of the mature polypeptide coding region of SEQ ID NO: 3.
  • the nucleotide sequence comprises or consists of nucleotides 67 to 1185 of SEQ ID NO: 3.
  • the nucleotide sequence comprises or consists of the mature polypeptide coding region contained in plasmid pCIC161 which is contained in E. coii NRRL B-30902.
  • the present invention aiso encompasses nucleotide sequences which encode polypeptides comprising or consisting of the amino acid sequence of SEQ ID NO: 4 or the mature polypeptide thereof, which differ from SEQ ID NO: 3 or the mature polypeptide coding sequence thereof by virtue of the degeneracy of the genetic code.
  • the present invention also relates to subsequences of SEQ ID NO: 3 which encode fragments of SEQ ID NO: 4 that have endoglucanase activity.
  • the nucleotide sequence comprises or consists of SEQ ID NO: 5
  • the nucleotide sequence comprises or consists of the sequence contained in plasmid pCIC453 which is contained in E. coii NRRL B-30903.
  • the nucleotide sequence comprises or consists of the mature polypeptide coding region of SEQ ID NO: 5
  • the nucleotide sequence comprises or consists of nucleotides 84 to 1229 of SEQ ID NO: 5.
  • the nucleotide sequence comprises or consists of the mature polypeptide coding region contained in plasmid pCIC453 which is contained in E. coii NRRL 8-30903.
  • the present invention also encompasses nucleotide sequences which encode polypeptides comprising or consisting of the amino acid sequence of SEQ SD NO: 6 or the mature polypeptide thereof, which differ from SEQ ID NO: 5 or the mature poSyp ⁇ ptide coding sequence thereof by virtue of the degeneracy of the genetic code.
  • the present invention also reiates Io subsequences of SEQ ID NO: 5 which encode fragments of SEQ ID NO: 6 that have endoglucanase activity.
  • the nucleotide sequence comprises or consists of SEQ ID NO: 7, In another more preferred aspect, the nucleotide sequence comprises or consists of the sequence contained in plasrnid pCIC486 which is contained in E, coli NRRL B-30904. in another preferred aspect the nucleotide sequence comprises or consists of the mature polypeptide coding region of SEQ ID NO. 7, in another preferred aspect, the nucleotide sequence comprises or consists of nucleotides 77 to 1300 of SEQ ID NO: 7. In another more preferred aspect, the nucleotide sequence comprises or consists of the mature polypeptide coding region contained in plasmid pCIC486 which is contained in E.
  • the present invention also encompasses nucleotide sequences which encode polypeptides comprising or consisting of the amino acid sequence of SEQ ID NO: 8 or the mature polypeptide thereof, which differ from SEQ ID NO: 7 or the mature polypeptide coding sequence thereof by virtue of the degeneracy of the genetic code.
  • the present invention also reiates to subsequences of SEQ ID NO: 7 which encode fragments of SEQ ID NO: 8 that have endoglucanase activity.
  • the nucleotide sequence comprises or consists of SEQ ID NO: 9.
  • the nucleotide sequence comprises or consists of the sequence contained in piasmid pPBCelSC which is contained in E. coli NRRL B-309GGN.
  • the nucleotide sequence comprises or consists of the mature polypeptide coding region of SEQ ID NO: 9.
  • the nucleotide sequence comprises or consists of nucleotides 73 to 1488 of SEQ ID NO; 9.
  • the nucleotide sequence comprises or consists of the mature polypeptide coding region contained in piasmid pP8Ce!5C which is contained in £ coil NRRL B-30900N.
  • the present invention also encompasses nucleotide sequences which encode polypeptides comprising or consisting of the amino acid sequence of SEQ ID NO: 10 or the mature polypeptide thereof, which differ from SEQ ID NO: 9 or the mature polypeptide coding sequence thereof by virtue of the degeneracy of the genetic code.
  • the present invention also relates to subsequences of SEQ ID NO: 9 which encode fragments of SEQ ID NO: 10 that have endoglucanase activity.
  • the present invention aiso relates to mutant polynucleotides comprising or consisting of at least one mutation in the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, in which the mutant nucleotide sequence encodes the mature polypeptide of SEQ ID NO: 4, SEQ SD NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10.
  • the mature polypeptide is amino acids 17 to 389 of SEQ ID NQ; 4.
  • the mature polypeptide is amino acids 16 to 397 of SEQ ID NO: 6.
  • the mature polypeptide is amino acids 22 to 429 of SEQ SD NQ: 8, in another preferred aspect, the mature polypeptide is amino acids 25 to 421 of SEQ iD NO: 10.
  • the techniques used to isoiate or clone a polynucleotide encoding a polypeptide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof.
  • the cloning of the polynucleotides of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cioned DNA fragments with shared structural features. See, e.g , lnnis ⁇ t ai., 1990, PCR: A Guide to Methods and Application, Academic Press, New York.
  • nucleic acid ampiification procedures such as ligase chain reaction (LCR), iigated activated transcription (LAT) and nucleotide sequence-based amplification (NASBA) may be used.
  • LCR ligase chain reaction
  • LAT iigated activated transcription
  • NASBA nucleotide sequence-based amplification
  • the polynucleotides may be cloned from a strain of MyceHophthom th ⁇ rmophila CBS 117.65, basidiomycete CBS 494.95, or basidiomycete CBS 495.95, or another or related organism and thus, for example, may be an allelic or species variant of the polypeptide encoding region of the nucleotide sequence.
  • the present invention aiso relates to isolated polynucleotides comprising or consisting of nucleotide sequences which have a degree of identity to the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 r or SEQ ID NO; 9 of at least 80%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at ieast 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at ieast 95%, and most preferably at least 97% identity, which encode &n active polypeptide,
  • the mature polypeptide coding sequence is nucleotides 67 to 1185 of SEQ ID NO: 3.
  • the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO: 5. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 77 to 1300 of SEQ ID NO: 7. In another preferred aspect, the mature polypeptide coding sequence is nucleotides 73 to 1488 of SEQ SD NO: 9.
  • Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially simiSar to the polypeptide.
  • the term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide.
  • These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g., artificial variants that differ in specific activity, thermostability, pH optimum, or the like.
  • the variant sequence may be constructed on the basis of the nucleotide sequence presented as the polypeptide encoding region of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, e.g., a subsequence thereof, and/or by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence.
  • nucleotide substitution see, e.g., Ford ei a/., 1991, Protein Expression and Purification 2 95-107
  • amino acid residues essential to the activity of the polypeptide encoded by an isolated polynucleotide of the invention may be identified according to procedures known in the art, such as site- directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, supra). In the latter technique, mutations are introduced at every positiveiy charged residue in the molecule, and the resultant mutant molecules are tested for endoglucanase activity to identify amino acid residues that are critical to the activity of the molecule.
  • Sites of substrate-enzyme interaction can also be determined by analysis of the three-dimensional structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photoaffinity labeling (see, e.g., de Vos et at., 1992, supra: Smith et a/,, 1992, supra; Wlodaver et a!., 1992, supra).
  • the present invention also reiates to isolated polynucleotides encoding a polypeptide of the present invention, which hybridize under very low stringency conditions, preferably low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NQ: 3, SEQ ID NQ: 5, SEQ ID NQ: 7, or SEQ ID NO: 9, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NQ: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7 : or (iii) a complementary strand of (i) or (ii); or aSSeiic variants and subsequences thereof (Sambrook et a/., 1989, supra), as defined herein.
  • the mature polypeptide coding sequence of SEQ ID NO: 3 is nucleotides 67 to 1185.
  • the mature polypeptide coding sequence of SEQ ID NO: 5 is nucleotides 84 to 1229,
  • the mature polypeptide coding sequence of SEQ ID NO: 7 is nucleotides 77 to 1300.
  • the mature polypeptide coding sequence of SEQ ID NO: 9 is nucleotides 73 to 1768
  • the present invention also reiates to isolated poiynucl ⁇ otides obtained by (a) hybridizing a population of DNA under very low, Sow, medium, medium-high, high, or very high stringency conditions with (i) the mature poiypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature poiypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or (iii) a complementary strand of (i) or (is); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having endoglucanase activity, in a preferred aspect, the mature polynucle
  • the mature polypeptide coding sequence of SEQ ID NO: 5 is nucleotides 84 to 1229.
  • the mature polypeptide coding sequence of SEQ ID NO: 7 is nucleotides 77 to 1300.
  • the mature polypeptide coding sequence of SEQ ID NG; 9 is nucleotides 73 to 1788.
  • the present invention also relates to nucleic acid constructs comprising an isolated polynucleotide of the present invention operabSy linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • An isolated polynucleotide encoding a polypeptide of the present invention may be manipulated in a variety of ways to provide for expression of the polypeptide. ManipuSation of the polynucleotide's sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention.
  • the promoter sequence contains transcriptional control sequences which mediate the expression of the polypeptide.
  • the promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • Suitable promoters for directing the transcription of the nucleic acid constructs of the present invention are the promoters obtained from the E, coli lac operon, Stmptomyces coelicolor agarase gene ⁇ dagA), Bacillus subtiiis levansucrase gene ⁇ sacB ⁇ , Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens aipha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene ⁇ penP), Bacillus subtiiis xylA and xylB genes, and prokaryotic beta- lactamase gene ⁇ Villa-Kama roff et a/.
  • promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryza ⁇ TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral aipha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae aikaitn ⁇ protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusatium venen
  • useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO- 1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3- phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomeras ⁇ (TPI) 1 Saccharomyces cemvisiae m ⁇ tallothion ⁇ in (CUP1), and Saccharomyces cerevisiae 3-phosphoglyc ⁇ rate kinase.
  • ENO-1 Saccharomyces cerevisiae enolase
  • GAL1 Saccharomyces cerevisiae galactokinase
  • ADH1, ADH2/GAP Saccharomyces cerevisiae triose phosphate isomeras ⁇
  • TPI Sac
  • the contra! sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is f ⁇ nctiona! in the host cell of choice may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthraniiate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.
  • Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cemvisiae ⁇ nolase, Saccharomyces cerevisiae cytochrome C (CYC 1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.
  • Other useful terminators for yeast host ceils are described by Romanos et a!.. 1992, supra.
  • the control sequence may also be a suitable leader sequence, a nontransSated region of an mRNA which is important for translation by the host cell.
  • the leader sequence is operably linked to the 5 s terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus niduians triose phosphate isomerase.
  • Suitable leaders for yeast host cells are obtained from the genes for
  • control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3 : terminus of the nucleotide sequence and which, when transcribed, is recognized by the host eel! as a signal to add polyadenosine residues to transcribed mRNA.
  • any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
  • Preferred poiyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamyiase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin- Sike protease, and Aspergillus niger alpha-gSucosidase.
  • control sequence may also be a signa! peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide info the cell's secretory pathway.
  • the 5' end of the coding sequence of the nucleotide sequence may inherently contain a signa! peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide.
  • the 5 1 end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence.
  • the foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signa! peptide coding region in order to enhance secretion of the polypeptide. However, any signa! peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice, / e., secreted into a culture medium, may be used in the present invention.
  • Effective signal peptide coding regions for bacterial host cells are the signal peptide coding regions obtained from the genes for Bacillus NCIB 11837 maitogenic amylase, Bacillus stearothermophllus aipha-amyiase, Bacillus lich ⁇ nifonnis subtilisin, Bacillus llcheniformis beta-lactamase, Bacillus stearothermophilus neutral proteases ⁇ nprT : nprS, nprM ⁇ : and Bacillus subtiiis prsA. Further signal peptides are described by Simonen and Palva r 1993 r Microbiological Reviews 57: 109-137.
  • Effective signal peptide coding regions for filamentous fungai host cells are the signa! peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus nlg$r neutral amylase, Aspergillus nlger giucoamylase, Rhizomucor mieh ⁇ i aspartic proteinase, Hutnicola insoi ⁇ ns cellulase, Humicola insolens endogSucanase V, and Humicola lanuginosa lipase.
  • Useful signal peptides for yeast host cells are obtained from the genes for
  • Saccharomyces ce ⁇ visiae alpha-factor and Saccharomyces cefOvisiae inverfase are described by Romanes et a/., 1992, supra.
  • the signal peptide comprises or consists of amino acids 1 to 16 of SEQ ID NO: 4.
  • the signa! peptide coding region is nucleotides 19 to 69 of SEQ ID NO. 3.
  • the signa! peptide comprises or consists of amino acids 1 to 15 of SEQ ID NO; 8.
  • the signa! peptide coding region comprises or consists of nucleotides 39 to 83 of SEQ SD NO: 5.
  • the signai peptide comprises or consists of amino acids 1 to 21 of SEQ ID NO; 8.
  • the signai peptide coding region comprises or consists of nucleotides 14 to 76 of SEQ SD NO: 7,
  • the signa! peptide comprises or consists of amino acids 1 to 16 of SEQ SD NO: 10
  • the signal peptide coding region comprises or consists of nucleotides 1 to 48 of SEQ ID NO: 9.
  • the controi sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propoiypeptid ⁇ (or a zymogen in some cases).
  • a propeptide is generally inactive and can be converted to a mature active poiypeptide by catalytic or autocatalytic cleavage of the propeptide from the propoiy peptide.
  • the propeptide coding region may be obtained from the genes for Bacillus subtiiis aikaSine protease (aprE), Ba ⁇ iius subtiiis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceiiophthora theimoph ⁇ la iaccase (WO 95/33836),
  • the propeptide comprises or consists of amino acids 17 to 24 of SEQ ID NO: 10.
  • the propeptide coding region comprises or consists of nucleotides 49 to 72 of SEQ ID NO: 9.
  • the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.
  • aSso be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide reiative to the growth of the host cell.
  • Exampies of reguiatory systems are those which cause the expression of the gene to be turned on or off in response to a chemicaS or physical stimuius, including the presence of a regulatory compound.
  • Regulatory systems in prokaryotic systems inciude the lac, tac, and trp operator systems.
  • yeast the ADH2 system or GAL1 system may be used.
  • the TAKA alpha-amySase promoter, Aspergillus niger glucoamySase promoter, and Aspergillus oryzae glucoamyiase promoter may be used as reguiatory sequences.
  • Other exampies of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofoiate reductase gene which is amplified in the presence of methotrexate, and the metailothionein genes which are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide would be operabiy linked with the regulatory sequence.
  • the present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and transiational stop signals.
  • the various nucieic acids and controi sequences described herein may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to aiiow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites.
  • a polynucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operabiy linked with the appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plascnid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about expression of the nucleotide sequence.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vectors may be linear or closed circular piasmids.
  • the vector may be an autonomously replicating vector, /. ⁇ ., a vector which exists as an ⁇ xtrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a piasmid, an extrachromosomal element, a minichromosome. or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been Integrated.
  • a single vector or piasmid or two or more vectors or piasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed, transfected, transduced, or the like cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, protofrophy to a ⁇ xotrophs, and the like.
  • bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus iicheniformis, or markers which confer antibiotic resistance such as ampicillin, Kanamycin, chloramphenicol, or tetracycline resistance.
  • Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1 , and URA3.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acefamidase), argB ⁇ ornithine carbamoyitransferase), bar (phosphinothricin acetyitransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG ⁇ orotidsn ⁇ -5 1 - phosphate decarboxylase), sC (sulfate adenyliransferase), and trpC (anthranilate synthase), as well as equivalents thereof.
  • amdS acefamidase
  • bar phosphinothricin acetyitransferase
  • hph hygromycin phosphotransferase
  • niaD
  • amdS and pyrG genes of Aspergillus nid ⁇ lans or Aspergillus oryzae and the bar gene of Stmptomyces hygmscopicus.
  • the vectors of the present invention preferably contain an elements) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the vici independent of the genome
  • the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homoiogous or nonhomologous recombination.
  • the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at a precise locations) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrationa!
  • the integrationa! elements should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to enhance the probability of homoiogous recombination.
  • the integrationa! elements may be any sequence that is homologous with the target sequence in the genome of the host ceil. Furthermore, the integrationai elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • the origin of replication may be any piasmid replicator mediating autonomous replication which functions in a cell.
  • the term "origin of replication" or “piasmid replicator” is defined herein as a nucleotide sequence that enables a piasmid or vector to replicate in vivo.
  • bacterial origins of replication are the origins of replication of plasmids p8R322, pUC19, pACYC177, and pACYC184 permitting replication in E. co!i t and pUB110, pE194, pTA1060, and pAIVS ⁇ .1 permitting replication in Bacillus.
  • origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN8,
  • AMA 1 and ANSI examples of origins of repiication useful in a filamentous fungal ceSS are AMA 1 and ANSI (Gems ef a/,, 1991 , Gene 98: 61-67; Cullen ef a/., 1987, Nucleic Acids Research 15: 9163-9175; WO 00/24883).
  • isolation of the AMAi gene and construction of piasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
  • More than one copy of a poiynucleotide of the present invention may be inserted into a host cell Io increase production of the gene product.
  • An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by inciuding an amplifiable seiectabie marker gene with the poiynucleotide where cells containing ampSifsed copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent,
  • the procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e g... Sambrook ef a/., 1989, supra).
  • the host CiUs may be any ceil useful in the recombinant production of a polypeptide of the present invention, e.g., a prokaryote or a eukaryote.
  • the prokaryotic host cell may be any Gram positive bacterium or a Gram negative bacterium.
  • Gram positive bacteria include, but not limited to, Bacillus, Streptococcus, Streptomyces, Staphylococcus, Entemcoccus, Lactobacillus, Lactococcus, Clostridium, Geobacilius, and Qceanobacillus.
  • Gram negative bacteria include, but not limited to, E. coli, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium, Fuse-bacterium, llyobacter, Neisseria, and Ureaplasma.
  • the bacterial host cell may be any Bacillus cell.
  • Bacillus ceils useful in the practice of the present invention include, but are not limited to, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis. Bacillus clfvulans, Bacillus ciausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus iicheniformis, Bacillus megaterium, Bacillus pumllus. Bacillus st ⁇ arothermophilus, Bacillus subtills, and Bacillus thuringiensis ceils.
  • the bacterial host cell is a Bacillus amyioliquefaciens, Bacillus lenius, Bacillus licheniformis, Bacillus stearoihermophilus or Bacillus subtilis cell.
  • the bacteria! host cell is a Bacillus amyioliquefaciens ceil,
  • the bacteria! host ceSi is a Bacillus clausii ceil,
  • the bacteria! host cell is a Bacillus liche ⁇ iformis c ⁇ iS.
  • the bacterial host eel! is a Bacillus s ⁇ btihs cell.
  • the bacteria! host ceSi may also be any Streptococcus ce ⁇ !.
  • Streptococcus ce ⁇ s usefu! in the practice of the present invention include, but are not limited to, Streptococcus eq ⁇ isirnilis.. Streptococcus pyogenes, Streptococcus uteris., and Streptococcus equi subsp. Zooepidemicus.
  • the bacterial host cell is a Streptococcus equisimiiis cell
  • the bacterial host ce ⁇ is a Streptococcus pyogenes eel!.
  • the bacterial host cell is a Streptococcus uberis eel!.
  • the bacterial host ceSi is a Streptococcus equi subsp. Zoo ⁇ pid ⁇ micus ce!S.
  • the bacterial host cell may aiso be any Streptomyces cell, Streptomyc&s ceils usefu! in the practice of the present invention include, but are not limited to, Streptomyces achromogenes. Streptomyces avermitilis, Streptomyces coeiicoior, Streptomyces griseus, and Streptomyces lividans.
  • the bacterial host cell is a Streptomyces achromogenes ceil. In another preferred aspect, the bacterial host cell is a Strepiomyces avermitilis ceil. In another preferred aspect, the bacterial host cit! is a Streptomyces coeiicoior ceil. In another preferred aspect, the bacterial host cit! is a Streptomyces griseus cell. In another preferred aspect, the bacterial host ce ⁇ is a Streptomyces lividans ceil.
  • DNA into a Bacillus ce ⁇ may, for instance, be effected by protopiast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), by using competent c ⁇ iSs (see, e.g., Young and Spizizen, 1961 Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56; 209-221), by eSectroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by conjugation (see, e.g., Koehier and Thome, 1987, Journal of Bacteriology 189; 5271-5278).
  • protopiast transformation see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115
  • competent c ⁇ iSs see, e.g., Young and Spizizen, 1961 Journal of
  • the introduction of DNA into an £ cols ceil may, for instance, be effected by protopiast transformation (see, e.g., Hanaha ⁇ 1983, J. MoI. Biol. 166: 557-580) or eSectroporation (see, e.g., Dower et a/., 1988, Nucleic Acids Res. 16: 6127-6145).
  • the introduction of DNA into a Streptomyces eel! may, for instance, be effected by protoplast transformation and eiectroporation (see, e.g., Gong et a/., 2004, Folia Microbiol.
  • Pseudomonas ceil may, for instance, be effected by eiecfroporation (see, e.g., Choi et a/., 2006 « J. Microbiol. Methods 64: 391-397) or by conjugation (see, e.g., Pinedo and Smets.
  • the introduction of DNA into a Streptococcus cell may, for instance, be effected by natural competence (see, e.g., Perry and Kuramitsu, 1981 Infect Immun. 32: 1295-1297), by protoplast transformation (see, e.g., Catt and Jollick, 1991 , Microbios, 88; 189-2070, by electroporation (see, e.g., Buckley et a/,, 1999, Appi. Environ. Microbiol, 65: 3800-3804) or by conjugation (see, e.g., Clewell, 1981 , Microbiol. Rev. 45: 409-436), However, any method known in the for introducing DNA into a host cell can be used.
  • the host cell may also be a eukaryote, such as a mammalian, insect plant, or fungal cell
  • the host cell is a fungal cell.
  • "Fungi” as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycete (as defined by Hawksworth et a/. , In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB international, University Press, Cambridge, UK) as weii as the Oomycota (as cited in Hawksworth et a/., 1995, supra, page 171 ⁇ and aii mit ⁇ sporic fungi ⁇ Hawksworth et a!., 1995, supra).
  • the fungal host Ci is a yeast ceS!.
  • yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast and yeast beionging to the Fungi imperfecti (BSastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, SM., and Davenport, R. R,, eds, Soc, App. Bacteriol. Symposium Series No, 9, 1980),
  • the yeast host vii is a Candida, Hansenu!a : Kiuyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
  • the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces dougiasii, Saccharomyces kluyveri, Saccharomyces n ⁇ rbensis, or Saccharomyces oviformis cell
  • the yeast host ceil is a Kiuyveromyces lactis ceil.
  • the yeast host cell is a Yarrowia lipolytics eel I .
  • the fungal host ceil is a filamentous fungal cell.
  • filamentous fungi include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et a/., 1995, supra).
  • the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides.
  • Vegetative growth is by hyphal elongation and carbon catabolism is obiigateSy aerobic.
  • vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thailus and carbon cataboSism may be fermentative.
  • the filamentous f ⁇ nga! host cell is an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysospo ⁇ um, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocailimastix, Neurospora, Paeciiomyces, Penicilliurn, Phanerochaete t Phlebia, Piromyces, Pleurotus, Schizophyiium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Tram ⁇ t ⁇ s, or Trichoderma ceil.
  • the filamentous funga! host ceil is an Aspergillus awamori, Aspergillus fumigatus t Aspergillus foetidus * Aspergillus japonicus, Aspergillus niduians, Aspergillus niger or Aspergillus oryzae ceSS.
  • the filamentous fungal host cell is a Fusarium bactridioid ⁇ s, Fusarium cerealis, Fusarium crookw ⁇ llens ⁇ , Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi..
  • Fusarium oxysporum Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporot ⁇ chioides, Fusarium sulphure ⁇ m, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell.
  • the filamentous fungaf host cell is a Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis oa ⁇ giea, Ceriporiopsis gilvescens, Ceriporiopsis pannoci ⁇ ta, Ceriporiopsis rivulosa.
  • Ceriporiopsis subrufa Ceriporiopsis subvermispora, Chrysosporium k ⁇ ratinophilum, Chrysospo ⁇ um lucknowensB, Chrysosporiutn tropicum, Chrysosponum merdarium, Chrysosporium inops, Chrysosporium pannicola, Chrysosponum queensSandicum, Chrysosporium zonatum, Coprinus cin ⁇ reus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora cmssa, Penicillium brasilianum, Peniclllium purpurogenum, Phanerochaete chrysosporium, Phlebia radiate, Pleurotus eryngii, Thielavia tenrestris, Tr&metes viliosa, Tr&metes vers
  • Funga! ceSSs may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.
  • Suitable procedures for transformation of Aspergillus and Trichoderma host ceils are described in EP 238 023 and Yelton et a/,, 1984, Proceedings of the National Academy of Sdenc&s USA 81: 1470-1474.
  • Suitable methods for transforming Fusarium species are described by Maiardier et a/., 1989, Gene 78: 147-158, and WO 96/00787.
  • Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.
  • the present invention also relates to methods for producing a polypeptide of the present invention, comprising: (a) cultivating a ceil, which in its wiSd-type form is capabie of producing the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • the Ci! is of the genus Myceliophthora.
  • the cell is Myceiiophthora thermophila.
  • the ceSS is Myceiiophthora thermophila CBS 117.65
  • the vii is basidiomycete CBS 494.95.
  • the cell is basidiomycete CBS 495.95.
  • the cell is of the genus Penicillium.
  • the eel! is Penicillium hrasiiianum.
  • the DCi is Peniciilium brasilianum iBT 20888.
  • the present invention also relates to methods for producing a polypeptide of the present invention, comprising: (a) cuitivating a host ceil under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • the present invention also relates to methods for producing a polypeptide of the present invention, comprising: (a) cuitivating a host ceil under conditions conducive for production of the polypeptide, wherein the host cell comprises a mutant nucleotide sequence having at ieast one mutation in the mature polypeptide coding sequence of SEQ ID NO; 3, SEQ ID NQ; 5, SEQ ID NO; 7, or SEQ ID NO: 9, wherein the mutant nucleotide sequence encodes a polypeptide which comprises or consists of the mature polypeptide of SEQ ID NO; 4, SEQ ID NO: 8, SEQ SD NO: 8, or SEQ ID NO: 10, and (b) recovering the polypeptide.
  • the mature poiypeptide of SEQ SD NO: 4 is amino acids 17 to 389.
  • the mature polypeptide of SEQ ID NO; 6 is amino acids 16 to 397.
  • the mature polypeptide of SEQ ID NO: 8 is amino acids 22 to 429, in another preferred aspect, the mature polypeptide of SEQ ID NO; 10 is amino acids 25 to 421.
  • the mature polypeptide coding sequence is nucleotides 87 to 1185 of SEQ ID NO: 3. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO: 5.
  • the mature polypeptide coding sequence is nucleotides 77 to 1300 of SEQ iD NO: 7. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 73 to 1488 of SEO. ID NO: 9.
  • the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods well known in the art.
  • the cell may be cultivated by shake flask cultivation, and small- scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art.
  • Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Cuiture Collection).
  • the polypeptide can be recovered directly from the medium, if the polypeptide is not secreted into the medium, it can be recovered from celi lysates.
  • the polypeptides may be detected using methods known in the art that are specific for the poiypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide as described herein. The resulting polypeptide may be recovered using methods known in the art.
  • the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exciusion), eSectrophoretic procedures (e.g., preparative isoelectric focusing), differentia! solubility ⁇ e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J. -C, janson and Lars Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides.
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exciusion
  • eSectrophoretic procedures e.g., preparative isoelectric focusing
  • differentia! solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction
  • the present invention also relates to plants, e.g., a transgenic plant, plant part, or plant cell, comprising an isolated polynucleotide encoding a polypeptide having endoglucanase activity of the present invention so as to express and produce the polypeptide in recoverable quantities.
  • the polypeptide may be recovered from the plant or plant part, Alternatively, the plant or plant part containing the recombinant polypeptide may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, payability, and Theological properties, or Io destroy an anti ⁇ utritive factor.
  • the transgenic plant can be dicotyledonous (a dicot) or rnonccctyledonous (a monocot).
  • monocot piants examples include grasses, such as meadow grass (blue grass, Poa), forage grass such as Fesiuca, Loiium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).
  • grasses such as meadow grass (blue grass, Poa)
  • forage grass such as Fesiuca, Loiium
  • temperate grass such as Agrostis
  • cereals e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).
  • dicot plants are tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related mode! organism Arabidopsis thaiiana.
  • plant parts are stem, callus, leaves, root, fruits, seeds, and tubers as well as the individual tissues comprising these parts, e.g., epidermis, mesophyll, parenchyma, vascular tissues, merist ⁇ ms.
  • Specific plant cell compartments such as chioroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a plant part.
  • any plant cell, whatever the tissue origin, is considered to be a plant part.
  • plant parts such as specific tissues and cells isolated to facilitate the utilisation of the invention are also considered plant parts, e.g., embryos, endosperms, ale ⁇ rone and seeds coats. Also included wtthtn the scope of the present invention are the progeny of such plants, plant parts, and plant cells.
  • the transgenic plant or plant cell expressing a polypeptide of the present invention may be constructed in accordance with methods known in the art.
  • the plant or plant cell is constructed by incorporating one or more expression constructs encoding a polypeptide of the present invention into the plant host genome or chioropSast genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.
  • the expression construct is conveniently a nucleic acid construct which comprises a polynucleotide encoding a polypeptide of the present invention operably linked with appropriate regulatory sequences required for expression of the nucleotide sequence in the plant or plant part of choice.
  • the expression construct may comprise a selectable marker useful for identifying host cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used).
  • regulatory sequences such as promoter and terminator sequences and optionally signal or transit sequences is determined, for example, on the basis of when, where, and how the polypeptide is desired to be expressed.
  • the expression of the gene encoding a polypeptide of the present invention may be constitutive or inducible, or may be developmentai, stage or tissue specific, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves.
  • Reguiatory sequences are : for example, described by Tague et a/, s 1988, Plant Physiology 86; 506.
  • the 35S-CaMV, the maize ubiquitin 1, and the rice actin 1 promoter may be used (Franck et a/., 1980, Ce// 21: 285-294, Christensen et a!... 1992, Plant Mo. Biol. 18: 675-689; Zhang et a/., 1991 , Plant Cell 3: 1155-1165), organ- specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990, Ann, Rev. Genet. 24: 275- 303), or from metabolic sink tissues such as meristems (ito et a!., 1994 r Plant MoI.
  • r a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et a/., 1998, Rant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et a!., 1998, Journal of Plant Physiology 152: 708-711), a promoter from a seed oil body protein (Chen ef a/,. 1998, Plant and Cell Physiology 39: 935-941), the storage protein napA promoter from Bmssica napus.
  • a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et a/., 1998, Rant and Cell Physiology 39: 885-889)
  • Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba
  • the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato (Kyozuka ef a/., 1993, Plant Physiology 102: 991-1000, the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-874), or a wound inducible promoter such as the potato pin2 promoter (Xu et a/,, 1993, Plant Molecular Biology 22: 573-588).
  • the promoter may inducible by abiotic treatments such as temperature, drought, or alterations in saiinity or induced by exogenously appiied substances that activate the promoter, e.g., ethanoi, oestrogens, plant hormones such as ethylene, abscisic acid, and gibbereilic add, and heavy metais.
  • abiotic treatments such as temperature, drought, or alterations in saiinity or induced by exogenously appiied substances that activate the promoter, e.g., ethanoi, oestrogens, plant hormones such as ethylene, abscisic acid, and gibbereilic add, and heavy metais.
  • a promoter enhancer element may also be used to achieve higher expression of a polypeptide of the present invention in the plant.
  • the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention.
  • Xu ef a/,, 1993, supra ⁇ disclose the use of the first intron of the rice actin 1 gene to enhance expression.
  • the selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.
  • the nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobactenum-me ⁇ laie ⁇ transformation, virus- mediated transformation, microinjection, pattide bombardment biolistic transformation, and electroporation (Gasser et a/,, 1990, Science 244: 1293;
  • Agrobact ⁇ rium tum ⁇ faciens-me ⁇ late ⁇ gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38 ⁇ and can also be used for transforming monocots, although other transformation methods are often used for these plants.
  • the method of choice for generating transgenic monocots is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic ca ⁇ or developing embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Curmnt Opinion Biotechnology 5; 158-162; Vasil et a/., 1992, Bio/Technoiogy 10: 667-674).
  • An alternative method for transformation of monocots is based on protoplast transformation as described by Gmiru ⁇ h et a/., 1993, Plant Molecular Biology 21 : 415-428.
  • the present invention also relates to methods for producing a polypeptide of the present invention comprising: (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding a polypeptide having endoglucanase activity of the present invention under conditions conducive for production of the polypeptide; and ⁇ b) recovering the polypeptide.
  • the present invention also relates to methods for producing a mutant of a parent cell, which comprises disrupting or deleting a polynucleotide sequence, or a portion thereof, encoding a polypeptide of the present invention, which results in the mutant cell producing less of the polypeptide than the parent cell when cultivated under the same conditions.
  • the mutant cell may be constructed by reducing or eliminating expression of a nucleotide sequence encoding a polypeptide of the present invention using methods well known in the art, for example, insertions, disruptions, replacements, or deletions, in a preferred aspect, the nucleotide sequence is inactivated.
  • the nucleotide sequence to be modified or inactivated may be, for example, the coding region or a part thereof essential for activity, or a reguiatory element required for the expression of the coding region.
  • An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the nucleotide sequence.
  • Other control sequences for possible modification include, but are not limited to, a leader, poiyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator
  • Modification or inactivation of the nucleotide sequence may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the nucleotide sequence has been reduced or eliminated.
  • the mutagenesis which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis.
  • the mutagenesis may be performed by use of any combination of these mutagenizing agents.
  • Examples of a physical or chemical mutagenizing agent suitable for the present purpose inciude ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N- nitrosoguanidine (MNNG), O-methyl hydroxyiamine, nitrous acid, ethyl methane suSphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.
  • UV ultraviolet
  • MNNG N-methyl-N'-nitro-N- nitrosoguanidine
  • EMS ethyl methane suSphonate
  • sodium bisulphite formic acid
  • nucleotide analogues examples of a physical or chemical mutagenizing agent suitable for the present purpose inciude ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N- nitrosoguanidine (MNNG), O-methyl hydroxyiamine, nitrous acid, ethyl methane suSphonate (EMS
  • the mutagenesis is typically performed by incubating the parent ceil to be mutagen ized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.
  • Modification or inactivation of the nucleotide sequence may be accomplished by introduction, substitution, or removal of one or more nucleotides in the gene or a regulatory element required for the transcription or translation thereof.
  • nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame.
  • modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art.
  • the modification may be performed in vivo, i.e., directly on the cell expressing the nucleotide sequence to be modified, it is preferred that the modification be performed in vitro as exemplified beiow.
  • nucleotide sequence is mutag ⁇ nized in vitro to produce a defective nucleic acid sequence which is then transformed into the parent cell to produce a defective gene.
  • the defective nucleic acid sequence repiaces the endogenous nucleotide sequence, it may be desirable that the defective nucleotide sequence aiso encodes a marker that may be used for selection of transformants in which the nucleotide sequence has been modified or destroyed.
  • the nucleotide sequence is disrupted with a selectable marker such as those described herein.
  • modification or inactivation of the nucieottde sequence may be performed by established anti-sense or RNAi techniques using a sequence complementary to the nucleotide sequence. More specifically, expression of the nucleotide sequence by a ceil may be reduced or eliminated by introducing a sequence complementary to the nucleotide sequence of the gene that may be transcribed in the ceil and is capable of hybridizing to the mRNA produced in the ceil. Under conditions allowing the complementary anti-sense nucleotide sequence to hybridize to the mRNA, the amount of protein translated is thus reduced or eliminated.
  • the present invention further relates to a mutant DC! of a parent cell which comprises a disruption or deletion of a nucleotide sequence encoding the polypeptide or a control sequence thereof, which results in the mutant cell producing less of the polypeptide or no polypeptide compared to the parent cell.
  • the poiypeptide-deficient mutant ceils so created are particularly useful as host ceils for the expression of homologous and/or heterologous polypeptides. Therefore, the present invention further relates to methods for producing a homologous or heterologous polypeptide comprising; ⁇ a ⁇ cultivating the mutant cell under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • heterologous polypeptides is defined herein as polypeptides which are not native to the host cell, a native protein in which modifications have been made to alter the native sequence, or a native protein whose expression is quantitatively altered as a result of a manipuiation of the host celi by recombinant DNA techniques.
  • the present invention relates to a method for producing a protein product essentially free of endoglucanase activity by fermentation of a cell which produces both a polypeptide of the present invention as well as the protein product of interest by adding an effective amount of an agent capable of inhibiting endogSucanase activity to the fermentation broth before, during, or after the fermentation has been completed, recovering the product of interest from the fermentation broth, and optionally subjecting the recovered product to further purification.
  • the present invention relates to a method for producing a protein product essentialiy free of endoglucanase activity by cuitivating the ceil under conditions permitting the expression of the product, subjecting the resultant culture broth to a combined pH and temperature treatment so as to reduce the endogSucanase activity substantially, and recovering the product from the cuiture broth.
  • the combined pH and temperature treatment may be performed on an enzyme preparation recovered from the culture broth.
  • the combined pH and temperature treatment may optionally be used in combination with a treatment with an endogiucanase inhibitor.
  • the combined pH and temperature treatment is preferably carried out at a pH in the range of 2-3 or 10-11 and a temperature in the range of at ieast 75-85'C for a sufficient period of time to attain the desired effect, where typically, 1 to 3 hours is sufficient.
  • the methods used for cultivation and purification of the product of interest may be performed by methods known in the art.
  • the methods of the present invention for producing an essentially endoglucanase-free product is of particular interest in the production of eukaryotic polypeptides, in particular fungal proteins such as enzymes.
  • the enzyme may be selected from, $.g,, an amylolytic enzyme, lipolytic enzyme, proteolytic enzyme, DCluiytic enzyme, oxidoreductase, or plant celi-wail degrading enzyme.
  • enzymes include an aminopeptidase, amylase, amyioglucosidase, carbohydrase, carboxypeptidase, catalase, celSulase, chitinase, cutinase, cyclodextrin glyc ⁇ syltransferase, deoxyribonuci ⁇ ase, esterase, galactosidase, beta-gal actosidase, giucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinolytic enzyme, peroxidase, phytase, phenoloxidase, poiyphenoloxidase, proteolytic enzyme, ribonuciease, transferase, transg
  • ⁇ ukaryotic polypeptides includes not only native polypeptides, but aiso those polypeptides, e.g., enzymes, which have been modified by amino acid substitutions, deletions or additions, or other such modifications to enhance activity, thermostability, pH tolerance and the like.
  • the present invention relates to a protein product essentiaily free from endoglucanase activity which is produced by a method of the present invention.
  • the present invention aiso relates to methods of inhibiting expression of a polypeptide in a cell, comprising administering to the cell or expressing in the cell a double-stranded RNA (dsRNA) molecule, wherein the dsRNA comprises a subsequence or portion of a polynucleotide of the present invention, in a preferred aspect, the dsRNA is about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more dupiex nucleotides in length. In another preferred aspect, the polypeptide has endoglucanase activity.
  • dsRNA double-stranded RNA
  • the dsRNA is preferably a smai! interfering RNA ⁇ siRNA ⁇ or a micro RNA (miRNA).
  • the dsRNA is small interfering RNA (siRNAs) for inhibiting transcription
  • the dsRNA is micro RNA (miRNAs) for inhibiting translation.
  • the present invention aiso relates to such double-stranded RNA ⁇ dsRNA ⁇ molecules for inhibiting expression of a polypeptide in a cell, wherein the dsRNA comprises a subsequence or portion of a polynucleotide encoding the mature polypeptide of SEQ ID NO: 4, SEQ ID NO; 6, SEQ ID NQ: 8, or SEQ ID NO: 10.
  • the dsRNA can enter a cell and cause the degradation of a single- stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs.
  • RNA interference RNA interference
  • the dsRNAs of the present invention can be used in gene-silencing therapeutics, in one aspect, the invention provides methods to selectively degrade RNA using the dsRNAis of the present invention.
  • the process may be practiced in vitro, ex vivo or in vivo,
  • the dsRNA molecuies can be used to generate a Soss-of- function mutation in a cell, an organ or an animal.
  • Methods for making and using dsRNA molecules to selectively degrade RNA are well known in the art, see, for example, U.S. Patent No. 6,506,559; U.S. Patent No. 6,511 ,824; U.S. Patent No. 6.515,109; and U.S. Patent No. 8,489,127.
  • compositions comprising a poiypeptide of the present invention.
  • the compositions are enriched in such a polypeptide.
  • the term "enriched" indicates that the endogSucanase activity of the composition has been increased, e.g., with an enrichment factor of at least 1.1.
  • the composition may comprise a polypeptide of the present invention as the major enzymatic component, e.g., a mono-component composition.
  • the composition may comprise muStiple enzymatic activities, such as an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cell ⁇ lase, chitinase, cutinase, cyclodextrin glycosyitransferas ⁇ , deoxyribonuclease, esterase, aSpna-galactosidase, beta-galactosidase, gSucoamyiase, alpha-glucosidase, beta-glucosidase, haloperoxidase, invertase, laccase, iipase, mannosidas ⁇ , oxidase, pectinolytic enzyme, peptidogiutaminase, peroxidase, phytase
  • the additional enzyme(s) may be produced, for example, by a microorganism belonging to the genus Aspergillus, preferably Aspergillus ac ⁇ leaius, Aspergillus awamori, Aspergillus fumigai ⁇ s, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nldulans, Aspergillus niger, or Aspergillus oryzae; Fusari ⁇ m, preferably Fusari ⁇ m bactridioides, F ⁇ sari ⁇ m cerealis, Fusarium crookweliense, Fusarium cultnorutn, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusariurn reticulat ⁇ m, F ⁇ sarium roseum, Fusa ⁇ urn sambucinum, Fusa
  • polypeptide compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition.
  • the polypeptide composition may be in the form of a granulate or a microgranulate.
  • the polypeptide to be included in the composition may be stabiiized in accordance with methods known in the art.
  • polypeptide compositions of the invention are given below of preferred uses of the polypeptide compositions of the invention.
  • dosage of the polypeptide corn position of the invention and other conditions under which the composition is used may be determined on the basis of methods known in the art.
  • the present invention also relates to methods for degrading or converting a ce ⁇ uiosic materia!, comprising: treating the cellulosic materia! with a composition comprising an effective amount of a polypeptide having endogiucanase activity of the present invention, in a preferred aspect, the method further comprises recovering the degraded or converted ce!u!osic materia!.
  • the polypeptides and host DCis of the present invention may be used in the production of monosaccharides, disaccharides, and polysaccharides as chemicai or fermentation feedstocks from ce ⁇ uiosic biomass for the production of ethanoi, piastics, other products or intermediates.
  • the composition comprising the polypeptide having endoglucanase activity may be in the form of a crude fermentation broth with or without the celis removed or in the form of a semi-purified or purified enzyme preparation.
  • the composition can also comprise other proteins and enzymes useful in the processing of biomass, e.g., cellobiohydrolase, beta-giucosidase, hemicellulolytic enzymes, enhancers (WO 2005/074647, WO 2005/074656), etc.
  • the composition may comprise a host ce ⁇ i of the present invention as a source of the po ⁇ ypeptide having endoglucanase activity in a fermentation process with the biomass.
  • the polypeptides and host cells of the present invention may be used to increase the vaiue of processing residues (dried distiliers grain, spent grains from brewing, sugarcane bagasse, etc.) by partial or complete degradation of cellulose or h ⁇ mic ⁇ llulose.
  • the host ceil may also contain native or heterologous genes that encode other proteins and enzymes, mentioned above, useful in the processing of biomass.
  • any c ⁇ iluiosic material such as biomass, can be used.
  • celluiosic materia encompasses iignocellulose, Biomass can inciude, but is not limited to, wood resources, municipal soiid waste, wastepaper, crops, and crop residues (see, for ⁇ xampie, Wiselogel et a/., 1995, in Handbook on Bioethanol (Charles E. Wyman, editor), pp.
  • the secondary cell wall also contains polysaccharides and is strengthened by polymeric iignin covalently cross-linked to hemiceSiuiose.
  • Ceiluiose is a homopolymer of anhydrocellobiose and thus a linear beta-(1-4)-D-glucan, whiie hemicelluSoses include a variety of compounds, such as xylans, xylogSucans, arabinoxylans, and mannans in complex branched structures with a spectrum of substituents.
  • ceSiuiose is found in piant tissue primarily as an insoluble crystalline matrix of parallel glucan chains, Hemicelluloses usually hydrogen bond to cellulose, as well as to other hemiceiiuloses, which help stabilize the ceil wall matrix.
  • Three major classes of enzymes are used to breakdown cellulosic biomass:
  • beta-D-giucosldases or beta-D-g!ucoside glucohydroiases (EC 3.2.1.21), which act to release D-glucose units from ceSS ⁇ foiose and soluble cellodextrms, as well as an array of glycosides.
  • polypeptides having endoglucanase activity of the present invention are preferably used in conjunction with other cellulofytic proteins, e.g., exo- 1 ,4- beta- D- glucanases and beta-D-glucosidases, to degrade the cellulose component of the biomass substrate, (see, for example, Brigham et al... 1995, in Handbook on Bioethano! (Charles E, Wyr ⁇ an, editor), pp,119-141, Taylor & Francis, Washington D. C; Lee, 1997, Journal of Biotechnology 56; 1-24).
  • cellulofytic proteins e.g., exo- 1 ,4- beta- D- glucanases and beta-D-glucosidases
  • exo-1 ,4-beta-D-g!ucanases and beta-D-glucosidases may be produced by any known method known in the art (see, e.g., Bennett, J, W, and LaSure, L. (eds.), More Gene Manipulations in Fungi, Academic Press, CA, 1991).
  • optimum amounts of a polypeptide having endoglucanase activity and other celluSoiytic proteins depends on several factors including, but not limited to, the mixture of component DCSui ⁇ lytic proteins, the cellulosic substrate, the concentration of celi ⁇ losic substrate, the pretreatment(s) of the cellulosic substrate, temperature, time, pH, and inclusion of fermenting organism (e.g., yeast for Simultaneous Saccharif ⁇ cation and Fermentation).
  • fermenting organism e.g., yeast for Simultaneous Saccharif ⁇ cation and Fermentation.
  • cellulolytic proteins is defined herein as those proteins or mixtures of proteins shown as being capable of hydrolyzlng or converting or degrading cellulose under the conditions tested.
  • the amount of polypeptide having endoglucanase activity per g of celluiosic material is about 0.5 to about 50 mg, preferably about 0.5 to about 40 mg, more preferably about 0.5 to about 25 mg, more preferably about 0.75 to about 20 mg, more preferably about 0.75 to about 15 mg, even more preferably about 0.5 to about 10 mg, and most preferably about 2.5 to about 10 mg per g of celiulosic material
  • the amount of cellulolyiic proteins per g of celluiosic material is about 0.5 to about 50 mg, preferabiy about 0.5 to about 40 mg, more preferably about 0.5 to about 25 mg, more preferably about 0.75 to about 20 mg, more preferably about 0.75 to about 15 mg, even more preferably about 0 5 to about 10 mg, and most preferabiy about 2 5 to about 10 mg per g of celiulosic materia!.
  • the composition may be supplemented by one or more additional enzyme activities to improve the degradation of the DCiuiosic material.
  • additional enzymes are hemiceiSulases, esterases (e g., upases, phosphoiipases, and/or cutinases), proteases, iaccases, peroxidases, or mixtures thereof.
  • the additional enzyme(s) may be added prior to or during fermentation, including during or after the propagation of the fermenting microorganism ⁇ s).
  • the enzymes may be derived or obtained from any suitable origin, including, bacterial, funga!, yeast or mammalian origin.
  • obtained means herein that the enzyme may have been isolated from an organism which naturally produces the enzyme as a native enzyme.
  • the term "obtained” also means herein that the enzyme may have been produced recombinantly in a host organism, wherein the recombinantly produced enzyme is either native or foreign to the host organism or has a modified amino acid sequence, e.g., having one or more amino acids which are deleted, inserted and/or substituted, i.e., a recombinantly produced enzyme which is a mutant and/or a fragment of a native amino acid sequence or &n enzyme produced by nucleic acid shuffling processes known in the art.
  • a native enzyme are natural variants and within the meaning of a foreign enzyme are variants obtained recombinant! ⁇ such as by site-directed mutagenesis or shuffling.
  • the enzymes may also be purified.
  • the term “purified” as used herein covers enzymes free from other components from the organism from which it is derived.
  • the term “purified” also covers enzymes free from components from the native organism from which it is obtained.
  • the enzymes may be purified, with oniy minor amounts of other proteins being present.
  • the expression “other proteins " ' relate in particular to other enzymes.
  • the term “purified” as used herein also refers to removal of other components, particularly other proteins and most particularly other enzymes present in the cell of origin of the enzyme of the invention.
  • the enzyme may be "substantially pure,” that is, free from other components from the organism in which it is produced, that is, for example, a host organism for recombinant ⁇ produced enzymes.
  • the enzymes are at least 75% (w/w), preferably at least 80%, more preferably at Seast 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, even more preferably at least 98%, or most preferably at least 99% pure. In another preferred aspect, the enzyme is 100% pure.
  • the enzymes used in the present invention may be in any form suitable for use in the processes described herein, such as, for example, a crude fermentation broth with or without cells, a dry powder or granulate, a non-dusting granulate, a liquid, a stabilized liquid, or a protected enzyme. Granulates may be produced, e.g., as disclosed in U.S.
  • Patent Nos. 4,106,991 and 4,661,452 may optionally be coated by process known in the art.
  • Liquid enzyme preparations may, for instance, be stabilized by adding stabilizers such as a sugar, a sugar alcohol or another polyol, and/or lactic acid or another organic acid according to established process.
  • stabilizers such as a sugar, a sugar alcohol or another polyol, and/or lactic acid or another organic acid according to established process.
  • Protected enzymes may be prepared according to the process disclosed in EP 238,216,
  • the methods of the present invention may be used to process a celiuiosic material to many useful organic products, chemicals and fuels.
  • some commodity and specialty chemicals that can be produced from cellulose include xylose, acetone, acetate, glycine, lysine, organic acids (e.g., lactic acid), 1,3- propanediol, butanedioi, glycerol, ethylene glycol, furfural, polyhydroxyaSkanoaf.es, cis : cis-muconic acid, and animal feed (Lynd, L R., Wyman, C. E., and Gerngross, T. U.
  • the methods of the present invention may be implemented using any conventional biomass processing apparatus configured to operate in accordance with the invention.
  • Such an apparatus may include a batch-stirred reactor, a continuous flow stirred reactor with ultrafiltration, a continuous plug-ffow column reactor (Gusakov, A. V., and Sinitsyn, A. P., 1985, Kinetics of the enzymatic hydrolysis of cellulose: 1.
  • an attrition reactor Rosakov, S. K,, and Lee, J.
  • the conventional methods include, but are not iimited to, saccharification, fermentation, separate hydrolysis and fermentation (SHF), simultaneous saccharification and fermentation (SSF), simultaneous saccharification and cofermentation (SSCF), hybrid hydrolysis and fermentation (HHF), and direct microbial conversion (DMC).
  • SHF uses separate process steps to first enzymatically hydr ⁇ lyze cellulose to glucose and then ferment glucose to ethanol.
  • SSF 1 the enzymatic hydrolysis of cellulose and the fermentation of glucose to ethanol is combined in one step (Philippidis, G, P., 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization ⁇ Wyman, C. E., ed., Taylor & Francis, Washington, DC, 179- 212).
  • HHF inciudes two separate steps carried out in the same reactor but at different temperatures, i.e., high temperature enzymatic saccharification followed by SSF at a lower temperature that the fermentation strain can tolerate, DMC combines ali three processes (cellulase production, cellulose hydrolysis, and fermentation) in one step (Lynd, L. R., Weimer, P. J., van ZyI, W. H., and Pretorius, I.
  • a fermentation process includes, without limitation, fermentation processes used to produce fermentation products including alcohols (e.g., arabinitol, butanol, ethanol, glycerol, methanol, 1 ,3- propanediol, sorbitol, and xylitol); organic acids (e.g., acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diketo-D-gi ⁇ conic acid, formic acid, fumaric acid, giucaric acid, gluconic add, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, rna ⁇ c acid, malonic acid, oxalic acid, propionic acid, succinic acid, and xylcnic acid); ketones (e.g., acetone); amino acids (&.g,, aspartic acid, glutamic acid, glycine, lysine, serine, and
  • Fermentation processes also inciude fermentation processes used in the consumable aicoho! industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), ieather industry, and tobacco industry.
  • the present invention further relates to methods of producing a substance, comprising: (a) saccharifying a cellulosic materia! with a composition comprising an effective amount of a polypeptide having endoglucanase activity; (b) fermenting the saccharified cellulosic materia!
  • composition comprising the polypeptide having endoglucanase activity may be in the form of a crude fermentation broth with or without the cells removed or in the form of a semi-purified or purified enzyme preparation or the composition may comprise a host ceil of the present invention as a source of the polypeptide having endogiucanase activity in a fermentation process with the biomass.
  • the substance can be any substance derived from the fermentation.
  • the substance is Bn alcohol.
  • alcahoi encompasses a substance that contains one or more hydroxyl moieties.
  • the aicohoi is arabtnito!.
  • the aicohoi is butanol.
  • the aicoho! is ethanol.
  • the aicoho! is glycerol, in another more preferred embodiment, the aicohoi is methanoS. in another more preferred embodiment, the aicoho! is 1,3-propanediol.
  • the alcohol is sorbitol
  • the aicoho! is xylitoi. See, for example, Gong, C. S., Cao, N, j., Du, J,, and Tsao, G, T,, 1999, Ethanol production from renewabie resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T., ed., Springer-Veriag Berlin Heideiberg, Germany, 65: 207-241 ; S ⁇ veira, M, M., and Jonas, R., 2002, The biotechnologica! production of sorbitol, Appl. Microbiol. Biotechnof.
  • the substance is an organic acid
  • the organic acid is acetic acid
  • the organic acid is acetonic acid, in another more preferred embodiment, the organic acid is adipic acid, In another more preferred embodiment the organic add is ascorbic acid. In another more preferred embodiment, the organic acid is citric acid. In another more preferred embodiment, the organic acid is 2,5-diketo-D-giuconic acid, In another more preferred embodiment, the organic acid is formic acid, in another more preferred embodiment, the organic acid is fumaric acid. In another more preferred embodiment, the organic acid is gl ⁇ caric acid, in another more preferred embodiment, the organic acid is gluconic acid, in another more preferred embodiment, the organic acid is giucuronic acid, in another more preferred embodiment, the organic acid is glutaric acid.
  • the organic acid is 3-hydroxy ⁇ ropionic acid, in another more preferred embodiment, the organic acid is itaconic acid. In another more preferred embodiment the organic acid is iactic acid, in another more preferred embodiment, the organic acid is maiic acid, in another more preferred embodiment, the organic acid is malonic acid, in another more preferred embodiment, the organic acid is oxalic acid. In another more preferred embodiment, the organic acid is propionic acid. In another more preferred embodiment, the organic acid is succinic acid. In another more preferred embodiment, the organic acid is xyionic acid.
  • the substance is a ketone, it will be understood that the term "ketone" encompasses a substance that contains one or more ketone moieties.
  • the ketone is acetone. See, for example, Qureshi and Biaschek, 2003, supra.
  • the substance is an amino acid, in another more preferred embodiment, the organic acid is aspartic acid, in another more preferred embodiment, the amino acid is glutamic acid, in another more preferred embodiment, the amino acid is glycine, in another more preferred embodiment, the amino acid is iysine. in another more preferred embodiment, the amino acid is serine. In another more preferred embodiment, the amino acid is threonine.
  • the substance is a gas.
  • the gas is methane, in another more preferred embodiment, the gas is H 2 . in another more preferred embodiment, the gas is CO 2 . In another more preferred embodiment, the gas is CO, See, for example, Kataoka, N., A. Miya, and K, Kiriyama. 1997. Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria, Water Science and Technology 38 (6-7): 41-47; and GunaseeSan V,N. in Biomass and Bioenergy, VoS. 13 (1-2), pp. 83-114, 1997, Anaerobic digestion of biomass for methane production; A review.
  • the cellulosic materia! is heated to break down the lignin and carbohydrate structure, soiubilize most of the hemiceiiuiose, and make the cellulose fraction accessible to cellulolytic enzymes.
  • the heating is performed either directly with steam or in slurry where a cataiyst may aSso be added to the materia! to speed up the reactions.
  • Catalysts include strong acids, such as sulfuric acid and SO 2 , or alkali, such as sodium hydroxide.
  • the purpose of the pretreatment stage is to facilitate the penetration of the enzymes and microorganisms.
  • Celluiosic biomass may also be subject to a hydrothermai steam explosion pretreatment ⁇ See U.S. Patent Application No. 20020164730).
  • Sa ⁇ harificatiQ.0.- in the enzymatic hydrolysis step also known as saccharificaticn, enzymes as described herein ar& added to the pretreated material to convert the cellulose fraction to gSucose and/or other sugars.
  • the saccharification is generally performed in stirred- tank reactors or fermentors under controiied pH : temperature, and mixing conditions.
  • a saccharification step may last up to 200 hours.
  • Saccharification may be carried out at temperatures from about 3CTC to about 65 41 C, in particuiar around 50 15 C, and at a pH in the range between about 4 and about 5, especiaiiy around pH 4.5.
  • the hydrolysis is typicaSiy performed in the presence of a beta-glucosidase.
  • Fermentation In the fermentation step, sugars, released from the DCSuiosic material as a result of the pretreatment and enzymatic hydrolysis steps, are fermented to ethanoi by a fermenting organism, such as yeast.
  • the fermentation can also be carried out simultaneously with the enzymatic hydrolysis in the same vessel, again under controlled pH, temperature, and mixing conditions.
  • saccharification and fermentation are performed simultaneously in the same vessel, the process is generally termed simultaneous saccharification and fermentation or SSF.
  • Any suitable celiulosic substrate or raw materia! may be used in a fermentation process of the present invention.
  • the substrate is generally selected based on the desired fermentation product i.e., the substance to be obtained from the fermentation, and the process employed, as is we!! known in the art.
  • substrates suitabie for use in the methods of present invention include cellulose-containing materials, such as wood or plant residues or Sow molecular sugars DP1-3 obtained from processed ceilulosic materia! that can be metabolized by the fermenting microorganism, and which may be supplied by direct addition to the fermentation medium.
  • fermentation medium will be understood to refer to a medium before the fermenting microorganism(s) is ⁇ are) added, such as, a medium resulting from a saccharification process, as well as a medium used in a simultaneous saccharification and fermentation process (SSF).
  • SSF simultaneous saccharification and fermentation process
  • “Fermenting microorganism” refers to any microorganism suitable for use in a desired fermentation process.
  • Suitabie fermenting microorganisms according to the invention are able to ferment, i.e , convert, sugars, such as glucose, xylose, arabinose, mannose, galactose, or oiig ⁇ saccharides directly or indirectly into the desired fermentation product.
  • Examples of fermenting microorganisms include fungai organisms, such as yeast.
  • Preferred yeast includes strains of the Sacchammyces spp. r and in particular, Sacchaivtnyces cerevisiae.
  • yeast include, e.g., Red Star®/TM/Lesaffre Ethanol Red (available from Red Star/Lesaffre, USA) FALi (available from Fleischmann's Yeast, a division of Burns Philp Food inc., USA), SUPERSTART (available from Ailtech), GERT STRAND (available from Gert Strand AB, Sweden) and FERMIOL (available from DSM Specialties).
  • Red Star®/TM/Lesaffre Ethanol Red available from Red Star/Lesaffre, USA
  • FALi available from Fleischmann's Yeast, a division of Burns Philp Food inc., USA
  • SUPERSTART available from Ailtech
  • GERT STRAND available from Gert Strand AB, Sweden
  • FERMIOL available from DSM Specialties.
  • the yeast is a Saccharomyces spp. in a more preferred embodiment, the yeast is Sacchammyces cerevisiae, In another more preferred embodiment, the yeast is Saccharomyces distaticus. In another more preferred embodiment the yeast is Sacchammyces uvar ⁇ m. Sn another preferred embodiment, the yeast is a Kiuyv ⁇ romyces. in another more preferred embodiment, the yeast is Kiuyveromyces marxianus. In another more preferred embodiment, the yeast is Kluyveromyces fragilis. In another preferred embodiment, the yeast is a Candida. In another more preferred embodiment, the yeast is Candida pseudotropicalis. in another more preferred embodiment, the yeast is Candida brassicae. In another preferred embodiment, the yeast is a Clavispora.
  • the yeast in another more preferred embodiment, is Clavispora l ⁇ sitaniae. In another more preferred embodiment, the yeast is Ciavispora opuntia ⁇ . in another preferred embodiment, the yeast is a Pachysoi ⁇ n. In another more preferred embodiment, the yeast is Pachysoi ⁇ n tannophii ⁇ s. In another preferred embodiment, the yeast is a Bretannomyces. In another more preferred embodiment, the yeast is Bretannomyces clausen ⁇ i (Phiiippidis, G. P., 1998, Cellulose bioconversion technology, in Handbook on Bioethanol; Production and Utilization, Wyman, C. E., e ⁇ , Taylor & Francis, Washington, DC, 179-212).
  • Bacteria that can efficiently ferment giucose to ethano! include, for example, Zymomonas tnobilis and Clostridium thermocelium ⁇ Phiiippidis, 1998, supra).
  • Zymomonas mobil ⁇ s Zhang, M., Eddy, C, Deanda, K., Fink ⁇ lstei ⁇ M., and Picataggio, S., 1995, Metabolic engineering of a pentose metabolism pathway in ethanologenic Zyrnornonas mohitis, Science 267. 240-243, Deanda, K., Zhang, M., Eddy, C, and Picataggio, S., 1996, Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering, Appl. Environ.
  • Microbial, 62: 4465-4470 has led to the construction of organisms capable of converting hexoses and pentoses to ethanol (cofermentation).
  • Yeast or another microorganism typically is added to the degraded cellulose or hydrolysate and the fermentation is ongoing for about 24 to about 96 hours, such as about 35 to about 80 hours.
  • the temperature is typically between about 26 0 C to about 40°C, in particular at about 32°C, and at about pH 3 to about pH 6, in particular around pH 4-5.
  • yeast or another microorganism is applied to the degraded cellulose or hydroiysate and the fermentation is ongoing for about 24 to about 96 hours, such as typica ⁇ y 35-60 hours.
  • the temperature is generally between about 26 to about 40 0 C, in particular about 32 0 C
  • the pH is generally from about pH 3 to about pH 6, preferably around pH 4-5
  • Yeast or another microorganism is preferably applied in amounts of approximateiy 10 5 to 10 12 , preferably from approximately 10 7 to 10 10 , especially approximately 5x10 7 viable count per ml of fermentation broth.
  • the yeast ceif count should preferably be in the range from approximately 10 7 to 10 t0 , especially around approximately 2 x 10 s . Further guidance in respect of using yeast for fermentation can be found in, e.g., "The Alcohol Textbook” (Editors K. Jacques, T, P. Lyons and D. R, Kelsall, Nottingham University Press, United Kingdom 1999), which is hereby incorporated by reference.
  • the most widely used process in the art is the simultaneous saccharificaiion and fermentation (SSF) process where there is no holding stage for the saccharificafion, meaning that yeast and enzyme are added together.
  • SSF simultaneous saccharificaiion and fermentation
  • For ethanol production following the fermentation the mash is distilled to extract the ethanol.
  • the ethanol obtained according to the process of the invention may be used as, e.g., fuel ethanol; drinking ethanol, i.e., potabie neutral spirits, or industrial ethanoi.
  • a fermentation stimulator may be used in combination with any of the enzymatic processes described herein to further improve the fermentation process, and in particular, the performance of the fermenting microorganism, such as, rate enhancement and ethanol yield.
  • a “fermentation stimulator” refers to stimulators for growth of the fermenting microorganisms, in particular, yeast Preferred fermentation stimulators for growth include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenate, nicotinic acid, meso-inositol, thiamine, pyridoxins, para-am inobenzoic acid, folic acid, riboflavin, and Vitamins A, 8, C, D, and E.
  • minerals include minerals and mineral salts that can supply nutrients comprising P, K, IVIg, S, Ca, Fe, Zn, Mn, and Cu.
  • Ethanol with a purity of up to about 96 vol. % ethanol can be obtained, which can be used as, for example, fuel ethanoi, drinking ⁇ thanol, i.e., potable neutral spirits, or industrial ⁇ thanol,
  • any method known in the art can be used including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatof ⁇ cusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS- PAGE, distillation, or extraction.
  • the polypeptide having endoglucanase activity and other celluiolytic protein(s) may be supplemented by one or more additional enzyme activities to improve the degradation of the cellulosic materia!.
  • additional enzymes are h ⁇ micellulases, esterases ⁇ e.g., lipases, phospholi pases, and/or cutinases), proteases, laccases, peroxidases, or mixtures thereof.
  • the additional enzyme(s) may be added prior to or during fermentation, including during or after the propagation of the fermenting microorganism(s).
  • the present invention also relates to nucieic acid constructs comprising a gene encoding a protein, wherein the gene is operabSy linked to one or both of a first nucleotide sequence encoding a signal peptide comprising or consisting of amino acids 1 to 16 of SEQ ID NO: 4, amino acids 1 to 15 of SEQ ID NO: 6, amino acids 1 to 21 of SEQ ID NQ: 8, or amino acids 1 to 16 of SEQ ID NO: 10 and a second nucleotide sequence encoding a propeptide comprising or consisting of amino acids 17 to 24 of SEQ SD NO: 10, wherein the gene is foreign to the first and second nucleotide sequences
  • the first nucleotide sequence comprises or consists of nucleotides 19 to 69 of SEQ ID NO: 3. In another preferred aspect the first nucleotide sequence comprises or consists of nucleotides 39 to 83 of SEQ ID NO: 5. in another preferred aspect, the first nucleotide sequence comprises or consists of nucleotides 14 to 76 of SEQ SD NO: 7, in another preferred aspect, the first nucieotide sequence comprises or consists of nucleotides 1 to 48 of SEQ i D NO: 9. in another preferred aspect, the second nucieotide sequence comprises or consists of nucleotides 49 to 72 Of SEQ ID NO: 9.
  • the present invention also relates to recombinant expression vectors and recombinant host cells comprising such nucleic acid constructs.
  • the present invention aiso relates to methods for producing a protein comprising (a) cultivating such a recombinant host eel! under conditions suitable for production of the protein; and (b) recovering the protein.
  • the protein may be native or heterologous to a host cell.
  • the term ''protein * ' is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins.
  • protein also encompasses two or more polypeptides combined to form the encoded product.
  • the proteins aiso include hybrid poiypeptides which comprise a combination of partial or complete polypeptide sequences obtained from at least two different proteins wherein one or more may be heterologous or native to the host celi. Proteins further include naiuraliy occurring aSi ⁇ iic and engineered variations of the above mentioned proteins and hybrid proteins.
  • the protein is a hormone or variant thereof, enzyme, receptor or portion thereof, antibody or portion thereof, or reporter.
  • the protein is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or Sigas ⁇ .
  • the protein is an aminopeptidase, amylase, carbohydrase, carboxypepiidase, cataiase, cellulase, chitinase, cutinase, cyclodextrin glycosylfransferase, deoxyribonuciease, esterase, alpha-gaiact ⁇ sidase, beta- galactosidase, glucoamylase, alpha-glucosidase, beta-giucosidase ; invertase, laccase, another lipase, mannosidase, mutanase, oxidase, pectinoiytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylanase.
  • the gene may be obtained from any prokaryotic, eukaryotic, or other source.
  • Chemicals used as buffers and substrates were commercial products of at least reagent grade.
  • LB medium was composed per liter of 10 g of tryptone, 5 g of yeast extract, and
  • L8 ampicillin medium was composed per liter of 10 g of tryptone, 5 g of yeast extract. 5 g of sodium chloride, and 50 ⁇ g of ampiciiSin per ml (filter sterilized, added after autoclaving).
  • LB ampiciSSin plates were composed per liter of LB ar ⁇ picillin medium and 15 g of bacto agar,
  • YPD medium was composed of 1% yeast extract, 2% peptone, and filter- sterilized 2% glucose added after autoclaving.
  • YPM medium was composed of 1% yeast extract 2% peptone, and filter- sterilized 2% maitodextrin added after aufociaving.
  • SC-URA medium with galactose was composed per liter of 100 ml of 10X Basal salts, 28 ml of 20% casarnino acids without vitamins, 10 ml of 1% tryptophan, 3.6 mi of 5% threonine (filter sterilized, added after autociaving), and 100 ml of 20% galactose (filter sterilized, added after autociaving).
  • SC-URA medium with giucose was composed per liter of 100 mi of 10X Basa! salts solution, 28 ml of 20% casamino acids without vitamins, 10 mi of 1% tryptophan, 3.6 mi of 5% threonine (filter sterilized, added after autoclaving ⁇ , and 100 ml of 20% glucose (filter sterilized, added after autoclaving).
  • 10X Basal salts solution was composed per liter of 75 g of yeast nitrogen base, 113 g of succinic acid, and 68 g of NaOH.
  • SC-agar was composed per liter of SC-URA medium (with glucose or galactose as indicated) and 20 g of agar.
  • 0.1% AZCL HE cellulose SC agar plates with galactose were composed per liter of SC-LSRA medium with galactose, 20 g of agar, and 0.1% AZCL HE cellulose (Megazym ⁇ , Wickiow, Ireland).
  • BA medium was composed per liter of 10 g of com steep liquor dry matter, 10 g of NH 4 NO 3 , 10 g of KH 2 PO 4 , 0,75 g of MgSO 4 -7H 2 O, 0,1 ml of pluronic, and 0.5 g of CaCOg. The pH was adjusted to 6,5 before autoclaving.
  • COVE plates were composed per liter of 342.3 g of sucrose, 25 g of Noble agar, 20 ml of COVE salts solution, 10 mM acetamide, and 20 mM CsCI. The solution was adjusted to pH 7.0 before autoclaving.
  • COVE salts solution was composed per liter of 26 g of KCi, 26 g of MgSO 4 - 7H 2 O, 76 g of KHiPO 4 , and 50 ml of COVE trace metals.
  • COVE trace metals solution was composed per liter of 0.04 g of NaB 4 O7-10H 2 O, 0.4 g of CuSO 4 SH 2 O, 1.2 g of FeSO 4 TH 2 O, 0.7 g of MnSO 4 H 2 O, 0.8 g of Na 2 MoO 2 ⁇ H 2 O, and 10 g of ZnSO 4 TH 2 O.
  • TE was composed of 10 mM Tris pH 7.4 and 0.1 mM EDTA.
  • Example 1 Construction of Myceliophthora thermophila CBS 117.65 cDNA expression libraries Jn Saccharomyces cerevlsiae Myceliophthora thermofila CBS 117.65 was cultivated in 200 mi of BA medium at 30° C for five days at 200 rpm. Myceiia from the shake fiask culture were harvested by filtering the contents through a funnel lined with MiraclothTM (CalBiochem, San Diego, CA, USA). The myceiia were then sandwiched between two MiraclothTM pieces and blotted dry with absorbent paper toweis. The mycelial mass was then transferred to Falcon 1059 plastic centrifuge tubes and frozen in liquid nitrogen. Frozen myceiia were stored in a -8O 0 C freezer until use.
  • Double-stranded cDNA was synthesized from 5 ⁇ g of poiy(A)+ RNA by the RNase H method (Gubler and Hoffman, 1983, Gene 25: 263-289, Sambrook et a/., 1989, Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY, USA).
  • the po!y(Ar RNA (5 ⁇ g in 5 ⁇ !
  • First-strand cDNA was synthesized by incubating the reaction mixture at 45 0 C for 1 hour. After synthesis, the rnRNAxDNA hybrid mixture was gei filtrated through a MicroSpin S-400 HR spin column (Pharmacia) according to the manufacturer's instructions.
  • the hybrids were diluted in 250 ⁇ ! of second strand buffer (20 mM Tris-HCI, pH 7.4, 90 mM KCI, 4.6 mM MgCI 2 , 10 mM (NH ⁇ SCu, 0.16 mM NAD) containing 200 ⁇ M of each dNTP, 60 units of E. coii DNA polymerase I (Pharmacia), 5.25 units of RNase H (Promega), and 15 units of E. coll DNA ligase (Boehringer Mannheim, Manheim, Germany).
  • second strand buffer 20 mM Tris-HCI, pH 7.4, 90 mM KCI, 4.6 mM MgCI 2 , 10 mM (NH ⁇ SCu, 0.16 mM NAD) containing 200 ⁇ M of each dNTP, 60 units of E. coii DNA polymerase I (Pharmacia), 5.25 units of RNase H (Promega), and 15 units of E. coll DNA ligase (Boehringer Mannheim, Man
  • Second strand cDNA synthesis was performed by incubating the reaction tube at 18X for 2 hours and an additional 15 minutes at 25"C, The reaction was stopped by addition of EDTA to a finai concentration of 20 mM followed by phenol and chloroform extractions.
  • the double-stranded cDNA was precipitated at -20 'C for 12 hours by addition of 2 volumes of 96% ⁇ thanol and 0.2 volume of 10 M ammonium acetate, recovered by centrifugation at 13,000 x g, washed in 70% ⁇ thanol, dried, and resuspended in 30 ⁇ l of Mung bean nuclease buffer (30 mM sodium acetate pH 4,6, 300 mM NaCI, 1 mM ZnSO 4 , 0.35 mM DTT, 2% glycerol) containing 25 units of Iviung bean nuclease (Pharmacia).
  • Mung bean nuclease buffer (30 mM sodium acetate pH 4,6, 300 mM NaCI, 1 mM ZnSO 4 , 0.35 mM DTT, 2% glycerol
  • the single-stranded hair-pin DNA was clipped by incubating the reaction at 3O 0 C for 30 minutes, followed by addition of 70 ⁇ l of 10 mM Tris-HCM mM EDTA pH 7.5, phenol extraction, and precipitation with 2 voiumes of 96% ethanoS and 0.1 volume of 3 M sodium acetate pH 5,2 on ice for 30 minutes.
  • the double- stranded cDNAs were recovered by centrifugation at 13,000 x g and blunt-ended in 30 ⁇ l of T4 DNA polymerase buffer (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) containing 0.5 mM of each dNTP and 5 units of T4 DNA poiymerase (New England Bi ⁇ iabs, Ipswich, MA, USA) by incubating the reaction mixture at 16 0 C for 1 hour. The reaction was stopped by addition of EDTA to a final concentration of 20 mM. followed by phenol and chloroform extractions, and precipitation for 12 hours at -20' 1 C by adding 2 volumes of 96% ethano! and 0.1 volume of 3 M sodium acetate pH 5.2.
  • T4 DNA polymerase buffer 20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1
  • the cDNAs were recovered by centrifugation at 13,000 x 0, washed in 70% ethanol, and dried.
  • the cDNA pellet was resuspended in 25 ⁇ l of ligation buffer (30 mM Tris-HCI, pH 7.8, 10 mM MgCI 2 , 10 mM DTT, 0.5 mM ATP) containing 2.5 ⁇ g of non-paiindromic Bst Xl adaptors (Snvitrogen, Carlsbad, CA, USA), shown below, and 30 units of T4 iigase (Promega), and then incubated at 16 '5 C for 12 hours. The reaction was stopped by heating at 65 * C for 20 minutes and then cooled on ice for 5 minutes.
  • the cDNA was size-selected with a cut-off at 0.7 kb and rescued from the gel by use of ⁇ -Agarase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions and precipitated for 12 hours at -2O°C by adding two volumes of 96% ethanol and 0.1 volume of 3 M sodium acetate pH 5,2.
  • the directional, size-selected cDNA was recovered by centrifugation at 13,000 x g, washed in 70% ethanol, dried, and then resuspended in 30 ⁇ l of 10 mft/i Tris-HCM mM EDTA pH 7.5.
  • the cDNAs were desalted by gel filtration through a MicrcSpin S- 300 HR spin column according to the manufacturer's instructions.
  • Three test ligations were carried out in 10 ⁇ l of ligation buffer (30 mM Tris-HCI, pH 7,8, 10 mM MgCi 2 , 10 rniVi DTT, 0.5 mM ATP) containing 5 ⁇ i of double-stranded cDNA (reaction tubes #1 and #2), 15 units of T4 iigase (Promega), and 30 ng (tube #1), 40 ng (tube #2), and 40 ng (tube #3, the vector background controi) of Bst Kl-Not I cleaved pYES2,0 vector (invitrogen, Carlsbad, CA, USA).
  • ligation buffer (30 mM Tris-HCI, pH 7,8, 10 mM MgCi 2 , 10 rniVi DTT, 0.5 mM ATP) containing 5 ⁇ i of double-stranded cDNA (reaction tubes #1 and #2), 15 units of T4 iigase (Promega), and 30 ng (
  • the ligation reactions were performed by incubation at 16°C for 12 hours, then heating at 70"C for 20 minutes, and finally adding 10 ⁇ ! of water to each tube.
  • One ⁇ i of each iigation mixture was eiectroporated into 40 ⁇ l of electrocompetent E. coli DH 10B cells (Bethesda Research Laboratories) as described by Sambrook et a/. , 1989, supra.
  • the Myceliophthora thermoph ⁇ la CBS 117.65 cDNA library was established in E. coii DH 10B consisting of pools. Each poo! was made by spreading transformed £ coli on LB ampiciliin plates, yielding 15,000-30,000 colonies/plate after incubation at 37°C for 24 hours. Twenty ml of LB ampicillin medium was added to the plate and the ceils were suspended therein. The cell suspension was shaken at 100 rpm in a 50 mi tube for 1 hour at 37 0 C.
  • the resulting Myceli ⁇ pfrthora therm ⁇ phila CBS 117,65 cDNA library consisted of approximately 10 ⁇ individual clones, with a vector background of 1%. Plasmid DNA from some of the library pools was isolated using a Plasmid Midi Kit (QIAGEN Inc., Valencia, CA, USA), according to the manufacturer's instructions, and stored at -20 0 C,
  • the SC agar plates were replica plated onto a set of 0.1% AZCL HE cellulose SC URA agar plates with galactose. The plates were incubated for 2-4 days at 30 15 C and e ⁇ dogi ⁇ canase positive colonies were identified as colonies surrounded by a blue hafo.
  • Example 3 Characterization of the Myceliophthora thermoph ⁇ fa CBS 117.65 cefSa gene Endoglucanase-expressing yeast colonies were inoculated into 20 ml of YPD medium in 50 ml glass test tubes. The tubes were shaken at 200 ⁇ m for 2 days at 30"C. The cells were harvested by centrifugation for 10 minutes at 3000 rpm in a H ⁇ raeus Megafuge 1.0R centrifuge with a 75002252 rotor (Hanau, Germany).
  • DNA was isolated according to VVD 94/14953 and dissolved in 50 ⁇ l of deionized wafer.
  • the DNA was transformed into E. coli DH 1OB cells by standard procedures according to Sambrook ef a/ , 1989, supra.
  • One E. coli transformant subsequently shown to contain the Myceiiophthora fhertnophila C8S 117.65 DCSa gene was designated pCICi61 ( Figure 1) and used as the material for deposit of bioiogicai material
  • E coli strain pC!C161 was deposited as £ coSi NRRL B-30902 on February 23, 2006.
  • Plasmid DNA was isolated from the £ coli transformants using standard procedures according to Sarnbrook et a/., 1989, supra.
  • the full iength cDNA sequence of the cel5a gene from Myceliophthora thermophila CBS 117.65 was sequenced with a Taq DyeDeoxy Terminator Cycle Sequencing Kit (Perkin Elmer, WeSiesley, MA, USA) and synthetic oligonucleotide primers using an Applied Btosystems ABI PRISM TM 377 DNA Sequencer (ABi, Foster City, CA, USA) according to the manufacturer's instructions.
  • the nucleotide sequence (SEQ ID NO: 3) and deduced amino actd sequence (SEQ ID NO: 4) of the Myc ⁇ liophthom thermophiia cel5a gene are shown in Figure 2.
  • the coding sequence is 1170 bp inciuding the stop codon.
  • the encoded predicted protein contains 389 amino acids.
  • the %G+C of the coding region of the gene is 63,6% and the mature polypeptide coding region is 63.6%.
  • SignaiP program, version 3 (Nielsen et a/,, 1997, Protein Engineering 10: 1-8)
  • the predicted mature protein contains 373 amino acids with a molecular mass of 40.9 kDa.
  • CEL5A protein contained the core sequence typical of a Family 5 glycosyl hydrolase, extending from approximately amino acid residue 77 to residue 350 of the predicted mature polypeptide.
  • the CEL5A protein also contained the sequence signature of a type ! fungal ce ⁇ ulose binding domain (CBMI). This sequence signature known as Prosite pattern PS00562 (Sigrist et at. f 2002, Brief Bi ⁇ inform. 3; 285-274) was present from amino acid residue 8 to residue 35 of the predicted mature polypeptide,
  • a comparative pairwise global alignment of amino acid sequences was determined using the Needleman-Wunsch algorithm (Needleman and Wunscn, 1970, J. Mo/, Biol. 48: 443-453) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 matrix.
  • the alignment showed that the deduced amino acid sequence of the Myceliophthora th ⁇ rmophila gene encoding the CEL5A mature polypeptide shared 75% and 72% identity ⁇ excluding gaps) to the deduced amino acid sequences of two Famiiy 5 giycosyi hydrolase proteins from Neurospom cmssa and Humicola insolens, respectively (accession numbers Q7SDR1 and G12624, respectively).
  • Example 4 Expression of Myceliophthora thermophila CBS 117.65 cel5a gene in Aspergillus oryzae
  • the Myceliophthora thermophiia CBS 1 17.65 ce!5a gene was excised from the pYES2.0 vector using Hind III and Xba I, and ligated into the Aspergillus expression vector pHD414 (EP 238 023 r WO 93/11249) using standard methods (Sambrook et a/., 1989, supra).
  • the Aspergillus expression vector pHD414 is a derivative of p775 (EP 238 023).
  • the resulting plasmid was designated pA2C181 ( Figure 3), Protoplasts of Aspergillus oryza ⁇ HowB104 were prepared as described in WO
  • a cDNA library from basidiomycete CBS 495.95, consisting of approximately 10 s individual clones was constructed in E. coli as described in Example 1 , with a vector background of 1%.
  • Example 5 The screening of the cDNA library (Example 5) was performed as described in Example 2.
  • Example 7 Characterization of a CEL5A encoding gene from bastdiomycete CSS 495.95
  • the basidiomycete CBS 495 95 cel ⁇ a gene was excised from pCIC453 using Hind ill and Xba I and ligated into the Aspergillus expression vector pHD414, The resulting plasmid was designated pA2C453 ( Figure 5).
  • SEQ ID NO: 6 ⁇ of the CBS 495.95 cel ⁇ a gene are shown in Figure 8.
  • the coding sequence is 1194 bp including the stop codon.
  • the %G+C of the coding region of the gene is 59.8% and the mature polypeptide coding region is 60.1%.
  • the encoded predicted protein contains 397 amino acids. Using the SignalP program, version 3 (Nieisen ⁇ t a/ , 1997. supra), a signal peptide of 15 residues was predicted.
  • the predicted mature protein contains 382 amino acids with a molecular mass of 40.1 kDa. Analysts of the deduced amino acid sequence of the c ⁇ lSa gene with the lnterproscan program (Zdobnov and Apw ⁇ iler, 2001.
  • the CEL5A protein contained the core sequence typical of a Family 5 glycosyl hydrolase, extending from approximately residues 81 to 359 of the predicted mature polypeptide.
  • the CEL5A protein also contained the sequence signature of a type I fungal cellulose binding domain (CSMI), This sequence signature known as Prosite pattern PS00562 (Sigrist et a/., 2002, supra) was present from amino acid residue 8 to residue 36 of the predicted mature polypeptide.
  • CSMI type I fungal cellulose binding domain
  • a comparative pairwise global alignment of amino acid sequences was determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5, and the E8LOSUM82 matrix.
  • the alignment showed that the deduced amino aetd sequence of the CBS 495.95 gene encoding the CEL5A mature polypeptide shared 82% and 79% identity (excluding gaps) to the deduced amino acid sequences of two Family 5 glycosyl hydrolase proteins from Irpex iacte ⁇ s and Trametes hirsute, respectively (accession numbers Q5W7K4 and Q75UV6, respectively).
  • Example 8 Expression of cel5a gene from basidiomycete CBS 495,95 in Aspergillus oryzae Expression of the cel5a gene from basidiomycete CBS 495,95 « and analysis of endoglucanase activity was performed as described in Example 4.
  • Example 9 Construction of a basidiomycete CBS 494.95 cDNA expression library in Saccharomyces cerevisiae
  • a cDNA library from basidiomycete CBS 494.95, consisting of approximately 10 ⁇ individual clones was constructed in E coli as described in Example 1 , with a vector background of 1%.
  • Example 9 The screening of the cDNA library (Example 9) was performed as described in Example 2.
  • Example 11 Characterization of a CEL5B encoding gene from basidiomycete CBS 494.95
  • the resuiting plasmid was designated pA2C486 ( Figure 8).
  • the nucleotide sequence (SEQ ID NO: 7 ⁇ and deduced amino acid sequence (SEQ ID NO-. 8 ⁇ of the CBS 494,95 DC ⁇ b gene are shown in Figure 9.
  • the coding sequence is 1290 bp inciuding the stop codon.
  • the %G+C of the coding region of the gene is 56 0% G+C and the mature polypeptide coding region is 58.1%.
  • the encoded predicted protein contains 429 amino acids.
  • CELSB protein contained the core sequence typical of a Famiiy 5 glycosyl hydrolase, extending from approximateSy amino acid residue 106 to residue 385 of the predicted mature polypeptide.
  • the CEL5A protein also contained the sequence signature of a type f fungal cellulose binding domain ⁇ CBMS). This sequence signature known as Prosife pattern PS00562 (Sigrist et a/,, 2002, supra) was present from amino acid residue 7 to residue 34 of the predicted mature polypeptide.
  • a comparative pairwise global alignment of amino acid sequences was determined using the Needleman-Wunsch aig ⁇ rithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUtv162 matrix.
  • the alignment showed that the deduced amino acid sequence of the CBS 495.95 gene encoding the CEL5A mature polypeptide shared 69% and 67% identity (excluding gaps) to the deduced amino acid sequences of two Family 5 glycosyl hydrolase proteins from Irpex lacteus and Tmmetes hirsuta, respectively (accession numbers Q5VV7K4 and Q75UV6, respectively).
  • Example 12 Expression of CEL5B from basidiomycete CBS 494.95 in Aspergillus oryzae Expression of the cel ⁇ B gene from basidiomycete CBS 494.95 : and analysis of endoglucanase activity was performed as described in Exampie 4.
  • Example 13 Purification of recombinant endoglucanases from Myceliophthora thermophila CBS 117.65, basidiomycete CBS 494.95, and basidiomycete CBS 49S.9S
  • BCA Bici ⁇ choninic acid
  • Enzyme dilutions were prepared fresh before each experiment from stock enzyme solutions, which were stored at -20 ' C
  • Example 14 Isolation of genomic DMA from Penicillium brasilianum IBT 20888
  • Mycelia were collected by filtration through a Nalgene DS0281-5000 filter (Nalge Nunc Internationa! Corporation, Rochester, NY, USA) until dryness and frozen in iiq ⁇ id nitrogen.
  • the frozen mycelia were ground to a powder in a dry ice chilled mortar and distributed to a screw-cap tube.
  • the powder was suspended in a total volume of 40 ml of 50 mM CAPS (3-(cyciohexylamino)-1-propanesulfonic acid)-NaQH pH 11 buffer containing 0.5% lithium dodecyi suifate and 0.5 mM EDTA.
  • the suspension was placed at 60 0 C for 2 hours and periodicaily resuspended by inversion.
  • phenol.chloroform (1:1 v/v) neutralized with 0.1 M Tris base, and the tube was mixed on a rotating wheei at 37 0 C for 2 hours. After centrifugation at 2500 rpm for 10 minutes in a Sorvall H 1000B rotor, the aqueous phase (top phase) was re-extracted again with phenoi:chloroform (1 :1 v/v) and centrifuged at 15,000 x g for 5 minutes. The aqueous phase from the second extraction was brought to 2.5 M ammonium acetate (stock 10 M) and placed at -20 :; C until frozen.
  • the extract was centrifuged at 15,000 x g for 20 minutes in a coid rotor.
  • the pellet (primarily rRNA) was discarded and the nucleic acids in the supernatant were precipitated by addition of 0.7 volumes of isopropano!.
  • the pe ⁇ et was rinsed three times with 5 ml of 70% ethanoi (without resuspension), air- dried almost completely, and dissolved in 1.0 ml of 0.1 X TE. The dissolved pellet was transferred to two 1 ,5 mi microfuges tubes.
  • the nucleic acids were precipitated by addition of ammonium acetate (0.125 ml) to 2.0 M and ethanoi to 63% (1,07 ml) and centrifuged at maximum speed for 10 minutes in a Sorvall MC 12V microcentrifuge ⁇ Kendro Laboratory Products, Asheville, NC ; USA). The pellet was rinsed twice with 70% ethanoi, air-dried completely, and dissolved in 500 ⁇ l of 0.1 X TE,
  • Example 15 Preparation of a genomic DMA library of Penicilltum brasilianum IBT 20888
  • Genomic libraries were constructed using a TOPO Shotgun Subcloning Kit (Invitrogen, Carlsbad, CA 1 USA). Briefly, total ceS ⁇ uSar DNA was sheared by nebulization under 10 psi nitrogen for 15 seconds and size-fractionated on 1% agarose gels using 40 mM Tris base-20 mM sodium acetate-1 mM disodium EDTA (TAE) buffer. DNA fragments migrating in the size range 3-6 kb were excised and eiuted using a
  • the eiuted DNA fragments were blunt end repaired and dephosphorylated using shrimp alkaline phosphatase (Roche Applied Science, Manheim, Germany).
  • the blunt end DNA fragments were cloned into the pCR48!unt-TOPO vector (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions, transformed into eiectrocompetent E. coli TOP10 ceils by electroporation, and plated on LB ampiciiiin plates.
  • the eiectroporation resulted in 15,300 clones.
  • Example 16 Purification of native CEL5C endoglucanase from Peniciflium brasifianum IBT 20888
  • the gel was run in an Xcell SureLockTM gel apparatus (Invitrogen, Carlsbad, CA, USA) for 90 minutes with initial power settings of 40 mA at maximum 135 V. Following electrophoresis the gel was incubated for 5 minutes in a blotting solution consisting of 10 mM CAPS pH 11 containing 6% methanol. A Pr ⁇ Bl ⁇ tt membrane (Applied Biosystems, Foster City, CA, USA) was wetted for 1 minute in pure methanol before being placed in the blotting solution for 5 minutes in order to saturate the membrane with 10 mM CAPS pH 11 containing 6% methanol.
  • ProBlott membrane, the polyacryiamide gel, and six pieces of Whatman no. 1 paper wetted in blotting solution The blotting apparatus was assembled thereby putting the negative electrode in contact with the upper stack of Whatman no. 1 paper. A weight of 11.3 kg was placed on top of the blotting apparatus. The electroblotting was performed at a current of 175 mA for 180 minutes.
  • N-terminaS sequencing was carried out using the method run file for PVDF membrane samples (Pulsed liquid PVDF) according to the manufacturer ' s instructions.
  • the N-terminal amino acid sequence was deduced from the resulting chromatograms by comparing the retention time of the peaks in the chromatograms to the retention times of the PTH-amino-acids in the standard chromatogram.
  • CEL5C endogSucanase was determined directly using a Precise 494 HT Sequencing System (Applied Biosystems, Foster City, CA 1 USA).
  • the N-terminal sequence was determined to be Ala-Ser-Ser-Phe-Val-Trp-Phe-Gly-Thr-Ser-Glu-Ser-Gly-Aia-G!u-Phe-
  • Gfy-Asn-Gin-Asn amino acids 25 to 44 in SEQ SD NO: 10
  • Example 18 PCR amplification of the cel5c endoglucanase gene from PeniciHium brasilianum JBT 20888
  • Amplification reactions (30 ⁇ l) were prepared using approximately 1 ⁇ g of PeniciHium brasilianum genomic DNA as template, in addition, each reaction contained the following components: 30 pmol of the forward primer, 30 pmo! of the reverse primer, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1X AmpliTaq poiymerase buffer (Applied Biosystems, Foster City, CA, USA), and 0.5 unit of AmpliTaq polymerase (5.0 U/ ⁇ f , Applied Biosyster ⁇ s, Foster City, CA, USA).
  • the reactions were incubated in a Robocycier (Stratagene, La JoiSa, CA, USA) programmed for 1 cycle at 96 °C for 3 minutes and at 72°C for 3 minutes; 34 cycles each at 95"C for 0.5 minute, 56°C for 0.5 minutes, and 72°C for 1.5 minutes; 1 cycle at 72°C for 7 minutes; and a soak cycle at 6X.
  • Taq poiymerase was added at 72°C in the first cycle.
  • PCR reaction products were separated on a 2% agarose gel (Amresco, Solon, OH, USA) using TAE buffer.
  • a band of approximateiy 650 bp (Fwd and Rev1 primers) and bands of approximateiy 320 and 380 bp (Fwd and Rev2 primers) were excised from the gei and purified using a MiniESuteTM Gei Extraction Kit (QIAGEN Inc., Vaiencia, CA, USA) according to the manufacturer's instructions.
  • the purified PCR products were subsequently analyzed by DNA sequencing.
  • the 320 bp product was found to encode a portion of a glycosyl hydrolase Family 5 polypeptide that was designated CEL5C.
  • Colony Sifts of the library described in Example 15 were performed (Maniatis et a/., 1982, Molecular Cloning, A Laboratory Manual, Coid Spring Harbor Press, CoSd Spring Harbor, New York) and the DNA was cross-finked onto Hybond N+ membranes (Amersham, Arlington Heights, IL, USA) for 2 hours at 8O 0 C.
  • the membranes from the coiony lifts were pre-wetted using 0.2X SSC (30 mM NaCI, 3 my sodium citrate), 0.2% SDS.
  • the pre-wetted filters were placed in a beaker with 7.5 ml of 6X SSPE (0.9 M NaCI, O.O ⁇ M NaH 2 PO 4 , and 6 mM EDTA), 7% SDS) per filter at 68 0 C in a shaking water bath for 30 minutes.
  • 6X SSPE 0.9 M NaCI, O.O ⁇ M NaH 2 PO 4 , and 6 mM EDTA
  • PCR product described in Example 18 Approximately 40 ng of the PCR product described in Example 18 were random- primer labeled using a Stratagene Prime-It Ii Kit (Stratagene, La JoIIa, CA) according to the manufacturer's instructions. The radiolabeled gene fragment was separated from unincorporated nucleotide using a MinEluie PCR Purification Kit (QIAGEN Inc., Valencia, CA, USA).
  • the radioactive probe was denatured by adding 5.0 M NaOH to a final concentration of 0.5 M, and added to the hybridization solution at an activity of approximately 0.5 x 10 ⁇ cpm per ml of hybridization solution.
  • the mixture was incubated for 10 hours at 68 * C in a shaking water bath. Following incubation, the membranes were washed three times in 0.2X SSC 1 0.2% SDS at 68°C. The membranes were then dried on blotting paper for 15 minutes, wrapped in SaranWrapTM, and exposed to X-ray film overnight at -80"C with intensifying screens (Kodak, Rochester, NY, USA),
  • Colonies producing hybridization signals with the probe were inoculated into 1 ml of LB ampiciiiin medium and cultivated overnight at 37"C, Dilutions of each solution were made and 100 ⁇ l were plated onto LB ampiciiiin plates. The dilution for each positive that produced about 40 colonies per plate was chosen for secondary lifts. The lifts were prepared, hybridized, and probed as above. Two colonies from each positive plate were inoculated into 3 ml of LB ampiciiiin medium and cultivated overnight at 37"C
  • Example 20 Characterization of the cefSc genomic sequence encoding the CELSC endogJucanase from Penicitllum bms ⁇ lianum IBT 20888
  • coding region of the gene is 51.2% and the mature polypeptide coding region is 50.8%.
  • SignalP software program Nieisen et a/., 1997, Protein Engineering 10: 1-6
  • residues 17 through 24 appear to constitute a pro-region that is proteoSyt ⁇ caSly cleaved during maturation.
  • the predicted mature protein contains 397 0 amino acids and has a predicted mass of 42.6 kDa.
  • CEL5C protein contained the core sequence typical of a Family 5 glycosyl hydrolase, extending from approximately residues 32 to 307 of the predicted full-length polypeptide.
  • the 5 CEL5C protein also contained the sequence signature of a type I fungal DCSuiose binding domain (CBMi). This sequence signature known as Prosite pattern PS00562 (Sigrist et a/,, 2002 « supra) was present from amino acid residue 393 to residue 420 of the predicted polypeptide.
  • a comparative pairwise globai alignment of amino acid sequences in public 0 databases was determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 matrix.
  • the alignment showed that the deduced amino acid sequence of the Penicillium brasiiianum DCSc gene encoding the CEL5C mature polypeptide shared 74.9% and 74.5% identity 5 (excluding gaps) to the deduced amino acid sequences of two predicted Family 5 glycosyl hydrolase proteins from Neosartorya fischeri and Aspergillus fumigatus, respectively (accession numbers A1 DAP? and Q4WMQ9, respectively).
  • Example 21 Construction of an Aspergillus oryzae expression plasmid for the cel5c endoglucanase gene from Penicillium brasilianum IBT 20888
  • the Aspergillus expression plasmicl pJaL721 (WO 03/008575) consists of an expression cassette based on the Aspergillus niger neutral amylase Il promoter fused to the Aspergillus nictulans triose phosphate isomerase non-translated leader sequence (NA2-t ⁇ i) and the Aspergillus niger amySoglycosicSase terminator.
  • E. coli DB6507 was made competent by the method of Mandei and Higa, 1970,
  • the cel5c endogiucanase gene from P ⁇ nicllli ⁇ m brasilianum was amplified by PCR using the following two oligonucleotide primers: Forward PCR: 5'-AATTGGATCCACC ATG AAATACCCTCTACTCCTGGCA AC-3' (SEQ ID NO: 14) Reverse PCR:
  • Genomic DNA prepared as in Example 14 was used as template in the PCR reaction. The reaction was performed in a volume of 50 ⁇ i containing 1.0 unit of Phusio ⁇ (Finnzymes Oy, Espoo, Finland), 1X Phusion buffer HF (Finnzymes Oy, Espoo, Finland), 500 ng of genomic, 250 ⁇ M of each dNTP, and 50 pmoi of each of the two primers described above.
  • the amplification was carried out in a PTC-220 DNA Engine Dyad Peltier Thermal Cycler (MJ Research, Inc., Waltham, MA, USA) programmed for 1 cycle at 95°C for 5 minutes; 24 cycles each at 94X for 0.5 minute, 58"C for 0.5 minute, and 88 0 C for 4.0 minutes; and 1 cycle at 68°C for 15 minutes.
  • the hot start PCR technique (Chou et a/,, 1992, Nucleic Acids Res, 20: 1717 ⁇ was used and the Phusion polymerase was added after 1 minute of the first cycle.
  • the PCR reaction produced a single DNA fragment of approximately 1500 bp in length.
  • the fragment was digested with Bam Hl and Xho I and isolated by agarose gel electrophoresis, purified, and cloned into ⁇ JaL721 digested with Bam Hi and Xho i, resulting in a plasmid designated pKBK03 ( Figure 11).
  • the sequence of the endoglucanase gene in pKBKOS was verified by sequencing with an Applied ⁇ iosystems 373OxI DNA Analyzer.
  • ⁇ KBK03 was digested with Bam Hi and Xho I and purified.
  • Plasmid pUC13 was digested with Sma i and dephosphoryiated with Calf Intestina! Protease (Roche Applied Science, Manh ⁇ im, Germany; CIP) for 1 hour at 37"C and the ClP was inactivated by heating the sample to 8(TC for 15 minutes.
  • the blunt end repaired fragment and the dephosphoryiated pUC13 fragment were Sigat ⁇ d overnight at 16°C using T4 DNA ligase (Roche Applied Science, Manheim, Germany).
  • a 0.25 ⁇ g sample of the iigated product was transformed into Escherichia coii DH5 ⁇ (Invitrogen, Carisbad, CA, USA). After incubation overnight at 37 0 C on LB ampic ⁇ ilin piates, transformants were transferred to 2 ml of LB medium and incubated at 37"C.
  • a plasmid designated pPBCel ⁇ C ( Figure 12) was purified using Jetquick. Plasmid Miniprep (Genomed, Lohne, Germany).
  • Example 22 Expression of the Penicillium brasiiianum IBT 20888 CEL5C endogSucanase in Aspergillus oryzae
  • Aspergillus oryzae BECh2 (WO 00/30322 ⁇ was transformed with 5 ⁇ g of pKBKOS as described by Christensen et al., 1988, Biotechnology 6: 1419-1422.
  • Transformants were cultivated in 50 ml tubes for 4 days at 3O 0 C in 10 ml of YPM medium. The whole broths were centrifuged at 12,100 x g and the supernatants removed. The supernatants were analyzed by SDS-PAGE using a Criterion XT Precast
  • the supernatants resuiting in a visible band after SDS-PAGE also contained endogiucanase activity, assayed as described in Example 3. The higher the intensity of the band, the higher endogiucanase activity measured in the same supernatant.
  • Aspergillus oryzae transformant KBK03 was grown in twenty 500 ml shake fiasks with 200 ml of YPM medium. The biomass was removed from 4.0 liters of fermentation broth by centrif ⁇ gation and filtration. SDS-PAGE analysis was performed as described in Exampie 9. The endogiucanase solution was ioaded onto a XK 50 column (Arnersham Biosciences, Uppsaia, Sweden) containing 110 g of Avicel Ph 101 (Merck KGaA 1 Darmstadt, Germany) pre-equilibrated with 25 mM Tris pH 7.5 prior to loading and the bound enzyme was eluted with 25 mM Tris, 1% triethanoiamine at pH 11.6. El ⁇ tion of the endogiucanase was monitored at 280 nm. The eiuted protein containing fractions were pooled immediately and the pH adjusted to 7.5, Fractions containing the endogiucanase were pooied.
  • the protein content was determined from the absorbance at 280 nm and the extinction coefficient caiculated from the primary structure of the endogiucanase.
  • the purification was foiiowed by SDS-PAGE.
  • the samples were boiled for 2 minutes with an equa! volume of 2X sample buffer and 1/5 volume of 1% PMSF and ioaded onto a 4-20% Tris-glycine ge! (Invitrogen, Carisbad, CA, USA).
  • the ge! was stained with GelCode BSue Stain Reagent (Pierce, Rockford, il_, USA) and destained with water.
  • SDS-PAGE reveaied one band of approximately 65 kDa.
  • the purified recombinant PenicHlium brasilia ⁇ um CEL5C end ⁇ giucanas ⁇ described in Example 23 was characterized with regard to pH optimum, temperature optimum, and temperature stability.
  • the endogiucanase activity was measured as described in Example 16 at temperatures from 20 0 C to 8Q*C and at pH values of 3.0 to 10 0.
  • the purified ⁇ ndogiucanas ⁇ was diluted in Milli-Q® ultrapure water (Millipore. Billerica, MA, USA) to ensure that activity was within the standard curve.
  • the substrate was dissolved in Britton- Robinson buffer (50 mM boric acid, 50 5 mM acetic acid, 50 mM phosphoric acid) adjusted to the desired pH, The temperature stability was determined for 20 hours at 50 0 C in the pH range from 4.0 to 6.0. Al! experimenta! assays were performed in duplicate.
  • the results of the temperature optimum determination is shown in Figure 14.
  • the temperature optimum at pH 4.8 was approximately ?0 ⁇ C with more than 75% of peak activity from 60 4 C to 80 0 C.
  • NREL National Renewabie Energy Laboratory
  • the following conditions were used for the pretreatment: 1.4 wt % suifuric acid at 165 0 C and 107 psi for 8 minutes
  • Compositionai analysis was performed at NREL Ceiiuiose and hemiceiiui ⁇ se were determined by a two-stage sulfuric acid hydrolysis with subsequent 5 anaiysis of sugars by high performance liquid chromatography (HPLC) using NREL Standard Analytical Procedure #002.
  • Lignin was determined gravimetrically after hydrolyzing the DCiuiose and hemicelSulose fractions with suifuric acid (NREL Standard Anaiyticai Procedure #003).
  • PCS pretreated corn stover
  • a 10 mg/ml stock suspension of phosphoric acid-swollen DCiuiose (PASC) in deionized water was prepared using the following procedure.
  • One hundred and fifty ml of ice-cold 85% ⁇ -phosphoric acid was added to 5 g of Avicei PH101 (PMC Corp., Philadelphia. PA, USA) moistened with water.
  • the suspension was siowly stirred in an ice bath for one hour, and 100 ml of ice-cold acetone was added to the suspension at constant stirring.
  • the slurry was transferred to a Kimax funnel with a glass filter of coarse porosity, washed three times with 100 ml of ice-cold acetone, and drained as compieteiy as possible after each wash, Finally, the slurry was washed twice with 500 ml of water, and again drained as completely as possible after each wash.
  • the PASC was mixed with water to a total volume of 500 mi.
  • Sodium azide was added to a fina! concentration of 0.02% to prevent microbiai growth.
  • the slurry was homogenized using a blender and stored at 4 0 C for up to one month.
  • Carboxym ⁇ thylcel ⁇ iose (CMC, sodium sait, type 7L2) with an average degree of substitution (DS) of 0.7 was obtained from Aquaion Division of Hercules Inc., Wilmington, DE, USA.
  • a 6.25 mg/ml solution of CMC in 50 mM sodium acetate pH 5.0 was prepared by slowly adding CMC to the vigorously agitated buffer. The slurry was heated to approximately 80 0 C under continuous stirring until the CMC was completely dissolved
  • Bacterial cellulose was prepared from Nata de Coco, a food-grade commercial cellulose (Fujicco Co., Kobe, Japan), as described in Boissef ⁇ t a/., 1999, Biochemical Journal, 340: 829-835.
  • a 1 mg/ml suspension of bacterial cellulose in deionized water with 0.01 % (w/v) sodium azide was stored at 4 0 C.
  • Avicei PH 101 was obtained from FMC Corporation, Philadelphia, PA, USA.
  • Xylan from birchwood was obtained from Sigma, St. Louis, MO, USA.
  • Xylogiucan from Tamarind seed (amyloid, lot 00401), wheat arabinoxylan (medium viscosity, 27 cSt, lot 90601), 1,4-beta-D-mannan (borohydride reduced, Man;Gal ⁇ 97;3, degree of polymerization DP - 15, lot 90302), and carob galactomannan (low viscosity, borohydride reduced, iot 90301) were obtained from Megazyme, Bray, ireland.
  • Example 26 p-Hydroxybenzoic acid hydrazide assay for determination of reducing sugars Reducing sugars (RS) were determined by a p-hydroxybenzoic acid hydrazide
  • a 90- ⁇ l aliquot of the diluted sample was placed into each well of a 96-wel! conical-bottomed microplate (Costa r, clear polycarbonate, Corning inc., Acton, MA, USA), The assay was initiated by adding 60 ⁇ l of 1.25% PHBAH in 2% sodium hydroxide to each well. The uncovered plate was heated on a custom-made heating block for 10 minutes at 95 0 C. Following heating, the rnicroplat ⁇ was cooled to room temperature, and 35 ⁇ l of deioniz ⁇ d water was added to each well.
  • a 100 ⁇ l aliquot was removed from each well and transferred to a fiat- bottomed 96-well plate (Costar, medium binding polystyrene, Corning inc., Acton, MA, USA).
  • the absorbance at 410 nm was measured using a SpectraMAX Microplate Reader (Molecular Devices, Sunnyvale, CA, USA).
  • the A 410 value was translated into gSuc ⁇ se eq ⁇ ivaients using a standard curve.
  • the standard curve was obtained with six glucose standards (0.005, 0.010, 0.025, 0.050, 0 075, and 0.100 mg/ml), which were treated simiiarly to the sampSes.
  • Glucose standards were prepared by diluting 10 mg/mS stock glucose soiution with d ⁇ ioniz ⁇ d water.
  • RS (tng r ⁇ ) x 100 / (Initial substrate concentration im ⁇ mf) x 1.138)
  • RS is the concentration of reducing sugars in solution measured in glucose equivalents (mg/ml)
  • the factors 1,111 and 1.136 reflect the weight gain in converting corresponding polysaccharides to hexose (MVV 180) or pentose (MW 150) sugars.
  • Example 27 Relative activity of endoglucanases on carboxymethyl-cellulose at 50°C
  • Table 1 shows the relative activity of the purified endoglucanases from Myceliophthora thermophila CBS 117.85, basidiomycete C8S 494.95, and basidiomycete CBS 495.95 toward the soluble sodium salt of carboxymethylceSiuiose (CMC).
  • the reiative activity is shown as percentage of the activity of basidiomycete CBS 495.95 endogiucanase.
  • the activity was determined by measuring the concentration of reducing sugars (RS) produced from CMC (5 mg/ml ⁇ after 30 minutes of hydrolysis in 50 mfvi sodium acetate pH 5.0 at 50 c C. Hydrolysis was carried out without stirring in the presence of 0.5 mg/ml bovine serum albumin (BSA, Sigma, St. Louis, MO, USA). Reducing sugars were determined using p-hydroxybenzoic acid hydrazide (PHBAH) assay described in Example 26.
  • RS reducing sugars
  • Example 28 Thermal stability of endoglucanases at 40 0 C-SO 0 C
  • the thermal stability of the purified endoglucanases from Myceli ⁇ pfrthona thermophila CBS 117.65, basidiomycete CBS 494.95, and basidiomycete C8S 495.95 was determined by incubating enzyme solutions at five temperatures (4Q 0 C, 50 0 C, 60 0 C, 70 0 C 1 and 8O 0 C), and measuring the residual activity of enzymes on carboxymethylceilulose (CMC).
  • the enzymes were diluted in 50 mM sodium acetate pH 5.0, which contained 3.0 mg/ml BSA, and incubated for 3 hours in 1.1-rnl ImmunoWare Microtubes arranged in an 8x12 micropSate format (Pierce, Rockford, IL, USA), BSA was added in order to prevent possibie enzyme adsorption onto the pSastic walls of microtubes.
  • the protein concentration in the incubation mixtures was chosen so that each enzyme would give less than 1% conversion of CMC in subsequent assay for CMCase activity.
  • Example 29 Relative activity of endoglucanases on phosphoric acid-swollen cellulose at 40-70°C
  • the activity of the purified encSoglucanases from basidiomycete CBS 494.95 and basidiomycete CBS 495.95 on phosphoric acid-swolien cellulose (PASC) was determined by measuring the concentration of the reducing sugars (RS) reieased during initial hydrolysis of PASC (2 mg/ml) in 50 mM sodium acetate pH 5.0. Hydrolysis was carried out without stirring in the presence of 0.5 mg/ml bovine serum aibumin (BSA, Sigma, St Louis, MO, USA). The enzymes were diluted so that the RS concentration would increase linearly during the initial 30 to 90 minutes of hydrolysis, and the degree of PASC conversion would not exceed 2% during this time. Reducing sugars were determined using the p-hydroxybenzoic acid hydrazide (PHBAH) assay as described in Example 26.
  • PBAH p-hydroxybenzoic acid hydrazide
  • the relative activity as a function of temperature of the endoglucanases from basidiomycete CBS 494.95 and bastdiomyc ⁇ te CBS 495 95 is shown in Figure 16.
  • the activity is shown as percentage of the activity of the endoglucanase from basidiomycete CBS 495.95 at 6O 0 C,
  • Example 30 Long-term hydrolysis of phosphoric acid-swo ⁇ len cellulose at 40- 70 0 C
  • Figure 17 shows the relative conversion of PASC after a 45 hour incubation with the endoglucanases from basidiomycete CBS 494.95 and basidiomycete CBS 495.95 (0.5 mg protein per g of PASC) as a function of temperature.
  • the relative conversion is shown as a percentage of the conversion obtained after 45-hour incubation with basidiomycete CBS 495,95 at 50" 1 C.
  • the optimal temperature for iong-term hydrolysis of PASC was 50°C.
  • Example 31 Characterization of endoglucanases on various polysaccharide substrates at 50 0 C
  • the purified endogiucanases from Myceliophthora thermophila CBS 117,65, basidiomycete C8S 494.95, and basidiomycete CBS 495.95 were evaluated in the hydrolysis of various polysaccharides at pH 5.0 (50 my sodium acetate buffer) and 50 0 C.
  • the resuits were compared with those for recombinant T ⁇ choderma rees ⁇ i Ce!7B (EGi) endoglucanase.
  • Trichod ⁇ rma reesei CeIZB (EGi) endogiucanase produced by Aspergillus oi ⁇ me can be prepared according to Takashima ef at., 1998, Journal of Bacteriology 65: 163- 171.
  • the polysaccharides included pretreated corn stover (PCS), phosphoric acid- swollen cellulose (PASC) 1 carboxymethylceliulose (CMC), bacterial cellulose (BC), Avicei, xyian, xylcgiuca ⁇ arabinoxyian, mannan and gaiactomannan.
  • PCS pretreated corn stover
  • PASC phosphoric acid- swollen cellulose
  • CMC carboxymethylceliulose
  • BC bacterial cellulose
  • Avicei xyian
  • xylcgiuca ⁇ arabinoxyian mannan
  • gaiactomannan gaiactomannan
  • the relative conversion was calculated as a percentage of conversion obtained after 24-hour hydrofysss of 1 ,4- ⁇ -D-mannan by bassdiomycei ⁇ CBS 495.95 CeISA endogiucanase.
  • Endoglucanases from glycoside hydrolase (GH) family 5 had relativ ⁇ iy high activity on ma ⁇ nan and gaiactoman ⁇ an, but iow activity on xylan, xylogiuean and arabinoxylan, in contrast
  • Trichoderma reesei Cel7B had relaiiveiy high activity on xyian, xyioglucan and arabinoxylan, but iow activity on manna n and galactomannan.
  • the GH5 endogiucanases showed better hydrolysis of PASC (insoluble unsubsfituted amorphous DCiuSose) than CMC (soluble substituted DCluiose derivative).
  • the GH5 endogiucanases had low activity on insolubie substrates with high degree of crystaSlinity: bacterial creluiose, Avicei, and PCS
  • Example 32 Hydrolysis of soluble beta-glucan from barley by endoglucanases at 60 0 C The activity of the endogSucanases from Myceliophthora thertnophila CBS 117.65, basidiomycete CBS 494.95, and basidiomycete CBS 495.95 on soluble beta- gl ⁇ ca ⁇ from barley (medium viscosity, 230 kDa, Megazyme Internationa! ireiand Ltd., Bray, Ireland) was determined at pH 5.5 (50 mM sodium acetate with 0.02% sodtum 5 azide) and 60' C.
  • the initial concentration of beta-giucan in the hydrolysis reactions was 1 0%
  • the endoglucanases from basidiomycete CBS 494,95 and basidiomycete CBS 495.95 showed similar performance in hydralyzing beta-giucan, and produced no additionai increase in reducing sugar concentration after 2 hour hydroiysis.
  • the endoglucanases from Myceliophthora thermophiia and Trichoderma reesei 5 continued to produce new reducing end-groups beyond the 2 hour incubation time.
  • the Myceliophthora thermophiia endogiucanase showed better performance in hydroiyzing beta-giucan than the basidiomycete CBS 494.95 CeiSB endogiucanase and basidiomycete CBS 495.95 Cei ⁇ A endogiucanase.
  • the strains have been deposited under conditions that assure that access to the cuitures wil! be available during the pendency of this patent appiication to one determined by the Commissioner of Patents and Trademarks to be entitied thereto under 37 CF. R. ⁇ 1.14 and 35 U.S.C. ⁇ 122.
  • the deposits represent substantially pure cultures of the deposited strains.
  • the deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny are filed. However, it shouid be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Detergent Compositions (AREA)

Abstract

The present invention relates to isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Description

POLYPEPTIDES HAVING ENDOGLUCANASE ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME
Reference to a Sequence Listing
This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference.
Reference to a Deposit of Biological Material This appiication contains a reference to deposits of biological materia! which have been made at the Northern Regional Research Center (NRRL) under the Budapest Treaty and assigned accession numbers NRRL B-3Q900N, NRRL B-30902, NRRL B- 30903, and NRRL 8-30904, which microbial deposits are incorporated herein by reference,
Background of the invention
Field of the invention
The present invention reiates to isolated poiy peptides having endogiucanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as weii as methods for producing and using the polypeptides.
Description of the Related Art Cellulose is a polymer of the simple sugar glucose covalently bonded by beta-
1,4-linkages. Many microorganisms produce enzymes that hydrolyze beta-linked glucans. These enzymes include endogiucanases, cellobiohydrolases, and beta- glucosidases, Endoglucanases digest the cellulose polymer at random locations, opening it to attack by cellobiohydrolases. CeSiofoiohydroSases sequentially release molecules of ceiiobiose from the ends of the cellulose polymer. Cellobiohydrolase I is a 1,4-beta-D-glucan cellobiohydrolase (E.G. 3.2.1.91) activity which catalyzes the hydrolysis of 1,4-beta-D-glucosidic linkages in cellulose, cellotetriose, or any beta- 1,4- linked glucose containing polymer, releasing ceiiobiose from the reducing ends of the chain. Celiobiohydrolase Il is a 1,4-D-giucan ceilobiohydrolase {E.G. 3.2.1.91) activity which catalyzes the hydrolysis of 1,4-beta-D-glucosidic linkages in cellulose, celloteiriαse, or any beia-1,4-ltnked glucose containing polymer, releasing ceiiobiose from the non-reducing ends of the chain, CeSiobiose is a water-solubie beta-1,4-Sinked dimβr of gfucose. 8eta-g!ucosidases hydrolyze cβiSofaiose to glucose.
The conversion of ceSlulosic feedstocks into ethanol has the advantages of the ready availability of large amounts of feedstock, the desirability of avoiding burning or land filling the materials, and the cleanliness of the ethanol fuel Wood, agricultural residues, herbaceous crops, and municipal solid wastes have been considered as feedstocks for ethanol production. These materials primarily consist of cellulose, hβmiceiluSose, and Signin, Once the cellulose is converted to glucose, the glucose is easily fermented by yeast into ethanol. Roy ef a/., 1990, Journal of General Microbiology 136; 1967-1972, disclose the purification and properties of an extracellular endogiucanase from Myceliophthora thermophila ATCC 48104, Chβrnoglazcv et a/., 1988, Biokhimiya 53; 475-482, disclose the isolation, purification, and substrate specificity of an endogiucanase from Myceliophthora thermophila. Klyosov et a/., 1988, Biotechnology Letters 10: 351-354, disclose a thermostable endogiucanase from Myceliophthora thermophila, Guzhova and Loginova, 1987, Pήkladnaya Biokhimiya I Mikrobiologiya 23: 820-825, disclose cβlluSolytic enzymes from Myceliophthora thermophila, Rabinovich et a/., 1Θ86: Bioorganicheskaya Khimiya 12; 1549-1560, disclose the purification and characterization of an endogiucanase from Myceliophthora thermophila. Svisfova e* al,, 1986, Mikrobiologiya 55: 49-54, disclose the regulation of cellulose biosynthesis in Myceliophthora thermophila. Bhat and Iviaheshwari, 1987, Applied and Environmental Microbiology 53; 2175-2182, disclose the activity of components of the extracellular cellulose system of Myceϋophthora thermophila. Klyosov ef a/., 1987, Prikladnaya Biokhimiya I Mikrobiologiya 23: 44-50, disclose a thermostable endogiucanase from Myceliophthora thermophiia. Jorgensen ef a/,, 2003, Enzyme and Microbial Technology 32; 851-861 , and Thygesen et a/,, 2003, Enzyme and Microbial Technology 32; 606- 615, disclose cellulose-degrading enzymes from Penicillium bmsilianurn IBT 20888.
It would be an advantage in the art to identify new endogiucanases having improved properties, such as improved hydrolysis rate, better thermal stability, reduced adsorption to lignin, and ability to hydroSyze non-cellulosic components of biomass, such as hemicellulαse, in addition to hydrolyzing cellulose. Endogiucanases with a broad range of side activities on hemiceliυlose can be especially beneficial for improving the overall hydrolysis yield of complex, hemieβllulose-rich biomass substrates.
It is an object of the present invention to provide improved polypeptides having endogiucanase activity and polynucleotides encoding the polypeptides. Summary of the {invention
The present invention relates to isolated polypeptides having βndogSucanase activity selected from the group consisting of: {a} a polypeptide comprising an amino acid sequence which has at least
80% identity with the mature polypeptide of SEQ ID NO. 4 or SEQ ID NO: 10, at least 85% identity with the mature polypeptide of SEO. ID NO: 8, or at least 75% identity with the mature polypeptide of SEQ ! D NO; 8;
(b) a polypeptide which is encoded by a polynucleotide which hybridizes under at least high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or (iii) a fuli-length complementary strand of (i) or (ii);
(c) a polypeptide which is encoded by a polynucleotide having at least 80% identity with the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO; 9, at least 85% identity with the mature polypeptide coding sequence of SEQ ID NO: 5, or at least 75% identity with the mature polypeptide coding sequence of SEQ ID NO: 7; and
(d) a variant comprising a substitution, deletion, and/or insertion of one or more amino acids of the mature polypeptide of SEQ ID NO: 4, SEQ !D NO: 8, SEQ ID NO; 8, or SEQ ID NO: 10.
The present invention also relates to isolated polynucleotides encoding polypeptides having endoglucanase activity, selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide comprising an amino acid sequence which has at least 80% identity with the mature polypeptide of SEQ ID NO: 4 or SEQ SD NO: 10, at least 85% identity with the mature polypeptide of SEQ ID NO: 6, or at least 75% identity with the mature polypeptide of SEQ ID NO: 8; (b) a polynucleotide which hybridizes under at least high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO; 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, {ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ SD NO: 3 or SEQ SD NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or (iii) a complementary strand of (i) or (ii);
(c) a polynucleotide having at least 80% identity with the mature polypeptide coding sequence of SEO. ID NO: 3 or SEQ ID NO: 9, at least 85% identity with the mature polypeptide coding sequence of SEQ ID NO: 5, or at least 75% identity with the mature polypeptide coding sequence of SEQ ID NO: 7; and
(ύ) a polynucleotide encoding a variant comprising a substitution, deletion, and/or insertion of one or more amino acids of the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 8, or SEQ ID NO: 10,
In a preferred aspect, the mature polypeptide is amino acids 17 to 389 of SEQ ID
NO; 4. In another preferred aspect, the mature polypeptide is amino acids 16 to 397 of
SEQ ID NO: 6. In another preferred aspect, the mature polypeptide is amino acids 22 to 429 of SEQ ID NO: 8. In another preferred aspect, the mature polypeptide is amino acids 25 to 421 of SEQ ID NO: 10, in another preferred aspect, the mature polypeptide coding sequence is nucleotides 87 to 1185 of SEQ SD NO: 3. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID
NO: 5. In another preferred aspect, the mature polypeptide coding sequence is nucleotides 77 to 1300 of SEQ ID NO: 7. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 73 to 1468 of SEQ ID NO: 9.
The present invention also relates to nucleic acid constructs, recombinant expression vectors, recombinant host cells comprising the polynucleotides, and methods of producing a polypeptide having endogiucanase activity. The present invention also relates to methods of inhibiting the expression of a polypeptide in a ceil, comprising administering to the cell or expressing in the cell a double- stranded RNA {dsRNA} molecule, wherein the dsRNA comprises a subsequence of a polynucleotide of the present invention. The present also relates to such a double- stranded inhibitory RNA {dsRNA) molecule, wherein optionally the dsRNA is an siRNA or an mi RNA molecule.
The present invention also relates to methods of using the polypeptides having endogiucanase activity in the conversion of ceiiulose to glucose and various substances.
The present invention also relates to plants comprising an isolated polynucleotide encoding such a polypeptide having endogiucanase activity.
The present invention also relates to methods for producing such a polypeptide having endogiucanase activity, comprising: (a) cultivating a transgenic plant or a piant ceil comprising a polynucleotide encoding such a polypeptide having endogiucanase activity under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
The present invention further relates to nucleic acid constructs comprising a gene encoding a protein, wherein the gene is operably linked to a nucleotide sequence encoding a signal peptide comprising or consisting of amino acids 1 to 16 of SEQ ID NQ; 4, amino acids 1 to 15 of SEQ ID NO: 6, amino acids 1 to 21 of SEQ ID NO: 8, or amino acids 1 to 16 of SEQ ID NO: 10 and a second nucleotide sequence encoding a propeptide comprising or consisting of amino acids 17 to 24 of SEQ ID NO: 10, wherein the gene is foreign to the first and second nucleotide sequences
Brief Description of the Figures
Figure 1 shows a restriction map of pC!C1δl
Figure 2 shows the genomic DNA sequence and the deduced amino acid sequence of a Myceliophthora thermophita CBS 1 17.65 endoglυcanase (SEQ ID NOs: 3 and 4, respectively).
Figure 3 shows a restriction map of pA2C161. Figure 4 shows a restriction map of pC!C453.
Figure 5 shows a restriction map of pA2C453.
Figure 8 shows the cDNA sequence and the deduced amino acid sequence of a basidiomycete CBS 495.95 endoglucanase (SEQ ID NOs: 5 and 6, respectively).
Figure 7 shows a restriction map of pC!C486. Figure 8 shows a restriction map of pA2C486.
Figure 9 shows the cDNA sequence and the deduced amino acid sequence of a basidiomycete CBS 494.95 endoglucanase (SEQ ID NOs: 7 and 8, respectively).
Figures 1OA and 1OB show the genomic DNA sequence and the deduced amino acid sequence of a Peniάffium bmsilianum strain SBT 20888 endogiucanase (SEQ ID NOs: 9 and 10, respectiveSy).
Figure 11 shows a restriction map of pKBK03. Figure 12 shows a restriction map of pPBCelSC.
Figure 13 shows the specific activity of the Penicillium brasilianum !BT 20888 CEL5C endogiucanase at different pH values and 5O0C (n~2). Figure 14 shows the specific activity of the Penicillium brasilianum iBT 20888
CEL5C endogiucanase at different temperatures and pH 4.8 (n=2).
Figure 15 shows the residual activity of the Peniάliium brasilianum IBT 20888 CEL5C endoglucanase after 20 hours of incubation at different pH values and 25*C and 50δC (n=2), Figure 16 shows the reiative activity on PASC (2 mg/mi) as a function of temperature for basidiomycete CBS 494.95 and basidiomycete CBS 495.95 at pH 5.0. Figure 17 shows the relative conversion of PASC (2 mg/ml) as a function of temperature after 45 hours of hydrolysis with basidiomycete CBS 494.95 and basidiomycete CBS 495.95 (0.5 mg protein per g of PASC) ai pH 5.0.
Figure 18 shows a comparison of endoglucanases from Mycetiophthora thermophila CBS 117.65, basidiomycete CBS 494.95, basidiomycete CBS 495.95, and Tiichoderma reesei for production of reducing sugars from beta-giucan (1% w/v) after 2- hour hydrolysis reaction at pH 5.5 and 600C.
Figure 19 shows a comparison of endoglucanases from Myceliophthora thermophϋa CBS 117.65, basidiomycete CBS 494.95, basidiomycete CBS 495.95, and Trichoderma reesei for production of reducing sugars from beta-giucan (1% w/v} after 2- hour hydrolysis reaction at pH 5.5 and 600C.
Definitions
Endoglucanase activity: The term "endoglucanase activity" is defined herein as an endo-1,4-beta-D-glucan 4-giucaπohydro!ase (E.G. No, 3.2.1,4) which catalyses the endohydrolysis of 1,4-beta-D-giycosidic linkages in cellulose, ceSSuiose derivatives (such as carboxymethyl cellulose and hydroxyethyi cellulose), licheπin, beta-1,4 bonds in mixed beta-1 ,3 glucans such as cereaS beta-D-giucans or xyioglucans, and other plant material containing ceiiuSosic components. For purposes of the present invention, endogiucanase activity is determined using carboxymethy! ceiiuiαse (CMC) hydrolysis according to the procedure of Ghαse, 1987, Pure and AppL Chem, 59: 257-268. One unit of endoglucanase activity is defined as 1.0 μmole of reducing sugars produced per minute at 500C, pH 4.8.
In a preferred aspect, the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward one or more substrates seiected from the group consisting of xylan, xyloglucan, arabinoxylan, 1,4-beta-D- mannan, and gaiactomannan. The activity of the polypeptides having endogiucanase activity on these poSy saccharide substrates is determined as percent of the substrate hydrolyzβd to reducing sugars after incubating the substrate (5 mg per ml) with a polypeptide having endogiucanase activity of the present invention (5 mg protein per g of substrate) for 24 hours with intermittent stirring at pH 5.0 (50 mM sodium acetate) and 5C1C. Reducing sugars in hydrolysis mixtures are determined by the p-hydroxybenzoic acid hydrazide (PHBAH) assay,
In a more preferred aspect, the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward xylan. In another more preferred aspect the polypeptides of the present invention having endogiucanase activity further have enzyme activity toward xyioglucan. in another more preferred aspect, the polypeptides of the present invention having endogiucanase activity further have enzyme activity toward arabiooxylan. Sn another more preferred aspect, the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward 1 ,4-beta-D-mannan. In another more preferred aspect, the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward gaiactomannan. In another more preferred aspect, the polypeptides of the present invention having endoglucanase activity further have enzyme activity toward xyian, xylog!ucan; arabinoxylan, 1 ,4-beta-D-mannan, and/or gaiactomannan.
The polypeptides of the present invention have at ieast 20%, preferabSy at least 40%, more preferabiy at least 50%, more preferably at ieast 80%, more preferably at least 70%, more preferably at least 80%, even more preferabiy at least 90%, most preferably at least 95%, and even most preferably at ieast 100% of the endoglucanase activity of mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10.
Family 5 glycoside hydrolase or Family GH5: The term "Family 5 glycoside hydrolase" or "Famiiy GH5" is defined herein as a polypeptide falling into the glycoside hydrolase Family 5 according to Henrissat B., 1991 A classification of giycosyi hydrolases based on amino-acid sequence similarities, Biochem. J. 280: 309-316, and Henrissat 8., and Bairoch A., 1996, Updating the sequence- based classification of giycosyi hydrolases, Biochem, J. 318: 695-896.
Isolated polypeptide: The term "isolated polypeptide" as used herein refers to a polypeptide which is at least 20% pure, preferably at ieast 40% pure, more preferabiy at ieast 80% pure, even more preferably at least 80% pure, most preferabiy at least 90% pure, and even most preferably at least 95% pure, as determined by SDS-PAGE.
Substantially pure polypeptide; The term "substantially pure polypeptide" denotes herein a polypeptide preparation which contains at most 10%, preferably at most 8%, more preferably at most 8%, more preferably at most 5%, more preferabiy at most 4%, more preferably at most 3%, even more preferably at most 2%. most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which it is natively or recombinantly associated, it is, therefore, preferred that the substantially pure polypeptide is at least 92% pure, preferably at ieast 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferabiy at least 97% pure, more preferably at ieast 98% pure, even more preferably at least 99%, most preferabiy at least 99.5% pure, and even most preferably 100% pure by weight of the tota! polypeptide material present in the preparation.
The polypeptides of the present invention are preferably in a substantially pure form. In particular, it is preferred that the polypeptides are in "essentially pure form", Le., that the polypeptide preparation is essentially free of other polypeptide materia! with which it is natively or recombinant^ associated. This can be accomplished, for example, by preparing the poiypeptide by means of weil-known recombinant methods or by ciassica! purification methods.
Herein, the term "substantially pure polypeptide" is synonymous with the terms "isolated polypeptide" and '"polypeptide in isolated form."
Mature polypeptide: The term "mature polypeptide" is defined herein as a polypeptide having endogSucanase activity that is in its final form following translation and any post-translationa! modifications, such as N-terminal processing, C-terminal truncation, giycosyiation, etc. Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" is defined herein as a nucleotide sequence that encodes a mature polypeptide having endoglucanase activity.
Identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity". For purposes of the present invention, the degree of identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch: 1970: J. MoI Biol. 48. 443-453) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0 5, and the EBLOSUM62 matrix. The output of Needle labeled longest identity" is used as the percent identity and is calculated as follows:
(Identical Residues x 100)/(Length of Alignment - Number of Gaps in Alignment)
For purposes of the present invention, the degree of identity between two nucleotide sequences is determined using the Needleman-Wunsch algorithm {Needleman and Wunsch, 1970, J. MoI. Biol. 48: 443-453} as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5. and the EDNAFULL matrix. The output of Needle labeled "longest identity" is used as the percent identity and is calculated as follows:
(identical Residues x 100}/(Length of Alignment ~ Number of Gaps in Alignment)
Homologous sequence: The term "homologous sequence" is defined herein as a predicted protein which gives an E value {or expectancy score) of less than 0.001 in a fasta search (Pearson, W.R., 1999, in Bioinformatics Methods and Protocols, S. Misener and S. A, Krawβtz, βd, pp. 185-219) with the mature endogSucanase of SEQ ID NO: 4, SEQ SD NO; 8, SEQ ID NO: 8, or SEQ SD NO: 10.
Polypeptide fragment: The term "polypeptide fragment" is defined herein as a polypeptide having one or more amino acids deleted from the amino and/or carboxy! terminus of the mature polypeptide of SEQ SD NO: 4, SEQ ID NO: 6, SEQ SD NO: 8, or SEQ SD NO. 10; or a homologous sequence thereof, wherein the fragment has endoglucanase activity, in a preferred aspect, a fragment contains at ieast 295 amino acid residues, more preferably at least 315 amino acid residues, and most preferably at ieast 335 amino acid residues of the mature polypeptide of SEQ SD NQ: 4 or a homologous sequence thereof. In another preferred aspect, a fragment contains at ieast 320 amino acid residues, more preferabiy at least 340 amino acid residues, and most preferably at ieast 380 amino acid residues of the mature polypeptide of SEQ ID NO: 6 or a homologous sequence thereof, in another preferred aspect, a fragment contains at least 325 amino acid residues, more preferably at least 345 amino acid residues, and most preferabiy at ieast 385 amino acid residues of the mature polypeptide of SEQ iD NO: 8 or a homoSogous sequence thereof, in another preferred aspect, a fragment contains at ieast 335 amino acid residues, more preferabiy at least 355 amino acid residues, and most preferabiy at least 375 amino acid residues of the mature polypeptide of SEQ ! D NO: 10 or a homologous sequence thereof. Subsequence: The term "subsequence" is defined herein as a nucleotide sequence having one or more nucleotides deleted from the 5' and/or 3' end of the mature polypeptide coding sequence of SEQ ID NO; 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ iD NO: S: or a homologous sequence thereof; wherein the subsequence encodes a polypeptide fragment having endogiucanase activity, in a preferred aspect, a subsequence contains at ieast 885 nucleotides, more preferably at least 945 nucleotides, and most preferabiy at ieast 1005 nucleotides of the mature polypeptide coding sequence of SEQ. iD NO: 3 or a homologous sequence thereof. In another preferred aspect, a subsequence contains at ieast 960 nucleotides, more preferably at ieast 1020 nucleotides, and most preferabiy at ieast 1080 nucleotides of the mature polypeptide coding sequence of SEQ ID NO; 5 or a homoiogous sequence thereof. In another preferred aspect, a subsequence contains at least 975 nucleotides, more preferably at least 1035 nucleotides, and most preferabiy at least 1095 nucleotides of the mature polypeptide coding sequence of SEQ !D NO: 7 or a homoiogous sequence thereof. In another preferred aspect, a subsequence contains at least 1005 nucleotides, more preferabiy at least 1065 nucleotides, and most preferabiy at least 1125 nucleotides of the mature polypeptide coding sequence of SEQ ID NO: 9 or a homologous sequence thereof.
Allelic variant: The term "allelic variant" denotes herein any of two or more alternative forms of a gene occupying the same chromosoma! locus, Allelic variation arises naturally through mutation, and may result in polymorphism within populations, Gene mutations can be silent (no change in the encoded polypeptide} or may encode polypeptides having altered amino acid sequences. An aiielic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
Isolated polynucleotide: The term 'isolated polynucleotide" as used herein refers to a polynucleotide which is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, most preferably af least 90% pure, and even most preferably at least 95% pure, as determined by agarose electrophoresis.
Substantially pure polynucleotide: The term "substantially pure pclynucieofide" as used herein refers to a polynucleotide preparation free of other extraneous or unwanted nucleotides and in a form suitable for use within genetically engineered protein production systems. Thus, a substantially pure polynucleotide contains at most 10%, preferably at most 8%, more preferabiy at most 6%, more preferably at most 5%, more preferabiy at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferabiy at most 0.5% by weight of other polynucleotide material with which it is natively or recombinantSy associated. A substantially pure polynucleotide may, however, include naturaiiy occurring 5' and 3' untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferabiy at Seast 92% pure, more preferabiy at least 84% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99% : and even most preferably at least 99,5% pure by weight. The polynucleotides of the present invention are preferably in a substantially pure form, In particular, it is preferred that the polynucleotides disciosed herein are in "essentially pure form", Le., that the polynucleotide preparation is essentially free of other polynucleotide material with which it is natively or recombinantiy associated. Herein, the term '"substantially pure polynucleotide" is synonymous with the terms "isolated polynucleotide" and "poiynucleotidβ in isolated form." The polynucleotides may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof, Coding sequence: When used herein the term "coding sequence" means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generaSiy determined by an open reading frame, which usuaϋy begins with the ATG start codon or alternative start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG, and TGA. The coding sequence may be a DNA, cDWA, or recombinant nucleotide sequence. Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" is defined herein as a nucleotide sequence that encodes a mature polypeptide having endogiucanase activity. cDISiA: The term "cDNA" is defined herein as a DNA molecule which can be prepared by reverse transcription from a mature, spiiced. mRNA moiecuie obtained from a eukaryotic cell. cDNA Sacks intron sequences that are usually present in the corresponding genomic DNA. The initiai, primary RNA transcript is a precursor to mRNA which is processed through a series of steps before appearing as mature spiiced mRNA. These steps incSude the removal of intron sequences by a process called splicing. cDNA derived from mRNA Sacks, therefore, any intron sequences. Nucleic acid construct; The term "nucleic acid construct" as used herein refers to a nucSeic acid molecule, either singie- or doubiβ-strandβd. which is isoiated from a naturaily occurring gene or which is modified to contain segments of nucleic acids in a manner that wouSd not otherwise exist in nature. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.
Control sequence; The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of a polynucleotide encoding a polypeptide of the present invention. Each contra! sequence may be native or foreign to the nucleotide sequence encoding the polypeptide or native or foreign to each other. Such contro! sequences include, but are not limited to, a leader, polyadenyiation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the contro! sequences include a promoter, and transcriptional and transiational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ϋgation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.
Operably linked: The term "operably linked" denotes herein a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the poiy nucleotide sequence such that the contro! sequence directs the expression of the coding sequence of a polypeptide, Expression; The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-traπscriptional modification, translation, post-translatioπal modification, and secretion.
Expression vector: The term "expression vector" is defined herein as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide of the present invention, and which is operabiy linked to additional nucleotides that provide for its expression.
Host ceil; The term "host cell", as used herein, includes any cell type which is susceptibie to transformation, transfection, transduction, and the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
Modification: The term "modification" means herein any chemical modification of the polypeptide consisting of the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6r SEQ ID NQ; 8, or SEQ ID NO; 10; or a homologous sequence thereof; as well as genetic manipulation of the DNA encoding such a polypeptide. The modification can be substitutions, deletions and/or insertions of one or more amino acids as we!! as replacements of one or more amino acid side chains.
Artificial variant: When used herein, the term ''artificial variant" means a polypeptide having endoglucanase activity produced by an organism expressing a modified nucleotide sequence of the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NQ: 9; or a homologous sequence thereof. The modified nucleotide sequence is obtained through human intervention by modification of the nucleotide sequence disclosed in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO' 7, or SEQ ID NO: 9; or a homologous sequence thereof
Detailed Description of the invention
Polypeptides Having Endoglucanase Activity
In a first aspect, the present invention relates to isolated polypeptides comprising an amino acid sequence which has a degree of identity to the mature poiypeptide of
SEQ SD NO: 4, SEQ ID NO: 6: SEQ ID NO: 8, or SEQ SD NO: 10, of at least 60%: preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 96%, 97%, 98%, or 99%, which have endoglucanase activity (hereinafter "homologous polypeptides"). In a preferred aspect the homologous polypeptides have an amino acid sequence which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even most preferably by one amino acid fraro the mature poiypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10, A polypeptide of the present invention preferably comprises the amino acid sequence of SEQ ID NO: 4 or an aiieiic variant thereof; or a fragment thereof that has endoglucanase activity. In a preferred aspect, a poiypeptide comprises the amino acid sequence of SEQ ID NO: 4. Sn another preferred aspect, a polypeptide comprises the mature polypeptide of SEQ ID NO: 4. In another preferred aspect, a poiypeptide comprises amino acids 17 to 389 of SEQ ID NO: 4, or an aileiic variant thereof; or a fragment thereof that has endogiucanase activity, in another preferred aspect, a polypeptide comprises amino acids 17 to 389 of SEQ ID NO; 4. in another preferred aspect, a polypeptide consists of the amino acid sequence of SEQ ID NO: 4 or an allelic variant thereof; or a fragment thereof that has endoglucanase activity, in another preferred aspect, a poiypeptide consists of the amino acid sequence of SEQ ID NO: 4. In another preferred aspect, a poiypeptide consists of the mature poiypeptide of SEQ ID NO: 4. In another preferred aspect, a poiypeptide consists of amino acids 17 to 389 of SEQ ID NO: 4 or an allelic variant thereof; or a fragment thereof that has endogiucanase activity. In another preferred aspect a polypeptide consists of amino acids 17 to 389 of SEQ ID NO; 4.
A polypeptide of the present invention preferably aiso comprises the amino acid sequence of SEQ ID NO: 6 or an aSSeiic variant thereof; or a fragment thereof that has endoglucanase activity. In a preferred aspect, a poiypeptide comprises the amino acid sequence of SEQ ID NO: 6. in another preferred aspect, a polypeptide comprises the mature polypeptide of SEQ ID NO: 6, In another preferred aspect, a poiypeptide comprises amino acids 18 to 397 of SEQ SD NO: 8, or an aileiic variant thereof; or a fragment thereof that has endogiucanase activity, in another preferred aspect, a polypeptide comprises amino acids 18 to 397 of SEQ ID NO: 6. In another preferred aspect, a polypeptide consists of the amino add sequence of SEQ SD NO. 6 or an allelic variant thereof; or a fragment thereof that has endoglucanase activity, in another preferred aspect, a poiypeptide consists of the amino acid sequence of SEQ ID NO: 6. In another preferred aspect a poiypeptide consists of the mature polypeptide of SEQ ID NO: 6. In another preferred aspect, a poiypeptide consists of amino acids 18 to 397 of SEQ ID NO; 8 or an allelic variant thereof; or a fragment thereof that has endogiucanase activity. In another preferred aspect a polypeptide consists of amino acids 16 to 397 of SEQ SD NO: 6. A polypeptide of the present invention preferably also comprises the amino acid sequence of SEQ ID NO: 8 or an aiieSic variant thereof; or a fragment thereof that has endoglucanase activity. In a preferred aspect, a polypeptide comprises the amino acid sequence of SEQ ID NO: 8. Sn another preferred aspect, a polypeptide comprises the mature polypeptide of SEQ ID NO: 8, In another preferred aspect, a poiypeptide comprises amino acids 22 to 429 of SEQ SD NO: 8, or an aSleiic variant thereof; or a fragment thereof that has endogiucanase activity, Sn another preferred aspect, a polypeptide comprises amino acids 22 to 429 of SEQ ID NQ: 8. In another preferred aspect, a polypeptide consists of the amino add sequence of SEQ SD NO: 8 or an allelic variant thereof; or a fragment thereof that has endoglucanase activity. Sn another preferred aspect, a poiypeptide consists of the amino acid sequence of SEQ ID NO: 8. In another preferred aspect a poiypeptide consists of the mature polypeptide of SEQ. ID NO: 8. In another preferred aspect, a poiypeptide consists of amino acids 22 to 429 of SEQ ID NO: 8 or an allelic variant thereof; or a fragment thereof that has endogiucanase activity. In another preferred aspect a polypeptide consists of amino acids 22 to 429 of SEQ ID NO: 8.
A polypeptide of the present invention preferably aiso comprises the amino acid sequence of SEQ SD NQ: 10 or an allelic variant thereof; or a fragment thereof that has endoglucanase activity. In a preferred aspect, a poiypeptide comprises the amino acid sequence of SEQ SD NO: 10. In another preferred aspect, a polypeptide comprises the mature polypeptide of SEQ ID NQ: 10. In another preferred aspect, a poiypeptide comprises amino acids 25 to 421 of SEQ SD NO: 10, or an aSleiic variant thereof; or a fragment thereof that has endogSucanase activity, in another preferred aspect, a polypeptide comprises amino acids 25 to 421 of SEQ ID NO: 10. Sn another preferred aspect, a polypeptide consists of the amino acid sequence of SEQ ID NO; 10 or an allelic variant thereof; or a fragment thereof that has endogSucanase activity, In another preferred aspect, a polypeptide consists of the amino acid sequence of SEQ ID NG: 10,
Sn another preferred aspect, a poiypeptide consists of the mature polypeptide of SEQ ID
NO: 10, in another preferred aspect, a poiypeptide consists of amino acids 25 to 421 of SEQ ID NO: 10 or an aiSeiic variant thereof; or a fragment thereof that has endoglucanase activity. In another preferred aspect, a poiypeptide consists of amino acids 25 to 421 of SEQ ID NO; 10.
In a second aspect, the present invention relates to isolated poiypeptides having endoglucanase activity which are encoded by poSynudeotides which hybridize under very low stringency conditions, preferabiy Saw stringency conditions, more preferabiy medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NQ; 5, SEQ ID NO: 7, or SEQ SD NO; 9, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ iD NO: 3 or SEQ iD NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, (iii) a subsequence of (i) or (ii}: or (iv) a complementary strand of (i), (ii), or (iii) (J, Sambrook, E, F, Fritsch, and T, Maniatis, 1989, Molecular Cloning, A Laboratory- Manual, 2d edition, Coid Spring Harbor, New York). A subsequence of the mature polypeptide coding sequence of SEQ ID NO: 3; SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9 contains at least 100 contiguous nucleotides or preferably at least 200 contiguous nucleotides. Moreover, the subsequence may encode a poiypeptide fragment which has endoglucanase activity, in a preferred aspect, the mature polypeptide coding sequence is nucleotides 67 to 1185 of SEQ ID NO: 3. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO: 5. in another preferred aspect, the mature poiypeptide coding sequence is nucleotides 77 to 1300 of SEQ iD NO: 7. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 73 to 1488 of SEQ ID NO: 9. In another preferred aspect, the complementary strand is the fuii-iength complementary strand of the mature polypeptide coding sequence of SEQ SD NO: 3, SEQ SD NO: 5, SEQ SD NO: 7, or SEQ ID NO; 9.
The nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ. SD NO: 7, or SEQ ID NO: 9; or a subsequence thereof; as well as the amino acid sequence of SEQ ID NQ: 4, SEQ ID NQ: 6; SEQ ID NQ: 8, or SEQ ID NO: 10; or a fragment thereof; may be used to design a nucleic acid probe to identify and clone DNA encoding polypeptides having endoglucanase activity from strains of different genera or species according to methods weil known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, foiiowing standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but shouid be at least 14: preferably at least 25: more preferably at least 35, and most preferably at Seast 70 nucleotides in length. It is, however, preferred that the nucleic acid probe is at Seast 100 nucleotides in length. For example, the nucleic acid probe may be at least 200 nucleotides, preferably at Seast 300 nucleotides, more preferably at least 400 nucleotides, or most preferably at least 500 nucleotides in length. Even longer probes may be used, e.g., nucieic acid probes which are at least 600 nucleotides, at least preferably at least 700 nucleotides, more prefβrabiy at least 800 nucleotides, or most preferably at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with 32p jj_j 35g I3J0IJ05 or avϊdin). Such probes are encompassed by the present invention.
A genomic DNA or cDNA library prepared from such other organisms may, therefore, be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide having endoglucanase activity. Genomic or other DNA from such other organisms may be separated by agarose or poiyacryiamide gel electrophoresis, or other separation techniques, DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material, In order to identify a clone or DNA which is homologous with SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9; or a subsequence thereof; the carrier material is preferably used in a Southern blot.
For purposes of the present invention, hybridization indicates that the nucleotide sequence hybridizes to a labeled nucleic acid probe corresponding to the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9; the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7; its complementary strand; or a subsequence thereof; under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film.
In a preferred aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 3. In another preferred aspect, the nucleic acid probe is nucleotides 67 to 1185 of SEQ ID NO: 3. In another preferred aspect, the nucleic acid probe is a polynucleotide sequence which encodes the polypeptide of SEQ ID NO: 4, or a subsequence thereof. In another preferred aspect, the nucleic acid probe is SEQ ID NO; 3. In another preferred aspect, the nucleic acid probe is the polynucleotide sequence contained in plasmid pC!C161 which is contained in E, coli NRRL B-30902, wherein the polynucleotide sequence thereof encodes a polypeptide having endoglucanase activity. In another preferred aspect, the nucleic acid probe is the mature polypeptide coding region contained in plasmid pC!C161 which is contained in £ cofi NRRL 8-30902,
In another preferred aspect, the nucleic add probe is the mature polypeptide coding sequence of SEQ ID NO: 5. In another preferred aspect, the nucleic acid probe is nucleotides 84 to 1229 of SEQ ID NO: 5. in another preferred aspect, the nucleic acid probe is a polynucleotide sequence which encodes the polypeptide of SEQ ID NO: 6, or a subsequence thereof. In another preferred aspect, the nucieic acid probe is SEQ ID NO; 5. Sn another preferred aspect, the nucleic acid probe is the polynucleotide sequence contained in plasmid pC!C453 which is contained in E. call NRRL B-30903, wherein the polynucieotide sequence thereof encodes a polypeptide having endoglucanase activity. In another preferred aspect, the nucleic acid probe is the mature polypeptide coding region contained in plasmid ρCIC453 which is contained in E. cod NRRL 8-30903,
In another preferred aspect the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 7. in another preferred aspect, the nucleic acid probe is nucleotides 77 to 1300 of SEQ ID NO; 7. in another preferred aspect, the nucieic acid probe is a polynucleotide sequence which encodes the polypeptide of SEQ SD NO: 8, or a subsequence thereof. In another preferred aspect, the nucleic acid probe is SEQ ID NO; 7. In another preferred aspect, the nucleic acid probe is the polynucleotide sequence contained in plasmid pCIC48β which is contained in E. colt NRRL B-30904, wherein the polynucleotide sequence thereof encodes a polypeptide having endoglucanase activity. In another preferred aspect, the nucieic acid probe is the mature polypeptide coding region contained in plasmid pCiC488 which is contained in £ coif NRRL 8-30904.
In another preferred aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 9. In another preferred aspect, the nucleic acid probe is nucleotides 73 to 1468 of SEQ ID NO: 9, in another preferred aspect, the nucieic acid probe is a polynucleotide sequence which encodes the polypeptide of SEQ ID NO: 10, or a subsequence thereof. In another preferred aspect, the nucleic acid probe is SEQ ID NO: 9. In another preferred aspect, the nucleic acid probe is the polynucleotide sequence contained in plasmid pPBCeiSC which is contained in E. colt NRRL B- 30900N, wherein the polynucleotide sequence thereof encodes a polypeptide having endoglucanase activity. In another preferred aspect, the nucleic acid probe is the mature polypeptide coding region contained in piasmid pPBCelδC which is contained in E. colt NRRL B-30900N. For long probes of at least 100 nucleotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 4215C in 5X SSPE, 0.3% SDS1 200 μg/mi sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formamide for medium and medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures for 12 to 24 hours optimally.
For long probes of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS preferably at least at 45X (very Sow stringency), more preferably at least at 5OX (Sow stringency), more preferably at least at 55"C (medium stringency), more preferably at least at 60"C (medium-high stringency), even more preferably at least at 65X (high stringency), and most preferably at least at 7OX (very high stringency).
For short probes which are about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as prehybricfeation, hybridization, and washing post-hybridization at about 5°C to about 1OX bβiow the calculated Tm using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCI, 0.09 M Tris-HCi pH 7.6, 6 mM EDTA, 0.5% NP-40, 1X Denhardt's solution, 1 mSvl sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures for 12 to 24 hours optimally.
For short probes which are about 15 nucleotides to about 70 nucleotides in length, the carrier material is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5X to 10X below the calculated T,n.
In a third aspect, the present invention relates to isolated polypeptides encoded by polynucleotides comprising or consisting of nucleotide sequences which have a degree of identity to the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ SD NO: 9 of at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferabiy at least 80%, more preferabiy at least 85%, more preferably at Seast 90%, even more preferably at least 95%, and most preferabiy at ieast 97% identity, which encode an active polypeptide. Sn a preferred aspect, the mature poSypeptide coding sequence is nucleotides 67 to 1185 of SEQ SD NO: 3. Sn another preferred aspect, the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO: 5. In another preferred aspect the mature polypeptide coding sequence is nucleotides 77 to 1300 of SEQ ID NO: 7. In another preferred aspect the mature polypeptide coding sequence is nucleotides 73 to 1468 of SEQ ID NO: 9. See polynucleotide section herein. In a fourth aspect, the present invention relates to artificial variants comprising a substitution, deletion, and/or insertion of one or more amino acids of the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO; 10; or a homologous sequence thereof. Preferably, amino acid changes are of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein: small deletions, typically of one to about 30 amino acids; small amino- or carboxyS-terminaS extensions, such as an amino-termina! methionine residue; a small linker peptide of up to about 20-25 residues; or a smal! extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.
Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids {phenylalanine, tryptophan and tyrosine), and smali amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions which do not generaily alter specific activity are known in the art and are described, for example, by H. Neurath and R. L Hill, 1979, in, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/llβ, Asp/Glu, Thr/Sβr, Ala/Gly, ASa/Thr, Sβr/Asn, Aia/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lie, Leu/Val, Ala/Glu, and Asp/Gly.
In addition to the 20 standard amino acids, non-standard amino acids (such as 4-hydroxyproline, 6-Λ/-methy! lysine, 2-aminoisobutyric acid, isovaline, and alpha-methyl serine) may be substituted for amino acid residues of a wiid-type polypeptide. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids may be substituted for amino acid residues. "Unnatural amino acids" have been modified after protein synthesis, and/or have a chemical structure in their side chain(s) different from that of the standard amino acids. Unnatural amino acids can be chemicaily synthesized, and preferably, are commercially available, and include pipecolic acid, thiazolidine carboxylic acid, dehydroproiine, 3- and 4-methylρroSine, and 3,3-dimethylproSine.
Alternatively, the amino acid changes are of such a nature that the physico- chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, aiter the substrate specificity, change the pH optimum, and the like.
Essential amino acids in the parent polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). in the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (;.e,, endogiucanase activity) to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et a/., 1996, J, Biol, Chem. 271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoafftnity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, dβ Vos et a/., 1992, Science 255: 306-312; Smith et a/., 1992, J. MoL BioL 224: 899-904: WSodaver et a/., 1992, FEBS Lett 309: 59-64. The identities of essential amino acids can also be inferred from analysis of identities with polypeptides which ar& reiated to a poiy peptide according to the invention.
Single or multiple amino acid substitutions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Oison and Sauer, 1988, Science 241 ■. 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad, Sd. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochem. 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et a/., 1986. Gene 46: 145; Ner ef a/.r 1988, DNA 7: 127). Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cioned, mutagenized polypeptides expressed by host cells (Ness et a/., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host ceils and rapidly seqυenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest and can be applied to polypeptides of unknown structure.
The total number of amino acid substitutions, deletions and/or insertions of the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10, such as amino acids 17 to 389 of SEQ ID NO: 2, amino acids 16 to 397 of SEQ ID NO: 6, amino acids 22 to 429 of SEQ ID NO: 8, or amino acids 25 to 421 of SEQ ID NO: 10, is 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 8, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
Sources of Polypeptides Having Endoglucanase Activity
A polypeptide of the present invention may be obtained from microorganisms of any genus. For purposes of the present invention, the term '"obtained from" as used herein in connection with a given source shall mean that the polypeptide encoded by a nucleotide sequence is produced by the source or by a strain in which the nucleotide sequence from the source has been inserted. In a preferred aspect, the polypeptide obtained from a given source is secreted extracellulariy. A polypeptide having endogSucanase activity of the present invention may be a bacterial polypeptide. For example, the polypeptide may be a gram positive bacteria! polypeptide such as a Bacillus, Streptococcus, Streptomyces, Staphylococcus, Enterococcus, Lactobacillus,. Lactococcus, Clostridium, Geobacillus, or Oceanobacillus polypeptide having [enzyme] activity, or a Gram negative bacterial polypeptide such as an E. co//, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium Fusobacterium, llyobacter, Neisseria, or Ureaplasma polypeptide having endogiucanase activity.
In a preferred aspect, the polypeptide is a Bacillus alkalαphilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans. Bacillus ciausii, Bacillus coagulans, Bacillus ϋrmus, Bacillus lautus. Bacillus lentus, Bacillus licheniformis, Bacillus megatenum. Bacillus pumilus, Bacillus stearothermophiius, Bacillus subtilis, or Bacillus thuringietisis polypeptide having endogiucanase activity.
In another preferred aspect, the polypeptide is a Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uteris, or Streptococcus equi subsp. Zooepidemicus polypeptide having endogiυcanase activity.
In another preferred aspect, the polypeptide is a Streptomyces achromogenes, Streptomyces avβrmitiiis, Streptomyces coelicolor, Strepiomyces gήseus. or Streptomyces lividans polypeptide having endogiucanase activity. A polypeptide having endogiucanase activity of the present invention may also be a fungai polypeptide, and more preferably a yeast polypeptide such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yatrowia polypeptide having endogiucanase activity; or more preferably a filamentous fungal polypeptide such as an Acremonium, Aspergillus, Aureobastdium, Chrysosporium, Cryptococcus, Fiiibasidiυm. Fusaiium, Humicola, Magnaporthe, Mucor, Myceliophthora. Neocailimastix, Neurospora, Paeάlomyces, Peniciliiυm, Pimmyces, Schizophyllum, Talaromycβs, Thetrnoascus, Thielavia, Tolypocladϊurn, or Tπchoderma polypeptide having endogiucanase activity.
In a preferred aspect, the polypeptide is a Sacchaωmyces carfsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyven, Saccharomyces norbensis, or Saccharomyces ovlformis polypeptide having endogiucanase activity.
In another preferred aspect, the polypeptide is an Aspergillus acuteatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium keratinophilum, Chrysosporium lucknowθnsθ, Chrysosporium tmpicutn, Chiγsosporium merdanum, Chrysosporium mops, Chrysosponutn pannicola, Chrysosponutn queenslandicum, Chrysosporium zonatum, Fusarium bactndioides, Fusarium cereaiis, Fusarium crookwellense, Fusarium culmorum, Fusarium grammearυm, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reftculatum, Fusarium roseutn, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichiσides, Fusarium sulphureum, Fusarium torulosum, Fusarium tήchothecιoides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceiiophthora thermophila, Neumspora crassa, Thieiavia achromatica, Thieiavia albomyces, Thieiavia albopilosa, Thieiavia australeinsis,. Thieiavia fimeti,. Thieiavia microsporia, Thieiavia ovispora, Thieiavia peruviana, Thieiavia spededonium, Thieiavia setosa, Thieiavia subthermophifa, Thieiavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Ttichodθrma rθθSθi, or Trichoderma viήde polypeptide having endoglueanasβ activity.
In another preferred aspect, the polypeptide is a Peniciilium brasitianum, Peniciilium camembertii, Peniciilium capsυtatum, Penlciltlum chrysogenum, Peniciilium citmonigrum, Peniciiiium citrinum, Penicilliumclaviforme, Peniciilium coryiophiium,. Peniciliiυm crustosum, Peniciiiium digitatum, Peniciilium βxpansum, Peniciilium funiculosum, Peniciilium glabrum, Peniciilium gmnulatum, Peniciiiium griseofulvum, Peniciiiium islandicum, Peniciiiium italicum, Peniciilium janthmelfum, Peniciilium fividum, Peniciiiium megasporum, Peniciiiium mβlinii, Peniciilium notatum, Peniciilium oxalicum, Peniciilium pubβrulum, Peniciilium purpumscens, Peniciilium puφurogenum, Peniciilium roquefσrtii, Peniciilium rugulosum, Peniciilium spinulαsum, Peniciilium waksmaniit or Peniciilium sp. polypeptide having eπcloglucanase activity.
In a more preferred aspect, the polypeptide is a Myceiiophthora thermophila polypeptide, and most preferably a Myceiiophthora thermophila CBS 111.65 polypeptide, e.g., the polypeptide of SEQ ID NO: 4, or the mature poiypeptide thereof.
In another more preferred aspect, the poiypeptide is a basidiomycete CBS 495.95 poiypeptide, e.g., the polypeptide of SEQ ID NO: 6, or the mature polypeptide thereof. In another more preferred aspect, the polypeptide is a basidiomycete CBS
494.95 polypeptide, e.g., the polypeptide of SEQ ID NO: 8, or the mature polypeptide thereof.
In another more preferred aspect, the poiypeptide is a Peniciilium bmsilianum polypeptide, and most preferably a Peniciilium brasilianurn IBT 20888 polypeptide, e.g., the polypeptide of SEQ ID NO: 10, or the mature poiypeptide thereof.
It will be understood that for the aforementioned species the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamorphs, regardfess of the species name by which they are known. Those skilled in the art will reacSiiy recognize the identity of appropriate equivalents.
Strains of these species are readiiy accessibie to the pubiic in a number of culture collections, such as the American Type CuSture Collection (ATCC), Deutsche
Sammiung von Mikroorganismen und Zelikulturen GmbH (DSM), Centraa! bureau Voor
Schimmelcuitures (CBS), and AgricuStura! Research Service Patent Culture Collection,
Northern Regionai Research Center (NRRL).
Furthermore, such poiy peptides may be identified and obtained from other sources including microorganisms isoiated from nature (e.g., soil, composts, wafer, etc.) using the above-mentioned probes. Techniques for isolating microorganisms from naturai habitats are weli known in the art. The polynucleotide may then be obtained by similarly screening a genomic or cDNA library of such a microorganism. Once a polynucleotide sequence encoding a polypeptide has been detected with the probe(s), the polynucleotide can be isolated or cloned by utilizing techniques which are well known to those of ordinary skill in the art (see, e.g., Sambrook et a!., 1989, supra).
Polypeptides of the present invention also include fused polypeptides or dβavabSe fusion polypeptides in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleotide sequence (or a portion thereof) encoding another polypeptide to a nucleotide sequence (or a portion thereof) of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fused polypeptide is under control of the same promoter(s) and terminator. A fusion polypeptide can further comprise a cleavage site. Upon secretion of the fusion protein, the site is cleaved releasing the polypeptide having endogiucanase activity from the fusion protein.
Examples of cieavage sites include, but are not limited to, a Kex2 site which encodes the dipeptide Lys-Arg (Martin et a/., 2003, J. /net Microbiol. Biotechnof. 3: 568- 76; Svetina et at, 2000, J. Biotechnol. 76: 245-251; Rasmussen- Wilson et ai., 1997, Appl. Environ. Microbiol. 63; 3488-3493; Ward ei a/,, 1995, Biotechnology 13; 498-503; and Contreras et a!., 1991, Biotechnology 9: 378-381), an Ue-(GIu or Asp)-Gly-Arg site, which is cleaved by a Factor Xa protease after the arginine residue (Eaton et a!., 1986, Biocbem. 25; 505-512); a Asp-Asp-Asp-Asp-Lys site, which is cleaved by an enterokinase after the lysine (Collins-Racie et ai, 1995, Biotechnology 13: 982-987); a His-Tyr-Giu site or His-Tyr-Asp site, which is cleaved by Genenase I (Carter et al., 1989, Proteins: Structure, Function, and Genetics 8: 240-248); a Leu-Val-Pro-Arg-Gly-Ser site, which is cleaved by thrombin after the Arg (Stevens. 2003. Drug Discovery World 4; 35- 48); a Glυ-Asn-Leυ-Tyr-Phe-Gln-Gly site, which is cleaved by TEV protease after the Gin (Stevens, 2003, supra); and a Leu-Glu-Val-Leu~Phe-GSn~Gly-Pro site, which is cleaved by a genetically engineered form of human rhinovirus 3C protease after the GSn (Stevens, 2003, supra).
Polynucleotides
The present invention aiso reiates to an isolated polynucleotide comprising or consisting of a nucleotide sequence which encodes a polypeptide of the present invention having endoglucanase activity.
In a preferred aspect, the nucleotide sequence comprises or consists of SEQ ID NO: 3. In another more preferred aspect, the nucleotide sequence comprises or consists of the sequence contained in plasmid ρCIC161 which is contained in E. colt NRRL B-30902. in another preferred aspect, the nucleotide sequence comprises or consists of the mature polypeptide coding region of SEQ ID NO: 3. In another preferred aspect, the nucleotide sequence comprises or consists of nucleotides 67 to 1185 of SEQ ID NO: 3. In another more preferred aspect, the nucleotide sequence comprises or consists of the mature polypeptide coding region contained in plasmid pCIC161 which is contained in E. coii NRRL B-30902. The present invention aiso encompasses nucleotide sequences which encode polypeptides comprising or consisting of the amino acid sequence of SEQ ID NO: 4 or the mature polypeptide thereof, which differ from SEQ ID NO: 3 or the mature polypeptide coding sequence thereof by virtue of the degeneracy of the genetic code. The present invention also relates to subsequences of SEQ ID NO: 3 which encode fragments of SEQ ID NO: 4 that have endoglucanase activity.
In another preferred aspect, the nucleotide sequence comprises or consists of SEQ ID NO: 5, In another more preferred aspect, the nucleotide sequence comprises or consists of the sequence contained in plasmid pCIC453 which is contained in E. coii NRRL B-30903. in another preferred aspect the nucleotide sequence comprises or consists of the mature polypeptide coding region of SEQ ID NO: 5, in another preferred aspect, the nucleotide sequence comprises or consists of nucleotides 84 to 1229 of SEQ ID NO: 5. In another more preferred aspect, the nucleotide sequence comprises or consists of the mature polypeptide coding region contained in plasmid pCIC453 which is contained in E. coii NRRL 8-30903. The present invention also encompasses nucleotide sequences which encode polypeptides comprising or consisting of the amino acid sequence of SEQ SD NO: 6 or the mature polypeptide thereof, which differ from SEQ ID NO: 5 or the mature poSypβptide coding sequence thereof by virtue of the degeneracy of the genetic code. The present invention also reiates Io subsequences of SEQ ID NO: 5 which encode fragments of SEQ ID NO: 6 that have endoglucanase activity.
In another preferred aspect, the nucleotide sequence comprises or consists of SEQ ID NO: 7, In another more preferred aspect, the nucleotide sequence comprises or consists of the sequence contained in plasrnid pCIC486 which is contained in E, coli NRRL B-30904. in another preferred aspect the nucleotide sequence comprises or consists of the mature polypeptide coding region of SEQ ID NO. 7, in another preferred aspect, the nucleotide sequence comprises or consists of nucleotides 77 to 1300 of SEQ ID NO: 7. In another more preferred aspect, the nucleotide sequence comprises or consists of the mature polypeptide coding region contained in plasmid pCIC486 which is contained in E. coli NRRL 8-30904, The present invention also encompasses nucleotide sequences which encode polypeptides comprising or consisting of the amino acid sequence of SEQ ID NO: 8 or the mature polypeptide thereof, which differ from SEQ ID NO: 7 or the mature polypeptide coding sequence thereof by virtue of the degeneracy of the genetic code. The present invention also reiates to subsequences of SEQ ID NO: 7 which encode fragments of SEQ ID NO: 8 that have endoglucanase activity.
In another preferred aspect, the nucleotide sequence comprises or consists of SEQ ID NO: 9. In another more preferred aspect, the nucleotide sequence comprises or consists of the sequence contained in piasmid pPBCelSC which is contained in E. coli NRRL B-309GGN. in another preferred aspect, the nucleotide sequence comprises or consists of the mature polypeptide coding region of SEQ ID NO: 9. in another preferred aspect, the nucleotide sequence comprises or consists of nucleotides 73 to 1488 of SEQ ID NO; 9. In another more preferred aspect, the nucleotide sequence comprises or consists of the mature polypeptide coding region contained in piasmid pP8Ce!5C which is contained in £ coil NRRL B-30900N. The present invention also encompasses nucleotide sequences which encode polypeptides comprising or consisting of the amino acid sequence of SEQ ID NO: 10 or the mature polypeptide thereof, which differ from SEQ ID NO: 9 or the mature polypeptide coding sequence thereof by virtue of the degeneracy of the genetic code. The present invention also relates to subsequences of SEQ ID NO: 9 which encode fragments of SEQ ID NO: 10 that have endoglucanase activity.
The present invention aiso relates to mutant polynucleotides comprising or consisting of at least one mutation in the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, in which the mutant nucleotide sequence encodes the mature polypeptide of SEQ ID NO: 4, SEQ SD NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10. in a preferred aspect, the mature polypeptide is amino acids 17 to 389 of SEQ ID NQ; 4. In another preferred aspect, the mature polypeptide is amino acids 16 to 397 of SEQ ID NO: 6. In another preferred aspect, the mature polypeptide is amino acids 22 to 429 of SEQ SD NQ: 8, in another preferred aspect, the mature polypeptide is amino acids 25 to 421 of SEQ iD NO: 10.
The techniques used to isoiate or clone a polynucleotide encoding a polypeptide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the polynucleotides of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cioned DNA fragments with shared structural features. See, e.g , lnnis βt ai., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid ampiification procedures such as ligase chain reaction (LCR), iigated activated transcription (LAT) and nucleotide sequence-based amplification (NASBA) may be used. The polynucleotides may be cloned from a strain of MyceHophthom thβrmophila CBS 117.65, basidiomycete CBS 494.95, or basidiomycete CBS 495.95, or another or related organism and thus, for example, may be an allelic or species variant of the polypeptide encoding region of the nucleotide sequence.
The present invention aiso relates to isolated polynucleotides comprising or consisting of nucleotide sequences which have a degree of identity to the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7r or SEQ ID NO; 9 of at least 80%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at ieast 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at ieast 95%, and most preferably at least 97% identity, which encode &n active polypeptide, In a preferred aspect, the mature polypeptide coding sequence is nucleotides 67 to 1185 of SEQ ID NO: 3. In another preferred aspect, the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO: 5. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 77 to 1300 of SEQ ID NO: 7. In another preferred aspect, the mature polypeptide coding sequence is nucleotides 73 to 1488 of SEQ SD NO: 9.
Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially simiSar to the polypeptide. The term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g., artificial variants that differ in specific activity, thermostability, pH optimum, or the like. The variant sequence may be constructed on the basis of the nucleotide sequence presented as the polypeptide encoding region of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, e.g., a subsequence thereof, and/or by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence. For a general description of nucleotide substitution, see, e.g., Ford ei a/., 1991, Protein Expression and Purification 2 95-107
It will be apparent to those skiiied in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active polypeptide. Amino acid residues essential to the activity of the polypeptide encoded by an isolated polynucleotide of the invention, and therefore preferably not subject to substitution, may be identified according to procedures known in the art, such as site- directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, supra). In the latter technique, mutations are introduced at every positiveiy charged residue in the molecule, and the resultant mutant molecules are tested for endoglucanase activity to identify amino acid residues that are critical to the activity of the molecule. Sites of substrate-enzyme interaction can also be determined by analysis of the three-dimensional structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photoaffinity labeling (see, e.g., de Vos et at., 1992, supra: Smith et a/,, 1992, supra; Wlodaver et a!., 1992, supra). The present invention also reiates to isolated polynucleotides encoding a polypeptide of the present invention, which hybridize under very low stringency conditions, preferably low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NQ: 3, SEQ ID NQ: 5, SEQ ID NQ: 7, or SEQ ID NO: 9, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NQ: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7: or (iii) a complementary strand of (i) or (ii); or aSSeiic variants and subsequences thereof (Sambrook et a/., 1989, supra), as defined herein. In a preferred aspect, the mature polypeptide coding sequence of SEQ ID NO: 3 is nucleotides 67 to 1185. In another preferred aspect, the mature polypeptide coding sequence of SEQ ID NO: 5 is nucleotides 84 to 1229, In another preferred aspect the mature polypeptide coding sequence of SEQ ID NO: 7 is nucleotides 77 to 1300. In another preferred aspect, the mature polypeptide coding sequence of SEQ ID NO: 9 is nucleotides 73 to 1768, The present invention also reiates to isolated poiynuclβotides obtained by (a) hybridizing a population of DNA under very low, Sow, medium, medium-high, high, or very high stringency conditions with (i) the mature poiypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature poiypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or (iii) a complementary strand of (i) or (is); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having endoglucanase activity, in a preferred aspect, the mature polypeptide coding sequence of SEQ ID NO. 3 is nucleotides 67 to 1185. In another preferred aspect, the mature polypeptide coding sequence of SEQ ID NO: 5 is nucleotides 84 to 1229. In another preferred aspect, the mature polypeptide coding sequence of SEQ ID NO: 7 is nucleotides 77 to 1300. In another preferred aspect, the mature polypeptide coding sequence of SEQ ID NG; 9 is nucleotides 73 to 1788.
Nucleic Acid Constructs
The present invention also relates to nucleic acid constructs comprising an isolated polynucleotide of the present invention operabSy linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. An isolated polynucleotide encoding a polypeptide of the present invention may be manipulated in a variety of ways to provide for expression of the polypeptide. ManipuSation of the polynucleotide's sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well known in the art.
The control sequence may be an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence contains transcriptional control sequences which mediate the expression of the polypeptide. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention, especially in a bacterial host cell, are the promoters obtained from the E, coli lac operon, Stmptomyces coelicolor agarase gene {dagA), Bacillus subtiiis levansucrase gene {sacB}, Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens aipha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene {penP), Bacillus subtiiis xylA and xylB genes, and prokaryotic beta- lactamase gene {Villa-Kama roff et a/. , 1978, Proceedings of the National Academy of Sciences USA 75-. 3727-3731), as weii as the tac promoter (DeBoer et a/., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25). Further promoters are described in "Usefu! proteins from recombinant bacteria" in Scientific Amencan, 1980, 242: 74-94; and in Sambrook ef a/., 1989, supra, Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzaύ TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral aipha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae aikaitnβ protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusatium venenatutn amyloglucosidase (WO 00/56900), Fusarium v&nenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/5690O)1 Fusarium oxyspotvm trypsin-like protease (WO 96/00787), Trichoderma reesei beta-glucosidase, Tnchoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase Ii, Trichoderma reese/ endogiucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endogiucanase III, Trichoderma reese/ endoglucanase IV, Trichoderma reesei endoglucanase V, Trichodenva reesei xyianase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-xyϊosidase, as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase); and mutant, truncated, and hybrid promoters thereof.
In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO- 1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3- phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerasβ (TPI)1 Saccharomyces cemvisiae mβtallothionβin (CUP1), and Saccharomyces cerevisiae 3-phosphoglycβrate kinase. Other useful promoters for yeast host celts are described by Romanes et ai< 1992, Yeast 8; 423-488.
The contra! sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is fυnctiona! in the host cell of choice may be used in the present invention.
Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthraniiate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.
Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cemvisiae βnolase, Saccharomyces cerevisiae cytochrome C (CYC 1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host ceils are described by Romanos et a!.. 1992, supra.
The control sequence may also be a suitable leader sequence, a nontransSated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5s terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus niduians triose phosphate isomerase. Suitable leaders for yeast host cells are obtained from the genes for
Saccharomyces cerevisiae enoSase (ENO-1), Saccharomyces cerevisiae 3- phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cemvisiae alcohol dehydrogenase/giycera!dehyde-3-phosphate dehydrogenase (ADH2/GAP). The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3: terminus of the nucleotide sequence and which, when transcribed, is recognized by the host eel! as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention. Preferred poiyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamyiase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin- Sike protease, and Aspergillus niger alpha-gSucosidase.
Useful polyadenylation sequences for yeast host cells are described by Gυo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990. The control sequence may also be a signa! peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide info the cell's secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signa! peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 51 end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signa! peptide coding region in order to enhance secretion of the polypeptide. However, any signa! peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice, / e., secreted into a culture medium, may be used in the present invention.
Effective signal peptide coding regions for bacterial host cells are the signal peptide coding regions obtained from the genes for Bacillus NCIB 11837 maitogenic amylase, Bacillus stearothermophllus aipha-amyiase, Bacillus lichθnifonnis subtilisin, Bacillus llcheniformis beta-lactamase, Bacillus stearothermophilus neutral proteases {nprT: nprS, nprM}: and Bacillus subtiiis prsA. Further signal peptides are described by Simonen and Palvar 1993r Microbiological Reviews 57: 109-137. Effective signal peptide coding regions for filamentous fungai host cells are the signa! peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus nlg$r neutral amylase, Aspergillus nlger giucoamylase, Rhizomucor miehβi aspartic proteinase, Hutnicola insoiβns cellulase, Humicola insolens endogSucanase V, and Humicola lanuginosa lipase. Useful signal peptides for yeast host cells are obtained from the genes for
Saccharomyces ceωvisiae alpha-factor and Saccharomyces cefOvisiae inverfase. Other useful signal peptide coding regions are described by Romanes et a/., 1992, supra.
In a preferred aspect, the signal peptide comprises or consists of amino acids 1 to 16 of SEQ ID NO: 4. In another preferred aspect, the signa! peptide coding region is nucleotides 19 to 69 of SEQ ID NO. 3. In another preferred aspect the signa! peptide comprises or consists of amino acids 1 to 15 of SEQ ID NO; 8. Sn another preferred aspect, the signa! peptide coding region comprises or consists of nucleotides 39 to 83 of SEQ SD NO: 5.
In another preferred aspect, the signai peptide comprises or consists of amino acids 1 to 21 of SEQ ID NO; 8. Sn another preferred aspect, the signai peptide coding region comprises or consists of nucleotides 14 to 76 of SEQ SD NO: 7,
In another preferred aspect, the signa! peptide comprises or consists of amino acids 1 to 16 of SEQ SD NO: 10, in another preferred aspect, the signal peptide coding region comprises or consists of nucleotides 1 to 48 of SEQ ID NO: 9. The controi sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propoiypeptidβ (or a zymogen in some cases). A propeptide is generally inactive and can be converted to a mature active poiypeptide by catalytic or autocatalytic cleavage of the propeptide from the propoiy peptide. The propeptide coding region may be obtained from the genes for Bacillus subtiiis aikaSine protease (aprE), Baάiius subtiiis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceiiophthora theimophϊla iaccase (WO 95/33836),
In a preferred aspect, the propeptide comprises or consists of amino acids 17 to 24 of SEQ ID NO: 10. In another preferred aspect, the propeptide coding region comprises or consists of nucleotides 49 to 72 of SEQ ID NO: 9.
Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.
It may aSso be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide reiative to the growth of the host cell. Exampies of reguiatory systems are those which cause the expression of the gene to be turned on or off in response to a chemicaS or physical stimuius, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems inciude the lac, tac, and trp operator systems. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the TAKA alpha-amySase promoter, Aspergillus niger glucoamySase promoter, and Aspergillus oryzae glucoamyiase promoter may be used as reguiatory sequences. Other exampies of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofoiate reductase gene which is amplified in the presence of methotrexate, and the metailothionein genes which are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide would be operabiy linked with the regulatory sequence.
Expression Vectors The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and transiational stop signals. The various nucieic acids and controi sequences described herein may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to aiiow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites. Aiternatively, a polynucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operabiy linked with the appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plascnid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about expression of the nucleotide sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular piasmids.
The vector may be an autonomously replicating vector, /.©., a vector which exists as an βxtrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a piasmid, an extrachromosomal element, a minichromosome. or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been Integrated. Furthermore, a single vector or piasmid or two or more vectors or piasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used. The vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, protofrophy to aυxotrophs, and the like.
Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus iicheniformis, or markers which confer antibiotic resistance such as ampicillin, Kanamycin, chloramphenicol, or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1 , and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acefamidase), argB {ornithine carbamoyitransferase), bar (phosphinothricin acetyitransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG {orotidsnβ-51- phosphate decarboxylase), sC (sulfate adenyliransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidυlans or Aspergillus oryzae and the bar gene of Stmptomyces hygmscopicus.
The vectors of the present invention preferably contain an elements) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the ceii independent of the genome
For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homoiogous or nonhomologous recombination. Alternatively, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at a precise locations) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrationa! elements should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to enhance the probability of homoiogous recombination. The integrationa! elements may be any sequence that is homologous with the target sequence in the genome of the host ceil. Furthermore, the integrationai elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any piasmid replicator mediating autonomous replication which functions in a cell. The term "origin of replication" or "piasmid replicator" is defined herein as a nucleotide sequence that enables a piasmid or vector to replicate in vivo.
Examples of bacterial origins of replication are the origins of replication of plasmids p8R322, pUC19, pACYC177, and pACYC184 permitting replication in E. co!it and pUB110, pE194, pTA1060, and pAIVSβ.1 permitting replication in Bacillus.
Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN8,
Examples of origins of repiication useful in a filamentous fungal ceSS are AMA 1 and ANSI (Gems ef a/,, 1991 , Gene 98: 61-67; Cullen ef a/., 1987, Nucleic Acids Research 15: 9163-9175; WO 00/24883). isolation of the AMAi gene and construction of piasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
More than one copy of a poiynucleotide of the present invention may be inserted into a host cell Io increase production of the gene product. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by inciuding an amplifiable seiectabie marker gene with the poiynucleotide where cells containing ampSifsed copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent, The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e g... Sambrook ef a/., 1989, supra).
Host CeUs The host cei! may be any ceil useful in the recombinant production of a polypeptide of the present invention, e.g., a prokaryote or a eukaryote.
The prokaryotic host cell may be any Gram positive bacterium or a Gram negative bacterium. Gram positive bacteria include, but not limited to, Bacillus, Streptococcus, Streptomyces, Staphylococcus, Entemcoccus, Lactobacillus, Lactococcus, Clostridium, Geobacilius, and Qceanobacillus. Gram negative bacteria include, but not limited to, E. coli, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium, Fuse-bacterium, llyobacter, Neisseria, and Ureaplasma.
The bacterial host cell may be any Bacillus cell. Bacillus ceils useful in the practice of the present invention include, but are not limited to, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis. Bacillus clfvulans, Bacillus ciausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus iicheniformis, Bacillus megaterium, Bacillus pumllus. Bacillus stβarothermophilus, Bacillus subtills, and Bacillus thuringiensis ceils.
In a preferred aspect, the bacterial host cell is a Bacillus amyioliquefaciens, Bacillus lenius, Bacillus licheniformis, Bacillus stearoihermophilus or Bacillus subtilis cell. In a more preferred aspect, the bacteria! host cell is a Bacillus amyioliquefaciens ceil, In another more preferred aspect, the bacteria! host ceSi is a Bacillus clausii ceil, In another more preferred aspect, the bacteria! host cell is a Bacillus licheπiformis cβiS. In another more preferred aspect the bacterial host eel! is a Bacillus sυbtihs cell.
The bacteria! host ceSi may also be any Streptococcus ceϊ!. Streptococcus ceϋs usefu! in the practice of the present invention include, but are not limited to, Streptococcus eqυisirnilis.. Streptococcus pyogenes, Streptococcus uteris., and Streptococcus equi subsp. Zooepidemicus.
In a preferred aspect, the bacterial host cell is a Streptococcus equisimiiis cell, In another preferred aspect, the bacterial host ceϋ is a Streptococcus pyogenes eel!. In another preferred aspect, the bacterial host cell is a Streptococcus uberis eel!. In another preferred aspect, the bacterial host ceSi is a Streptococcus equi subsp. Zooθpidθmicus ce!S.
The bacterial host cell may aiso be any Streptomyces cell, Streptomyc&s ceils usefu! in the practice of the present invention include, but are not limited to, Streptomyces achromogenes. Streptomyces avermitilis, Streptomyces coeiicoior, Streptomyces griseus, and Streptomyces lividans.
In a preferred aspect, the bacterial host cell is a Streptomyces achromogenes ceil. In another preferred aspect, the bacterial host cell is a Strepiomyces avermitilis ceil. In another preferred aspect, the bacterial host cei! is a Streptomyces coeiicoior ceil. In another preferred aspect, the bacterial host cei! is a Streptomyces griseus cell. In another preferred aspect, the bacterial host ceϋ is a Streptomyces lividans ceil.
The introduction of DNA into a Bacillus ceϋ may, for instance, be effected by protopiast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), by using competent cβiSs (see, e.g., Young and Spizizen, 1961 Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56; 209-221), by eSectroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by conjugation (see, e.g., Koehier and Thome, 1987, Journal of Bacteriology 189; 5271-5278). The introduction of DNA into an £ cols ceil may, for instance, be effected by protopiast transformation (see, e.g., Hanahaα 1983, J. MoI. Biol. 166: 557-580) or eSectroporation (see, e.g., Dower et a/., 1988, Nucleic Acids Res. 16: 6127-6145). The introduction of DNA into a Streptomyces eel! may, for instance, be effected by protoplast transformation and eiectroporation (see, e.g., Gong et a/., 2004, Folia Microbiol. (Praha) 49: 399-405), by conjugation (see, e.g., Ma20dier ef a/., 1989, J. Bacterid. 171: 3583-3585), or by transduction (see, e.g., Burke et a/., 2001, Proc. Natl. Acad Sci. USA 98:6289-6294). The introduction of DNA into a Pseudomonas ceil may, for instance, be effected by eiecfroporation (see, e.g., Choi et a/., 2006« J. Microbiol. Methods 64: 391-397) or by conjugation (see, e.g., Pinedo and Smets. 2005, Appi, Environ. Microbiol. 71: 51-57). The introduction of DNA into a Streptococcus cell may, for instance, be effected by natural competence (see, e.g., Perry and Kuramitsu, 1981 Infect Immun. 32: 1295-1297), by protoplast transformation (see, e.g., Catt and Jollick, 1991 , Microbios, 88; 189-2070, by electroporation (see, e.g., Buckley et a/,, 1999, Appi. Environ. Microbiol, 65: 3800-3804) or by conjugation (see, e.g., Clewell, 1981 , Microbiol. Rev. 45: 409-436), However, any method known in the for introducing DNA into a host cell can be used.
The host cell may also be a eukaryote, such as a mammalian, insect plant, or fungal cell
In a preferred aspect, the host cell is a fungal cell. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycete (as defined by Hawksworth et a/. , In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB international, University Press, Cambridge, UK) as weii as the Oomycota (as cited in Hawksworth et a/., 1995, supra, page 171} and aii mitαsporic fungi {Hawksworth et a!., 1995, supra).
In a more preferred aspect, the fungal host ceii is a yeast ceS!. "Yeasf as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast and yeast beionging to the Fungi imperfecti (BSastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, SM., and Davenport, R. R,, eds, Soc, App. Bacteriol. Symposium Series No, 9, 1980),
In an even more preferred aspect, the yeast host ceii is a Candida, Hansenu!a: Kiuyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell. In a most preferred aspect, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces dougiasii, Saccharomyces kluyveri, Saccharomyces nαrbensis, or Saccharomyces oviformis cell, in another most preferred aspect, the yeast host ceil is a Kiuyveromyces lactis ceil. In another most preferred aspect, the yeast host cell is a Yarrowia lipolytics eel I .
In another more preferred aspect, the fungal host ceil is a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et a/., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obiigateSy aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thailus and carbon cataboSism may be fermentative.
In an even more preferred aspect, the filamentous fυnga! host cell is an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysospoήum, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocailimastix, Neurospora, Paeciiomyces, Penicilliurn, Phanerochaetet Phlebia, Piromyces, Pleurotus, Schizophyiium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Tramθtθs, or Trichoderma ceil.
In a most preferred aspect the filamentous funga! host ceil is an Aspergillus awamori, Aspergillus fumigatust Aspergillus foetidus* Aspergillus japonicus, Aspergillus niduians, Aspergillus niger or Aspergillus oryzae ceSS. In another most preferred aspect, the filamentous fungal host cell is a Fusarium bactridioidθs, Fusarium cerealis, Fusarium crookwθllensβ, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi.. Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotήchioides, Fusarium sulphureυm, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell. In another most preferred aspect, the filamentous fungaf host cell is a Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis oaωgiea, Ceriporiopsis gilvescens, Ceriporiopsis pannociπta, Ceriporiopsis rivulosa.. Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium kβratinophilum, Chrysospoήum lucknowensB, Chrysosporiutn tropicum, Chrysosponum merdarium, Chrysosporium inops, Chrysosporium pannicola, Chrysosponum queensSandicum, Chrysosporium zonatum, Coprinus cinβreus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora cmssa, Penicillium brasilianum, Peniclllium purpurogenum, Phanerochaete chrysosporium, Phlebia radiate, Pleurotus eryngii, Thielavia tenrestris, Tr&metes viliosa, Tr&metes versicolor, Trichoderma harzianum, Trichoϋerma koningii, Trichoderma longibrachiatum, Trichoderma mesei, or Trichoderma viride cell.
Funga! ceSSs may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host ceils are described in EP 238 023 and Yelton et a/,, 1984, Proceedings of the National Academy of Sdenc&s USA 81: 1470-1474. Suitable methods for transforming Fusarium species are described by Maiardier et a/., 1989, Gene 78: 147-158, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M. L, editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; ito et a/., 1983. Journal of Bacteriology 153; 183; and Hinnen et a/,, 1978, Proceedings of the National Academy of Sciences USA 75; 1920.
Methods of Production
The present invention also relates to methods for producing a polypeptide of the present invention, comprising: (a) cultivating a ceil, which in its wiSd-type form is capabie of producing the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide. In a preferred aspect, the cei! is of the genus Myceliophthora. in a more preferred aspect, the cell is Myceiiophthora thermophila. In a most preferred aspect, the ceSS is Myceiiophthora thermophila CBS 117.65, In another preferred aspect, the ceii is basidiomycete CBS 494.95. in another preferred aspect, the cell is basidiomycete CBS 495.95. In another preferred aspect, the cell is of the genus Penicillium. in another more preferred aspect, the eel! is Penicillium hrasiiianum. In another most preferred aspect, the ceii is Peniciilium brasilianum iBT 20888.
The present invention also relates to methods for producing a polypeptide of the present invention, comprising: (a) cuitivating a host ceil under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide. The present invention also relates to methods for producing a polypeptide of the present invention, comprising: (a) cuitivating a host ceil under conditions conducive for production of the polypeptide, wherein the host cell comprises a mutant nucleotide sequence having at ieast one mutation in the mature polypeptide coding sequence of SEQ ID NO; 3, SEQ ID NQ; 5, SEQ ID NO; 7, or SEQ ID NO: 9, wherein the mutant nucleotide sequence encodes a polypeptide which comprises or consists of the mature polypeptide of SEQ ID NO; 4, SEQ ID NO: 8, SEQ SD NO: 8, or SEQ ID NO: 10, and (b) recovering the polypeptide.
In a preferred aspect, the mature poiypeptide of SEQ SD NO: 4 is amino acids 17 to 389. in another preferred aspect, the mature polypeptide of SEQ ID NO; 6 is amino acids 16 to 397. In another preferred aspect, the mature polypeptide of SEQ ID NO: 8 is amino acids 22 to 429, in another preferred aspect, the mature polypeptide of SEQ ID NO; 10 is amino acids 25 to 421. In another preferred aspect, the mature polypeptide coding sequence is nucleotides 87 to 1185 of SEQ ID NO: 3. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 84 to 1229 of SEQ ID NO: 5. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 77 to 1300 of SEQ iD NO: 7. in another preferred aspect, the mature polypeptide coding sequence is nucleotides 73 to 1488 of SEO. ID NO: 9.
In the production methods of the present invention, the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods well known in the art. For example, the cell may be cultivated by shake flask cultivation, and small- scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Cuiture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium, if the polypeptide is not secreted into the medium, it can be recovered from celi lysates. The polypeptides may be detected using methods known in the art that are specific for the poiypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide as described herein. The resulting polypeptide may be recovered using methods known in the art.
For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
The polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exciusion), eSectrophoretic procedures (e.g., preparative isoelectric focusing), differentia! solubility {e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J. -C, janson and Lars Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides.
Plants
The present invention also relates to plants, e.g., a transgenic plant, plant part, or plant cell, comprising an isolated polynucleotide encoding a polypeptide having endoglucanase activity of the present invention so as to express and produce the polypeptide in recoverable quantities. The polypeptide may be recovered from the plant or plant part, Alternatively, the plant or plant part containing the recombinant polypeptide may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, payability, and Theological properties, or Io destroy an antiπutritive factor. The transgenic plant can be dicotyledonous (a dicot) or rnonccctyledonous (a monocot). Examples of monocot piants are grasses, such as meadow grass (blue grass, Poa), forage grass such as Fesiuca, Loiium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).
Examples of dicot plants are tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related mode! organism Arabidopsis thaiiana.
Examples of plant parts are stem, callus, leaves, root, fruits, seeds, and tubers as well as the individual tissues comprising these parts, e.g., epidermis, mesophyll, parenchyma, vascular tissues, meristβms. Specific plant cell compartments, such as chioroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a plant part. Furthermore, any plant cell, whatever the tissue origin, is considered to be a plant part. Likewise, plant parts such as specific tissues and cells isolated to facilitate the utilisation of the invention are also considered plant parts, e.g., embryos, endosperms, aleυrone and seeds coats. Also included wtthtn the scope of the present invention are the progeny of such plants, plant parts, and plant cells.
The transgenic plant or plant cell expressing a polypeptide of the present invention may be constructed in accordance with methods known in the art. In short, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a polypeptide of the present invention into the plant host genome or chioropSast genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.
The expression construct is conveniently a nucleic acid construct which comprises a polynucleotide encoding a polypeptide of the present invention operably linked with appropriate regulatory sequences required for expression of the nucleotide sequence in the plant or plant part of choice. Furthermore, the expression construct may comprise a selectable marker useful for identifying host cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used).
The choice of regulatory sequences, such as promoter and terminator sequences and optionally signal or transit sequences is determined, for example, on the basis of when, where, and how the polypeptide is desired to be expressed. For instance, the expression of the gene encoding a polypeptide of the present invention may be constitutive or inducible, or may be developmentai, stage or tissue specific, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves. Reguiatory sequences are: for example, described by Tague et a/,s 1988, Plant Physiology 86; 506.
For constitutive expression, the 35S-CaMV, the maize ubiquitin 1, and the rice actin 1 promoter may be used (Franck et a/., 1980, Ce// 21: 285-294, Christensen et a!... 1992, Plant Mo. Biol. 18: 675-689; Zhang et a/., 1991 , Plant Cell 3: 1155-1165), organ- specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990, Ann, Rev. Genet. 24: 275- 303), or from metabolic sink tissues such as meristems (ito et a!., 1994r Plant MoI. Biol. 24: 863-878)r a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et a/., 1998, Rant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et a!., 1998, Journal of Plant Physiology 152: 708-711), a promoter from a seed oil body protein (Chen ef a/,. 1998, Plant and Cell Physiology 39: 935-941), the storage protein napA promoter from Bmssica napus. or any other seed specific promoter known in the art, e.g., as described in VVO 91/14772. Furthermore, the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato (Kyozuka ef a/., 1993, Plant Physiology 102: 991-1000, the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-874), or a wound inducible promoter such as the potato pin2 promoter (Xu et a/,, 1993, Plant Molecular Biology 22: 573-588). Likewise, the promoter may inducible by abiotic treatments such as temperature, drought, or alterations in saiinity or induced by exogenously appiied substances that activate the promoter, e.g., ethanoi, oestrogens, plant hormones such as ethylene, abscisic acid, and gibbereilic add, and heavy metais.
A promoter enhancer element may also be used to achieve higher expression of a polypeptide of the present invention in the plant. For instance, the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention. For instance, Xu ef a/,, 1993, supra^ disclose the use of the first intron of the rice actin 1 gene to enhance expression. The selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.
The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobactenum-meύlaieά transformation, virus- mediated transformation, microinjection, pattide bombardment biolistic transformation, and electroporation (Gasser et a/,, 1990, Science 244: 1293;
Potrykus, 1990, Bio/T&chnology 8; 535; Shimamoto et a/., 1989, Nature 338'. 274),
Presently, Agrobactθrium tumθfaciens-meύlateά gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38} and can also be used for transforming monocots, although other transformation methods are often used for these plants. Presently, the method of choice for generating transgenic monocots is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic caϋϊ or developing embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Curmnt Opinion Biotechnology 5; 158-162; Vasil et a/., 1992, Bio/Technoiogy 10: 667-674). An alternative method for transformation of monocots is based on protoplast transformation as described by Gmiruϋβh et a/., 1993, Plant Molecular Biology 21 : 415-428.
Following transformation, the transformants having incorporated the expression construct are selected and regenerated into whole plants according to methods well- known in the art. Often the transformation procedure is designed for the selective elimination of selection genes either during regeneration or in the following generations by using, for example, co-transformation with &vo separate T-DNA constructs or site specific excision of the selection gene by a specific recombinase. The present invention also relates to methods for producing a polypeptide of the present invention comprising: (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding a polypeptide having endoglucanase activity of the present invention under conditions conducive for production of the polypeptide; and <b) recovering the polypeptide.
Removal or Reduction of Endoglucanase Activity
The present invention also relates to methods for producing a mutant of a parent cell, which comprises disrupting or deleting a polynucleotide sequence, or a portion thereof, encoding a polypeptide of the present invention, which results in the mutant cell producing less of the polypeptide than the parent cell when cultivated under the same conditions. The mutant cell may be constructed by reducing or eliminating expression of a nucleotide sequence encoding a polypeptide of the present invention using methods well known in the art, for example, insertions, disruptions, replacements, or deletions, in a preferred aspect, the nucleotide sequence is inactivated. The nucleotide sequence to be modified or inactivated may be, for example, the coding region or a part thereof essential for activity, or a reguiatory element required for the expression of the coding region. An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the nucleotide sequence. Other control sequences for possible modification include, but are not limited to, a leader, poiyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator
Modification or inactivation of the nucleotide sequence may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the nucleotide sequence has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing agents. Examples of a physical or chemical mutagenizing agent suitable for the present purpose inciude ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N- nitrosoguanidine (MNNG), O-methyl hydroxyiamine, nitrous acid, ethyl methane suSphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.
When such agents are used, the mutagenesis is typically performed by incubating the parent ceil to be mutagen ized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.
Modification or inactivation of the nucleotide sequence may be accomplished by introduction, substitution, or removal of one or more nucleotides in the gene or a regulatory element required for the transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame. Such modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art. Although, in principle, the modification may be performed in vivo, i.e., directly on the cell expressing the nucleotide sequence to be modified, it is preferred that the modification be performed in vitro as exemplified beiow.
An example of a convenient way to eliminate or reduce expression of a nucleotide sequence by a cell is based on techniques of gene replacement, gene deletion, or gene disruption. For example, in the gene disruption method, a nucleic acid sequence corresponding to the endogenous nucleotide sequence is mutagβnized in vitro to produce a defective nucleic acid sequence which is then transformed into the parent cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence repiaces the endogenous nucleotide sequence, it may be desirable that the defective nucleotide sequence aiso encodes a marker that may be used for selection of transformants in which the nucleotide sequence has been modified or destroyed. In a particulariy preferred aspect, the nucleotide sequence is disrupted with a selectable marker such as those described herein.
Alternatively, modification or inactivation of the nucieottde sequence may be performed by established anti-sense or RNAi techniques using a sequence complementary to the nucleotide sequence. More specifically, expression of the nucleotide sequence by a ceil may be reduced or eliminated by introducing a sequence complementary to the nucleotide sequence of the gene that may be transcribed in the ceil and is capable of hybridizing to the mRNA produced in the ceil. Under conditions allowing the complementary anti-sense nucleotide sequence to hybridize to the mRNA, the amount of protein translated is thus reduced or eliminated.
The present invention further relates to a mutant cei! of a parent cell which comprises a disruption or deletion of a nucleotide sequence encoding the polypeptide or a control sequence thereof, which results in the mutant cell producing less of the polypeptide or no polypeptide compared to the parent cell. The poiypeptide-deficient mutant ceils so created are particularly useful as host ceils for the expression of homologous and/or heterologous polypeptides. Therefore, the present invention further relates to methods for producing a homologous or heterologous polypeptide comprising; {a} cultivating the mutant cell under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide. The term "heterologous polypeptides" is defined herein as polypeptides which are not native to the host cell, a native protein in which modifications have been made to alter the native sequence, or a native protein whose expression is quantitatively altered as a result of a manipuiation of the host celi by recombinant DNA techniques.
In a further aspect, the present invention relates to a method for producing a protein product essentially free of endoglucanase activity by fermentation of a cell which produces both a polypeptide of the present invention as well as the protein product of interest by adding an effective amount of an agent capable of inhibiting endogSucanase activity to the fermentation broth before, during, or after the fermentation has been completed, recovering the product of interest from the fermentation broth, and optionally subjecting the recovered product to further purification. In a further aspect, the present invention relates to a method for producing a protein product essentialiy free of endoglucanase activity by cuitivating the ceil under conditions permitting the expression of the product, subjecting the resultant culture broth to a combined pH and temperature treatment so as to reduce the endogSucanase activity substantially, and recovering the product from the cuiture broth. Alternatively, the combined pH and temperature treatment may be performed on an enzyme preparation recovered from the culture broth. The combined pH and temperature treatment may optionally be used in combination with a treatment with an endogiucanase inhibitor.
In accordance with this aspect of the invention, it is possibie to remove at least 60%, preferably at least 75%, more preferably at least 85%, stiil more preferably at least 95%, and most preferably at least 99% of the endoglucanase activity. Complete removal of endogiucanase activity may be obtained by use of this method.
The combined pH and temperature treatment is preferably carried out at a pH in the range of 2-3 or 10-11 and a temperature in the range of at ieast 75-85'C for a sufficient period of time to attain the desired effect, where typically, 1 to 3 hours is sufficient.
The methods used for cultivation and purification of the product of interest may be performed by methods known in the art.
The methods of the present invention for producing an essentially endoglucanase-free product is of particular interest in the production of eukaryotic polypeptides, in particular fungal proteins such as enzymes. The enzyme may be selected from, $.g,, an amylolytic enzyme, lipolytic enzyme, proteolytic enzyme, ceiluiytic enzyme, oxidoreductase, or plant celi-wail degrading enzyme. Examples of such enzymes include an aminopeptidase, amylase, amyioglucosidase, carbohydrase, carboxypeptidase, catalase, celSulase, chitinase, cutinase, cyclodextrin glycαsyltransferase, deoxyribonuciβase, esterase, galactosidase, beta-gal actosidase, giucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinolytic enzyme, peroxidase, phytase, phenoloxidase, poiyphenoloxidase, proteolytic enzyme, ribonuciease, transferase, transglutaminase, or xylanase. The endogiucanase-deficient cells may also be used to express heterologous proteins of pharmaceutical interest such as hormones, growth factors, receptors, and the like.
It wii! be understood that the term "βukaryotic polypeptides" includes not only native polypeptides, but aiso those polypeptides, e.g., enzymes, which have been modified by amino acid substitutions, deletions or additions, or other such modifications to enhance activity, thermostability, pH tolerance and the like.
In a further aspect, the present invention relates to a protein product essentiaily free from endoglucanase activity which is produced by a method of the present invention.
Methods of Inhibiting Expression of a Polypeptide
The present invention aiso relates to methods of inhibiting expression of a polypeptide in a cell, comprising administering to the cell or expressing in the cell a double-stranded RNA (dsRNA) molecule, wherein the dsRNA comprises a subsequence or portion of a polynucleotide of the present invention, in a preferred aspect, the dsRNA is about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more dupiex nucleotides in length. In another preferred aspect, the polypeptide has endoglucanase activity.
The dsRNA is preferably a smai! interfering RNA {siRNA} or a micro RNA (miRNA). In a preferred aspect, the dsRNA is small interfering RNA (siRNAs) for inhibiting transcription, in another preferred aspect, the dsRNA is micro RNA (miRNAs) for inhibiting translation.
The present invention aiso relates to such double-stranded RNA {dsRNA} molecules for inhibiting expression of a polypeptide in a cell, wherein the dsRNA comprises a subsequence or portion of a polynucleotide encoding the mature polypeptide of SEQ ID NO: 4, SEQ ID NO; 6, SEQ ID NQ: 8, or SEQ ID NO: 10. Whiie the present invention is not limited by any particular mechanism of action, the dsRNA can enter a cell and cause the degradation of a single- stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs. When a cell is exposed to dsRNA, mRNA from the homologous gene is selectively degraded by a process called RNA interference (RNAi). The dsRNAs of the present invention can be used in gene-silencing therapeutics, in one aspect, the invention provides methods to selectively degrade RNA using the dsRNAis of the present invention. The process may be practiced in vitro, ex vivo or in vivo, In one aspect, the dsRNA molecuies can be used to generate a Soss-of- function mutation in a cell, an organ or an animal. Methods for making and using dsRNA molecules to selectively degrade RNA are well known in the art, see, for example, U.S. Patent No. 6,506,559; U.S. Patent No. 6,511 ,824; U.S. Patent No. 6.515,109; and U.S. Patent No. 8,489,127.
Compositions The present invention aiso relates to compositions comprising a poiypeptide of the present invention. Preferably, the compositions are enriched in such a polypeptide. The term "enriched" indicates that the endogSucanase activity of the composition has been increased, e.g., with an enrichment factor of at least 1.1.
The composition may comprise a polypeptide of the present invention as the major enzymatic component, e.g., a mono-component composition. Alternatively, the composition may comprise muStiple enzymatic activities, such as an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellυlase, chitinase, cutinase, cyclodextrin glycosyitransferasβ, deoxyribonuclease, esterase, aSpna-galactosidase, beta-galactosidase, gSucoamyiase, alpha-glucosidase, beta-glucosidase, haloperoxidase, invertase, laccase, iipase, mannosidasβ, oxidase, pectinolytic enzyme, peptidogiutaminase, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuciease, transglutaminase, or xylanase. The additional enzyme(s) may be produced, for example, by a microorganism belonging to the genus Aspergillus, preferably Aspergillus acυleaius, Aspergillus awamori, Aspergillus fumigaiυs, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nldulans, Aspergillus niger, or Aspergillus oryzae; Fusariυm, preferably Fusariυm bactridioides, Fυsariυm cerealis, Fusarium crookweliense, Fusarium cultnorutn, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusariurn reticulatυm, Fαsarium roseum, Fusaήurn sambucinum, Fusarium sarcochroαm, Fusarium sυlphureum, Fusarium toruiosβum, Fusarium tnchoihecioides, or Fusarium venβnatum] Humicola, preferably Humicola insolens or Humicola lanuginosa-, or Trichoderma, preferabiy Trichoderma harziaπum, Trichoderma koningli, Trichoderma longibrachlatum, Trichoderma reesei, or Trichoderma viride.
The polypeptide compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. For instance, the polypeptide composition may be in the form of a granulate or a microgranulate. The polypeptide to be included in the composition may be stabiiized in accordance with methods known in the art.
Examples are given below of preferred uses of the polypeptide compositions of the invention. The dosage of the polypeptide corn position of the invention and other conditions under which the composition is used may be determined on the basis of methods known in the art.
Uses
The present invention also relates to methods for degrading or converting a ceϋuiosic materia!, comprising: treating the cellulosic materia! with a composition comprising an effective amount of a polypeptide having endogiucanase activity of the present invention, in a preferred aspect, the method further comprises recovering the degraded or converted ce!!u!osic materia!.
The polypeptides and host ceiis of the present invention may be used in the production of monosaccharides, disaccharides, and polysaccharides as chemicai or fermentation feedstocks from ceϋuiosic biomass for the production of ethanoi, piastics, other products or intermediates. The composition comprising the polypeptide having endoglucanase activity may be in the form of a crude fermentation broth with or without the celis removed or in the form of a semi-purified or purified enzyme preparation. The composition can also comprise other proteins and enzymes useful in the processing of biomass, e.g., cellobiohydrolase, beta-giucosidase, hemicellulolytic enzymes, enhancers (WO 2005/074647, WO 2005/074656), etc. Alternatively, the composition may comprise a host ceϊi of the present invention as a source of the poϊypeptide having endoglucanase activity in a fermentation process with the biomass. In particular, the polypeptides and host cells of the present invention may be used to increase the vaiue of processing residues (dried distiliers grain, spent grains from brewing, sugarcane bagasse, etc.) by partial or complete degradation of cellulose or hβmicβllulose. The host ceil may also contain native or heterologous genes that encode other proteins and enzymes, mentioned above, useful in the processing of biomass. In the methods of the present invention, any cβiluiosic material, such as biomass, can be used. It is understood herein that the term "celluiosic materia!" encompasses iignocellulose, Biomass can inciude, but is not limited to, wood resources, municipal soiid waste, wastepaper, crops, and crop residues (see, for βxampie, Wiselogel et a/., 1995, in Handbook on Bioethanol (Charles E. Wyman, editor), pp. 105-118, Tayior & Francis, Washington D.C.; Wyman, 1994, Bioresource Technology 50: 3-16; Ly nd, 1990, Applied Biochemistry and Biotechnology 24/25: 695- 719; Mosier et a/., 1999, Recent Progress in Bioconversion of Lignoceiiuiosics, in Advances in Biochemical Engineering/Biotechnology, T. Scheper, managing editor, Voiume 65, pp.23-40, Springer- Verlag, New York). The predominant polysaccharide in the primary ceii waS! of biomass is cellulose, the second most abundant is hemi-ceiluiose, and the third is pectin. The secondary cell wall, produced after the ceil has stopped growing, also contains polysaccharides and is strengthened by polymeric iignin covalently cross-linked to hemiceSiuiose. Ceiluiose is a homopolymer of anhydrocellobiose and thus a linear beta-(1-4)-D-glucan, whiie hemicelluSoses include a variety of compounds, such as xylans, xylogSucans, arabinoxylans, and mannans in complex branched structures with a spectrum of substituents. Although generaiSy polymorphous, ceSiuiose is found in piant tissue primarily as an insoluble crystalline matrix of parallel glucan chains, Hemicelluloses usually hydrogen bond to cellulose, as well as to other hemiceiiuloses, which help stabilize the ceil wall matrix. Three major classes of enzymes are used to breakdown cellulosic biomass:
{1} The "endo-1,4-beta-glucanases" or 1 ,4-bβta-D-giucan-4- glucanchydrolases (EC 3.2.1.4), which act randomly on soluble and insoluble 1 ,4- beta- glucan substrates.
(2) The "exo-1 ,4-beta-D-glucanases" including both the 1 ,4-beta-D-gSucan glucohydroϊases (EC 3.2.1.74), which liberate D-glucose from 1 ,4-beta-D-glucans and hydrolyze D-celiobiose slowly, and ceilobiohydrolases (1,4-beta-D-g!ucan cβllobiohydroiases, EC 3.2.1.91), which liberate D-celiobiosβ from 1 ,4-beta-glucans,
(3) The "befa-D-giucosldases" or beta-D-g!ucoside glucohydroiases (EC 3.2.1.21), which act to release D-glucose units from ceSSαfoiose and soluble cellodextrms, as well as an array of glycosides.
The polypeptides having endoglucanase activity of the present invention are preferably used in conjunction with other cellulofytic proteins, e.g., exo- 1 ,4- beta- D- glucanases and beta-D-glucosidases, to degrade the cellulose component of the biomass substrate, (see, for example, Brigham et al... 1995, in Handbook on Bioethano! (Charles E, Wyrπan, editor), pp,119-141, Taylor & Francis, Washington D. C; Lee, 1997, Journal of Biotechnology 56; 1-24).
The exo-1 ,4-beta-D-g!ucanases and beta-D-glucosidases may be produced by any known method known in the art (see, e.g., Bennett, J, W, and LaSure, L. (eds.), More Gene Manipulations in Fungi, Academic Press, CA, 1991). The optimum amounts of a polypeptide having endoglucanase activity and other celluSoiytic proteins depends on several factors including, but not limited to, the mixture of component ceiSuiαlytic proteins, the cellulosic substrate, the concentration of celiυlosic substrate, the pretreatment(s) of the cellulosic substrate, temperature, time, pH, and inclusion of fermenting organism (e.g., yeast for Simultaneous Saccharifϊcation and Fermentation). The term "cellulolytic proteins" is defined herein as those proteins or mixtures of proteins shown as being capable of hydrolyzlng or converting or degrading cellulose under the conditions tested.
In a preferred aspect, the amount of polypeptide having endoglucanase activity per g of celluiosic material is about 0.5 to about 50 mg, preferably about 0.5 to about 40 mg, more preferably about 0.5 to about 25 mg, more preferably about 0.75 to about 20 mg, more preferably about 0.75 to about 15 mg, even more preferably about 0.5 to about 10 mg, and most preferably about 2.5 to about 10 mg per g of celiulosic material
In another preferred aspect, the amount of cellulolyiic proteins per g of celluiosic material is about 0.5 to about 50 mg, preferabiy about 0.5 to about 40 mg, more preferably about 0.5 to about 25 mg, more preferably about 0.75 to about 20 mg, more preferably about 0.75 to about 15 mg, even more preferably about 0 5 to about 10 mg, and most preferabiy about 2 5 to about 10 mg per g of celiulosic materia!.
In the methods of the present invention, the composition may be supplemented by one or more additional enzyme activities to improve the degradation of the ceiiuiosic material. Preferred additional enzymes are hemiceiSulases, esterases (e g., upases, phosphoiipases, and/or cutinases), proteases, iaccases, peroxidases, or mixtures thereof.
In the methods of the present invention, the additional enzyme(s) may be added prior to or during fermentation, including during or after the propagation of the fermenting microorganismξs). The enzymes may be derived or obtained from any suitable origin, including, bacterial, funga!, yeast or mammalian origin. The term "obtained" means herein that the enzyme may have been isolated from an organism which naturally produces the enzyme as a native enzyme. The term "obtained" also means herein that the enzyme may have been produced recombinantly in a host organism, wherein the recombinantly produced enzyme is either native or foreign to the host organism or has a modified amino acid sequence, e.g., having one or more amino acids which are deleted, inserted and/or substituted, i.e., a recombinantly produced enzyme which is a mutant and/or a fragment of a native amino acid sequence or &n enzyme produced by nucleic acid shuffling processes known in the art. Encompassed within the meaning of a native enzyme are natural variants and within the meaning of a foreign enzyme are variants obtained recombinant!^ such as by site-directed mutagenesis or shuffling.
The enzymes may also be purified. The term "purified" as used herein covers enzymes free from other components from the organism from which it is derived. The term "purified" also covers enzymes free from components from the native organism from which it is obtained. The enzymes may be purified, with oniy minor amounts of other proteins being present. The expression "other proteins"' relate in particular to other enzymes. The term "purified" as used herein also refers to removal of other components, particularly other proteins and most particularly other enzymes present in the cell of origin of the enzyme of the invention. The enzyme may be "substantially pure," that is, free from other components from the organism in which it is produced, that is, for example, a host organism for recombinant^ produced enzymes. In a preferred aspect, the enzymes are at least 75% (w/w), preferably at least 80%, more preferably at Seast 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, even more preferably at least 98%, or most preferably at least 99% pure. In another preferred aspect, the enzyme is 100% pure. The enzymes used in the present invention may be in any form suitable for use in the processes described herein, such as, for example, a crude fermentation broth with or without cells, a dry powder or granulate, a non-dusting granulate, a liquid, a stabilized liquid, or a protected enzyme. Granulates may be produced, e.g., as disclosed in U.S. Patent Nos. 4,106,991 and 4,661,452, and may optionally be coated by process known in the art. Liquid enzyme preparations may, for instance, be stabilized by adding stabilizers such as a sugar, a sugar alcohol or another polyol, and/or lactic acid or another organic acid according to established process. Protected enzymes may be prepared according to the process disclosed in EP 238,216,
The methods of the present invention may be used to process a celiuiosic material to many useful organic products, chemicals and fuels. Sn addition to βthanol, some commodity and specialty chemicals that can be produced from cellulose include xylose, acetone, acetate, glycine, lysine, organic acids (e.g., lactic acid), 1,3- propanediol, butanedioi, glycerol, ethylene glycol, furfural, polyhydroxyaSkanoaf.es, cis: cis-muconic acid, and animal feed (Lynd, L R., Wyman, C. E., and Gerngross, T. U.: 1999, Biocommodity Engineering* Biot&chnol, Prog,. 15: 777-793; Philippidis, G. P., 1996, CeSluSose bioconversion technology, in Handbook on Bioethanof: Production and Utilization, Wyman, C. E., ed., Tayior & Francis, Washington, DC, 179-212, and Ryu, D, D. Y., and Iviandels, M., 1980, Cellulases: biosynthesis and applications, Enz, Microb, Technol , 2: 91-102). Potential coproduction benefits extend beyond the synthesis of muStipie organic products from fermentabSe carbohydrate. Lignin-rich residues remaining after biological processing can be converted to lignin-derived chemicals, or used for power production.
Conventional methods used to process the celiuiosic material in accordance with the methods of the present invention are well understood to those skilled in the art. The methods of the present invention may be implemented using any conventional biomass processing apparatus configured to operate in accordance with the invention. Such an apparatus may include a batch-stirred reactor, a continuous flow stirred reactor with ultrafiltration, a continuous plug-ffow column reactor (Gusakov, A. V., and Sinitsyn, A. P., 1985, Kinetics of the enzymatic hydrolysis of cellulose: 1. A mathematical model for a batch reactor process, Enz. M/erøώ. TechnoL 7; 346-352), an attrition reactor (Ryu, S. K,, and Lee, J. IvI1 1983, Byconversion of waste cellulose by using an attrition bioreactor, Biotøchπol. Biσeng. 25: 53-65) , or a reactor with intensive stirring induced by an electromagnetic field (Gusakov, A, V,, Sinitsyn, A. P., Davydkin, i. Y., Davydkin, V. Y., Protas, O. V., 1996, Enhancement of enzymatic cellulose hydrolysis using a novei type of bioreactor with intensive stirring induced by electromagnetic field, Appl, Biochem. Biotechnoi. 56: 141 - 153) ,
The conventional methods include, but are not iimited to, saccharification, fermentation, separate hydrolysis and fermentation (SHF), simultaneous saccharification and fermentation (SSF), simultaneous saccharification and cofermentation (SSCF), hybrid hydrolysis and fermentation (HHF), and direct microbial conversion (DMC). SHF uses separate process steps to first enzymatically hydrølyze cellulose to glucose and then ferment glucose to ethanol. in SSF1 the enzymatic hydrolysis of cellulose and the fermentation of glucose to ethanol is combined in one step (Philippidis, G, P., 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization^ Wyman, C. E., ed., Taylor & Francis, Washington, DC, 179- 212). SSCF includes the cofermentation of multiple sugars (Shβehan, J., and Himmel, M., 1999, Enzymes, energy and the environment; A strategic perspective on the U.S. Department of Energy's research and development activities for bioethanol Biotechnoi, Prog. 15: 817-827). HHF inciudes two separate steps carried out in the same reactor but at different temperatures, i.e., high temperature enzymatic saccharification followed by SSF at a lower temperature that the fermentation strain can tolerate, DMC combines ali three processes (cellulase production, cellulose hydrolysis, and fermentation) in one step (Lynd, L. R., Weimer, P. J., van ZyI, W. H., and Pretorius, I. S., 2002, Microbial cellulose utilization: Fundamentals and biotechnology, Microbiol. MoL Biol. Reviews 86; 506-577). "Fermentation" or 'fermentation process" refers to any fermentation process or any process comprising a fermentation step. A fermentation process includes, without limitation, fermentation processes used to produce fermentation products including alcohols (e.g., arabinitol, butanol, ethanol, glycerol, methanol, 1 ,3- propanediol, sorbitol, and xylitol); organic acids (e.g., acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diketo-D-giυconic acid, formic acid, fumaric acid, giucaric acid, gluconic add, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, rnaϋc acid, malonic acid, oxalic acid, propionic acid, succinic acid, and xylcnic acid); ketones (e.g., acetone); amino acids (&.g,, aspartic acid, glutamic acid, glycine, lysine, serine, and threonine); gases (e.g., methane, hydrogen (H2), carbon dioxide (COs). and carbon monoxide (CO)). Fermentation processes also inciude fermentation processes used in the consumable aicoho! industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), ieather industry, and tobacco industry.
The present invention further relates to methods of producing a substance, comprising: (a) saccharifying a cellulosic materia! with a composition comprising an effective amount of a polypeptide having endoglucanase activity; (b) fermenting the saccharified cellulosic materia! of step (a) with one or more fermentating microorganisms; and (c) recovering the substance from the fermentation The composition comprising the polypeptide having endoglucanase activity may be in the form of a crude fermentation broth with or without the cells removed or in the form of a semi-purified or purified enzyme preparation or the composition may comprise a host ceil of the present invention as a source of the polypeptide having endogiucanase activity in a fermentation process with the biomass.
The substance can be any substance derived from the fermentation. In a preferred embodiment, the substance is Bn alcohol. It will be understood that the term "alcahoi" encompasses a substance that contains one or more hydroxyl moieties, In a more preferred embodiment, the aicohoi is arabtnito!. In another more preferred embodiment, the aicohoi is butanol. in another more preferred embodiment, the aicoho! is ethanol. In another more preferred embodiment, the aicoho! is glycerol, in another more preferred embodiment, the aicohoi is methanoS. in another more preferred embodiment, the aicoho! is 1,3-propanediol. In another more preferred embodiment, the alcohol is sorbitol, In another more preferred embodiment, the aicoho! is xylitoi. See, for example, Gong, C. S., Cao, N, j., Du, J,, and Tsao, G, T,, 1999, Ethanol production from renewabie resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T., ed., Springer-Veriag Berlin Heideiberg, Germany, 65: 207-241 ; Sϋveira, M, M., and Jonas, R., 2002, The biotechnologica! production of sorbitol, Appl. Microbiol. Biotechnof. 59: 400-408; Nigam, P., and Singh, D., 1995, Processes for fermentative production of xylitoi - a sugar substitute, Process Biochemistry 30 (2): 117-124; Ezeji, T. C, Qureshi, N. and Blaschek, H. P., 2003, Production of acetone, butanoi and efhano! by Clostridium b&ij&rinckii BA101 and in situ recovery by gas stripping, World Journal of Microbiology and Biotechnology 19 (6): 595-603. In another preferred embodiment, the substance is an organic acid, !n another more preferred embodiment, the organic acid is acetic acid. In another more preferred embodiment, the organic acid is acetonic acid, in another more preferred embodiment, the organic acid is adipic acid, In another more preferred embodiment the organic add is ascorbic acid. In another more preferred embodiment, the organic acid is citric acid. In another more preferred embodiment, the organic acid is 2,5-diketo-D-giuconic acid, In another more preferred embodiment, the organic acid is formic acid, in another more preferred embodiment, the organic acid is fumaric acid. In another more preferred embodiment, the organic acid is glυcaric acid, in another more preferred embodiment, the organic acid is gluconic acid, in another more preferred embodiment, the organic acid is giucuronic acid, in another more preferred embodiment, the organic acid is glutaric acid. In another preferred embodiment, the organic acid is 3-hydroxyρropionic acid, in another more preferred embodiment, the organic acid is itaconic acid. In another more preferred embodiment the organic acid is iactic acid, in another more preferred embodiment, the organic acid is maiic acid, in another more preferred embodiment, the organic acid is malonic acid, in another more preferred embodiment, the organic acid is oxalic acid. In another more preferred embodiment, the organic acid is propionic acid. In another more preferred embodiment, the organic acid is succinic acid. In another more preferred embodiment, the organic acid is xyionic acid. See, for example, Chen, R., and Lee, Y, Y., 1997, Membrane-mediated extractive fermentation for iactic acid production from cellulosic biomass, AppL Biochem, Blotechnol. 63-65; 435-448.
In another preferred embodiment, the substance is a ketone, it will be understood that the term "ketone" encompasses a substance that contains one or more ketone moieties. In another more preferred embodiment, the ketone is acetone. See, for example, Qureshi and Biaschek, 2003, supra. In another preferred embodiment, the substance is an amino acid, in another more preferred embodiment, the organic acid is aspartic acid, in another more preferred embodiment, the amino acid is glutamic acid, in another more preferred embodiment, the amino acid is glycine, in another more preferred embodiment, the amino acid is iysine. in another more preferred embodiment, the amino acid is serine. In another more preferred embodiment, the amino acid is threonine. See, for example, Richard, A,, and Margaritis, A., 2004, Empirical modeiing of batch fermentation kinetics for poly{glutamic acid) production and other microbia! biopolymers, Biotechnology and Bio&ngin&θring 87 (4): 501-515.
In another preferred embodiment, the substance is a gas. in another more preferred embodiment, the gas is methane, in another more preferred embodiment, the gas is H2. in another more preferred embodiment, the gas is CO2. In another more preferred embodiment, the gas is CO, See, for example, Kataoka, N., A. Miya, and K, Kiriyama. 1997. Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria, Water Science and Technology 38 (6-7): 41-47; and GunaseeSan V,N. in Biomass and Bioenergy, VoS. 13 (1-2), pp. 83-114, 1997, Anaerobic digestion of biomass for methane production; A review.
Production of a substance from cellulosic materia! typically requires four major steps. These four steps are pretreatment, enzymatic hydrolysis, fermentation, and recovery. Exemplified befow is a process for producing ethanof, but it will be understood that similar processes can be used to produce other substances, for example, the substances described above.
Pretreatment. in the pretreatment or pre-hydroiysis step, the cellulosic materia! is heated to break down the lignin and carbohydrate structure, soiubilize most of the hemiceiiuiose, and make the cellulose fraction accessible to cellulolytic enzymes. The heating is performed either directly with steam or in slurry where a cataiyst may aSso be added to the materia! to speed up the reactions. Catalysts include strong acids, such as sulfuric acid and SO2, or alkali, such as sodium hydroxide. The purpose of the pretreatment stage is to facilitate the penetration of the enzymes and microorganisms. Celluiosic biomass may also be subject to a hydrothermai steam explosion pretreatment {See U.S. Patent Application No. 20020164730). Sa∞harificatiQ.0.- in the enzymatic hydrolysis step, also known as saccharificaticn, enzymes as described herein ar& added to the pretreated material to convert the cellulose fraction to gSucose and/or other sugars. The saccharification is generally performed in stirred- tank reactors or fermentors under controiied pH: temperature, and mixing conditions. A saccharification step may last up to 200 hours. Saccharification may be carried out at temperatures from about 3CTC to about 6541C, in particuiar around 5015C, and at a pH in the range between about 4 and about 5, especiaiiy around pH 4.5. To produce glucose that can be metabolized by yeast, the hydrolysis is typicaSiy performed in the presence of a beta-glucosidase.
Fermentation, In the fermentation step, sugars, released from the ceiSuiosic material as a result of the pretreatment and enzymatic hydrolysis steps, are fermented to ethanoi by a fermenting organism, such as yeast. The fermentation can also be carried out simultaneously with the enzymatic hydrolysis in the same vessel, again under controlled pH, temperature, and mixing conditions. When saccharification and fermentation are performed simultaneously in the same vessel, the process is generally termed simultaneous saccharification and fermentation or SSF.
Any suitable celiulosic substrate or raw materia! may be used in a fermentation process of the present invention. The substrate is generally selected based on the desired fermentation product i.e., the substance to be obtained from the fermentation, and the process employed, as is we!! known in the art. Examples of substrates suitabie for use in the methods of present invention include cellulose-containing materials, such as wood or plant residues or Sow molecular sugars DP1-3 obtained from processed ceilulosic materia! that can be metabolized by the fermenting microorganism, and which may be supplied by direct addition to the fermentation medium.
The term "fermentation medium" will be understood to refer to a medium before the fermenting microorganism(s) is{are) added, such as, a medium resulting from a saccharification process, as well as a medium used in a simultaneous saccharification and fermentation process (SSF).
"Fermenting microorganism" refers to any microorganism suitable for use in a desired fermentation process. Suitabie fermenting microorganisms according to the invention are able to ferment, i.e , convert, sugars, such as glucose, xylose, arabinose, mannose, galactose, or oiigαsaccharides directly or indirectly into the desired fermentation product. Examples of fermenting microorganisms include fungai organisms, such as yeast. Preferred yeast includes strains of the Sacchammyces spp.r and in particular, Sacchaivtnyces cerevisiae. Commercially available yeast include, e.g., Red Star®/™/Lesaffre Ethanol Red (available from Red Star/Lesaffre, USA) FALi (available from Fleischmann's Yeast, a division of Burns Philp Food inc., USA), SUPERSTART (available from Ailtech), GERT STRAND (available from Gert Strand AB, Sweden) and FERMIOL (available from DSM Specialties).
In a preferred embodiment the yeast is a Saccharomyces spp. in a more preferred embodiment, the yeast is Sacchammyces cerevisiae, In another more preferred embodiment, the yeast is Saccharomyces distaticus. In another more preferred embodiment the yeast is Sacchammyces uvarυm. Sn another preferred embodiment, the yeast is a Kiuyvβromyces. in another more preferred embodiment, the yeast is Kiuyveromyces marxianus. In another more preferred embodiment, the yeast is Kluyveromyces fragilis. In another preferred embodiment, the yeast is a Candida. In another more preferred embodiment, the yeast is Candida pseudotropicalis. in another more preferred embodiment, the yeast is Candida brassicae. In another preferred embodiment, the yeast is a Clavispora. in another more preferred embodiment, the yeast is Clavispora lυsitaniae. In another more preferred embodiment, the yeast is Ciavispora opuntiaθ. in another preferred embodiment, the yeast is a Pachysoiβn. In another more preferred embodiment, the yeast is Pachysoiθn tannophiiυs. In another preferred embodiment, the yeast is a Bretannomyces. In another more preferred embodiment, the yeast is Bretannomyces clausenϊi (Phiiippidis, G. P., 1998, Cellulose bioconversion technology, in Handbook on Bioethanol; Production and Utilization, Wyman, C. E., e<±, Taylor & Francis, Washington, DC, 179-212).
Bacteria that can efficiently ferment giucose to ethano! include, for example, Zymomonas tnobilis and Clostridium thermocelium {Phiiippidis, 1998, supra).
It is well known in the art that the organisms described above can also be used to produce other substances, as described herein.
The cioning of heterologous genes in Sacchammycθs cθrevisiaθ (Chen, Z., Ho1 N. W. Y., 1993, Cloning and improving the expression of Pichia stipitis xylose reductase gene in Saccharomyces cerevisiae, Appl. Biochem. Biotechnoi. 39-40: 135-147; Ho, N. W Y , Chen, Z, Brainard, A P , 1998, Geneticaily engineered Saccharomyces yeast capable of effectively cofermenting giucose and xylose, Appi, Environ. Microbiol. 84; 1852-1859), or in bacteria such as Escherichia cols (Beall, D. S., Qhta, K., Ingram, L O., 1991 , Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coii, Biotech. Bioeng, 38: 296-303), Klebsiella oxytoca (Ingram, L O., Gomes, P. F., Lai, X., Moniruzzaman, M., Wood, B. E., Yomano, L. P., York, S. W., 1998, Metabolic engineering of bacteria for ethanol production, Biotechnoi. Bioeng. 58; 204-214), and Zymomonas mobilϊs (Zhang, M., Eddy, C, Deanda, K., Finkβlsteiα M., and Picataggio, S., 1995, Metabolic engineering of a pentose metabolism pathway in ethanologenic Zyrnornonas mohitis, Science 267. 240-243, Deanda, K., Zhang, M., Eddy, C, and Picataggio, S., 1996, Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering, Appl. Environ. Microbial, 62: 4465-4470) has led to the construction of organisms capable of converting hexoses and pentoses to ethanol (cofermentation). Yeast or another microorganism typically is added to the degraded cellulose or hydrolysate and the fermentation is ongoing for about 24 to about 96 hours, such as about 35 to about 80 hours. The temperature is typically between about 260C to about 40°C, in particular at about 32°C, and at about pH 3 to about pH 6, in particular around pH 4-5. In a preferred embodiment, yeast or another microorganism is applied to the degraded cellulose or hydroiysate and the fermentation is ongoing for about 24 to about 96 hours, such as typicaϋy 35-60 hours. In a preferred embodiments, the temperature is generally between about 26 to about 400C, in particular about 320C, and the pH is generally from about pH 3 to about pH 6, preferably around pH 4-5, Yeast or another microorganism is preferably applied in amounts of approximateiy 105 to 1012, preferably from approximately 107 to 1010, especially approximately 5x107 viable count per ml of fermentation broth. During an ethanol producing phase the yeast ceif count should preferably be in the range from approximately 107 to 10t0, especially around approximately 2 x 10s. Further guidance in respect of using yeast for fermentation can be found in, e.g., "The Alcohol Textbook" (Editors K. Jacques, T, P. Lyons and D. R, Kelsall, Nottingham University Press, United Kingdom 1999), which is hereby incorporated by reference.
The most widely used process in the art is the simultaneous saccharificaiion and fermentation (SSF) process where there is no holding stage for the saccharificafion, meaning that yeast and enzyme are added together. For ethanol production, following the fermentation the mash is distilled to extract the ethanol. The ethanol obtained according to the process of the invention may be used as, e.g., fuel ethanol; drinking ethanol, i.e., potabie neutral spirits, or industrial ethanoi.
A fermentation stimulator may be used in combination with any of the enzymatic processes described herein to further improve the fermentation process, and in particular, the performance of the fermenting microorganism, such as, rate enhancement and ethanol yield. A "fermentation stimulator" refers to stimulators for growth of the fermenting microorganisms, in particular, yeast Preferred fermentation stimulators for growth include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenate, nicotinic acid, meso-inositol, thiamine, pyridoxins, para-am inobenzoic acid, folic acid, riboflavin, and Vitamins A, 8, C, D, and E. See, e.g., Alfenore et a/,, Improving efhano! production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer- Veriag (2002), which is hereby incorporated by reference. Examples of minerals include minerals and mineral salts that can supply nutrients comprising P, K, IVIg, S, Ca, Fe, Zn, Mn, and Cu.
Recovery. The alcohol is separated from the fermented cellulosic material and purified by conventional methods of distillation, Ethanol with a purity of up to about 96 vol. % ethanol can be obtained, which can be used as, for example, fuel ethanoi, drinking βthanol, i.e., potable neutral spirits, or industrial βthanol, For other substances, any method known in the art can be used including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofαcusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS- PAGE, distillation, or extraction. In the methods of the present invention, the polypeptide having endoglucanase activity and other celluiolytic protein(s) may be supplemented by one or more additional enzyme activities to improve the degradation of the cellulosic materia!. Preferred additional enzymes are hβmicellulases, esterases {e.g., lipases, phospholi pases, and/or cutinases), proteases, laccases, peroxidases, or mixtures thereof. in the methods of the present invention, the additional enzyme(s) may be added prior to or during fermentation, including during or after the propagation of the fermenting microorganism(s).
Propeptide and Signal Peptides
The present invention also relates to nucieic acid constructs comprising a gene encoding a protein, wherein the gene is operabSy linked to one or both of a first nucleotide sequence encoding a signal peptide comprising or consisting of amino acids 1 to 16 of SEQ ID NO: 4, amino acids 1 to 15 of SEQ ID NO: 6, amino acids 1 to 21 of SEQ ID NQ: 8, or amino acids 1 to 16 of SEQ ID NO: 10 and a second nucleotide sequence encoding a propeptide comprising or consisting of amino acids 17 to 24 of SEQ SD NO: 10, wherein the gene is foreign to the first and second nucleotide sequences
In a preferred aspect, the first nucleotide sequence comprises or consists of nucleotides 19 to 69 of SEQ ID NO: 3. In another preferred aspect the first nucleotide sequence comprises or consists of nucleotides 39 to 83 of SEQ ID NO: 5. in another preferred aspect, the first nucleotide sequence comprises or consists of nucleotides 14 to 76 of SEQ SD NO: 7, in another preferred aspect, the first nucieotide sequence comprises or consists of nucleotides 1 to 48 of SEQ i D NO: 9. in another preferred aspect, the second nucieotide sequence comprises or consists of nucleotides 49 to 72 Of SEQ ID NO: 9. The present invention also relates to recombinant expression vectors and recombinant host cells comprising such nucleic acid constructs.
The present invention aiso relates to methods for producing a protein comprising (a) cultivating such a recombinant host eel! under conditions suitable for production of the protein; and (b) recovering the protein. The protein may be native or heterologous to a host cell. The term ''protein*' is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins. The term "protein" also encompasses two or more polypeptides combined to form the encoded product. The proteins aiso include hybrid poiypeptides which comprise a combination of partial or complete polypeptide sequences obtained from at least two different proteins wherein one or more may be heterologous or native to the host celi. Proteins further include naiuraliy occurring aSiβiic and engineered variations of the above mentioned proteins and hybrid proteins.
Preferably, the protein is a hormone or variant thereof, enzyme, receptor or portion thereof, antibody or portion thereof, or reporter. In a more preferred aspect, the protein is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or Sigasβ. in an even more preferred aspect, the protein is an aminopeptidase, amylase, carbohydrase, carboxypepiidase, cataiase, cellulase, chitinase, cutinase, cyclodextrin glycosylfransferase, deoxyribonuciease, esterase, alpha-gaiactøsidase, beta- galactosidase, glucoamylase, alpha-glucosidase, beta-giucosidase; invertase, laccase, another lipase, mannosidase, mutanase, oxidase, pectinoiytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylanase.
The gene may be obtained from any prokaryotic, eukaryotic, or other source.
The present invention is further described by the following examples which should not be construed as limiting the scope of the invention.
Examples
Materials
Chemicals used as buffers and substrates were commercial products of at least reagent grade.
Strains Mycetiophthora thermophHa CBS 117.65, basidiomycete CBS 494.95, basidiomycete CBS 495.95, and Penicillium brasilianum strain IBT 20888 (iBT Culture Collection of Fungi, TeehnicaS University of Denmark, Copenhagen, Denmark) were used as sources of the endogiucanase genes. Sacchammyces cerevisiae strain W3124 (MATa; ura 3-52; ieu 2-3, 112; his 3-D200; pep 4-1137; prc1;:HIS3; prb1:; LEU2; cir+) was used for screening of Myceliophthora thermophHa CBS 117.65 expression libraries for endogiucanase activity. Aspergillus oryzae HowB104 (aSpha-amySase- negative) was used for expression of the ce/5a genes.
Media and Solutions LB medium was composed per liter of 10 g of tryptone, 5 g of yeast extract, and
5 g of sodium chloride. L8 ampicillin medium was composed per liter of 10 g of tryptone, 5 g of yeast extract. 5 g of sodium chloride, and 50 μg of ampiciiSin per ml (filter sterilized, added after autoclaving).
LB ampiciSSin plates were composed per liter of LB arπpicillin medium and 15 g of bacto agar,
YPD medium was composed of 1% yeast extract, 2% peptone, and filter- sterilized 2% glucose added after autoclaving.
YPM medium was composed of 1% yeast extract 2% peptone, and filter- sterilized 2% maitodextrin added after aufociaving. SC-URA medium with galactose was composed per liter of 100 ml of 10X Basal salts, 28 ml of 20% casarnino acids without vitamins, 10 ml of 1% tryptophan, 3.6 mi of 5% threonine (filter sterilized, added after autociaving), and 100 ml of 20% galactose (filter sterilized, added after autociaving).
SC-URA medium with giucose was composed per liter of 100 mi of 10X Basa! salts solution, 28 ml of 20% casamino acids without vitamins, 10 mi of 1% tryptophan, 3.6 mi of 5% threonine (filter sterilized, added after autoclaving}, and 100 ml of 20% glucose (filter sterilized, added after autoclaving).
10X Basal salts solution was composed per liter of 75 g of yeast nitrogen base, 113 g of succinic acid, and 68 g of NaOH. SC-agar was composed per liter of SC-URA medium (with glucose or galactose as indicated) and 20 g of agar.
0.1% AZCL HE cellulose SC agar plates with galactose were composed per liter of SC-LSRA medium with galactose, 20 g of agar, and 0.1% AZCL HE cellulose (Megazymβ, Wickiow, Ireland). BA medium was composed per liter of 10 g of com steep liquor dry matter, 10 g of NH4NO3, 10 g of KH2PO4, 0,75 g of MgSO4-7H2O, 0,1 ml of pluronic, and 0.5 g of CaCOg. The pH was adjusted to 6,5 before autoclaving.
COVE plates were composed per liter of 342.3 g of sucrose, 25 g of Noble agar, 20 ml of COVE salts solution, 10 mM acetamide, and 20 mM CsCI. The solution was adjusted to pH 7.0 before autoclaving.
COVE salts solution was composed per liter of 26 g of KCi, 26 g of MgSO4- 7H2O, 76 g of KHiPO4, and 50 ml of COVE trace metals.
COVE trace metals solution was composed per liter of 0.04 g of NaB4O7-10H2O, 0.4 g of CuSO4 SH2O, 1.2 g of FeSO4TH2O, 0.7 g of MnSO4 H2O, 0.8 g of Na2MoO2^H2O, and 10 g of ZnSO4TH2O.
TE was composed of 10 mM Tris pH 7.4 and 0.1 mM EDTA. Example 1 : Construction of Myceliophthora thermophila CBS 117.65 cDNA expression libraries Jn Saccharomyces cerevlsiae Myceliophthora thermofila CBS 117.65 was cultivated in 200 mi of BA medium at 30° C for five days at 200 rpm. Myceiia from the shake fiask culture were harvested by filtering the contents through a funnel lined with Miracloth™ (CalBiochem, San Diego, CA, USA). The myceiia were then sandwiched between two Miracloth™ pieces and blotted dry with absorbent paper toweis. The mycelial mass was then transferred to Falcon 1059 plastic centrifuge tubes and frozen in liquid nitrogen. Frozen myceiia were stored in a -8O0C freezer until use.
The extraction of tota! RNA was performed with guanidinium thiocyanate foiiowed by ultracβntrifugation through a 5.7 M CsCI cushion, and isolation of poly(A)+RNA was carried out by oligo{dϊ)-ce!iυ!ose affinity chromatography, using the procedures described in WO 94/14953.
Double-stranded cDNA was synthesized from 5 μg of poiy(A)+ RNA by the RNase H method (Gubler and Hoffman, 1983, Gene 25: 263-289, Sambrook et a/., 1989, Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY, USA). The po!y(Ar RNA (5 μg in 5 μ! of DEPC {0.1% diethylpyrocarbonate)-treated water) was heated at 70"C for 8 minutes in a pre- siliconized, RNase-free Eppendorf tube, quenched on ice, and combined in a final volume of 50 μl with reverse transcriptase buffer composed of 50 miVl Tris-HCI, pH 8,3, 75 mM KCi, 3 mM IVIgCI2, 10 mM dithiothreitol (DTT) (Bethesda Research Laboratories, Bethesda, MD, USA), 1 mM of dATP, dGTP and dTTP, and 0.5 mM 5~methy!-dCTP (Pharmacia. Uppsala. Sweden), 40 units of human placental ribonuclease inhibitor (RNasin, Promega, Madison, Wl, USA), 1.45 μg of o!igo(dT)1s-Λ/of I primer (Pharmacia), and 1000 units of Superscript I! RNasβ H reverse transcriptase (Bethesda Research Laboratories). First-strand cDNA was synthesized by incubating the reaction mixture at 450C for 1 hour. After synthesis, the rnRNAxDNA hybrid mixture was gei filtrated through a MicroSpin S-400 HR spin column (Pharmacia) according to the manufacturer's instructions.
After gei filtration, the hybrids were diluted in 250 μ! of second strand buffer (20 mM Tris-HCI, pH 7.4, 90 mM KCI, 4.6 mM MgCI2, 10 mM (NH^SCu, 0.16 mM NAD) containing 200 μM of each dNTP, 60 units of E. coii DNA polymerase I (Pharmacia), 5.25 units of RNase H (Promega), and 15 units of E. coll DNA ligase (Boehringer Mannheim, Manheim, Germany). Second strand cDNA synthesis was performed by incubating the reaction tube at 18X for 2 hours and an additional 15 minutes at 25"C, The reaction was stopped by addition of EDTA to a finai concentration of 20 mM followed by phenol and chloroform extractions.
The double-stranded cDNA was precipitated at -20 'C for 12 hours by addition of 2 volumes of 96% βthanol and 0.2 volume of 10 M ammonium acetate, recovered by centrifugation at 13,000 x g, washed in 70% βthanol, dried, and resuspended in 30 μl of Mung bean nuclease buffer (30 mM sodium acetate pH 4,6, 300 mM NaCI, 1 mM ZnSO4, 0.35 mM DTT, 2% glycerol) containing 25 units of Iviung bean nuclease (Pharmacia). The single-stranded hair-pin DNA was clipped by incubating the reaction at 3O0C for 30 minutes, followed by addition of 70 μl of 10 mM Tris-HCM mM EDTA pH 7.5, phenol extraction, and precipitation with 2 voiumes of 96% ethanoS and 0.1 volume of 3 M sodium acetate pH 5,2 on ice for 30 minutes.
The double- stranded cDNAs were recovered by centrifugation at 13,000 x g and blunt-ended in 30 μl of T4 DNA polymerase buffer (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM DTT) containing 0.5 mM of each dNTP and 5 units of T4 DNA poiymerase (New England Biαiabs, Ipswich, MA, USA) by incubating the reaction mixture at 160C for 1 hour. The reaction was stopped by addition of EDTA to a final concentration of 20 mM. followed by phenol and chloroform extractions, and precipitation for 12 hours at -20'1C by adding 2 volumes of 96% ethano! and 0.1 volume of 3 M sodium acetate pH 5.2.
After the fill-in reaction the cDNAs were recovered by centrifugation at 13,000 x 0, washed in 70% ethanol, and dried. The cDNA pellet was resuspended in 25 μl of ligation buffer (30 mM Tris-HCI, pH 7.8, 10 mM MgCI2, 10 mM DTT, 0.5 mM ATP) containing 2.5 μg of non-paiindromic Bst Xl adaptors (Snvitrogen, Carlsbad, CA, USA), shown below, and 30 units of T4 iigase (Promega), and then incubated at 16'5C for 12 hours. The reaction was stopped by heating at 65* C for 20 minutes and then cooled on ice for 5 minutes.
5'-CTTTCCAGCACA-3' (SEQ ID NO: 1) 3'-GAAAGGTC-S1 (SEQ ID NO. 2) The adapted cDNA was digested with Not I, followed by incubation for 2.5 hours at 370C. The reaction was stopped by heating at 65'C for 10 minutes. The cDNAs were size-fractionated by gel electrophoresis on a 0,8% SeaPlaque GTG low melting temperature agarose gel (Cambrex Corporation, East Rutherford, Nj, USA) in 44 mlvi Tris Base, 44 mM boric acid, 0.5 mM EDTA (TBE) buffer to separate unligated adaptors and small cDNAs. The cDNA was size-selected with a cut-off at 0.7 kb and rescued from the gel by use of β-Agarase (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions and precipitated for 12 hours at -2O°C by adding two volumes of 96% ethanol and 0.1 volume of 3 M sodium acetate pH 5,2.
The directional, size-selected cDNA was recovered by centrifugation at 13,000 x g, washed in 70% ethanol, dried, and then resuspended in 30 μl of 10 mft/i Tris-HCM mM EDTA pH 7.5. The cDNAs were desalted by gel filtration through a MicrcSpin S- 300 HR spin column according to the manufacturer's instructions. Three test ligations were carried out in 10 μl of ligation buffer (30 mM Tris-HCI, pH 7,8, 10 mM MgCi2, 10 rniVi DTT, 0.5 mM ATP) containing 5 μi of double-stranded cDNA (reaction tubes #1 and #2), 15 units of T4 iigase (Promega), and 30 ng (tube #1), 40 ng (tube #2), and 40 ng (tube #3, the vector background controi) of Bst Kl-Not I cleaved pYES2,0 vector (invitrogen, Carlsbad, CA, USA). The ligation reactions were performed by incubation at 16°C for 12 hours, then heating at 70"C for 20 minutes, and finally adding 10 μ! of water to each tube. One μi of each iigation mixture was eiectroporated into 40 μl of electrocompetent E. coli DH 10B cells (Bethesda Research Laboratories) as described by Sambrook et a/. , 1989, supra.
The Myceliophthora thermophϊla CBS 117.65 cDNA library was established in E. coii DH 10B consisting of pools. Each poo! was made by spreading transformed £ coli on LB ampiciliin plates, yielding 15,000-30,000 colonies/plate after incubation at 37°C for 24 hours. Twenty ml of LB ampicillin medium was added to the plate and the ceils were suspended therein. The cell suspension was shaken at 100 rpm in a 50 mi tube for 1 hour at 370C.
The resulting Myceliαpfrthora thermσphila CBS 117,65 cDNA library consisted of approximately 10δ individual clones, with a vector background of 1%. Plasmid DNA from some of the library pools was isolated using a Plasmid Midi Kit (QIAGEN Inc., Valencia, CA, USA), according to the manufacturer's instructions, and stored at -200C,
ExampSe 2: Screening of Myceliophthora thermophila CBS 117.65 expression libraries for ersdoglucanase activity
One ml aliquots of purified plasmid DNA (100 ng/ml) from some of the library pools (Example 1) were transformed into Saccharomyces cerevisiae e3124 by electroporation (Becker and Guarante, 1991, Methods Enzymol. 194-. 182-187) and the transformants were plated on SC agar containing 2% giucose and incubated at 3OX. in total, 50-100 plates containing 250-400 yeast colonies were obtained from each pool.
After 3-5 days of incubation, the SC agar plates were replica plated onto a set of 0.1% AZCL HE cellulose SC URA agar plates with galactose. The plates were incubated for 2-4 days at 3015C and eπdogiυcanase positive colonies were identified as colonies surrounded by a blue hafo.
Example 3: Characterization of the Myceliophthora thermophϊfa CBS 117.65 cefSa gene Endoglucanase-expressing yeast colonies were inoculated into 20 ml of YPD medium in 50 ml glass test tubes. The tubes were shaken at 200 φm for 2 days at 30"C. The cells were harvested by centrifugation for 10 minutes at 3000 rpm in a Hβraeus Megafuge 1.0R centrifuge with a 75002252 rotor (Hanau, Germany).
DNA was isolated according to VVD 94/14953 and dissolved in 50 μl of deionized wafer. The DNA was transformed into E. coli DH 1OB cells by standard procedures according to Sambrook ef a/ , 1989, supra. One E. coli transformant subsequently shown to contain the Myceiiophthora fhertnophila C8S 117.65 ceiSa gene was designated pCICi61 (Figure 1) and used as the material for deposit of bioiogicai material E coli strain pC!C161 was deposited as £ coSi NRRL B-30902 on February 23, 2006.
Plasmid DNA was isolated from the £ coli transformants using standard procedures according to Sarnbrook et a/., 1989, supra. The full iength cDNA sequence of the cel5a gene from Myceliophthora thermophila CBS 117.65 was sequenced with a Taq DyeDeoxy Terminator Cycle Sequencing Kit (Perkin Elmer, WeSiesley, MA, USA) and synthetic oligonucleotide primers using an Applied Btosystems ABI PRISM ™ 377 DNA Sequencer (ABi, Foster City, CA, USA) according to the manufacturer's instructions.
The nucleotide sequence (SEQ ID NO: 3) and deduced amino actd sequence (SEQ ID NO: 4) of the Mycθliophthom thermophiia cel5a gene are shown in Figure 2. The coding sequence is 1170 bp inciuding the stop codon. The encoded predicted protein contains 389 amino acids. The %G+C of the coding region of the gene is 63,6% and the mature polypeptide coding region is 63.6%. Using the SignaiP program, version 3 (Nielsen et a/,, 1997, Protein Engineering 10: 1-8), a signai peptide of 16 residues was predicted. The predicted mature protein contains 373 amino acids with a molecular mass of 40.9 kDa.
Analysis of the deduced amino acid sequence of the cel5a gene with the lnterproscan program (Zdobnov and Apweiler, 2001, Bioinfαrmatics 17: 847-848) showed that the CEL5A protein contained the core sequence typical of a Family 5 glycosyl hydrolase, extending from approximately amino acid residue 77 to residue 350 of the predicted mature polypeptide. The CEL5A protein also contained the sequence signature of a type ! fungal ceϋulose binding domain (CBMI). This sequence signature known as Prosite pattern PS00562 (Sigrist et at.f 2002, Brief Biαinform. 3; 285-274) was present from amino acid residue 8 to residue 35 of the predicted mature polypeptide,
A comparative pairwise global alignment of amino acid sequences was determined using the Needleman-Wunsch algorithm (Needleman and Wunscn, 1970, J. Mo/, Biol. 48: 443-453) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 matrix. The alignment showed that the deduced amino acid sequence of the Myceliophthora thβrmophila gene encoding the CEL5A mature polypeptide shared 75% and 72% identity {excluding gaps) to the deduced amino acid sequences of two Famiiy 5 giycosyi hydrolase proteins from Neurospom cmssa and Humicola insolens, respectively (accession numbers Q7SDR1 and G12624, respectively).
Example 4: Expression of Myceliophthora thermophila CBS 117.65 cel5a gene in Aspergillus oryzae The Myceliophthora thermophiia CBS 1 17.65 ce!5a gene was excised from the pYES2.0 vector using Hind III and Xba I, and ligated into the Aspergillus expression vector pHD414 (EP 238 023r WO 93/11249) using standard methods (Sambrook et a/., 1989, supra). The Aspergillus expression vector pHD414 is a derivative of p775 (EP 238 023). The resulting plasmid was designated pA2C181 (Figure 3), Protoplasts of Aspergillus oryzaθ HowB104 were prepared as described in WO
95/02043. One hundred microliters of protoplast suspension was mixed with 5-25 μg of the Aspergillus expression vector pA2C161 in 10 μ! of STC composed of 1.2 M sorbitol, 10 mM Tris-HCI, pH 7.5, 10 mM CaCI2) and further mixed with 5-25 μg of p3SR2, an Aspergillus niύυlans amdS gene carrying plasmid (Christensen et al., 1988« Bio/Technology 6: 1419-1422), The mixture was left at room temperature for 25 minutes. Two hundred microliters of 80% PEG 4000 (BDH1 Poole, England) (polyethylene glycol, molecular weight 4,000), 10 mM CaCI2, and 10 mM Tris-HC! pH 7,5 was added and gently mixed and finally 0.85 ml of the same solution was added and gently mixed. The mixture was left at room temperature for 25 minutes, centrifuged at 2.500 x g for 15 minutes, and the pellet was resuspended in 2 ml of 1,2 M sorbitol. This sedimentation process was repeated, and the protoplasts were spread on COVE plates. After incubation for 4-7 days at 37''C spores were picked and spread in order to isolate single colonies. This procedure was repeated and spores of a single colony after the second reisoiation were stored, Each of the transformants was inoculated in 10 ml of YPM medium. After 2-5 days of incubation at 30*C, 200 rpm, the supernatant was removed. Endoglucanase activity was identified by applying 20 μl of culture broth to 4 mm diameter holes punched out in a 0.1% AZCL HE cellulose SC-agar plate and incubation overnight at 300C, Endoglucanase activity was then identified by a blue halo around a colony. Several transformant broths had endoglucanase activity significantly greater than broth from an untransformβd Aspergillus oryzae background control, which demonstrated efficient expression of the CEL5A endogiucanase from Myceliophthom thermophiia CBS 117.65 in Aspergillus oryzae.
Example 5: Construction of a bastdiomycete CBS 495.95 cDNA expression Jibrary in Saccharomyces cemvisiae
A cDNA library from basidiomycete CBS 495.95, consisting of approximately 10s individual clones was constructed in E. coli as described in Example 1 , with a vector background of 1%.
Example 6: Screening of basidiomycete CBS 495,95 cDlMA expression libraries for endoglucanase activity
The screening of the cDNA library (Example 5) was performed as described in Example 2.
Example 7: Characterization of a CEL5A encoding gene from bastdiomycete CSS 495.95
Cloning of the celδa gene from basidiomycete CBS 495,95 was carried out as described in Example 3. One £ coli transformant subsequently shown to contain a cel5a gene was designated pC!C453 (Figure 4) and used as the material for deposit of biological material. E. coli strain pCIC453 was deposited as E. coli NRRL B-30903 on February 23. 2008.
The basidiomycete CBS 495 95 celδa gene was excised from pCIC453 using Hind ill and Xba I and ligated into the Aspergillus expression vector pHD414, The resulting plasmid was designated pA2C453 (Figure 5). The nucleotide sequence (SEQ ID NO: 5) and deduced amino acid sequence
(SEQ ID NO: 6} of the CBS 495.95 celδa gene are shown in Figure 8. The coding sequence is 1194 bp including the stop codon. The %G+C of the coding region of the gene is 59.8% and the mature polypeptide coding region is 60.1%. The encoded predicted protein contains 397 amino acids. Using the SignalP program, version 3 (Nieisen βt a/ , 1997. supra), a signal peptide of 15 residues was predicted. The predicted mature protein contains 382 amino acids with a molecular mass of 40.1 kDa. Analysts of the deduced amino acid sequence of the cθlSa gene with the lnterproscan program (Zdobnov and Apwβiler, 2001. supra) showed that the CEL5A protein contained the core sequence typical of a Family 5 glycosyl hydrolase, extending from approximately residues 81 to 359 of the predicted mature polypeptide. The CEL5A protein also contained the sequence signature of a type I fungal cellulose binding domain (CSMI), This sequence signature known as Prosite pattern PS00562 (Sigrist et a/., 2002, supra) was present from amino acid residue 8 to residue 36 of the predicted mature polypeptide.
A comparative pairwise global alignment of amino acid sequences was determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5, and the E8LOSUM82 matrix. The alignment showed that the deduced amino aetd sequence of the CBS 495.95 gene encoding the CEL5A mature polypeptide shared 82% and 79% identity (excluding gaps) to the deduced amino acid sequences of two Family 5 glycosyl hydrolase proteins from Irpex iacteυs and Trametes hirsute, respectively (accession numbers Q5W7K4 and Q75UV6, respectively).
Example 8: Expression of cel5a gene from basidiomycete CBS 495,95 in Aspergillus oryzae Expression of the cel5a gene from basidiomycete CBS 495,95« and analysis of endoglucanase activity was performed as described in Example 4.
Example 9: Construction of a basidiomycete CBS 494.95 cDNA expression library in Saccharomyces cerevisiae A cDNA library from basidiomycete CBS 494.95, consisting of approximately 10δ individual clones was constructed in E coli as described in Example 1 , with a vector background of 1%.
Example 10: Screening of basidiomycete CBS 494.95 cDNA expression libraries for endoglucanase activity
The screening of the cDNA library (Example 9) was performed as described in Example 2.
Example 11 : Characterization of a CEL5B encoding gene from basidiomycete CBS 494.95
Cloning of the cel5b gene from basidiomycete CBS 494.95 was carried out as described in Example 3. One £ coli transformant subsequently shown to contain the CBS 494.95 celSb gene was designated pCIC486 (Figure 7} and used as the materia! for deposit of bioSogica! materia!. E. coli strain pCIC486 was deposited as E coli NRRL B-30904 on February 23, 2008. The basidiomycete CBS 494,95 celSb gene was excised from the pYES2.0 vector using Kpn I and Xho I and Sigafed into the Aspergillus expression vector pHD423 (Lassen et a/. , 2001 , Appl Environ Microbiol 67; 4701 -4707), a ρHD414 derivative with a Kpn ! site in the polylinker. The resuiting plasmid was designated pA2C486 (Figure 8). The nucleotide sequence (SEQ ID NO: 7} and deduced amino acid sequence (SEQ ID NO-. 8} of the CBS 494,95 ceiδb gene are shown in Figure 9. The coding sequence is 1290 bp inciuding the stop codon. The %G+C of the coding region of the gene is 56 0% G+C and the mature polypeptide coding region is 58.1%. The encoded predicted protein contains 429 amino acids. Using the Signal P program, version 3 (Nieisen et a/., 1997, supra), a signal peptide of 21 residues was predicted. The predicted mature protein contains 408 amino acids with a mαlecuiar mass of 43.1 kDa.
Analysis of the deduced amino acid sequence of the celSb gene with the lnterproscan program (Zdobnov and Apweiler, 2001, supra) showed that the CELSB protein contained the core sequence typical of a Famiiy 5 glycosyl hydrolase, extending from approximateSy amino acid residue 106 to residue 385 of the predicted mature polypeptide. The CEL5A protein also contained the sequence signature of a type f fungal cellulose binding domain {CBMS). This sequence signature known as Prosife pattern PS00562 (Sigrist et a/,, 2002, supra) was present from amino acid residue 7 to residue 34 of the predicted mature polypeptide.
A comparative pairwise global alignment of amino acid sequences was determined using the Needleman-Wunsch aigαrithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUtv162 matrix. The alignment showed that the deduced amino acid sequence of the CBS 495.95 gene encoding the CEL5A mature polypeptide shared 69% and 67% identity (excluding gaps) to the deduced amino acid sequences of two Family 5 glycosyl hydrolase proteins from Irpex lacteus and Tmmetes hirsuta, respectively (accession numbers Q5VV7K4 and Q75UV6, respectively).
Example 12: Expression of CEL5B from basidiomycete CBS 494.95 in Aspergillus oryzae Expression of the celδB gene from basidiomycete CBS 494.95: and analysis of endoglucanase activity was performed as described in Exampie 4. Example 13: Purification of recombinant endoglucanases from Myceliophthora thermophila CBS 117.65, basidiomycete CBS 494.95, and basidiomycete CBS 49S.9S The endoglucanases from Myceliophthora thermophila CBS 117,65, basidiomycete CBS 494.95, and basidiomycete CBS 495.95, produced recombinant^ in Aspergillus oryzae as described in Examples 4, 8, and 12, were purified to homogeneity using a protocol essentially as described by Gteen et al., 1999, Protein Sd. 8: 1878-87.
Protein concentration in the enzyme preparations was determined using the Biciπchoninic acid (BCA) Microplatβ Assay according to the manufacturer's instructions for a BCA Protein Assay Reagent Kit (Pierce Chemical Co., Rockford, IL, USA),
Enzyme dilutions were prepared fresh before each experiment from stock enzyme solutions, which were stored at -20'C
Example 14: Isolation of genomic DMA from Penicillium brasilianum IBT 20888
Spores of Penicilliurπ brasilianum strain IBT 20888 were propagated on rice according to Carlsen, 1994, Ph.D. thesis, Department of Biotechnology, The Technica! University of Denmark. The spores were recovered with 20 ml of 0.1% Tween 20 and inocuiated at a concentration of 1*106 spores per mi into 100 ml of Mandels and Weber medium (Mandels and Weber, 1969, Adv. Chem, Ser. 95: 394-414) containing 1% glucose supplemented per liter with 0.25 g of yeast extract and 0,75 g of Bactopepione in a 500 ml baffled shake flask. The fungal mycelia were harvested after 24 hours of aerobic growth at 3Q"C, 150 rpm.
Mycelia were collected by filtration through a Nalgene DS0281-5000 filter (Nalge Nunc Internationa! Corporation, Rochester, NY, USA) until dryness and frozen in iiqυid nitrogen. The frozen mycelia were ground to a powder in a dry ice chilled mortar and distributed to a screw-cap tube. The powder was suspended in a total volume of 40 ml of 50 mM CAPS (3-(cyciohexylamino)-1-propanesulfonic acid)-NaQH pH 11 buffer containing 0.5% lithium dodecyi suifate and 0.5 mM EDTA. The suspension was placed at 600C for 2 hours and periodicaily resuspended by inversion. To the suspension was added an equal volume of phenol.chloroform (1:1 v/v) neutralized with 0.1 M Tris base, and the tube was mixed on a rotating wheei at 370C for 2 hours. After centrifugation at 2500 rpm for 10 minutes in a Sorvall H 1000B rotor, the aqueous phase (top phase) was re-extracted again with phenoi:chloroform (1 :1 v/v) and centrifuged at 15,000 x g for 5 minutes. The aqueous phase from the second extraction was brought to 2.5 M ammonium acetate (stock 10 M) and placed at -20:;C until frozen. After thawing, the extract was centrifuged at 15,000 x g for 20 minutes in a coid rotor. The pellet (primarily rRNA) was discarded and the nucleic acids in the supernatant were precipitated by addition of 0.7 volumes of isopropano!. After centrifυgation at 15,000 x g for 15 minutes, the peϋet was rinsed three times with 5 ml of 70% ethanoi (without resuspension), air- dried almost completely, and dissolved in 1.0 ml of 0.1 X TE. The dissolved pellet was transferred to two 1 ,5 mi microfuges tubes. The nucleic acids were precipitated by addition of ammonium acetate (0.125 ml) to 2.0 M and ethanoi to 63% (1,07 ml) and centrifuged at maximum speed for 10 minutes in a Sorvall MC 12V microcentrifuge {Kendro Laboratory Products, Asheville, NC; USA). The pellet was rinsed twice with 70% ethanoi, air-dried completely, and dissolved in 500 μl of 0.1 X TE,
Example 15: Preparation of a genomic DMA library of Penicilltum brasilianum IBT 20888
Genomic libraries were constructed using a TOPO Shotgun Subcloning Kit (Invitrogen, Carlsbad, CA1 USA). Briefly, total ceSϊuSar DNA was sheared by nebulization under 10 psi nitrogen for 15 seconds and size-fractionated on 1% agarose gels using 40 mM Tris base-20 mM sodium acetate-1 mM disodium EDTA (TAE) buffer. DNA fragments migrating in the size range 3-6 kb were excised and eiuted using a
MiniElute™ Gel Extraction Kit (QiAGEN Inc. Valencia, CA, USA). The eiuted fragments were size-fractionated again using a 1% agarose gel as above and DNA fragments migrating in the size range 3-6 kb were excised and eiuted using a MiniESutβ™ Gel
Extraction Kit.
The eiuted DNA fragments were blunt end repaired and dephosphorylated using shrimp alkaline phosphatase (Roche Applied Science, Manheim, Germany). The blunt end DNA fragments were cloned into the pCR48!unt-TOPO vector (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions, transformed into eiectrocompetent E. coli TOP10 ceils by electroporation, and plated on LB ampiciiiin plates. The eiectroporation resulted in 15,300 clones.
Example 16: Purification of native CEL5C endoglucanase from Peniciflium brasifianum IBT 20888
The endoglucanase was purified and assayed as described in Jørgensen et a/., 2003 (Enzyme Mlcrob. Techno!. 32: 851-861). The substrate was azo-carboxymethy! ceiluiose (Megazyme international Ireland Ltd., Bray, ireiand) and the incubation time was 15 minutes. Purified enzyme was stored frozen at -2O0C. ExampJe 17: N-terminal sequencing of CELSC encloglucanase from Penfcillium brasiiianum JBT 20888
The purified sample of Peniάtiium bmsilianυm CEL5C endoglucanase (Example
16} was thawed. A 100 μl aliquot of the sample was added to 100 μ! of SDS-PAGE sample buffer (4 ml of 0.5 M TRIS-HCI, pH 6.8, 20 ml of 10% SDS1 20 ml of glycerol (87%), 56 ml of Milii-Q® υltrapure water, and 15 grains of bromophenoi blue) in an Eppendorf tube and heated to 95 :;C for 4 minutes. Following heating four 20 μl aiiquots of the diluted sample were applied separately to a precast 4-20% SDS poiyacrylamide gel (Invitrcgen, Carlsbad,
CA, USA), in addition to the four lanes containing the sample, a Mark 12 protein standard mixture (invitrogen, Carlsbad, CA, USA) was applied to the gel.
The gel was run in an Xcell SureLock™ gel apparatus (Invitrogen, Carlsbad, CA, USA) for 90 minutes with initial power settings of 40 mA at maximum 135 V. Following electrophoresis the gel was incubated for 5 minutes in a blotting solution consisting of 10 mM CAPS pH 11 containing 6% methanol. A PrøBløtt membrane (Applied Biosystems, Foster City, CA, USA) was wetted for 1 minute in pure methanol before being placed in the blotting solution for 5 minutes in order to saturate the membrane with 10 mM CAPS pH 11 containing 6% methanol.
Eiβctrobiotting was carried out in a Semi Dry Blotter Il apparatus (KemEnTec,
Copenhagen, DK) as follows. Six pieces of Whatman no. 1 paper wetted in the blotting solution were placed on the positive electrode of the blotting apparatus followed by the
ProBlott membrane, the polyacryiamide gel, and six pieces of Whatman no. 1 paper wetted in blotting solution. The blotting apparatus was assembled thereby putting the negative electrode in contact with the upper stack of Whatman no. 1 paper. A weight of 11.3 kg was placed on top of the blotting apparatus. The electroblotting was performed at a current of 175 mA for 180 minutes.
Following the electroblotting the ProBlott membrane was stained for 1 minute in
0,1% (w/v) Coomassie Brilliant Blue R-250 dissolved in 80% methanol, 1% acetic add,
39% H2O. Destaining of the ProBlott membrane was performed in 40% aqueous methanol for 5 minutes before the membrane was rinsed in deionized water. Finally the ProBlott membrane was air-dried.
For N-terminal amino add sequencing two pieces of the ProBlott membrane consisting of a 65 kDa band were cut out and placed in the blotting cartridge of an Applied
Biosystems Procise Protein Sequencer (Applied Biosystems, Foster City, CA, USA). The
N-terminaS sequencing was carried out using the method run file for PVDF membrane samples (Pulsed liquid PVDF) according to the manufacturer's instructions.
The N-terminal amino acid sequence was deduced from the resulting chromatograms by comparing the retention time of the peaks in the chromatograms to the retention times of the PTH-amino-acids in the standard chromatogram.
The N-termiπal amino acid sequence of the purified PeniciHium brasilianum
CEL5C endogSucanase was determined directly using a Precise 494 HT Sequencing System (Applied Biosystems, Foster City, CA1 USA). The N-terminal sequence was determined to be Ala-Ser-Ser-Phe-Val-Trp-Phe-Gly-Thr-Ser-Glu-Ser-Gly-Aia-G!u-Phe-
Gfy-Asn-Gin-Asn (amino acids 25 to 44 in SEQ SD NO: 10),
Example 18: PCR amplification of the cel5c endoglucanase gene from PeniciHium brasilianum JBT 20888
Based on the N-tβrminaS amino acid sequence of the purified Penicilliυtn brasiiianutn endogiucanase, a forward primer was designed using the CODEHOP strategy (Rose et a!., 1998, Nucleic Acids Res. 26: 1628-35). From database information on other endogiucanases, two reverse primers were designed as shown below using the CODEHOP strategy. Forward primer, Fwd:
5'-TTCGGTACCTCTGAGTCTGGNGCNGARTT-S* (SEQ SD NO: 11) Reverse primer, Rev1: 5'-TGATCCATATCGTGGTACTCGTTRTTNGTRTCRAA-S' (SEQ SD NO: 12) Reverse prtmer, Rβv2.
5'-CCGTTGTAGCGACCGTARTTRTGNGGRTC-S' (SEQ ID NO: 13) where R=A or G1 Y=C or T, K=G or T and N~A, C, G or T
Amplification reactions (30 μl) were prepared using approximately 1 μg of PeniciHium brasilianum genomic DNA as template, in addition, each reaction contained the following components: 30 pmol of the forward primer, 30 pmo! of the reverse primer, 200 μM each of dATP, dCTP, dGTP, and dTTP, 1X AmpliTaq poiymerase buffer (Applied Biosystems, Foster City, CA, USA), and 0.5 unit of AmpliTaq polymerase (5.0 U/μf , Applied Biosysterπs, Foster City, CA, USA). The reactions were incubated in a Robocycier (Stratagene, La JoiSa, CA, USA) programmed for 1 cycle at 96 °C for 3 minutes and at 72°C for 3 minutes; 34 cycles each at 95"C for 0.5 minute, 56°C for 0.5 minutes, and 72°C for 1.5 minutes; 1 cycle at 72°C for 7 minutes; and a soak cycle at 6X. Taq poiymerase was added at 72°C in the first cycle.
PCR reaction products were separated on a 2% agarose gel (Amresco, Solon, OH, USA) using TAE buffer. A band of approximateiy 650 bp (Fwd and Rev1 primers) and bands of approximateiy 320 and 380 bp (Fwd and Rev2 primers) were excised from the gei and purified using a MiniESute™ Gei Extraction Kit (QIAGEN Inc., Vaiencia, CA, USA) according to the manufacturer's instructions. The purified PCR products were subsequently analyzed by DNA sequencing. The 320 bp product was found to encode a portion of a glycosyl hydrolase Family 5 polypeptide that was designated CEL5C.
Example 19: Screening of genomic library of PenicWium bmsHianum JBT 20888
Colony Sifts of the library described in Example 15 were performed (Maniatis et a/., 1982, Molecular Cloning, A Laboratory Manual, Coid Spring Harbor Press, CoSd Spring Harbor, New York) and the DNA was cross-finked onto Hybond N+ membranes (Amersham, Arlington Heights, IL, USA) for 2 hours at 8O0C. The membranes from the coiony lifts were pre-wetted using 0.2X SSC (30 mM NaCI, 3 my sodium citrate), 0.2% SDS. The pre-wetted filters were placed in a beaker with 7.5 ml of 6X SSPE (0.9 M NaCI, O.Oβ M NaH2PO4, and 6 mM EDTA), 7% SDS) per filter at 680C in a shaking water bath for 30 minutes.
Approximately 40 ng of the PCR product described in Example 18 were random- primer labeled using a Stratagene Prime-It Ii Kit (Stratagene, La JoIIa, CA) according to the manufacturer's instructions. The radiolabeled gene fragment was separated from unincorporated nucleotide using a MinEluie PCR Purification Kit (QIAGEN Inc., Valencia, CA, USA).
The radioactive probe was denatured by adding 5.0 M NaOH to a final concentration of 0.5 M, and added to the hybridization solution at an activity of approximately 0.5 x 10β cpm per ml of hybridization solution. The mixture was incubated for 10 hours at 68*C in a shaking water bath. Following incubation, the membranes were washed three times in 0.2X SSC1 0.2% SDS at 68°C. The membranes were then dried on blotting paper for 15 minutes, wrapped in SaranWrap™, and exposed to X-ray film overnight at -80"C with intensifying screens (Kodak, Rochester, NY, USA),
Colonies producing hybridization signals with the probe were inoculated into 1 ml of LB ampiciiiin medium and cultivated overnight at 37"C, Dilutions of each solution were made and 100 μl were plated onto LB ampiciiiin plates. The dilution for each positive that produced about 40 colonies per plate was chosen for secondary lifts. The lifts were prepared, hybridized, and probed as above. Two colonies from each positive plate were inoculated into 3 ml of LB ampiciiiin medium and cultivated overnight at 37"C
Miniprep DNA was prepared from each colony using a Bio Robot 9600 (QIAGEN
Inc. Valencia, CA, USA) according to the manufacturer's protocol. The size of each insert was determined by Eco Rl restriction and agarose gel electrophoresis. Two clones each contained an approximately 5.5 kb insert. Sequencing revealed that the clones were identical, and they were hereafter referred to as pKKAHI (see Example 20),
Example 20: Characterization of the cefSc genomic sequence encoding the CELSC endogJucanase from Penicitllum bmsϊlianum IBT 20888
5 DNA sequencing of the Peniciilium brasiiianum βndoglucanase gene from pKKAHI was performed with an Applied Biosystems Model 3700 Automated DNA Sequencer (Applied Biosystems, Foster City, CA: USA) using the primer walking technique with dye-terminator chemistry (Giesecke et a/,, 1992, J. Virol, Methods 38: 47- 60).
10 The nucleotide sequence (SEQ ID NO: 9) and deduced amino acid sequence
(SEQ ID NO' 10} of the Peniciilium brasiiianum cβiδc gene are shown in Figures 10A and 108. The genomic coding sequence of 1471 bp (including stop codon) encodes a polypeptide of 421 amino actds, interrupted by 4 introns of 51 bp (89-139 bp), 47 bp (352-398 bp), 55 bp (464-518 bp), and 52 bp (617-668 bp). The %G+C content of the
] 5 coding region of the gene is 51.2% and the mature polypeptide coding region is 50.8%. Using the SignalP software program (Nieisen et a/., 1997, Protein Engineering 10: 1-6), a signal peptide of 16 residues was predicted. Based on the N-termina! sequence of the endoglucanase. residues 17 through 24 appear to constitute a pro-region that is proteoSytϊcaSly cleaved during maturation. The predicted mature protein contains 397 0 amino acids and has a predicted mass of 42.6 kDa.
Analysis of the deduced amino acid sequence of the cel5c gene with the lnterproscan program (Zdobnov and Apweiier, 2001 , supra) showed that the CEL5C protein contained the core sequence typical of a Family 5 glycosyl hydrolase, extending from approximately residues 32 to 307 of the predicted full-length polypeptide. The 5 CEL5C protein also contained the sequence signature of a type I fungal ceiSuiose binding domain (CBMi). This sequence signature known as Prosite pattern PS00562 (Sigrist et a/,, 2002« supra) was present from amino acid residue 393 to residue 420 of the predicted polypeptide.
A comparative pairwise globai alignment of amino acid sequences in public 0 databases was determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of EMBOSS with gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 matrix. The alignment showed that the deduced amino acid sequence of the Penicillium brasiiianum ceiSc gene encoding the CEL5C mature polypeptide shared 74.9% and 74.5% identity 5 (excluding gaps) to the deduced amino acid sequences of two predicted Family 5 glycosyl hydrolase proteins from Neosartorya fischeri and Aspergillus fumigatus, respectively (accession numbers A1 DAP? and Q4WMQ9, respectively).
Example 21 : Construction of an Aspergillus oryzae expression plasmid for the cel5c endoglucanase gene from Penicillium brasilianum IBT 20888
The Aspergillus expression plasmicl pJaL721 (WO 03/008575) consists of an expression cassette based on the Aspergillus niger neutral amylase Il promoter fused to the Aspergillus nictulans triose phosphate isomerase non-translated leader sequence (NA2-tρi) and the Aspergillus niger amySoglycosicSase terminator. Also present on the plasmicl is the selective marker amdS from Aspergillus nidulans enabling growth on acetamide as sole nitrogen source and the URA3 marker from Saccharomyces cemvlsiae enabling growth of the pyrF defective Escherichia coli strain DB6507 (ATCC 35673). Transformation into E. coli DB6507 was performed using the Saccharomyces cerevisiae U R A3 gene as selective marker as described below. E. coli DB6507 was made competent by the method of Mandei and Higa, 1970,
J. Mo/. Biol. 45: 154. Transformants were selected on solid M9 medium (J. Sambrαok, E F. Fritsch, and T. Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York) supplemented per Siter with 1 g of casamino acids, 500 μg of thiamine, and 10 mg of kanamycin. The endoglucanase gene was cloned into pJaL721 as described below. The cel5c endogiucanase gene from Pθnicllliυm brasilianum was amplified by PCR using the following two oligonucleotide primers: Forward PCR: 5'-AATTGGATCCACC ATG AAATACCCTCTACTCCTGGCA AC-3' (SEQ ID NO: 14) Reverse PCR:
5!~ TTAACTCGAGTTACAGACACTGCGAATAATACGCATTC-3' (SEQ ID NO: 15)
To facilitate cloning a restriction enzyme site was inserted into the 5! end of each primer where the forward primer contained a Bam HI site and the reverse primer contained an Xho I site. Genomic DNA prepared as in Example 14 was used as template in the PCR reaction. The reaction was performed in a volume of 50 μi containing 1.0 unit of Phusioπ (Finnzymes Oy, Espoo, Finland), 1X Phusion buffer HF (Finnzymes Oy, Espoo, Finland), 500 ng of genomic, 250 μM of each dNTP, and 50 pmoi of each of the two primers described above. The amplification was carried out in a PTC-220 DNA Engine Dyad Peltier Thermal Cycler (MJ Research, Inc., Waltham, MA, USA) programmed for 1 cycle at 95°C for 5 minutes; 24 cycles each at 94X for 0.5 minute, 58"C for 0.5 minute, and 880C for 4.0 minutes; and 1 cycle at 68°C for 15 minutes. The hot start PCR technique (Chou et a/,, 1992, Nucleic Acids Res, 20: 1717} was used and the Phusion polymerase was added after 1 minute of the first cycle.
The PCR reaction produced a single DNA fragment of approximately 1500 bp in length. The fragment was digested with Bam Hl and Xho I and isolated by agarose gel electrophoresis, purified, and cloned into ρJaL721 digested with Bam Hi and Xho i, resulting in a plasmid designated pKBK03 (Figure 11). The sequence of the endoglucanase gene in pKBKOS was verified by sequencing with an Applied θiosystems 373OxI DNA Analyzer. In order to create a plasmid for deposit of biological material, ρKBK03 was digested with Bam Hi and Xho I and purified. The fragment was blunt end repaired using Klenow enzyme (Roche Applied Science, Manheim, Germany) for 30 minutes at 25X. Plasmid pUC13 was digested with Sma i and dephosphoryiated with Calf Intestina! Protease (Roche Applied Science, Manhβim, Germany; CIP) for 1 hour at 37"C and the ClP was inactivated by heating the sample to 8(TC for 15 minutes.
The blunt end repaired fragment and the dephosphoryiated pUC13 fragment were Sigatβd overnight at 16°C using T4 DNA ligase (Roche Applied Science, Manheim, Germany). A 0.25 μg sample of the iigated product was transformed into Escherichia coii DH5α (Invitrogen, Carisbad, CA, USA). After incubation overnight at 370C on LB ampicϊilin piates, transformants were transferred to 2 ml of LB medium and incubated at 37"C. A plasmid designated pPBCelδC (Figure 12) was purified using Jetquick. Plasmid Miniprep (Genomed, Lohne, Germany). The sequence of the endoglucanase gene was verified by sequencing with an Applied Biosystems 373OxI ONA Analyzer. E. coil TOP10 cells (Invitrogen, Carlsbad, CA) containing piasmid pPBCelδC (strain designation PBCeISC) were deposited with the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center, 1815 University Street, Peoria, Illinois, 61604, as NRRL B-30900N, with a deposit date of Febraury 23, 2006.
Example 22: Expression of the Penicillium brasiiianum IBT 20888 CEL5C endogSucanase in Aspergillus oryzae
Aspergillus oryzae BECh2 (WO 00/30322} was transformed with 5 μg of pKBKOS as described by Christensen et al., 1988, Biotechnology 6: 1419-1422.
Transformants were cultivated in 50 ml tubes for 4 days at 3O0C in 10 ml of YPM medium. The whole broths were centrifuged at 12,100 x g and the supernatants removed. The supernatants were analyzed by SDS-PAGE using a Criterion XT Precast
Gel, 10% Bis-Tris gel in a XT MES buffer (BioRad Laboratories, Hercules, CA, USA) according to the manufacturer's instructions. A 10 μl volume of supernatant was mixed with 9 μl of sample buffer (0.125 M Tris-HCI pH 8,8, 20% glycerol, and 4.6% SDS). and 1 μl of 1 M dithiothreitol, and heated to 96:;C for 5 minutes, in 16 out of 20 supernatants, one band of approximately 65 kDa was visible in the range of the standards 35 kDa to 150 kDa by SDS-PAGE. The supernatants resuiting in a visible band after SDS-PAGE also contained endogiucanase activity, assayed as described in Example 3. The higher the intensity of the band, the higher endogiucanase activity measured in the same supernatant.
One transformant was designated Aspergillus oryzae KBK03.
Example 23: Production and purification of recombinant PenicHltum brasilianυm JBT 20888 CEL5C endogiucanase
Aspergillus oryzae transformant KBK03 was grown in twenty 500 ml shake fiasks with 200 ml of YPM medium. The biomass was removed from 4.0 liters of fermentation broth by centrifυgation and filtration. SDS-PAGE analysis was performed as described in Exampie 9. The endogiucanase solution was ioaded onto a XK 50 column (Arnersham Biosciences, Uppsaia, Sweden) containing 110 g of Avicel Ph 101 (Merck KGaA1 Darmstadt, Germany) pre-equilibrated with 25 mM Tris pH 7.5 prior to loading and the bound enzyme was eluted with 25 mM Tris, 1% triethanoiamine at pH 11.6. Elυtion of the endogiucanase was monitored at 280 nm. The eiuted protein containing fractions were pooled immediately and the pH adjusted to 7.5, Fractions containing the endogiucanase were pooied.
The protein content was determined from the absorbance at 280 nm and the extinction coefficient caiculated from the primary structure of the endogiucanase.
The purification was foiiowed by SDS-PAGE. The samples were boiled for 2 minutes with an equa! volume of 2X sample buffer and 1/5 volume of 1% PMSF and ioaded onto a 4-20% Tris-glycine ge! (Invitrogen, Carisbad, CA, USA). The ge! was stained with GelCode BSue Stain Reagent (Pierce, Rockford, il_, USA) and destained with water. SDS-PAGE reveaied one band of approximately 65 kDa.
Example 24: Characterization of purified recombinant PenicHltum brasth'anum JBT 20888 CEL5C endogiucanase
The purified recombinant PenicHlium brasiliaπum CEL5C endαgiucanasβ described in Example 23 was characterized with regard to pH optimum, temperature optimum, and temperature stability. The endogiucanase activity was measured as described in Example 16 at temperatures from 200C to 8Q*C and at pH values of 3.0 to 10 0. The purified βndogiucanasβ was diluted in Milli-Q® ultrapure water (Millipore. Billerica, MA, USA) to ensure that activity was within the standard curve. For the pH optimum, the substrate was dissolved in Britton- Robinson buffer (50 mM boric acid, 50 5 mM acetic acid, 50 mM phosphoric acid) adjusted to the desired pH, The temperature stability was determined for 20 hours at 500C in the pH range from 4.0 to 6.0. Al! experimenta! assays were performed in duplicate.
The results of the pH optimum determination is shown in Figure 13. The optimum pH was ciose to 4 0 at 5G"C with very little activity at pH 3.0 and approximately ] 0 80% of peak activity at pH 5.0.
The results of the temperature optimum determination is shown in Figure 14. The temperature optimum at pH 4.8 was approximately ?0ήC with more than 75% of peak activity from 604 C to 800C.
The results of the temperature stabiiity determination is shown in Figure 15. 15 When pre-incubated in the absence of substrate for 20 hours at 25'C and 5O0C in the pH range from 4,0 to 6,0, the endoglucanase retained more than 80% of its starting activity.
ExampJe 25: Preparation of substrates 0 Pretreated corn stover (PCS) was prepared by the U.S. Department of Energy
National Renewabie Energy Laboratory (NREL) using diiute suifuric acid. The following conditions were used for the pretreatment: 1.4 wt % suifuric acid at 1650C and 107 psi for 8 minutes Compositionai analysis was performed at NREL Ceiiuiose and hemiceiiuiαse were determined by a two-stage sulfuric acid hydrolysis with subsequent 5 anaiysis of sugars by high performance liquid chromatography (HPLC) using NREL Standard Analytical Procedure #002. Lignin was determined gravimetrically after hydrolyzing the ceiiuiose and hemicelSulose fractions with suifuric acid (NREL Standard Anaiyticai Procedure #003). Water-insoiubie solids in the pretreated corn stover (PCS) were determined to be 56.5% ce!iu!ose: 4.6% hemicellulose, and 28.4% iignin. 0 The PCS was washed with large volume of deionized water on a Kimax funnel with a glass filter of coarse porosity (Fisher Scientific, Pittsbυrg, PA, USA). Water- washed PCS was miiied in a coffee grinder and additionally washed with deionized water on a 22 μm IVIiSiipore Filter with a 6P Express Membrane {Millipore, Bedford, MA, USA). Dry weight of the milled PCS was 32,4%. 5 A 10 mg/ml stock suspension of phosphoric acid-swollen ceiiuiose (PASC) in deionized water was prepared using the following procedure. One hundred and fifty ml of ice-cold 85% ø-phosphoric acid was added to 5 g of Avicei PH101 (PMC Corp., Philadelphia. PA, USA) moistened with water. The suspension was siowly stirred in an ice bath for one hour, and 100 ml of ice-cold acetone was added to the suspension at constant stirring. The slurry was transferred to a Kimax funnel with a glass filter of coarse porosity, washed three times with 100 ml of ice-cold acetone, and drained as compieteiy as possible after each wash, Finally, the slurry was washed twice with 500 ml of water, and again drained as completely as possible after each wash. The PASC was mixed with water to a total volume of 500 mi. Sodium azide was added to a fina! concentration of 0.02% to prevent microbiai growth. The slurry was homogenized using a blender and stored at 40C for up to one month.
Carboxymβthylcelϊυiose (CMC, sodium sait, type 7L2) with an average degree of substitution (DS) of 0.7 was obtained from Aquaion Division of Hercules Inc., Wilmington, DE, USA. A 6.25 mg/ml solution of CMC in 50 mM sodium acetate pH 5.0 was prepared by slowly adding CMC to the vigorously agitated buffer. The slurry was heated to approximately 800C under continuous stirring until the CMC was completely dissolved
Bacterial cellulose (BC) was prepared from Nata de Coco, a food-grade commercial cellulose (Fujicco Co., Kobe, Japan), as described in Boissef øt a/., 1999, Biochemical Journal, 340: 829-835. A 1 mg/ml suspension of bacterial cellulose in deionized water with 0.01 % (w/v) sodium azide was stored at 40C.
Avicei PH 101 was obtained from FMC Corporation, Philadelphia, PA, USA. Xylan from birchwood was obtained from Sigma, St. Louis, MO, USA. Xylogiucan from Tamarind seed (amyloid, lot 00401), wheat arabinoxylan (medium viscosity, 27 cSt, lot 90601), 1,4-beta-D-mannan (borohydride reduced, Man;Gal~97;3, degree of polymerization DP - 15, lot 90302), and carob galactomannan (low viscosity, borohydride reduced, iot 90301) were obtained from Megazyme, Bray, ireland.
Example 26: p-Hydroxybenzoic acid hydrazide assay for determination of reducing sugars Reducing sugars (RS) were determined by a p-hydroxybenzoic acid hydrazide
(PHBAH) assay (Lever, 1972, Ami. Biochem. 47: 273-279), which was adapted to a 96- well microplate format.
A 90-μl aliquot of the diluted sample was placed into each well of a 96-wel! conical-bottomed microplate (Costa r, clear polycarbonate, Corning inc., Acton, MA, USA), The assay was initiated by adding 60 μl of 1.25% PHBAH in 2% sodium hydroxide to each well. The uncovered plate was heated on a custom-made heating block for 10 minutes at 950C. Following heating, the rnicroplatβ was cooled to room temperature, and 35 μl of deionizβd water was added to each well. A 100 μl aliquot was removed from each well and transferred to a fiat- bottomed 96-well plate (Costar, medium binding polystyrene, Corning inc., Acton, MA, USA). The absorbance at 410 nm (A410) was measured using a SpectraMAX Microplate Reader (Molecular Devices, Sunnyvale, CA, USA). The A410 value was translated into gSucøse eqυivaients using a standard curve.
The standard curve was obtained with six glucose standards (0.005, 0.010, 0.025, 0.050, 0 075, and 0.100 mg/ml), which were treated simiiarly to the sampSes. Glucose standards were prepared by diluting 10 mg/mS stock glucose soiution with dβionizβd water.
For all substrates except for xylan and arabinoxylan, the degree of conversion {%) was calculated using the following equation:
Conversion m - RS {mimi) x 100 x 162 / {initial substrate concentration mψmf} x 180) = RS {mg;mf) x 100 / (I nitial substrate concentration imιm x 1.111)
For xyian and arabinoxylan, percent of substrate hydrolyzed to RS was calculated using the following equation; Conversion w = RS {mψmi) x 100 x 132 / (initial substrate concentration (m,mi) x 150) =
RS (tngrø) x 100 / (Initial substrate concentration im<mf) x 1.138) In these equations, RS is the concentration of reducing sugars in solution measured in glucose equivalents (mg/ml), and the factors 1,111 and 1.136 reflect the weight gain in converting corresponding polysaccharides to hexose (MVV 180) or pentose (MW 150) sugars.
Example 27: Relative activity of endoglucanases on carboxymethyl-cellulose at 50°C
Table 1 shows the relative activity of the purified endoglucanases from Myceliophthora thermophila CBS 117.85, basidiomycete C8S 494.95, and basidiomycete CBS 495.95 toward the soluble sodium salt of carboxymethylceSiuiose (CMC). The reiative activity is shown as percentage of the activity of basidiomycete CBS 495.95 endogiucanase. The activity was determined by measuring the concentration of reducing sugars (RS) produced from CMC (5 mg/ml} after 30 minutes of hydrolysis in 50 mfvi sodium acetate pH 5.0 at 50cC. Hydrolysis was carried out without stirring in the presence of 0.5 mg/ml bovine serum albumin (BSA, Sigma, St. Louis, MO, USA). Reducing sugars were determined using p-hydroxybenzoic acid hydrazide (PHBAH) assay described in Example 26.
Figure imgf000084_0002
Example 28: Thermal stability of endoglucanases at 400C-SO0C
The thermal stability of the purified endoglucanases from Myceliαpfrthona thermophila CBS 117.65, basidiomycete CBS 494.95, and basidiomycete C8S 495.95 was determined by incubating enzyme solutions at five temperatures (4Q0C, 500C, 600C, 700C1 and 8O0C), and measuring the residual activity of enzymes on carboxymethylceilulose (CMC).
The enzymes were diluted in 50 mM sodium acetate pH 5.0, which contained 3.0 mg/ml BSA, and incubated for 3 hours in 1.1-rnl ImmunoWare Microtubes arranged in an 8x12 micropSate format (Pierce, Rockford, IL, USA), BSA was added in order to prevent possibie enzyme adsorption onto the pSastic walls of microtubes. The protein concentration in the incubation mixtures was chosen so that each enzyme would give less than 1% conversion of CMC in subsequent assay for CMCase activity.
After a 3 hour incubation, 15 μl aiiquots were removed using an 8-channel pipettor, and added to 75 μ! of CMC solution (6 mg/ml in 50 mM sodium acetate pH 5.0) in a 36-weSi conical- bottomed microplate (Costar, clear polycarbonate, Corning inc., Acton, MA, USA). The residua! CMCase activity was then measured as described in Example 27, and expressed as a percentage of the initiai CMCase activity (Table 2).
At 40*C and 500C, all three endoglucanases were stable and retained 98-100% of the initial CMCase activity after 3 hours of incubation. At 600C and 7O0C, the Myceliophthora thermophila Cel5A showed better stability than the two other endoglucanases, and retained 100% and 49.3% of the initial CMCase activity after a 3- hour incubation, respectively. None of the endoglucanases were stable at 8O0C.
Figure imgf000084_0001
Figure imgf000085_0001
Example 29: Relative activity of endoglucanases on phosphoric acid-swollen cellulose at 40-70°C
The activity of the purified encSoglucanases from basidiomycete CBS 494.95 and basidiomycete CBS 495.95 on phosphoric acid-swolien cellulose (PASC) was determined by measuring the concentration of the reducing sugars (RS) reieased during initial hydrolysis of PASC (2 mg/ml) in 50 mM sodium acetate pH 5.0. Hydrolysis was carried out without stirring in the presence of 0.5 mg/ml bovine serum aibumin (BSA, Sigma, St Louis, MO, USA). The enzymes were diluted so that the RS concentration would increase linearly during the initial 30 to 90 minutes of hydrolysis, and the degree of PASC conversion would not exceed 2% during this time. Reducing sugars were determined using the p-hydroxybenzoic acid hydrazide (PHBAH) assay as described in Example 26.
The relative activity as a function of temperature of the endoglucanases from basidiomycete CBS 494.95 and bastdiomycβte CBS 495 95 is shown in Figure 16. The activity is shown as percentage of the activity of the endoglucanase from basidiomycete CBS 495.95 at 6O0C, For both endogiucanases, the activity on PASC attained the maximum value at T opt = 600C.
Example 30: Long-term hydrolysis of phosphoric acid-swoϊlen cellulose at 40- 700C
Hydrolysis of phosphoric acid-swollen celluSose (PASC, 2 mg/ml) by the purified endoglucanases from basidiomycete CBS 494.95 and basidiomycete CBS 495.95 was carried out for 45 hours in 50 mM sodium acetate pH 5.0 containing 0.5 mg/ml BSA at four temperatures, 4O0C, 5Q°C, 600C, and 700C, The endoglucanases were used at three protein loadings, 0.056, 0.167, or 0,5 mg per g of PASC. The reactions with the initial volume of 1 ml were run without stirring in 1.1-mi ImmunoWare Microtubes arranged in an 8x12 microplate format (Pierce, Rockford. IL. USA).
One hundred microliter aliquots were removed from the reactions at different time points (1, 1.5, 3, δ, 21, 27, and 45 hours) using an 8-channei pipettor, and added to 25 μi of 2% NaOH in Multiscreen HV 96-well filtration plate (Miilipore, Bedford, MA, USA). The collected samples were vacuum-filtered into a flat-bottomed microplate to remove the PASC residue. The filtrates were analyzed for reducing sugars by the p- hydrcxybβnzoic acid hydrazide (PHBAH) assay as described in Example 28.
Figure 17 shows the relative conversion of PASC after a 45 hour incubation with the endoglucanases from basidiomycete CBS 494.95 and basidiomycete CBS 495.95 (0.5 mg protein per g of PASC) as a function of temperature. The relative conversion is shown as a percentage of the conversion obtained after 45-hour incubation with basidiomycete CBS 495,95 at 50"1C. Temperature profiies obtained at two other protein loadings, 0.056 and 0.167 mg protein per g of PASC, had similar shapes. For both endoglucanases, the optimal temperature for iong-term hydrolysis of PASC was 50°C.
Example 31 : Characterization of endoglucanases on various polysaccharide substrates at 500C
The purified endogiucanases from Myceliophthora thermophila CBS 117,65, basidiomycete C8S 494.95, and basidiomycete CBS 495.95 were evaluated in the hydrolysis of various polysaccharides at pH 5.0 (50 my sodium acetate buffer) and 500C. The resuits were compared with those for recombinant Tάchoderma reesβi Ce!7B (EGi) endoglucanase. Recombinant Trichodβrma reesei CeIZB (EGi) endogiucanase produced by Aspergillus oiγme can be prepared according to Takashima ef at., 1998, Journal of Bacteriology 65: 163- 171.
The polysaccharides included pretreated corn stover (PCS), phosphoric acid- swollen cellulose (PASC)1 carboxymethylceliulose (CMC), bacterial cellulose (BC), Avicei, xyian, xylcgiucaα arabinoxyian, mannan and gaiactomannan. AIi substrates were used at 5 mg/roS, with the exception of bacterial cellulose, which was used at 0.9 mg/mi.
Reactions with an initial volume of 1 mi were carried out for 24 hours with intermittent stirring in Eppendorf 96 DeepWeil Plates (1.2 ml, VVVR Scientific, West Chester, PA, USA) capped with Eppendorf 96 DeepWeil Mats (VWR Scientific, West Chester, PA1 USA). Unless otherwise specified, the enzymes were loaded at 5 mg of protein per g of solids.
After 24 hours, 20 μl aliquots were removed from the hydrolysis reactions using an 8~channel pipβttor, and added to 180 μi of 102 mM Na2CO3- 58 mM NaHCO3) in a MultiScreen HV 9θ-we!i filtration plate (Miiiipore, Bedford, MA, USA) to terminate the hydrolysis. The samples were vacuum-filtered into a flat-bottomed microplatβ. After appropriate diiution, the filtrates were analyzed for reducing sugars using the p- hydroxybenzoic acid hydrazide (PHBAH) assay as described in Example 26. Table 3 shows relative conversion of various polysaccharides by the endoglucanases after 24-hour incubation. The relative conversion was calculated as a percentage of conversion obtained after 24-hour hydrofysss of 1 ,4-β-D-mannan by bassdiomyceiβ CBS 495.95 CeISA endogiucanase. Endoglucanases from glycoside hydrolase (GH) family 5 had relativβiy high activity on maπnan and gaiactomanπan, but iow activity on xylan, xylogiuean and arabinoxylan, in contrast Trichoderma reesei Cel7B had relaiiveiy high activity on xyian, xyioglucan and arabinoxylan, but iow activity on manna n and galactomannan. The GH5 endogiucanases showed better hydrolysis of PASC (insoluble unsubsfituted amorphous ceiiuSose) than CMC (soluble substituted ceiluiose derivative). The GH5 endogiucanases had low activity on insolubie substrates with high degree of crystaSlinity: bacterial ceiluiose, Avicei, and PCS
Figure imgf000087_0001
"All endoglucanases were used at 0.25 mg protein per g solids for hyclroiysis of PASC and CMC
Example 32: Hydrolysis of soluble beta-glucan from barley by endoglucanases at 600C The activity of the endogSucanases from Myceliophthora thertnophila CBS 117.65, basidiomycete CBS 494.95, and basidiomycete CBS 495.95 on soluble beta- glυcaπ from barley (medium viscosity, 230 kDa, Megazyme Internationa! ireiand Ltd., Bray, Ireland) was determined at pH 5.5 (50 mM sodium acetate with 0.02% sodtum 5 azide) and 60' C. The results were compared with those for Tάchoderma mesθi Ce!7B (EGI) endoglυcaπase. Recombinant Trichoderma reesei Cel78 (EG!) endogiucanase can be prepared as described in Exam pie 31.
The initial concentration of beta-giucan in the hydrolysis reactions was 1 0%
(w/v) One mi reactions were run without stirring in Eppendorf 96 DeepWeli Plates (1.2
I O mi, VWR Scientific, West Chester, PA, USA), The enzymes were used at three protein ioadings, 0 05, 0.1. and G 2 ring per g of giucan. In a buffer controi, the endoglucanases were substituted with 50 mM sodium acetate pH 5.5 containing 0.02% sodium azide.
Aliquots were removed from the hydrolysis reactions at 2 hours and 24 hours, diiuted with deionized water, and anaiyzed for reducing sugars using the p-
15 hydroxybenzoic acid hydrazide (PHBAH) assay as described in Example 28. The relative conversion of beta-glucan as a function of protein loading at two incubation times, 2 hours and 24 hours, ts shown in Figures 18 and 19, respectively. The relative conversion is shown as a percentage of conversion obtained after 24 hour hydroiysis of beta-giucan by Myceliophthora thermophiia C8S 117.65 CeISA endogiucanase (0.2 mg 0 protein per g of giucan).
The endoglucanases from basidiomycete CBS 494,95 and basidiomycete CBS 495.95 showed similar performance in hydralyzing beta-giucan, and produced no additionai increase in reducing sugar concentration after 2 hour hydroiysis. In contrast the endoglucanases from Myceliophthora thermophiia and Trichoderma reesei 5 continued to produce new reducing end-groups beyond the 2 hour incubation time. The Myceliophthora thermophiia endogiucanase showed better performance in hydroiyzing beta-giucan than the basidiomycete CBS 494.95 CeiSB endogiucanase and basidiomycete CBS 495.95 CeiδA endogiucanase.
0 Deposit of Biological Material
The following biological materials have been deposited under the terms of the Budapest Treaty with the Agricultura! Research Service Patent Culture Collection, Northern Regionai Research Center, 1815 University Street, Peoria, liiinois, 61604, and 5 given the following accession numbers:
Deposit Accession Number Date of Deposit B. coli strain PBCeSSC NRRL 8-30900N February 23, 2006
B. coli strain pCiC161 NRRL 8-30902 February 23, 2006
E. coll strain pCSC453 NRRL B-30903 February 23, 2006
E, cob strain pC!C486 NRRL B-30904 February 23, 2006
The strains have been deposited under conditions that assure that access to the cuitures wil! be available during the pendency of this patent appiication to one determined by the Commissioner of Patents and Trademarks to be entitied thereto under 37 CF. R. §1.14 and 35 U.S.C. §122. The deposits represent substantially pure cultures of the deposited strains. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny are filed. However, it shouid be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.
The invention described and claimed herein is not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of severa! aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein wiil become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims, In the case of conflict, the present disclosure including definitions will control.
Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.

Claims

ClaimsWhat is claimed is;
1. An isolated polypeptide having βndoglucanase activity, selected from the group consisting of.
{a} a polypeptide comprising an amino acid sequence which has at least 80% identity with the mature polypeptide of SEQ ID NO: 4 or SEQ ID NO: 10, at least 85% identity with the mature polypeptide of SEQ IO NQ: 6, or at least 75% identity with the mature polypeptide of SEQ ID NO: 8;
(b) a polypeptide which is encoded by a polynucleotide which hybridizes under at least high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, (it) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NQ: 3 or SEQ ID NO: 9 or the genomic DMA sequence comprising the mature polypeptide coding sequence of SEQ ID NQ: 5 or SEQ ID NO: 7, or (iii) a fuii-Sength complementary strand of (i) or (ii);
(c) a polypeptide which is encoded by a polynucleotide having at least 80% identity with the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO; 9, at least 85% identity with the mature polypeptide coding sequence of SEQ ID NO: 5r or at least 75% identity with the mature polypeptide coding sequence of SEQ ID NO: 7; and
(d) a variant comprising a substitution, deletion, and/or insertion of one or more amino acids of the mature polypeptide of SEQ ID NO: 4 SEQ !D NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10.
2, The polypeptide of claim 1, comprising an amino acid sequence which has preferably at least 80% identity, more preferably at least 85% identity, even more preferably at least 90% identity, and most preferably at least 95% identity with the mature polypeptide of SEQ ID NO: 4; an amino acid sequence which has preferably at ieast 85% identity, more preferably at least 90% identity, and most preferably at least 95% identity with the mature polypeptide of SEQ ID NO: 6; an amino acid sequence which has preferably at least 75% identity, more preferably at least 80% identity, even more preferably at least 85% identity, most preferably at least 90% identity, and even most preferably at least 95% identity with the mature polypeptide of SEQ ID NO: 8; or an amino acid sequence which has preferably at least 80% identity, more preferably at least 85% identity, even more preferably at least 90% identity, and most preferably at least 95% identity with the mature polypeptide of SEQ SD NO; 10,
3. The polypeptide of claim 1, which comprises or consists of the amino acid sequence of SEQ ID NQ: 4, SEQ iD NQ: 8, SEQ ID NO: 8, or SEQ ID NQ: 10; or a fragment thereof having endoglucanase activity.
4. The polypeptide of claim 3, which comprises or consists of the amino acid sequence of SEQ ID NO: 4; SEQ iD NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10.
5. The poiypeptide of claim 3, which comprises or consists of the mature polypeptide of SEQ SD NO: 4, SEQ ID NO: 6, SEQ iD NO: 8, or SEQ ID NO: 10.
6. The polypeptide of claim 1, which is encoded by a polynucleotide which hybridizes under at least high stringency conditions with (i) the mature polypeptide coding sequence of SEQ iD NO: 3, SEQ iD NO: 5, SEQ !D NO: 7, or SEQ ID NO: 9t (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ iD NO: 5 or SEQ ID NO: 7, or (iii) a complementary strand of (t) or (ii).
7. The polypeptide of claim 1 which is encoded by a polynucleotide having preferably at least 80% identity, more preferabSy at least 85% identity, even more preferably at Seast 90% identity, and most preferably at least 95% identity with the mature poiypeptide coding sequence of SEQ ID NO: 3; a polynucleotide having preferably at least 85% identity, more preferably at least 90% identity, and most preferably at ieast 95% identity with the mature polypeptide coding sequence of SEQ ID NO; 5; a polynucleotide having preferably at least 75% identity, more preferabiy at least 80% identity, even more preferably at ieast 85% identity, most preferably at least 90% identity, and even most preferably at least 95% identity with the mature poiypeptide coding sequence of SEQ ID NO: 7; or a polynucleotide having preferably at least 80% identity, more preferably at least 85% identity, even more preferably at least 90% identity, and most preferably at least 95% identity with the mature polypeptide coding sequence of SEQ ID NO: 9.
8. The polypeptide of claim 1, which is encoded by a polynucleotide comprising or consisting of SEQ ID NO; 3, SEQ ID NO: 5, SEQ ID NQ; 7, or SEQ ID NQ: 9; or a subsequence thereof which encodes a polypeptide fragment having endogSucanase activity.
9, The polypeptide of claim 8, which is encoded by a poiynucleotide comprising or consisting of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9.
10. The polypeptide of claim 8, which is encoded by a poiynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ SD NQ: 3; SEQ ID NO: 5t SEQ ID NO: 7, or SEQ ID NO: 9.
11. The polypeptide of claim 1, wherein the polypeptide is a variant comprising a substitution, deletion, and/or insertion of one or more amino acids of the mature polypeptide of SEQ ID NO: 4 SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10.
12. The polypeptide of claim 1 , which is encoded by the polynucleotide contained in plasmid pC!C161 which is contained in £ coli NRRL B-30902, pC!C453 which is contained in E. coii NRRL B-30903, pCIC486 which is contained in E coli NRRL B- 30904, or pPBCelδC which is contained in E coli NRRL B-30900N.
13. The polypeptide of claim 1« 2, 5, or 11« wherein the mature polypeptide is amino acids 17 to 389 of SEQ ID NQ: 4, amino acids 16 to 397 of SEQ ID NO: 6, amino acids 22 to 429 of SEQ ID NO: 8, or amino acids 25 to 421 of SEQ ID NO: 10.
14. The polypeptide of claim 1« 6, 7, or 10, wherein the mature polypeptide coding sequence is nucleotides 67 to 1185 of SEQ ID NO: 3, nucleotides 84 to 1229 of SEQ ID NO; 5, nucleotides 77 to 1300 of SEQ ID NQ: 7, or nucleotides 73 to 1488 of SEQ ID NO; 9.
15. The polypeptide of any of claims 1-14, further having enzyme activity toward one or more substrates selected from the group consisting of xyian, xyioglυcan, arabinoxylan. 1,4-beta-D-mannan, and galactomannan.
16. An isolated polynucleotide comprising a nucleotide sequence which encodes the polypeptide of any of claims 1-15.
17. The isolated polynucleotide of claim 18, comprising at least one mutation in the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ SD NO: 5, SEQ ID NO: 7, or SEQ SD NQ: 9, in which the mutant nucleotide sequence encodes the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ SD NO: 8, or SEQ ID NO: 1O1 respectively.
18. A nucleic acid construct comprising the polynucleotide of claim 16 or 17 operably linked to one or more control sequences that direct the production of the polypeptide in an expression host.
19 A recombinant expression vector comprising the nucleic acid construct of claim 18.
20. A recombinant host ceS! comprising the nυcieic acid construct of claim 18.
21. A method for producing the polypeptide of any of claims 1-15 comprising: (a) cultivating a cell, which in its wild-type form is capable of producing the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
22. A method for producing the polypeptide of any of claims 1-15 comprising: (a) cultivating a host cell comprising a nucleic acid construct comprising a nucleotide sequence encoding the polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
23. A method for producing a mutant of a parent ce!!: which comprises disrupting or deleting a nucleotide sequence encoding the polypeptide of any of claims 1-15, which results in the mutant producing less of the polypeptide than the parent cell.
24. A mutant cell produced by the method of claim 23.
25. The mutant cell of claim 24, which further comprises a gene encoding a native or heterologous protein.
26. A method for producing a protein comprising; (a) cultivating the mutant celi of claim 25 under conditions conducive for production of the protein; and (b) recovering the protein.
27. An isolated polynucleotide obtained by (a) hybridizing a population of DNA under at least high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NQ: 5, SEQ ID NO: 7, or SEQ ID NO: 9, (si) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ SD NO: 3 or SEQ ID NO: 9 or the genomic DNA sequence comprising the mature polypeptide coding sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or (iii) a complementary strand of (i) or (ii); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having endoglucanase activity.
28. The isolated polynucleotide of claim 27, wherein the mature polypeptide coding sequence is nucieotides 67 to 1185 of SEQ iD NO: S1 nucleotides 84 to 1229 of SEQ ID NO: 5, nucleotides 77 to 1300 of SEQ ID NO: 7r or nucleotides 73 to 1468 of SEQ ID NO: 9.
2Θ. A method for producing a polynucleotide comprising a mutant nucleotide sequence, comprising: (a) introducing at least one mutation into the mature polypeptide coding sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, wherein the mutant nucleotide sequence encodes a polypeptide consisting of the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10; and (b) recovering the polynucleotide comprising the mutant nucleotide sequence,
30. The method of claim 29, wherein the mature polypeptide coding sequence is nucieotides 67 to 1185 of SEQ ID NO: 3, nucleotides 84 to 1229 of SEQ ID NO: 5, nucleotides 77 to 1300 of SEQ SD NO: 7, or nucleotides 73 to 1468 of SEQ ID NO: 9.
31. A mutant polynucleotide produced by the method of claim 29 or 30.
32. A method for producing a polypeptide, comprising: (a) cultivating a cell comprising the mutant polynucleotide of ciaim 31 encoding the polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
33. A nucleic acid construct comprising a gene encoding a protein operably linked to one or both of a first nucleotide sequence encoding a signal peptide comprising or consisting of amino acids 1 to 17 of SEQ ID NO: 4, amino acids 1 to 15 of SEQ ID NO: 6, amino acids 1 to 21 of SEQ ID NO: 8, or amino acids 1 to 16 of SEQ ID NO: 10, and a second nucleotide sequence encoding a propeptide comprising or consisting of amino acids 17 to 24 of SEQ SD NO: 10, wherein the gene is foreign to the nucleotide sequence.
34. A recombinant expression vector comprising the nucleic acid construct of claim 33.
35, A recombinant host cell comprising the nucleic acid construct of eiaim 33.
36. A method for producing a protein comprising: (a) cultivating the recombinant host ceil of claim 35 under conditions conducive for production of the protein; and (b) recovering the protein.
37. A method for producing the polypeptide of any of claims 1-15, comprising: (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding a polypeptide having endoglucanase activity under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
38. A transgenic plant, plant part or plant cell, which has been transformed with a polynucleotide encoding the polypeptide of any of claims 1-15,
3Θ. A method of degrading or converting a celluiosic material, comprising: treating the ceiiulosic materia! with a composition comprising an effective amount of a polypeptide having endoglucanase activity of any of claims 1-15,
40. The method of claim 39, wherein the composition further comprises an effective amount of an endo-1,4-beta-g!ucanase, βxo-1,4-beta-D-glucanasβ, and/or beta-D- glucosidase.
41. The method of ciaim 39 or 40, wherein the composition further comprises an effective amount of one or more enzymes selected from the group consisting of a hemiceliuSase, esterase, protease, laccase, and peroxidase.
42. The method of any of claims ciaim 39-41 wherein the method is a pretreatment process; a step in a simultaneous saccharifscation and fermentation process (SSF); or a step in a hybrid hydrolysis and fermentation process (HHF).
43. The method of any of claims 39-42, further comprising recovering the degraded or converted ceJluiosic material,
44, A method of degrading or converting a ceSiuiosic material, comprising: treating the biomass with a composition comprising the host cell of ciairn 20.
45. The method of claim 44, wherein the composition further comprises an effective amount of endo-1 ,4-beta-glucanase, exo-i^-beta-D-glucanase, and/or beta-D- gSucosidase.
46. The method of claim 44 or 45, wherein the composition further comprises an effective amount of one or more enzymes selected from the group consisting of a hemiceilulasβ, esterase, protease, laccase, and peroxidase.
47. The method of any of claims 44-46, further comprising recovering the degraded or converted ceSiuiosic material.
48. A method of producing a substance, comprising: (a) saccharifying a ceiiuiosic material with a composition comprising an effective amount of a polypeptide having endoglucanase activity of any of claims 1-15, (b) fermenting the saccharified cefSuiosic material of step (a) with one or more fermentating microorganisms; and (c) recovering the substance from the fermentation.
49. The method of ciairn 48, wherein the composition further comprises an effective amount of endo-1 ,4-bβta-glucanasβ, exo-1«4-beta-D-glucanase« and/or bβta-D- gSucosidase,
50. The method of claim 48 or 49, wherein the composition further comprises an effective amount of one or more enzymes selected from the group consisting of a hemiceiiuSase, esterase, protease, laccase, and peroxidase.
51. The method of any of claims 48-50, wherein steps (a) and (b) are performed simultaneously in a simultaneous saccharification and fermentation.
52. The method of any of claims 48-51, wherein the substance is an alcohol, organic acid, ketone, amino acid, or gas.
53. A method of inhibiting expression of a polypeptide in a cell, comprising administering to the ceii or expressing in the ceii a doubie-stranded RNA (dsRNA) moiecuie, wherein the dsRNA comprises a subsequence or portion of a polynucleotide encoding the mature polypeptide of SEQ SD NO: 4, SEQ ID NO: 8, SEQ ID NO: 8, or SEQ ID NO: 10.
54 The method of claim 53, wherein the dsRNA is about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more duplex nucleotides in length.
55. A double-stranded RNA (dsRNA) moiecuie for inhibiting expression of a polypeptide in a ceil, wherein the dsRNA comprises a subsequence or portion of a polynucleotide encoding the mature polypeptide of SEQ ID NO: 4, SEQ ID NO: 6; SEQ ID NO: 8, or SEQ ID NO: 10.
PCT/US2007/063710 2006-03-20 2007-03-09 Polypeptides having endoglucanase activity and polynucleotides encoding same Ceased WO2007109441A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
DK07758275.7T DK1999257T3 (en) 2006-03-20 2007-03-09 Polypeptides that have endo-glucosidase activity and polynucleotides encoding the same
US12/293,735 US8143482B2 (en) 2006-03-20 2007-03-09 Polypeptides having endoglucanase activity and polynucleotides encoding same
BRPI0708949A BRPI0708949B1 (en) 2006-03-20 2007-03-09 methods for degrading or converting a cellulosic material, for producing a substance, and for producing a polypeptide having endoglucanase activity, and recombinant microbial cell
AT07758275T ATE513907T1 (en) 2006-03-20 2007-03-09 POLYPEPTIDES WITH ENDOGLUCANASE ACTIVITY AND POLYNUCLEOTIDES FOR THEIR ENCODING
EP07758275A EP1999257B1 (en) 2006-03-20 2007-03-09 Polypeptides having endoglucanase activity and polynucleotides encoding same
US13/399,588 US8288615B2 (en) 2006-03-20 2012-02-17 Polypeptides having endoglucanase activity and polynucleotides encoding same
US13/597,121 US8614079B2 (en) 2006-03-20 2012-08-28 Polypeptides having endoglucanase activity and polynucleotides encoding same
US13/959,577 US9428742B2 (en) 2006-03-20 2013-08-05 Polypeptides having endoglucanase activity and polynucleotides encoding same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US78408806P 2006-03-20 2006-03-20
US60/784,088 2006-03-20

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/293,735 A-371-Of-International US8143482B2 (en) 2006-03-20 2007-03-09 Polypeptides having endoglucanase activity and polynucleotides encoding same
US13/399,588 Division US8288615B2 (en) 2006-03-20 2012-02-17 Polypeptides having endoglucanase activity and polynucleotides encoding same

Publications (2)

Publication Number Publication Date
WO2007109441A2 true WO2007109441A2 (en) 2007-09-27
WO2007109441A3 WO2007109441A3 (en) 2008-03-13

Family

ID=38523152

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/063710 Ceased WO2007109441A2 (en) 2006-03-20 2007-03-09 Polypeptides having endoglucanase activity and polynucleotides encoding same

Country Status (8)

Country Link
US (4) US8143482B2 (en)
EP (2) EP2336309A3 (en)
CN (2) CN101454444A (en)
AT (1) ATE513907T1 (en)
BR (1) BRPI0708949B1 (en)
DK (1) DK1999257T3 (en)
ES (1) ES2368608T3 (en)
WO (1) WO2007109441A2 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009111692A3 (en) * 2008-03-06 2009-11-26 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2011057140A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Compositions for saccharification of cellulosic material
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2012024698A1 (en) 2010-08-20 2012-02-23 Codexis, Inc. Use of glycoside hydrolase 61 family proteins in processing of cellulose
CN102369295A (en) * 2009-02-26 2012-03-07 丹麦达科有限公司 Compositions and methods for performing hybridization with separate denaturation of samples and probes
WO2012030844A1 (en) * 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013028701A1 (en) 2011-08-22 2013-02-28 Codexis, Inc. Gh61 glycoside hydrolase protein variants and cofactors that enhance gh61 activity
WO2012088159A3 (en) * 2010-12-21 2013-09-19 Codexis, Inc. Endoglucanase variants
US8624082B2 (en) 2010-08-30 2014-01-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
US8629325B2 (en) 2010-08-30 2014-01-14 Novozymes A/S Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2015075391A1 (en) 2013-11-22 2015-05-28 IFP Energies Nouvelles Endoglucanase variants having improved activity, and uses of same
WO2015105835A1 (en) 2014-01-07 2015-07-16 Novozymes A/S Process for degrading mannan-containing cellulosic materials
US9187742B2 (en) 2010-08-30 2015-11-17 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2015193587A1 (en) 2014-06-20 2015-12-23 IFP Energies Nouvelles Variants of exoglucanases having improved activity and uses thereof
WO2015193588A1 (en) 2014-06-20 2015-12-23 IFP Energies Nouvelles Variants of exoglucanases having improved activity and uses thereof
EP2791329A4 (en) * 2011-12-15 2016-02-17 Novozymes Inc Polypeptides having endoglucanase activity and polynucleotides encoding same
US9303074B2 (en) 2010-08-30 2016-04-05 Novoyzmes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US10662465B2 (en) 2011-09-30 2020-05-26 Agilent Technologies, Inc. Hybridization compositions and methods using formamide
US11118214B2 (en) 2008-05-27 2021-09-14 Agilent Technologies, Inc. Hybridization compositions and methods
US11118226B2 (en) 2011-10-21 2021-09-14 Agilent Technologies, Inc. Hybridization compositions and methods

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104169417B (en) * 2009-12-01 2020-05-08 诺维信公司 Polypeptide with glucoamylase activity and its encoding polynucleotide
US8525002B2 (en) 2011-04-20 2013-09-03 Limagrain Europe SA Inbred corn line ML9
CN102399769B (en) * 2011-11-16 2013-05-01 广东溢多利生物科技股份有限公司 Optimized and improved neutral cellulose MEG1, gene and application thereof
CN104136608A (en) * 2011-12-15 2014-11-05 诺维信股份有限公司 Polypeptides having endoglucanase activity and polynucleotides encoding same
US20140230098A1 (en) * 2013-02-12 2014-08-14 Novozymes Inc. Polypeptides Having Endoglucanase Activity and Polynucleotides Encoding Same
US8771993B1 (en) * 2013-02-12 2014-07-08 Novozymes A/S Polypeptides having endoglucanse activity and polynucleotides encoding same
US9175276B2 (en) * 2013-02-12 2015-11-03 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
US8778639B1 (en) * 2013-02-12 2014-07-15 Novozymes Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
JP6774494B2 (en) 2016-02-19 2020-10-21 インターコンチネンタル グレート ブランズ エルエルシー Process for forming multiple useful streams from a biomass source
CN110846231B (en) * 2019-12-03 2020-11-27 安徽农业大学 A laccase-producing fungus Trametes pilus La-7 and its application

Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4106991A (en) 1976-07-07 1978-08-15 Novo Industri A/S Enzyme granulate composition and process for forming enzyme granulates
US4661452A (en) 1984-05-29 1987-04-28 Novo Industri A/S Enzyme containing granulates useful as detergent additives
EP0238216A1 (en) 1986-02-20 1987-09-23 Albright &amp; Wilson Limited Protected enzyme systems
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
WO1991014772A1 (en) 1990-03-23 1991-10-03 Gist-Brocades N.V. Production of enzymes in seeds and their use
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
WO1993011249A1 (en) 1991-12-04 1993-06-10 Novo Nordisk A/S A method of cloning proteins in yeast and cellulase from humicola insolens
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1994014953A1 (en) 1992-12-23 1994-07-07 Novo Nordisk A/S An enzyme with endoglucanase activity
WO1995002043A1 (en) 1993-07-06 1995-01-19 Novo Nordisk A/S DNA ENCODING AN ENZYME WITH ENDOGLUCANASE ACTIVITY FROM $i(TRICHODERMA HARZIANUM)
WO1995017413A1 (en) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Process for the evolutive design and synthesis of functional polymers based on designer elements and codes
WO1995022625A1 (en) 1994-02-17 1995-08-24 Affymax Technologies N.V. Dna mutagenesis by random fragmentation and reassembly
WO1995033836A1 (en) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides useful in the treatment of cardiovascular diseases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2000030322A2 (en) 1998-11-17 2000-05-25 Sun Microsystems, Incorporated Computer data packet switching and load balancing system using a general-purpose multiprocessor architecture
WO2000056900A2 (en) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoter sequences derived from fusarium venenatum and uses thereof
US20020164730A1 (en) 2000-02-24 2002-11-07 Centro De Investigaciones Energeticas, Medioambientales Y Tecnologicas (C.I.E.M.A.T.) Procedure for the production of ethanol from lignocellulosic biomass using a new heat-tolerant yeast
WO2003008575A2 (en) 2001-07-20 2003-01-30 Novozymes A/S Dna sequences for regulating transcription
WO2003062409A2 (en) 2002-01-25 2003-07-31 Dsm Ip Assets B.V. Thermostable enzyme compositions
WO2005059084A1 (en) 2003-12-19 2005-06-30 Novozymes A/S Mashing process
WO2005074656A2 (en) 2004-02-06 2005-08-18 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5945327A (en) * 1992-07-02 1999-08-31 Novo Nordisk A/S DNA constructs and methods of producing cellulytic enzymes
ES2230594T3 (en) 1996-01-29 2005-05-01 Novozymes A/S PROCESS FOR ELIMINATION OR DECOLORATION OF DIRT OR CELLULOSE FABRICS.
WO2000020555A2 (en) 1998-10-06 2000-04-13 Aarl Inc Transformation system in the field of filamentous fungal hosts: in chrysosporium
US7883872B2 (en) 1996-10-10 2011-02-08 Dyadic International (Usa), Inc. Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose
US5811381A (en) * 1996-10-10 1998-09-22 Mark A. Emalfarb Cellulase compositions and methods of use
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6511824B1 (en) 1999-03-17 2003-01-28 Exelixis, Inc. Nucleic acids and polypeptides of invertebrate TWIK channels and methods of use
US6531644B1 (en) 2000-01-14 2003-03-11 Exelixis, Inc. Methods for identifying anti-cancer drug targets
WO2002030963A1 (en) 2000-10-12 2002-04-18 Exelixis, Inc. Human ect2 and methods of use
DK2277997T3 (en) 2001-06-26 2013-12-02 Novozymes As Polypeptides with cellobiohydrolase I activity and the same coding polynucleotides
EP1735454B1 (en) * 2004-03-25 2017-05-10 Novozymes, Inc. Methods for degrading or converting plant cell wall polysaccharides
NZ578309A (en) 2007-01-30 2012-06-29 Verenium Corp Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them
US7923236B2 (en) 2007-08-02 2011-04-12 Dyadic International (Usa), Inc. Fungal enzymes

Patent Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4106991A (en) 1976-07-07 1978-08-15 Novo Industri A/S Enzyme granulate composition and process for forming enzyme granulates
US4661452A (en) 1984-05-29 1987-04-28 Novo Industri A/S Enzyme containing granulates useful as detergent additives
EP0238216A1 (en) 1986-02-20 1987-09-23 Albright &amp; Wilson Limited Protected enzyme systems
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1991014772A1 (en) 1990-03-23 1991-10-03 Gist-Brocades N.V. Production of enzymes in seeds and their use
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
WO1993011249A1 (en) 1991-12-04 1993-06-10 Novo Nordisk A/S A method of cloning proteins in yeast and cellulase from humicola insolens
WO1994014953A1 (en) 1992-12-23 1994-07-07 Novo Nordisk A/S An enzyme with endoglucanase activity
WO1995002043A1 (en) 1993-07-06 1995-01-19 Novo Nordisk A/S DNA ENCODING AN ENZYME WITH ENDOGLUCANASE ACTIVITY FROM $i(TRICHODERMA HARZIANUM)
WO1995017413A1 (en) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Process for the evolutive design and synthesis of functional polymers based on designer elements and codes
WO1995022625A1 (en) 1994-02-17 1995-08-24 Affymax Technologies N.V. Dna mutagenesis by random fragmentation and reassembly
WO1995033836A1 (en) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides useful in the treatment of cardiovascular diseases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2000030322A2 (en) 1998-11-17 2000-05-25 Sun Microsystems, Incorporated Computer data packet switching and load balancing system using a general-purpose multiprocessor architecture
WO2000056900A2 (en) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoter sequences derived from fusarium venenatum and uses thereof
US20020164730A1 (en) 2000-02-24 2002-11-07 Centro De Investigaciones Energeticas, Medioambientales Y Tecnologicas (C.I.E.M.A.T.) Procedure for the production of ethanol from lignocellulosic biomass using a new heat-tolerant yeast
WO2003008575A2 (en) 2001-07-20 2003-01-30 Novozymes A/S Dna sequences for regulating transcription
WO2003062409A2 (en) 2002-01-25 2003-07-31 Dsm Ip Assets B.V. Thermostable enzyme compositions
WO2005059084A1 (en) 2003-12-19 2005-06-30 Novozymes A/S Mashing process
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005074656A2 (en) 2004-02-06 2005-08-18 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

Non-Patent Citations (144)

* Cited by examiner, † Cited by third party
Title
"Biology and Activities of Yeast", 1980, SOC. APP. BACTERIOL. SYMPOSIUM SERIES NO. 9
"More Gene Manipulations in Fungi", 1991, ACADEMIC PRESS
"Protein Purification", 1989, VCH PUBLISHERS
"The Alcohol Textbook", 1999, NOTTINGHAM UNIVERSITY PRESS
"Useful proteins from recombinant bacteria", SCIENTIFIC AMERICAN, vol. 242, 1980, pages 74 - 94
ALFENORE ET AL.: "Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process", 2002, SPRINGER-VERLAG
BEALL, D. S.; OHTA, K.; INGRAM, L. 0.: "Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coli", BIOTECH. BIOENG., vol. 38, 1991, pages 296 - 303, XP000215006, DOI: doi:10.1002/bit.260380311
BECKER; GUARANTE, METHODS ENZYMOL., vol. 194, 1991, pages 182 - 187
BECKER; GUARENTE: "Methods in Enzymology", vol. 194, ACADEMIC PRESS, INC., article "Guide to Yeast Genetics and Molecular Biology", pages: 182 - 187
BHAT; MAHESHWARI, APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 53, 1987, pages 2175 - 2182
BOISSET ET AL., BIOCHEMICAL JOURNAL, vol. 340, 1999, pages 829 - 835
BOLTON; MCCARTHY, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 48, 1962, pages 1390
BOWIE; SAUER, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2152 - 2156
BRIGHAM ET AL.: "Handbook on Bioethanol", 1995, TAYLOR & FRANCIS, pages: 119 - 141
BUCKLEY ET AL., APPL. ENVIRON. MICROBIOL., vol. 65, 1999, pages 3800 - 3804
BURKE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 98, 2001, pages 6289 - 6294
CARTER ET AL., PROTEINS: STRUCTURE, FUNCTION, AND GENETICS, vol. 6, 1989, pages 240 - 248
CATT; JOLLICK, MICROBIOS, vol. 68, 1991, pages 189 - 2070
CHANG; COHEN, MOLECULAR GENERAL GENETICS, vol. 168, 1979, pages 111 - 115
CHEN ET AL., PLANT AND CELL PHYSIOLOGY, vol. 39, 1998, pages 935 - 941
CHEN, R.; LEE, Y. Y.: "Membrane-mediated extractive fermentation for lactic acid production from cellulosic biomass", APPL. BIOCHEM. BIOTECHNOL., vol. 63-65, 1997, pages 435 - 448, XP008087560, DOI: doi:10.1007/BF02920444
CHEN, Z.; HO, N. W. Y.: "Cloning and improving the expression of Pichia stipitis xylose reductase gene in Saccharomyces cerevisiae", APPL. BIOCHEM. BIOTECHNOL., vol. 39-40, 1993, pages 135 - 147, XP009063851, DOI: doi:10.1007/BF02918984
CHERNOGLAZOV ET AL., BIOKHIMIYA, vol. 53, 1988, pages 475 - 482
CHOI ET AL., J. MICROBIOL. METHODS, vol. 64, 2006, pages 391 - 397
CHOU ET AL., NUCLEIC ACIDS RES., vol. 20, 1992, pages 1717
CHRISTENSEN ET AL., BIOLTECHNOLOGY, vol. 6, 1988, pages 1419 - 1422
CHRISTENSEN ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 1419 - 1422
CHRISTENSEN ET AL., PLANT MO. BIOL., vol. 18, 1992, pages 675 - 689
CHRISTOU, PLANT JOURNAL, vol. 2, 1992, pages 275 - 281
CLEWELL, MICROBIOL. REV., vol. 45, 1981, pages 409 - 436
COLLINS-RACIE ET AL., BIOTECHNOLOGY, vol. 13, 1995, pages 982 - 987
CONRAD ET AL., JOURNAL OF PLANT PHYSIOLOGY, vol. 152, 1998, pages 708 - 711
CONTRERAS ET AL., BIOTECHNOLOGY, vol. 9, 1991, pages 378 - 381
CULLEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 15, 1987, pages 9163 - 9175
CUNNINGHAM; WELLS, SCIENCE, vol. 244, 1989, pages 1081 - 1085
DE VOS ET AL., SCIENCE, vol. 255, 1992, pages 306 - 312
DEANDA, K.; ZHANG, M.; EDDY, C.; PICATAGGIO, S.: "Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering", APPL. ENVIRON. MICROBIOL., vol. 62, 1996, pages 4465 - 4470, XP055058599
DEBOER ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 80, 1983, pages 21 - 25
DERBYSHIRE ET AL., GENE, vol. 46, 1986, pages 145
DOWER ET AL., NUCLEIC ACIDS RES., vol. 16, 1988, pages 6127 - 6145
DUBNAU; DAVIDOFF-ABELSON, JOURNAL OF MOLECULAR BIOLOGY, vol. 56, 1971, pages 209 - 221
EATON ET AL., BIOCHEM., vol. 25, 1986, pages 505 - 512
EDWARDS; CORUZZI, ANN. REV. GENET., vol. 24, 1990, pages 275 - 303
EZEJI, T. C.; QURESHI, N.; BLASCHEK, H. P.: "Production of acetone, butanol and ethanol by Clostridium beijerinckii BA101 and in situ recovery by gas stripping", WORLD JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, vol. 19, no. 6, 2003, pages 595 - 603
FORD ET AL., PROTEIN EXPRESSION AND PURIFICATION, vol. 2, 1991, pages 95 - 107
FRANCK ET AL., CELL, vol. 21, 1980, pages 285 - 294
GASSER ET AL., SCIENCE, vol. 244, 1990, pages 1293
GEMS ET AL., GENE, vol. 98, 1991, pages 61 - 67
GHOSE, PURE AND APPL. CHEM., vol. 59, 1987, pages 257 - 268
GIESECKE ET AL., J. VIROL. METHODS, vol. 38, 1992, pages 47 - 60
GONG ET AL., FOLIA MICROBIOL., vol. 49, 2004, pages 399 - 405
GONG, C. S.; CAO, N. J.; DU, J.; TSAO, G. T.: "Advances in Biochemical Engineering/Biotechnology", vol. 65, 1999, SPRINGER-VERLAG, article "Ethanol production from renewable resources", pages: 207 - 241
GUBLER; HOFFMAN, GENE, vol. 25, 1983, pages 263 - 269
GUNASEELAN V.N., BIOMASS AND BIOENERGY, vol. 13, no. 1-2, 1997, pages 83 - 114
GUO; SHERMAN, MOLECULAR CELLULAR BIOLOGY, vol. 15, 1995, pages 5983 - 5990
GUSAKOV, A. V.; SINITSYN, A. P.: "Kinetics of the enzymatic hydrolysis of cellulose: 1. A mathematical model for a batch reactor process", ENZ. MICROB. TECHNOL., vol. 7, 1985, pages 346 - 352, XP023679176, DOI: doi:10.1016/0141-0229(85)90114-0
GUSAKOV, A. V.; SINITSYN, A. P.; DAVYDKIN, I. Y.; DAVYDKIN, V. Y.; PROTAS, O. V.: "Enhancement of enzymatic cellulose hydrolysis using a novel type of bioreactor with intensive stirring induced by electromagnetic field", APPL. BIOCHEM. BIOTECHNOL., vol. 56, 1996, pages 141 - 153, XP035176121, DOI: doi:10.1007/BF02786945
GUZHOVA; LOGINOVA, PRIKLADNAYA BIOKHIMIYA I MIKROBIOLOGIYA, vol. 23, 1987, pages 820 - 825
H. NEURATH; R.L. HILL: "The Proteins", 1979, ACADEMIC PRESS
HANAHAN, J. MOL. BIOL., vol. 166, 1983, pages 557 - 580
HAWKSWORTH ET AL.: "Ainsworth and Bisby's Dictionary of The Fungi", 1995, UNIVERSITY PRESS
HENRISSAT B.: "A classification of glycosyl hydrolases based on amino-acid sequence similarities", BIOCHEM. J., vol. 280, 1991, pages 309 - 316, XP002050142
HENRISSAT B.; BAIROCH A.: "Updating the sequence-based classification of glycosyl hydrolases", BIOCHEM. J., vol. 316, 1996, pages 695 - 696, XP001176681
HILTON ET AL., J. BIOL. CHEM., vol. 271, 1996, pages 4699 - 4708
HINNEN ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 75, 1978, pages 1920
HO, N. W. Y.; CHEN, Z; BRAINARD, A. P.: "Genetically engineered Saccharomyces yeast capable of effectively cofermenting glucose and xylose", APPL. ENVIRON. MICROBIOL., vol. 64, 1998, pages 1852 - 1859
HOOYKAS; SCHILPEROORT, PLANT MOLECULAR BIOLOGY, vol. 19, 1992, pages 15 - 38
INGRAM, L. 0.; GOMES, P. F.; LAI, X.; MONIRUZZAMAN, M.; WOOD, B. E.; YOMANO, L. P.; YORK, S. W.: "Metabolic engineering of bacteria for ethanol production", BIOTECHNOL. BIOENG., vol. 58, 1998, pages 204 - 214, XP000999111, DOI: doi:10.1002/(SICI)1097-0290(19980420)58:2/3<204::AID-BIT13>3.0.CO;2-C
INNIS ET AL.: "PCR: A Guide to Methods and Application", 1990, ACADEMIC PRESS
ITO ET AL., JOURNAL OF BACTERIOLOGY, vol. 153, 1983, pages 163
ITO ET AL., PLANT MOL. BIOL., vol. 24, 1994, pages 863 - 878
J. SAMBROOK; E.F. FRITSCH; T. MANIATIS: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR
JORGENSEN ET AL., ENZYME AND MICROBIAL TECHNOLOGY, vol. 32, 2003, pages 851 - 861
JORGENSEN ET AL., ENZYME MICROB. TECHNOL., vol. 32, 2003, pages 851 - 861
KAGAYA ET AL., MOLECULAR AND GENERAL GENETICS, vol. 248, 1995, pages 668 - 674
KATAOKA, N.; A. MIYA; K. KIRIYAMA: "Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria", WATER SCIENCE AND TECHNOLOGY, vol. 36, no. 6-7, 1997, pages 41 - 47
KLYOSOV ET AL., BIOTECHNOLOGY LETTERS, vol. 10, 1988, pages 351 - 354
KLYOSOV ET AL., PRIKLADNAYA BIOKHIMIYA I MIKROBIOLOGIYA, vol. 23, 1987, pages 44 - 50
KOEHLER; THORNE, JOURNAL OF BACTERIOLOGY, vol. 169, 1987, pages 5271 - 5278
KYOZUKA ET AL., PLANT PHYSIOLOGY, vol. 102, 1993, pages 991 - 1000
LASSEN ET AL., APPL ENVIRON MICROBIOL, vol. 67, 2001, pages 4701 - 4707
LEE, JOURNAL OF BIOTECHNOLOGY, vol. 56, 1997, pages 1 - 24
LEVER, ANAL. BIOCHEM., vol. 47, 1972, pages 273 - 279
LOWMAN ET AL., BIOCHEM., vol. 30, 1991, pages 10832 - 10837
LYND, APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY, vol. 24/25, 1990, pages 695 - 719
LYND, L. R.; WEIMER, P. J.; VAN ZYL, W. H.; PRETORIUS, I. S.: "Microbial cellulose utilization: Fundamentals and biotechnology", MICROBIOL. MOL. BIOL. REVIEWS, vol. 66, 2002, pages 506 - 577, XP002551605, DOI: doi:10.1128/MMBR.66.3.506-577.2002
LYND, L. R.; WYMAN, C. E.; GERNGROSS, T. U., BIOCOMMODITY ENGINEERING, BIOTECHNOL. PROG., vol. 15, 1999, pages 777 - 793
MALARDIER ET AL., GENE, vol. 78, 1989, pages 147 - 156
MANDEL; HIGA, J. MOL. BIOL., vol. 45, 1970, pages 154
MANDELS; WEBER, ADV. CHEM. SER., vol. 95, 1969, pages 394 - 414
MANIATIS ET AL.: "Molecular Cloning, A Laboratory Manual", 1982, COLD SPRING HARBOR PRESS
MARTIN ET AL., J. IND. MICROBIOL. BIOTECHNOL., vol. 3, 2003, pages 568 - 76
MAZODIER ET AL., J. BACTERIOL., vol. 171, 1989, pages 3583 - 3585
MITRA; HIGGINS, PLANT MOLECULAR BIOLOGY, vol. 26, 1994, pages 85 - 93
MOSIER ET AL.: "Advances in Biochemical Engineering/Biotechnology", vol. 65, 1999, SPRINGER-VERLAG, article "Recent Progress in Bioconversion of Lignocellulosics", pages: 23 - 40
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
NER ET AL., DNA, vol. 7, 1988, pages 127
NESS ET AL., NATURE BIOTECHNOLOGY, vol. 17, 1999, pages 893 - 896
NIELSEN ET AL., PROTEIN ENGINEERING, vol. 10, 1997, pages 1 - 6
NIGAM, P.; SINGH, D.: "Processes for fermentative production of xylitol - a sugar substitute", PROCESS BIOCHEMISTRY, vol. 30, no. 2, 1995, pages 117 - 124
OMIRULLEH ET AL., PLANT MOLECULAR BIOLOGY, vol. 21, 1993, pages 415 - 428
OTZEN ET AL., PROTEIN SCI., vol. 8, 1999, pages 1878 - 87
PEARSON, W.R.: "Bioinformatics Methods and Protocols", 1999, pages: 185 - 219
PERRY; KURAMITSU, INFECT. IMMUN., vol. 32, 1981, pages 1295 - 1297
PHILIPPIDIS, G. P.: "Handbook on Bioethanol: Production and Utilization", 1996, TAYLOR & FRANCIS, article "Cellulose bioconversion technology", pages: 179 - 212
PINEDO; SMETS, APPL. ENVIRON. MICROBIOL., vol. 71, 2005, pages 51 - 57
POTRYKUS, BIOLTECHNOLOAV, vol. 8, 1990, pages 535
RABINOVICH ET AL., BIOORGANICHESKAYA KHIMIYA, vol. 12, 1986, pages 1549 - 1560
RASMUSSEN-WILSON ET AL., APPL. ENVIRON. MICROBIOL., vol. 63, 1997, pages 3488 - 3493
REIDHAAR-OLSON; SAUER, SCIENCE, vol. 241, 1988, pages 53 - 57
RICHARD, A.; MARGARITIS, A.: "Empirical modeling of batch fermentation kinetics for poly(glutamic acid) production and other microbial biopolymers", BIOTECHNOLOGY AND BIOENGINEERING, vol. 87, no. 4, 2004, pages 501 - 515
ROMANOS ET AL., YEAST, vol. 8, 1992, pages 423 - 488
ROSE ET AL., NUCLEIC ACIDS RES., vol. 26, 1998, pages 1628 - 35
ROY ET AL., JOURNAL OF GENERAL MICROBIOLOGY, vol. 136, 1990, pages 1967 - 1972
RYU, D. D. Y.; MANDELS, M.: "Cellulases: biosynthesis and applications", ENZ. MICROB. TECHNOL., vol. 2, 1980, pages 91 - 102, XP023898119, DOI: doi:10.1016/0141-0229(80)90063-0
RYU, S. K.; LEE, J. M.: "Bioconversion of waste cellulose by using an attrition bioreactor", BIOTECHNOL. BIOENG., vol. 25, 1983, pages 53 - 65, XP002397253, DOI: doi:10.1002/bit.260250106
SAMBROOK ET AL.: "Molecular cloning: A laboratory manual", 1989, COLD SPRING HARBOR LAB.
SHEEHAN, J.; HIMMEL, M.: "Enzymes, energy and the environment: A strategic perspective on the U.S. Department of Energy's research and development activities for bioethanol", BIOTECHNOL. PROG., vol. 15, 1999, pages 817 - 827
SHIGEKAWA; DOWER, BIOTECHNIQUES, vol. 6, 1988, pages 742 - 751
SHIMAMOTO ET AL., NATURE, vol. 338, 1989, pages 274
SHIMAMOTO, CURRENT OPINION BIOTECHNOLOGY, vol. 5, 1994, pages 158 - 162
SIGRIST ET AL., BRIEF BIOINFORM., vol. 3, 2002, pages 265 - 274
SILVEIRA, M. M.; JONAS, R.: "The biotechnological production of sorbitol", APPL. MICROBIOL. BIOTECHNOL., vol. 59, 2002, pages 400 - 408
SIMONEN; PALVA, MICROBIOLOGICAL REVIEWS, vol. 57, 1993, pages 109 - 137
SMITH ET AL., J. MOL. BIOL., vol. 224, 1992, pages 899 - 904
STEVENS, DRUG DISCOVERY WORLD, vol. 4, 2003, pages 35 - 48
SVETINA ET AL., J. BIOTECHNOL., vol. 76, 2000, pages 245 - 251
SVISTOVA ET AL., MIKROBIOLOGIYA, vol. 55, 1986, pages 49 - 54
TAGUE ET AL., PLANT PHYSIOLOGY, vol. 86, 1988, pages 506
TAKASHIMA ET AL., JOURNAL OF BACTERIOLOGY, vol. 65, 1998, pages 163 - 171
THYGESEN ET AL., ENZYME AND MICROBIAL TECHNOLOGY, vol. 32, 2003, pages 606 - 615
VASIL ET AL., BIOLTECHNOLOGY, vol. 10, 1992, pages 667 - 674
VILLA-KAMAROFF ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 75, 1978, pages 3727 - 3731
WARD ET AL., BIOTECHNOLOGY, vol. 13, 1995, pages 498 - 503
WISELOGEL ET AL.: "Handbook on Bioethanol", 1995, TAYLOR & FRANCIS, pages: 105 - 118
WLODAVER ET AL., FEBS LETT., vol. 309, 1992, pages 59 - 64
WU ET AL., PLANT AND CELL PHYSIOLOGY, vol. 39, 1998, pages 885 - 889
WYMAN, BIORESOURCE TECHNOLOGY, vol. 50, 1994, pages 3 - 16
XU ET AL., PLANT MOLECULAR BIOLOGY, vol. 22, 1993, pages 573 - 588
YELTON ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 81, 1984, pages 1470 - 1474
YOUNG; SPIZIZEN, JOURNAL OF BACTERIOLOGY, vol. 81, 1961, pages 823 - 829
ZDOBNOV; APWEILER, BIOINFORMATICS, vol. 17, 2001, pages 847 - 848
ZHANG ET AL., PLANT CELL, vol. 3, 1991, pages 1155 - 1165
ZHANG, M.; EDDY, C.; DEANDA, K.; FINKELSTEIN, M.; PICATAGGIO, S.: "Metabolic engineering of a pentose metabolism pathway in ethanologenic Zymomonas mobilis", SCIENCE, vol. 267, 1995, pages 240 - 243

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009111692A3 (en) * 2008-03-06 2009-11-26 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US8609932B2 (en) 2008-03-06 2013-12-17 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US12209276B2 (en) 2008-05-27 2025-01-28 Agilent Technologies, Inc. Hybridization compositions and methods
US11118214B2 (en) 2008-05-27 2021-09-14 Agilent Technologies, Inc. Hybridization compositions and methods
US11834703B2 (en) 2008-05-27 2023-12-05 Agilent Technologies, Inc. Hybridization compositions and methods
US12534755B2 (en) 2009-02-26 2026-01-27 Agilent Technologies, Inc. Compositions and methods for performing hybridizations with separate denaturation of the sample and probe
CN102369295A (en) * 2009-02-26 2012-03-07 丹麦达科有限公司 Compositions and methods for performing hybridization with separate denaturation of samples and probes
CN102369295B (en) * 2009-02-26 2017-11-24 丹麦达科有限公司 Compositions and methods for performing hybridization with separate denaturation of samples and probes
US11795499B2 (en) 2009-02-26 2023-10-24 Agilent Technologies, Inc. Compositions and methods for performing hybridizations with separate denaturation of the sample and probe
CN107574230B (en) * 2009-02-26 2022-01-11 安捷伦科技有限公司 Compositions and methods for performing hybridization with separate denaturation of sample and probe
CN107574230A (en) * 2009-02-26 2018-01-12 丹麦达科有限公司 The composition and method for the hybridization being individually denatured for carrying out sample and probe
US9309562B2 (en) 2009-02-26 2016-04-12 Dako Denmark A/S Compositions and methods for performing hybridizations with separate denaturation of the sample and probe
US10202638B2 (en) 2009-02-27 2019-02-12 Dako Denmark A/S Compositions and methods for performing hybridizations with separate denaturation of the sample and probe
EP3550016A1 (en) 2009-11-06 2019-10-09 Novozymes, Inc. Composition for saccharification of cellulosic material
WO2011057140A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Compositions for saccharification of cellulosic material
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
EP3222716A1 (en) 2009-11-06 2017-09-27 Novozymes, Inc. Composition for saccharification of cellulosic material
US8877474B2 (en) 2010-08-20 2014-11-04 Codexis, Inc. GH61 glycoside hydrolase protein variants and cofactors that enhance GH61 activity
WO2012024698A1 (en) 2010-08-20 2012-02-23 Codexis, Inc. Use of glycoside hydrolase 61 family proteins in processing of cellulose
US9493802B2 (en) 2010-08-20 2016-11-15 Codexis, Inc. Use of glycohydrolase 61 protein variants with improved thermostability for processing cellulose
US10167461B2 (en) 2010-08-30 2019-01-01 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US8865447B2 (en) 2010-08-30 2014-10-21 Novozymes Inc. Polypeptides having xylanase activity and polynucleotides encoding same
US9267126B2 (en) 2010-08-30 2016-02-23 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
US9303074B2 (en) 2010-08-30 2016-04-05 Novoyzmes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030844A1 (en) * 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US8624082B2 (en) 2010-08-30 2014-01-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
US8629325B2 (en) 2010-08-30 2014-01-14 Novozymes A/S Polypeptides having beta-glucosidase activity and polynucleotides encoding same
US9187742B2 (en) 2010-08-30 2015-11-17 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
US8859254B2 (en) 2010-08-30 2014-10-14 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
US9512416B2 (en) 2010-12-21 2016-12-06 Codexis, Inc. Endoglucanase variants
US8906689B2 (en) 2010-12-21 2014-12-09 Codexis, Inc. Endoglucanase variants
WO2012088159A3 (en) * 2010-12-21 2013-09-19 Codexis, Inc. Endoglucanase variants
WO2013028701A1 (en) 2011-08-22 2013-02-28 Codexis, Inc. Gh61 glycoside hydrolase protein variants and cofactors that enhance gh61 activity
US8951758B2 (en) 2011-08-22 2015-02-10 Codexis, Inc. GH61 glycoside hydrolase protein variants and cofactors that enhance GH61 activity
US10662465B2 (en) 2011-09-30 2020-05-26 Agilent Technologies, Inc. Hybridization compositions and methods using formamide
US11118226B2 (en) 2011-10-21 2021-09-14 Agilent Technologies, Inc. Hybridization compositions and methods
EP2791329A4 (en) * 2011-12-15 2016-02-17 Novozymes Inc Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2015075391A1 (en) 2013-11-22 2015-05-28 IFP Energies Nouvelles Endoglucanase variants having improved activity, and uses of same
WO2015105835A1 (en) 2014-01-07 2015-07-16 Novozymes A/S Process for degrading mannan-containing cellulosic materials
EP3511418A1 (en) 2014-01-07 2019-07-17 Novozymes A/S Process for degrading mannan-containing cellulosic materials
WO2015193587A1 (en) 2014-06-20 2015-12-23 IFP Energies Nouvelles Variants of exoglucanases having improved activity and uses thereof
FR3073230A1 (en) 2014-06-20 2019-05-10 Centre National De La Recherche Scientifique - Cnrs - EXOGLUCANASE VARIANTS WITH IMPROVED ACTIVITY AND USES THEREOF
WO2015193588A1 (en) 2014-06-20 2015-12-23 IFP Energies Nouvelles Variants of exoglucanases having improved activity and uses thereof

Also Published As

Publication number Publication date
EP1999257B1 (en) 2011-06-22
EP1999257A2 (en) 2008-12-10
US8614079B2 (en) 2013-12-24
US20120331587A1 (en) 2012-12-27
US20130340122A1 (en) 2013-12-19
EP2336309A2 (en) 2011-06-22
BRPI0708949B1 (en) 2017-04-04
CN101454444A (en) 2009-06-10
BRPI0708949A2 (en) 2011-06-14
ES2368608T3 (en) 2011-11-18
CN103740674A (en) 2014-04-23
US20120151633A1 (en) 2012-06-14
US20110047652A1 (en) 2011-02-24
WO2007109441A3 (en) 2008-03-13
EP2336309A3 (en) 2011-08-10
US9428742B2 (en) 2016-08-30
DK1999257T3 (en) 2011-10-31
US8143482B2 (en) 2012-03-27
US8288615B2 (en) 2012-10-16
ATE513907T1 (en) 2011-07-15

Similar Documents

Publication Publication Date Title
US9428742B2 (en) Polypeptides having endoglucanase activity and polynucleotides encoding same
US8791328B2 (en) Polypeptides having endoglucanase activity and polynucleotides encoding same
CA2625933C (en) Polypeptides having beta-glucosidase activity and polynucleotides encoding same
US8975059B2 (en) Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2009042871A1 (en) Polypeptides having cellobiohydrolase ii activity and polynucleotides encoding same
US20090148903A1 (en) Polypeptides having beta-glucosidase activity and polynucleotides encoding same
US8268589B2 (en) Polypeptides having endoglucanase activity and polynucleotides encoding same
CA2606475C (en) Polypeptides having endoglucanase activity and polynucleotides encoding same

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200780018204.6

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07758275

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007758275

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12293735

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0708949

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20080919