WO2007105150A2 - Methods and systems for identification of dna patterns through spectral analysis - Google Patents

Methods and systems for identification of dna patterns through spectral analysis Download PDF

Info

Publication number
WO2007105150A2
WO2007105150A2 PCT/IB2007/050762 IB2007050762W WO2007105150A2 WO 2007105150 A2 WO2007105150 A2 WO 2007105150A2 IB 2007050762 W IB2007050762 W IB 2007050762W WO 2007105150 A2 WO2007105150 A2 WO 2007105150A2
Authority
WO
WIPO (PCT)
Prior art keywords
dna
dna sequence
sequence
methods
spectrogram
Prior art date
Application number
PCT/IB2007/050762
Other languages
French (fr)
Other versions
WO2007105150A3 (en
Inventor
Nevenka Dimitrova
Yee Him Cheung
Original Assignee
Koninklijke Philips Electronics, N.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Koninklijke Philips Electronics, N.V. filed Critical Koninklijke Philips Electronics, N.V.
Priority to US12/282,435 priority Critical patent/US8189892B2/en
Priority to EP07713221A priority patent/EP1999663A2/en
Priority to CN200780008687.1A priority patent/CN101401101B/en
Priority to JP2008557880A priority patent/JP5297207B2/en
Publication of WO2007105150A2 publication Critical patent/WO2007105150A2/en
Publication of WO2007105150A3 publication Critical patent/WO2007105150A3/en

Links

Classifications

    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B45/00ICT specially adapted for bioinformatics-related data visualisation, e.g. displaying of maps or networks
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B40/00ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
    • G16B40/20Supervised data analysis
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B40/00ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
    • G16B40/30Unsupervised data analysis
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B40/00ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding

Definitions

  • the present disclosure is directed to systems and methods for facilitating DNA spectral analysis and, more particularly, to systems and methods that employ image processing techniques and/or signal processing methods to automate and/or expedite, in whole or in part, the processing of DNA sequence data.
  • systems and methods are provided to support one or more of the following DNA spectral analysis techniques: (i) comparative histogram methodologies; (ii) selection/classification using support vector machines and genetic algorithms; and (iii) spectrovideo methodologies based on spectrogram extractions from DNA sequence data.
  • Bioinformatics seeks to organize tremendous volumes of biological data into comprehensible information which can be used to derive useful knowledge.
  • techniques for spectral analysis of DNA sequences have been developed.
  • Spectral analysis techniques generally represent an improvement over manual DNA pattern analysis techniques which aim at identifying DNA patterns serving as biological markers related to important life processes.
  • automatic analyses are performed directly on strings of DNA sequences composed of the four characters A, T, C and G, which represent the four nucleotide bases.
  • DNA spectral analysis offers an approach to systematically tackle the problem of deriving useful information from DNA sequence data.
  • DNA spectral analysis involves an identification of the occurrences of each nucleotide base in a DNA sequence as an individual digital signal, and transforming each of the four nucleotide signals into a frequency domain. The magnitude of a frequency component can then be used to reveal how strongly a nucleotide base pattern is repeated at that frequency.
  • each nucleotide base is represented by a color and the frequency spectrums of the four bases are combined and presented as a color spectrogram.
  • the translation of the magnitudes/values for nucleotide bases into a visual image is a powerful visualization tool for DNA analysis.
  • the resultant pixel color is indicative of the relative intensity of the four bases at a particular frequency, and the representation of DNA sequences as color images allows patterns to be more easily identified by visual inspection.
  • the hue in a spectrogram region reflects its overall nucleotide composition, and bright lines and patches in a spectrogram reveal the existence of special repetitive patterns.
  • the sequence U[k] provides a measure of the frequency content at frequency k, which is equivalent to an underlying period o ⁇ N/k samples (reproduced in FIG. 3).
  • Equation (2) (in)Mapping of DTF values to RGB colors.
  • the four DFT sequences are reduced to three sequences in the RGB space by the following set of linear equations, collectively designated as Equation (2):
  • X r [k] a r U A [k] + t r U T [k] + c r U c [k] + g r U G [k]
  • X g [k] a g U ⁇ [k] + t g U ⁇ [k] + c g U c [k] + gg U G [k]
  • X b [k] a b U ⁇ [k] + t b U T [k] + c b U c [k] + gb U G [k]
  • FIGS. 5 and 6 further illustrate the mapping of DFT values to colors according to exemplary embodiments of the present disclosure.
  • color vectors are selected for the respective nucleotide bases A, T 5 C and G, respectively.
  • the DFT values are combined in color space, as shown in FIG. 6.
  • Alternative mapping techniques and/or protocols may be employed, e.g., DFT values may be mapped to Hue Saturation Value (HSV space), YCrCb space, etc. (iv)Normalizing the pixel values.
  • the RGB values of each pixel are generally normalized such that they fall between 0 and 1.
  • the simplest approach is to divide all values by the global maximum. However, such a one-step approach may degrade the overall color contrast of the image.
  • a better method is to perform normalization at two levels: at a first level, all pixel values are divided by a statistical maximum, e.g., equal to the overall mean plus one standard deviation, such that after the initial operation, a majority of pixels have RGB values between 0 and 1; then, at a second level, for the remaining pixels with any of their RGB values greater than one, a second level of normalization is individually performed by dividing each of such pixel values by its local maximum max(x r , x g , xt).
  • This two level approach prevents the overall intensity of the image from being excessively reduced by the more extreme pixel values and, as a result, the color contrast of the spectrogram image can be better preserved.
  • FIG. 7 presents exemplary normalized plots of the combined DFT values of FIG. 6.
  • the window size determines the effective range of a pixel value in a spectrogram.
  • a larger window results in a spectrogram that reveals statistics collected from longer DNA local segments and may be useful in identifying wider patterns.
  • the window size should be made several times larger than the length of the repetitive pattern of interest and smaller than the size of the region that contains the pattern.
  • the window overlap determines the length of the DNA segment common to two adjacent STFT windows. Therefore, the larger the overlap, the more gradual is the transition of the frequency spectrum from one STFT window to the next. Smaller window intervals yield in higher image resolutions, thereby making it easier to extract features by image processing or visual inspection. However, smaller intervals also generally demand more computational resources.
  • the Newell '773 method involves: (a) reverse translating the set of protein sequences to a set of functionally aligned nucleic acid sequences using codon-usage tables and creating a profile from the set of functionally aligned nucleic acid sequences; (b) constructing a first indicator function (adenine) for the profile; (c) constructing a second indicator function (adenine) for the test nucleic acid sequence; (d) computing the Fourier transform of each of the indicator functions; (e) complex conjugating the Fourier transform of the second indicator function; (f) multiplying the Fourier transform of the first indicator function and the complex conjugated Fourier transform of the second indicator function to obtain a Fourier transform of the number of matches of adenine bases; (g) repeating steps (b) reverse translating the set of protein sequences to a set of functionally aligned nucleic acid sequences using codon-usage tables and creating a profile from the set of functionally aligned nucleic acid sequences; (b) constructing a first indicator function
  • the first indicator function allows the value at a given position to be continuous between 0 and 1 as a function of the percentage presence of adenine at a particular position.
  • the method can then detect the presence of known blocks of functionally aligned protein sequences in a test nucleic acid sequence based on the total number of base matches for the variety of possible lags, i.e., to facilitate sequence matching.
  • a need remains for systems and methods that facilitate expeditious visualization of genomic information.
  • a need remains for systems and methods that facilitate identification of repetitive DNA patterns, e.g., CpG islands, AIu repeats, non-coding RNAs, tandem repeats and various types of satellite repeats.
  • the present disclosure provides advantageous systems and methods for facilitating DNA spectral analysis and, more particularly, systems and methods that employ image processing techniques and/or signal processing methods to automate and/or expedite, in whole or in part, the processing of DNA sequence data.
  • exemplary systems and methods of the present disclosure support one or more of the following DNA spectral analysis techniques: (i) comparative histogram methodologies; (ii) selection/classification using support vector machines and genetic algorithms; (iii) unsupervised classification and discovery of structurally novel DNA segments; and (iv) spectrovideo methodologies based on spectrogram extractions from DNA sequence data.
  • the disclosed systems and methods offer numerous advantages, including (i) facilitating visualization of genomic information, (ii) identifying repetitive DNA patterns, e.g., CpG islands, AIu repeats, tandem repeats, satellite repeats, etc., (iii) rapid, full-scale analysis of spectral images using supervised and/or unsupervised machine learning techniques, and (iv) increasing the resolution of spectral image sequences, e.g., to permit rapid visualization of an entire genome at a varying and desired resolution.
  • a DNA spectrogram is generated by applying Fourier transform to convert a symbolic DNA sequence consisting of letters A, T, C, G into a visual representation that highlights periodicities of cooccurrence of DNA patterns.
  • the disclosed systems and methods facilitate the identification and/or location of repetitive DNA patterns by applying image processing operators to find prominent features in the vertical and horizontal direction of the DNA spectrograms. Rapid, full scale analysis of the derived spectral images is undertaken using supervised and unsupervised machine learning methods.
  • two exemplary methods to detect and classify repetitive DNA patterns according to the present disclosure include (a) a comparative histogram methodology, and (b) a technique that involves feature selection and classification using support vector machines and genetic algorithms.
  • the disclosed image processing operators are effective for identifying and/or locating DNA patterns, such as CpG islands, AIu repeats, non-coding RNAs (e.g., microRNAs and small nucleolar RNAs), tandem repeats, various type of satellite repeats, and the like.
  • the image processing operators may be employed to identify and/or locate repetitive elements in a variety of biologic systems, e.g., within a chromosome, within a genome, or across genomes of various species.
  • the disclosed system and method overcomes the limitations of existing methodologies, wherein a DNA sequence or genome is processed to generate huge numbers of spectrogram images, but such images fail to yield or elucidate the location of repetitive patterns and/or to associate a biological or clinical meaning to such repetitive patterns, in an efficient and reliable manner.
  • a DNA spectrogram is generated by converting a DNA sequence to a binary indicator sequence and then applying short term Fourier transform and mapping to a color space in order to visualize the output.
  • the DNA spectrogram is slid along DNA sequences to produce a video image.
  • the video image - termed a "spectrovideo" - may be generated from very long DNA sequences to facilitate visualization thereof, e.g., long DNA sequences such as chromosomes or entire genomes.
  • the disclosed spectrovideo provides enhanced resolution.
  • the disclosed spectrovideo facilitates visualization of the genome in a short amount of time and at a desired resolution.
  • Spectrovideo analysis may be employed to provide or facilitate a full genome analysis and/or to detect changes in full length DNA patterns (or desired portions thereof).
  • Scene change detection methods may be employed with respect to a spectrovideo to find breaks in linear visual features. Moreover, for each scene in a spectrovideo, statistical features may be extracted from the spectral domain. Furthermore, individual scenes from a full (or substantially complete) spectrovideo may be clustered using unsupervised clustering methods. Indeed, unsupervised video feature detection methods according to the present disclosure may be employed to identify and/or reveal genome- wide similarities at the spectral DNA level. Such analytic techniques can thus be employed for automatic DNA analysis, e.g., to find gene networks, important motifs, repetitive DNA elements, and other prominent DNA patterns. Additional advantageous features and functions of the disclosed systems and methods will be apparent from the detailed description which follows, particularly when read in conjunction with the appended figures. BRIEF DESCRIPTION OF APPENDED FIGURES
  • FIG. 1 sets forth exemplary binary indicator sequences (BISs) for a DNA sequence according to spectral imaging techniques employed according to the present disclosure
  • FIG. 2 sets forth plots of the exemplary BISs set forth in FIG. 1 hereto;
  • FIG. 3 sets forth discrete Fourier transforms (DFTs) for the exemplary BISs of FIGS. 1 and 2;
  • FIG. 4 illustrates the mapping of the exemplary DFT values of FIG. 3 to color space
  • FIG. 5 illustrates the mapping of the exemplary DFT values of FIG. 3 to color space based upon illustrative color vectors
  • FIG. 6 sets forth the summation of DFT values in color space according to the present disclosure
  • FIG. 7 sets forth normalized plots of the DFT summation values in color space
  • FIG. 8 is an exemplary color spectrum for a DNA sequence (reproduced in gray scale).
  • FIG. 9 is an exemplary concatenation of a plurality of color spectra strips for exemplary DNA segments according to the present disclosure
  • FIG. 10 are spectrogram images of exemplary CpG islands
  • FIG. 11 are spectrogram image of the CpG islands of FIG. 10, limited to red and green colors;
  • FIG. 12 sets forth a series of denoised spectrograms according to the present disclosure
  • FIG. 13 are spectral images and edge measurements for green- and red-based spectrograms according to the present disclosure
  • FIG. 14 sets forth edges extracted from an exemplary RGB-based spectrogram and related CpG island classification associated therewith;
  • FIG. 15 sets forth a flowchart for an exemplary comparative histogram method/technique according to the present disclosure
  • FIGS. 16 and 17 are exemplary plots showing CpG island detection using edge histograms on spectrograms derived using color mapping;
  • FIG. 18 sets forth a flowchart for an exemplary genetic algorithm-support vector machine (GA-SVM) method/technique according to the present disclosure;
  • GA-SVM genetic algorithm-support vector machine
  • FIG. 19 sets forth a flowchart for an exemplary method/technique for generating a spectrovideo according to the present disclosure.
  • FIG. 20 is an image from an exemplary spectrovideo according to the present disclosure.
  • exemplary systems and methods support and/or utilize one or more of the following DNA spectral analysis techniques: (i) comparative histogram methodologies; (ii) selection/classification using support vector machines and genetic algorithms; and (iii) spectrovideo methodologies based on spectrogram extractions from DNA sequence data.
  • DNA spectrograms are generated in a conventional manner, as described in greater detail herein above with reference to FIGS. 1-9.
  • a conventional algorithm or technique for the generation of DNA spectrograms may be employed that entails the following five steps:
  • the sequence Uf kj provides a measure of the frequency content at frequency k, which is equivalent to an underlying period of N/k samples.
  • FIG. 7 presents exemplary normalized plots of the combined DFT values of FIG. 6.
  • CpG islands may be advantageously extracted from the DNA spectral images generated hereby.
  • CpG islands are important biological markers for the promoter regions of genes in organisms containing 5- methylcytosine in their genomes, and CpG islands play important roles in cell differentiation and in the regulation of gene expression in vertebrates.
  • CpG islands have been defined by Gardiner-Garden and Frommer as regions with at least 200 base pairs (bp), a C+G content greater than 50% and an observed/expected CpG ratio larger than 0.6.
  • CpG islands have also been defined by Takai and Jones as regions longer than 500 bp, with a C+G nucleotide content of at least 55% and an observed/expected CpG ratio of 0.65. It is noted that the Takai and Jones definition is targeted at returning CpG islands more likely to be associated with the 5 ' regions of genes and at excluding most AIu- repetitive elements. In both definitions, the observed/expected CpG ratio is given by
  • two exemplary spectrograms are providing showing a CpG island at the center.
  • the size of the STFT window is chosen to be 120 base pairs (bp), with an overlap of 119 bp between adjacent windows. It is noted that in the extraction of a CpG from a spectral image, it is generally not necessary to differentiate A from T, and C from G. Therefore, instead of using four color vectors respectively for the four nucleotide bases, two color vectors may be used, e.g., red (1, 0, 0) for A and T and green (0, 1, 0) for C and G. The corresponding spectrograms are shown in FIG.
  • the disclosed color selection technique permits and/or facilitates generation of images wherein features are more distinguishable, i.e., enhanced extraction performance is achieved by adopting optimal color scheme(s).
  • image feature detection methods may involve three steps: (i) image denoising, (ii) extraction of classification features, and (iii) decision-making by evaluating the classification features.
  • image denoising of the spectral images is not required, although enhanced results may generally be achieved by including an appropriate denoising step.
  • a raw spectrogram image contains noise, the removal of which can improve or enhance detection reliability, efficiency and/or performance.
  • Denoising of a spectrogram image can be achieved using one or more morphological operations. For example, by performing morphological opening followed by morphological closing, small regions of weak pixels can be removed. Thereafter, regions containing strong pixels that are close together can be merged. Denoising is generally undertaken separately in the green and red color spaces. The shape and size of the structural elements for the morphological operations are carefully chosen so that noise is filtered out, while useful details are retained in the spectrogram. Rectangular structuring elements with a height of one and a length of fifty pixels have been found to provide effective parameters for denoising operations in connection with the detection of CpG islands.
  • the intensity of the green color is generally stronger (presence of C and G) than the red (presence of A and T).
  • the intensity of the red color is typically evenly low - i.e., substantially uniform - in the region, whereas there is a larger fluctuation in intensity in the green space, which is evident from one or more clusters of bright spots.
  • systems and methods of the present disclosure advantageously facilitate enhanced extraction of classification features.
  • 'Sobel' edge detection is performed on the denoised spectrogram in the green and red spaces respectively.
  • the Sobel operator is a discrete differentiation operator that computes an approximation of the gradient of the image intensity function. At each point in the image, the result of the Sobel operator is either the corresponding gradient vector or the norm of this vector.
  • Alternative edge detection techniques may be employed, e.g., Canny edge detector, without departing from the spirit or scope of the present disclosure.
  • Sobel edge detection to a denoised spectrogram yields binary images of edges, which correspond to pixels having larger intensity differences from their neighbors. It has generally been found that there are more edge pixels for CpG islands in the green space than in the red space.
  • the binary images generated through edge detection are further processed by counting the number of edge pixels along the x-axis (STFT window position) and the y-axis (spectral frequency), respectively. Four histograms are obtained as a result: x- and y-histograms for the green and red spaces. Finally, the foregoing histograms are smoothed by computing moving averages for each.
  • Exemplary spectral images reflecting edge readings for green- and red-based spectrograms are set forth in FIG. 13.
  • the left column of FIG. 13 shows the original image, while the right column shows the corresponding image after applying Sobel edge detection with a square 2x2 mask.
  • the images on the right show horizontal and vertical edge histograms.
  • the extraction of classification features is influenced by a series of parameters that may be addressed according to the systems and methods of the present disclosure.
  • the parameters that affect the extraction of classification features and that are controlled according to the present disclosure are: (i) the method of edge detection, (ii) the threshold for edge detection, and (iii) the size of the moving-average window. DECISION-MAKING THROUGH EVALUATION OF CLASSIFICATION FEATURES
  • a classifier for CpG islands may be provided.
  • Two exemplary approaches for generating a classifier are (i) a fixed- threshold approach, and (ii) a genetic algorithm/support vector machine (GA-SVM) approach.
  • GA-SVM genetic algorithm/support vector machine
  • CpG islands are advantageously extracted in the following way:
  • the edges are extracted from a color spectrogram which maps the bases 'A', 'T' to the red color, and 'C, 'G' to the green color.
  • the edge pixels which may displayed in red and green, are extracted from the corresponding color spaces independently.
  • a further color e.g., a yellow color, may be used to display results associated with coexistence of both red and green edges.
  • the count of the green pixels in the histograms along the x-axis clearly exceeds that of the red pixels for the CpG island.
  • a CpG island is identified as being located from 1102 to 1322 nucleotides of the DNA segment.
  • the CpG islands based on Gardiner's and Takai's CpG definitions are also shown in FIG. 14, i.e., Gardiner (855, 1524) and Takai (744, 1243).
  • Gardiner 855, 1524
  • Takai 744, 1243
  • the CpG island identification criteria set forth herein is more stringent as compared to Gardiner's and Takai's definition/criteria, at least for purposes of the exemplary spectrogram presented in FIG. 14.
  • the CpG island identification criteria is adjustable through variation of the applicable parameter values.
  • an exemplary histogram comparative system and method involves the following steps, a flowchart for which is presented in FIG. 15.
  • the order in which the steps are presented herein is representative of the disclosed system/method, it is to be understood that the disclosed system and method are not limited to the order presented herein.
  • the disclosed system and method do not exclude the introduction of one or more additional steps that may further enhance or facilitate the identification process, nor are the disclosed system and method limited in scope to implementations entail each and every step disclosed herein, as is readily apparent from the detailed description provided herein.
  • the histograms can also represent combined colors. For example, C and G can be combined and represented by a green component and A and T can be combined to represent a red component;
  • DNA segments that satisfy the evaluation criteria are marked as repetitive element(s) and the start and end position are noted/recorded (e.g., CpG island).
  • DNA sequences that may exhibit repetitive characteristics at the structural level for whole genomes and/or across genomes Recently, it has been recognized that important functional roles may be performed by and/or associated with non-coding RNAs.
  • the DNA sequences that give rise to hairpin structures represent a class of such non-coding RNAs.
  • MicroRNAs are small RNAs that regulate gene expression post-transcriptionally. David Bartel, a biology professor at the
  • the disclosed processing techniques are typically implemented through appropriate software/programming that is run/operated on an appropriate processing unit.
  • the processing system may be free-standing, e.g., a personal computer, or associated with a network (intranet, extranet, distributed network that communicates across the Internet, etc.).
  • the processing unit/system typically communicates with appropriate memory/storage, e.g., for purposes of accessing software/programming, databases that contain parameters and values associated with the disclosed systems/methods, and for storage (both short-term and long-term) of values/data/images generated through the disclosed systems/methods.
  • the disclosed processing unit/system also typically communicates with one or more output systems for displaying and/or recording the values/data/images generated according to the present disclosure, e.g., printer(s), monitor(s), and the like.
  • the disclosed systems and methods are susceptible to computer and/or processor-based implementations, as are known to persons skilled in the art.
  • a support vector machine with genetic algorithm is utilized to evaluate and rank the quality of a set of features, e.g., a set of image-based features.
  • the disclosed evaluation/ranking functionality are effective to identify, for example, CpG islands.
  • recursive feature elimination method(s) and/or principal component analysis may be employed to find prominent features.
  • existing CpG island definitions like those by Gardiner and Takai, guide implementation of the disclosed systems and methods, although alternative definitions may be accommodated, as will be readily apparent to persons skilled in the art.
  • a typical goal of the disclosed GA-SVM approach/technique is to find features that are useful for CpG island classification.
  • the disclosed GA-SVM approach/technique generally involves use of a support vector machine with genetic algorithm to evaluate and rank the quality of a set of features, e.g., for identifying CpG islands.
  • the disclosed GA-SVM approach/technique may be employed to extract a predetermined number of features, e.g., 127 features, from each DNA segment having a given length, e.g., a DNA segment that is 200 bases in length.
  • CpG island definitions may be employed, e.g., Gardiner's and/or Takai's CpG island definition.
  • a large number of features is typically generated according to the disclosed GA-SVM approach/technique, e.g., 127 features for each spectrogram image.
  • 3206 DNA segments were used, such segments being converted to spectrograms.
  • the features sets are extracted from spectrograms representing CpG or non-CpG classes.
  • a predetermined percentage of the input data is used to "train" the support vector machine, e.g., two-thirds of the input data may be used for training the SVM (see table below).
  • the remaining data (e.g., one third of the total) are used for testing purposes according to the disclosed GA-SVM approach/technique. Preliminary results have shown that out of the 127 features noted above, the best feature set consists of 57 elements, and an optimum accuracy of 67% has been achieved.
  • the exemplary implementations are based on a color- mapping scheme that groups the bases 'A', 'T' and 'C, 'G' into the red and green colors, respectively.
  • other color mapping schemes may be employed according to the present disclosure, in which case it may be necessary to consider all three layers of color R, G, and B (or HSV).
  • the set of features and selection criteria may be adjusted, as appropriate, to address alternative color mapping schemes, as will be apparent to persons skilled in the art based on the detailed description provided herein.
  • FIGS. 16 and 17 CpG island detection results are presented, wherein edge histograms are employed n spectrograms derived using color mapping.
  • N STFT window size, q - overlap, p - viewing resolution (where M » p > N)
  • edge detection to DNA spectral image using a conventional edge detection method (e.g., Sobel or Canny edge detector);
  • a support vector machine classifier is employed; however, alternative classifiers may be employed without departing from the spirit or scope of the present disclosure, e.g., neural network(s), self-organizing map (SOM) techniques/systems and other classifiers known in the machine learning literature may be employed.
  • the classifier detects and classifies unknown input DNA sequences into sub-segments that have repetitive DNA structure(s) (e.g., CpG islands);
  • DNA segments that satisfy the evaluation criteria are marked as repetitive element(s) and the start and end positions are noted/recorded (e.g., CpG island).
  • FIG. 18 A flowchart for the exemplary GA-SVM system/method for feature selection and classification, as described herein above, is presented in FIG. 18. As with the comparative histogram/fixed threshold processing systems and methods described above, the disclosed GA-SVM systems/methods are typically implemented through appropriate software/programming that is run/operated on an appropriate processing unit.
  • the processing system may be free-standing, e.g., a personal computer, or associated with a network (intranet, extranet, distributed network that communicates across the Internet, etc.).
  • the processing unit/system typically communicates with appropriate memory/storage, e.g., for purposes of accessing software/programming, databases that contain parameters and values associated with the disclosed systems/methods, and for storage (both short-term and long-term) of values/data/images generated through the disclosed systems/methods.
  • the disclosed processing unit/system also typically communicates with one or more output systems for displaying and/or recording the values/data/images generated according to the present disclosure, e.g., printer(s), monitor(s), and the like.
  • printer(s), monitor(s) e.g., printer(s), monitor(s), and the like.
  • the disclosed comparative histogram/fixed threshold and GA-SVM systems/methods have wide ranging applicability and utility.
  • repetitive DNA spectral analysis can be used for fast whole genome analysis and for identifying/finding significant patterns for long DNA sequences.
  • the identification of such patterns can be used for epigenomic analysis of DNA sequences, which is important and/or useful for studying and diagnosing cancer, aging and developmental disorders.
  • systems and methods for creating spectrovideo from a spectrograms associated with a DNA sequence are disclosed.
  • the frequency spectrum of a very long DNA sequence e.g., a chromosome which might be 150 million bases long
  • exemplary systems and methods of the present disclosure facilitate the creation of a continuous video from spectrograms.
  • the disclosed spectrovideo essentially corresponds to "panning" across a genome or other DNA sequence of interest. With spectrovideo, visualization of the genome in a short amount of time and at a desired resolution is enabled.
  • analysis of the spectrovideo provides full genome analysis and permits detection of changes in full length DNA patterns.
  • the disclosed spectrovideo provides more resolution of the same sequence.
  • spectrovideos offer numerous advantages and/or functionalities, including:
  • the disclosed system/method for translating spectrograms into a spectrovideo may be implemented through software/computer programming.
  • software/programming is provided for operation on a processing unit/computer, such software being adapted to display the frequency spectrum of an entire DNA sequence (or desired portion thereof) by gradually panning the spectrogram window across the DNA sequence, e.g., from the 5' to the 3' end.
  • An exemplary program/algorithm for effectuating the disclosed spectrovideo is described herein. Reference is also made to the flowchart set forth in FIG. 19 hereto.
  • EXEMPLARY ALGORITHM/PROGRAM FOR CREATING SPECTROVIDEO (1) Input: DNA sequence of length M to disclosed system/method
  • N - STFT window size N - window overlap
  • p - viewing resolution the width of the video image
  • v - speed of viewing i.e., number of spectral image columns shifted per video frame (where M » p > N).
  • an exemplary image from a spectrovideo is set forth.
  • the disclosed spectrovideo-related system and method offers significant advantages for the review and analysis of DNA sequences, e.g., both for known and unknown biomarker detection.
  • scene change detection methods may be employed with respect to a spectrovideo to find breaks in linear visual features.
  • statistical features may be extracted from the spectral domain.
  • individual scenes from a full (or substantially complete) spectrovideo may be clustered using unsupervised clustering methods.
  • unsupervised video feature detection methods may be employed to identify and/or reveal genome-wide similarities at the spectral DNA level.
  • Such analytic techniques can thus be employed for automatic DNA analysis, e.g., to find gene networks, important motifs, spectrally and structurally repetitive DNA elements, and other prominent DNA patterns.
  • spectrograms may be employed for unsupervised exploration of gene regulatory elements and networks. Indeed, large scale spectrogram analysis to find important regulatory elements is contemplated according to the present disclosure. Unsupervised methods, such as hierarchical clustering, may be employed in order to determine the groups of most prevalent patterns. The most frequent patterns throughout a genome can generally be identified/located without relying on linear dependency of nucleotide occurrence (i.e., simple statistical measures). Traditional methods in bioinformatics use multiple sequence alignment in order to find ultra-conserved segments. However, with spectral analysis, the systems and methods of the present disclosure may be employed to identify evolutionary and/or slowly varying changes, and not ultra- but mostly conserved elements, that have occurred in the genome.
  • the systems and methods of the present disclosure facilitate scanning of the genome and focus on spectrally- conserved sequences - from the point of view of similar frequencies of occurring patterns. Rather than looking at linear nucleotide order, the disclosed systems/methods advantageously examine structural characteristics that may only be apparent from the spectral representation - and hardly discernible with sequence alignment.
  • An advantage of the disclosed technique/approach is that the distribution of each repetitive spectral pattern within a single chromosome may be visualized, e.g., across entire chromosomes and genomes. Indeed, the disclosed analytic techniques may be applied across genomes to identify both known and novel patterns.
  • Repeat elements e.g., starting with a few hundred base pairs to a few hundred thousand base pairs, such as AIu, short hairpin structures (e.g., microRNAs), SINEs, LINEs, and CpG islands, can be effectively characterized in this manner.
  • patterns at different resolutions can be shown: within 200bp windows and within lOOKbp long windows. This facilitates detection of new classes of repetitive elements.
  • certain repeat elements may be masked, e.g., elements that are of no interest to the user.
  • An exemplary method/algorithm is described herein below:
  • Step 1 For input DNA sequence (e.g., a chromosome), generate spectrogram S 1 of length L (L is the number of nucleotides), with a STFT window W (where W ⁇ L), and the window overlap is V, where V ⁇ W. Step 2. Move R nucleotides to the right and generate spectrogram S 1 until the end of the DNA sequence is reached.
  • L is the number of nucleotides
  • W where W ⁇ L
  • V V ⁇ W.
  • Step 3 With all the spectrograms generated in steps 1 and 2, perform unsupervised image based clustering (.e.g., k-means clustering, hierarchical clustering).
  • exemplary similarity metrics for use according to the disclosed method/algorithm include any image-based similarity metric, e.g., the Ll metric that generates C clusters.
  • the features for clustering can include: color, texture, specific objects that appear in the images: lines, squares, diagonals, etc.
  • Step 4 Find the largest cluster, take the cluster center, and perform search against a known genome resource to see the label class of the elements of this cluster. This can reveal the most repetitive elements on a particular chromosome. Step 5. Select one of (a) or (b):
  • Step 9 Increase W and go to step (1), with a given step size, until W reaches half of L, then go to step (10).
  • Step 10 Increase L and go to step (1).
  • Step 11 Summarize results at each level of V, W, and L.
  • the disclosed method/algorithm may be adapted for computer-based operation/implementation, thereby facilitating automated operation thereof. Indeed, the disclosed method/algorithm may be advantageously performed in an unsupervised manner, thereby generating V, W and L values for DNA sequences without user supervision and/or intervention.
  • novel elements by association may be identified using step 5, i.e., the disclosed method/algorithm facilitates identification of sequences having a potential significant similarity that had previously been unrecognized and/or unappreciated. Indeed, sequences from a first species can be efficiently and effectively compared against sequenced genomes from different species to determine and/or identify potentially novel elements within the DNA sequence for such species.
  • novel classes of elements may be identified from DNA sequences by the techniques identified in step 7 of the foregoing method/algorithm. These classes can be efficiently and effectively explored against other genomes according to the present disclosure. Further applications of the disclosed method/algorithm include:
  • Intragenome comparison An algorithm for large scale analysis can be applied to each chromosome of a studied genome. Then, all the cluster centers can be used to perform overall clustering to see functionally important elements (across chromosomes) for that genome.
  • Comparative genomics An algorithm for large scale analysis can be applied to each genome of the known 200+ sequenced genomes. Then, all the cluster centers can be used to perform overall clustering to see functionally conserved elements during the evolution.
  • scene change detection methods may be applied to a spectrovideo generated according tot the techniques described above to find breaks in important linear visual features. For each scene, statistical features from the spectral domain can be extracted. Furthermore, individual scenes of the full spectrovideo can be clustered using unsupervised clustering methods. Unsupervised video feature detection methods can then be employed to reveal genome-wide similarities at the spectral DNA level. The results of such unsupervised detection methods can then be used for automatic DNA analysis in order to find gene networks, important motifs, repetitive DNA elements and other prominent DNA patterns. An exemplary methodology/algorithm for undertaking such unsupervised detection is described herein below: Step 1. Generate spectrovideo for a given DNA sequence (e.g., a part or full chromosome);
  • Step 2 Extract features, e.g., horizontal and vertical edge histograms for a given window, color, length of edges, number of same colors on a particular column, etc.
  • Step 3. Find spectro-cuts, e.g., find continuous patterns using the extracted features - this technique is similar to finding "cuts" in film.
  • Step 4 Cluster scenes, e.g., store the features for each spectro-cut. Indeed, spectro-cuts may be clustered using these features, as if clustering scenes in a video.
  • Step 5 Find clusters with longest elements, e.g., sort order and visualize "scenes" with particular length.
  • Step 6 Query spectral elements of the same length, e.g., the ones that belong to a single scene.
  • Each segment corresponding to a spectro-cut may be advantageously checked against a known genomic resource (e.g., NCBI) to determine any known functional importance.
  • NCBI genomic resource

Landscapes

  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medical Informatics (AREA)
  • Health & Medical Sciences (AREA)
  • Data Mining & Analysis (AREA)
  • Evolutionary Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Theoretical Computer Science (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Bioethics (AREA)
  • Software Systems (AREA)
  • Public Health (AREA)
  • Evolutionary Computation (AREA)
  • Artificial Intelligence (AREA)
  • Epidemiology (AREA)
  • Databases & Information Systems (AREA)
  • Computer Vision & Pattern Recognition (AREA)
  • Chemical & Material Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Image Analysis (AREA)

Abstract

Spectrogram extraction from DNA sequence has been known since 2001. A DNA spectrogram is generated by applying Fourier transform to convert a symbolic DNA sequence consisting of letters A, T, C, G into a visual representation that highlights periodicities of co-occurrence of DNA patterns. Given a DNA sequence or whole genomes, with this method it is easy to generate a large number of spectrogram images. However, the difficult part is to elucidate where are the repetitive patterns and to associate a biological and clinical meaning to them. The present disclosure provides systems and methods that facilitate the location and/or identification of repetitive DNA patterns, such as CpG islands, AIu repeats, tandem repeats and various types of satellite repeats. These repetitive elements can be found within a chromosome, within a genome or across genomes of various species. The disclosed systems and methods apply image processing operators to find prominent features in the vertical and horizontal direction of the DNA spectrograms. Systems and methods for fast, full scale analysis of the derived images using supervised machine learning methods are also disclosed. The disclosed systems and methods for detecting and/or classifying repetitive DNA patterns include: (a) comparative histogram method, (b) feature selection and classification using support vector machines and genetic algorithms, and (c) generation of spectrovideo from a plurality of spectral images.

Description

METHODS AND SYSTEMS FOR IDENTIFICATION OF DNA PATTERNS THROUGH SPECTRAL ANALYSIS
BACKGROUND 1. Technical Field
The present disclosure is directed to systems and methods for facilitating DNA spectral analysis and, more particularly, to systems and methods that employ image processing techniques and/or signal processing methods to automate and/or expedite, in whole or in part, the processing of DNA sequence data. According to exemplary embodiments of the present disclosure, systems and methods are provided to support one or more of the following DNA spectral analysis techniques: (i) comparative histogram methodologies; (ii) selection/classification using support vector machines and genetic algorithms; and (iii) spectrovideo methodologies based on spectrogram extractions from DNA sequence data. 2. Background Art
Bioinformatics seeks to organize tremendous volumes of biological data into comprehensible information which can be used to derive useful knowledge. In the field of bioinformatics, techniques for spectral analysis of DNA sequences have been developed. Spectral analysis techniques generally represent an improvement over manual DNA pattern analysis techniques which aim at identifying DNA patterns serving as biological markers related to important life processes. Traditionally, automatic analyses are performed directly on strings of DNA sequences composed of the four characters A, T, C and G, which represent the four nucleotide bases. However, due to the tremendous length of DNA sequences (e.g., the length of the shortest human chromosome is 46.9Mb), the wide range of pattern spans associated with the limited character set, and the statistical nature of the problem, such an intuitive/manual approach is inefficient, if not impossible, for achieving the desired purpose. DNA spectral analysis offers an approach to systematically tackle the problem of deriving useful information from DNA sequence data. Generally, DNA spectral analysis involves an identification of the occurrences of each nucleotide base in a DNA sequence as an individual digital signal, and transforming each of the four nucleotide signals into a frequency domain. The magnitude of a frequency component can then be used to reveal how strongly a nucleotide base pattern is repeated at that frequency. A larger magnitude/value usually indicates a stronger presence of the repetition. To improve the readability of the results, the prior art discloses systems wherein each nucleotide base is represented by a color and the frequency spectrums of the four bases are combined and presented as a color spectrogram. These techniques are described by:
• D. Anastassiou, "Frequency-Domain Analysis of Biomolecular Sequences,"
Bioinformatics, Vol. 16, No. 12, December 2000, pp. 1073-1081; and
• D. Sussillo, A. Kundaje and D. Anastassiou, "Spectrogram Analysis of
Genomes," EURASIP Journal on Applied Signal Processing, Special Issue on Genomic Signal Processing, Vol. 2004, No. 1, January 2004, pp. 29-42. The translation of the magnitudes/values for nucleotide bases into a visual image, i.e., a spectrogram, is a powerful visualization tool for DNA analysis. The resultant pixel color is indicative of the relative intensity of the four bases at a particular frequency, and the representation of DNA sequences as color images allows patterns to be more easily identified by visual inspection. In general, the hue in a spectrogram region reflects its overall nucleotide composition, and bright lines and patches in a spectrogram reveal the existence of special repetitive patterns.
An algorithm or technique for the generation of DNA spectrograms can be summarized in five steps as follows.
(i) Formation of binary indicator sequences (BISs) iiAfn], uτ[n], utfn] and ugfnj for the four nucleotide bases. The BIS for a particular base takes the value of "1" at positions where the base exists and "0" otherwise. Thus, in an exemplary DNA sequence having a nucleotide sequence "AACTGGCATCCGGGAAT AAGGTCT", the BIS translates as follows:
AACTGGCATCCGGGAATAAGGTCT ... uA[n] 110000010000001101100000 ... uτ[n] 000100001000000010000101 ... uc[n] 001000100110000000000010 ... uG[n] 000011000001110000011000 ...
The foregoing exemplary BIS pattern is reproduced in FIG. 1 hereto. Based on the foregoing DNA sequence, the BIS values may be plotted as follows (reproduced in FIG. 2):
Figure imgf000005_0001
(ii) Discrete Fourier Transform (DFT) on BISs. The frequency spectrum of each base is then obtained by computing the DFT of its corresponding BIS using Equation (1):
N-I 2π -J—kn
Ux[k~\ = ∑ux[n\e N , k = 0, 1, ..., [N/2J + 1 X = A, T, C or G (1)
The sequence U[k] provides a measure of the frequency content at frequency k, which is equivalent to an underlying period oϊN/k samples (reproduced in FIG. 3).
Frequency, k
Figure imgf000006_0001
(in)Mapping of DTF values to RGB colors. The four DFT sequences are reduced to three sequences in the RGB space by the following set of linear equations, collectively designated as Equation (2):
Xr[k] = arUA[k] + trUT[k] + crUc[k] + grUG [k] Xg [k] = agUΛ[k] + tgUτ [k] + cgUc[k] + ggUG[k] (2) Xb [k] = abUΛ[k] + tbUT [k] + cbUc[k] + gbUG [k]
where (ar, ag, ab), (U, tg, tb), (cr, cg, cb) and (gr, gg, gb) are the color mapping vectors for the nucleotide bases A, T, C and G, respectively. The resultant pixel color (Xr[k], Xg[k], Xb[k]) is thus a superposition of the color mapping vectors weighted by the magnitude of the frequency component of their respective nucleotide base as set forth below and reproduced in FIG. 4 hereto.
)
)
)
Figure imgf000007_0001
FIGS. 5 and 6 further illustrate the mapping of DFT values to colors according to exemplary embodiments of the present disclosure. Thus, with reference to FIG. 5, color vectors are selected for the respective nucleotide bases A, T5C and G, respectively. In selecting color vectors, it is generally desirable to improve and/or enhance the color contrast of the DNA features. Based on exemplary color vectors, the DFT values are combined in color space, as shown in FIG. 6. Alternative mapping techniques and/or protocols may be employed, e.g., DFT values may be mapped to Hue Saturation Value (HSV space), YCrCb space, etc. (iv)Normalizing the pixel values. Before rendering the color spectrograms, the RGB values of each pixel are generally normalized such that they fall between 0 and 1. There are numerous ways to implement the normalization function. The simplest approach is to divide all values by the global maximum. However, such a one-step approach may degrade the overall color contrast of the image. A better method is to perform normalization at two levels: at a first level, all pixel values are divided by a statistical maximum, e.g., equal to the overall mean plus one standard deviation, such that after the initial operation, a majority of pixels have RGB values between 0 and 1; then, at a second level, for the remaining pixels with any of their RGB values greater than one, a second level of normalization is individually performed by dividing each of such pixel values by its local maximum max(xr, xg, xt). This two level approach prevents the overall intensity of the image from being excessively reduced by the more extreme pixel values and, as a result, the color contrast of the spectrogram image can be better preserved. FIG. 7 presents exemplary normalized plots of the combined DFT values of FIG. 6.
(v) Short-time Fourier Transform (STFT). Up to now, only a single Discrete Fourier Transform (DFT) window has been considered. For long DNA sequences, however, it may be necessary to repeat steps (i) to (iv) for DFT windows that are shifted along the sequence. This results in consecutive strips of color pixels, with each of the strips depicting the frequency spectrum of a local DNA segment. A DNA spectrogram is then formed by a concatenation of these strips. The images set forth below are reproduced in FIGS. 8 and 9 hereto.
a) 5'
Figure imgf000009_0001
Frequency
Color Spectrum of the DNA segment
b)
Size
Figure imgf000009_0002
Color Spectrogram of a DNA sequence
It is noted that the set of equations designated as equations (8) in the publication by D. Anastassiou ("Frequency-Domain Analysis of Biomolecular Sequences," Bioinformatics, Vol. 16, No. 12, December 2000, pp. 1073-1081) suggests that the order of steps (ii) and (iii) is reversible, i.e. it is possible to first reduce the four binary indicator sequences to three numerical sequences (xr, xg, xt) and then perform a Discrete Fourier Transform (DFT). This, however, needs further proof because the binary indicator sequences are not independent functions.
The appearance of a spectrogram is very much affected by the choice of the Short Term Fourier Transform (STFT) window size, the length of the overlapping sequence between adjacent windows, and the color mapping vectors. Basically, the window size determines the effective range of a pixel value in a spectrogram. A larger window results in a spectrogram that reveals statistics collected from longer DNA local segments and may be useful in identifying wider patterns. In general, the window size should be made several times larger than the length of the repetitive pattern of interest and smaller than the size of the region that contains the pattern. The window overlap determines the length of the DNA segment common to two adjacent STFT windows. Therefore, the larger the overlap, the more gradual is the transition of the frequency spectrum from one STFT window to the next. Smaller window intervals yield in higher image resolutions, thereby making it easier to extract features by image processing or visual inspection. However, smaller intervals also generally demand more computational resources.
With reference to U.S. Patent No. 6,287,773 to Newell, a method for detecting known blocks of functionally aligned protein sequences in a test nucleic acid sequence, e.g., in an uncharacterized EST, is disclosed. The Newell '773 method involves: (a) reverse translating the set of protein sequences to a set of functionally aligned nucleic acid sequences using codon-usage tables and creating a profile from the set of functionally aligned nucleic acid sequences; (b) constructing a first indicator function (adenine) for the profile; (c) constructing a second indicator function (adenine) for the test nucleic acid sequence; (d) computing the Fourier transform of each of the indicator functions; (e) complex conjugating the Fourier transform of the second indicator function; (f) multiplying the Fourier transform of the first indicator function and the complex conjugated Fourier transform of the second indicator function to obtain a Fourier transform of the number of matches of adenine bases; (g) repeating steps (b)-(f) for guanine, thymine, and cytosine; (h) summing the Fourier transforms of the number of matches for each base, respectively, to obtain the total Fourier transform; (i) computing the inverse Fourier transform of the total Fourier transform to obtain a complex series; and (j) taking the real part of the series to determine the total number of base matches for the variety of possible lags of the profile relative to the test sequence. The first indicator function allows the value at a given position to be continuous between 0 and 1 as a function of the percentage presence of adenine at a particular position. The method can then detect the presence of known blocks of functionally aligned protein sequences in a test nucleic acid sequence based on the total number of base matches for the variety of possible lags, i.e., to facilitate sequence matching. Despite efforts to date, a need remains for systems and methods that facilitate expeditious visualization of genomic information. In addition, a need remains for systems and methods that facilitate identification of repetitive DNA patterns, e.g., CpG islands, AIu repeats, non-coding RNAs, tandem repeats and various types of satellite repeats. A need remains for tools that can identify structurally or compositionally similar patterns that exhibit similar spectral properties. Such tools are to be contrasted with sequence alignment tools that seek to align sequences in linear order or nucleotide appearance. Still further, a need remains for systems and methods for facilitating rapid, full-scale analysis of spectral images using supervised and/or unsupervised machine learning techniques. Moreover, a need remains for systems and methods for increasing the resolution of spectral image sequences, e.g., to permit rapid visualization of an entire genome at a desired resolution. These and other needs are met by the systems and methods disclosed herein. SUMMARY OF THE DISCLOSURE
The present disclosure provides advantageous systems and methods for facilitating DNA spectral analysis and, more particularly, systems and methods that employ image processing techniques and/or signal processing methods to automate and/or expedite, in whole or in part, the processing of DNA sequence data. As described in greater detail herein, exemplary systems and methods of the present disclosure support one or more of the following DNA spectral analysis techniques: (i) comparative histogram methodologies; (ii) selection/classification using support vector machines and genetic algorithms; (iii) unsupervised classification and discovery of structurally novel DNA segments; and (iv) spectrovideo methodologies based on spectrogram extractions from DNA sequence data. The disclosed systems and methods offer numerous advantages, including (i) facilitating visualization of genomic information, (ii) identifying repetitive DNA patterns, e.g., CpG islands, AIu repeats, tandem repeats, satellite repeats, etc., (iii) rapid, full-scale analysis of spectral images using supervised and/or unsupervised machine learning techniques, and (iv) increasing the resolution of spectral image sequences, e.g., to permit rapid visualization of an entire genome at a varying and desired resolution.
According to a first aspect of the present disclosure, a DNA spectrogram is generated by applying Fourier transform to convert a symbolic DNA sequence consisting of letters A, T, C, G into a visual representation that highlights periodicities of cooccurrence of DNA patterns. The disclosed systems and methods facilitate the identification and/or location of repetitive DNA patterns by applying image processing operators to find prominent features in the vertical and horizontal direction of the DNA spectrograms. Rapid, full scale analysis of the derived spectral images is undertaken using supervised and unsupervised machine learning methods. In the supervised mode two exemplary methods to detect and classify repetitive DNA patterns according to the present disclosure include (a) a comparative histogram methodology, and (b) a technique that involves feature selection and classification using support vector machines and genetic algorithms.
The disclosed image processing operators are effective for identifying and/or locating DNA patterns, such as CpG islands, AIu repeats, non-coding RNAs (e.g., microRNAs and small nucleolar RNAs), tandem repeats, various type of satellite repeats, and the like. The image processing operators may be employed to identify and/or locate repetitive elements in a variety of biologic systems, e.g., within a chromosome, within a genome, or across genomes of various species. The disclosed system and method overcomes the limitations of existing methodologies, wherein a DNA sequence or genome is processed to generate huge numbers of spectrogram images, but such images fail to yield or elucidate the location of repetitive patterns and/or to associate a biological or clinical meaning to such repetitive patterns, in an efficient and reliable manner.
According to a second aspect of the present disclosure, a DNA spectrogram is generated by converting a DNA sequence to a binary indicator sequence and then applying short term Fourier transform and mapping to a color space in order to visualize the output. The DNA spectrogram is slid along DNA sequences to produce a video image. The video image - termed a "spectrovideo" - may be generated from very long DNA sequences to facilitate visualization thereof, e.g., long DNA sequences such as chromosomes or entire genomes. In contrast to a conventional DNA spectrogram of the same sequence, the disclosed spectrovideo provides enhanced resolution. In addition, the disclosed spectrovideo facilitates visualization of the genome in a short amount of time and at a desired resolution. Spectrovideo analysis may be employed to provide or facilitate a full genome analysis and/or to detect changes in full length DNA patterns (or desired portions thereof).
Scene change detection methods may be employed with respect to a spectrovideo to find breaks in linear visual features. Moreover, for each scene in a spectrovideo, statistical features may be extracted from the spectral domain. Furthermore, individual scenes from a full (or substantially complete) spectrovideo may be clustered using unsupervised clustering methods. Indeed, unsupervised video feature detection methods according to the present disclosure may be employed to identify and/or reveal genome- wide similarities at the spectral DNA level. Such analytic techniques can thus be employed for automatic DNA analysis, e.g., to find gene networks, important motifs, repetitive DNA elements, and other prominent DNA patterns. Additional advantageous features and functions of the disclosed systems and methods will be apparent from the detailed description which follows, particularly when read in conjunction with the appended figures. BRIEF DESCRIPTION OF APPENDED FIGURES
To assist those of ordinary skill in the art in making and using the disclosed systems and methods, reference is made to the accompanying figures, wherein:
FIG. 1 sets forth exemplary binary indicator sequences (BISs) for a DNA sequence according to spectral imaging techniques employed according to the present disclosure; FIG. 2 sets forth plots of the exemplary BISs set forth in FIG. 1 hereto;
FIG. 3 sets forth discrete Fourier transforms (DFTs) for the exemplary BISs of FIGS. 1 and 2;
FIG. 4 illustrates the mapping of the exemplary DFT values of FIG. 3 to color space;
FIG. 5 illustrates the mapping of the exemplary DFT values of FIG. 3 to color space based upon illustrative color vectors;
FIG. 6 sets forth the summation of DFT values in color space according to the present disclosure; FIG. 7 sets forth normalized plots of the DFT summation values in color space;
FIG. 8 is an exemplary color spectrum for a DNA sequence (reproduced in gray scale);
FIG. 9 is an exemplary concatenation of a plurality of color spectra strips for exemplary DNA segments according to the present disclosure; FIG. 10 are spectrogram images of exemplary CpG islands;
FIG. 11 are spectrogram image of the CpG islands of FIG. 10, limited to red and green colors;
FIG. 12 sets forth a series of denoised spectrograms according to the present disclosure; FIG. 13 are spectral images and edge measurements for green- and red-based spectrograms according to the present disclosure;
FIG. 14 sets forth edges extracted from an exemplary RGB-based spectrogram and related CpG island classification associated therewith; FIG. 15 sets forth a flowchart for an exemplary comparative histogram method/technique according to the present disclosure;
FIGS. 16 and 17 are exemplary plots showing CpG island detection using edge histograms on spectrograms derived using color mapping; FIG. 18 sets forth a flowchart for an exemplary genetic algorithm-support vector machine (GA-SVM) method/technique according to the present disclosure;
FIG. 19 sets forth a flowchart for an exemplary method/technique for generating a spectrovideo according to the present disclosure; and
FIG. 20 is an image from an exemplary spectrovideo according to the present disclosure.
DESCRIPTION OF EXEMPLARY EMBODIMENTS)
The systems and methods of the present disclosure facilitate DNA spectral analysis. As described herein, exemplary systems and methods support and/or utilize one or more of the following DNA spectral analysis techniques: (i) comparative histogram methodologies; (ii) selection/classification using support vector machines and genetic algorithms; and (iii) spectrovideo methodologies based on spectrogram extractions from DNA sequence data. Many benefits may be realized according to the present disclosure, e.g., (i) enhanced visualization of genomic information, (ii) identification of repetitive DNA patterns, e.g., CpG islands, AIu repeats, non-coding RNAs, tandem repeats, satellite repeats, etc., (iii) unsupervised classification and discovery of structurally novel DNA segments; (iv) rapid, full-scale analysis of spectral images using supervised and/or unsupervised machine learning techniques, and (iv) increased resolution of spectral image sequences, e.g., to permit rapid visualization of an entire genome at a desired resolution.
According to the disclosed systems and methods, DNA spectrograms are generated in a conventional manner, as described in greater detail herein above with reference to FIGS. 1-9. For example, a conventional algorithm or technique for the generation of DNA spectrograms may be employed that entails the following five steps:
(i) Formation of binary indicator sequences (BISs) UAfn], uτ[n], ucfn] and uβfn] for the four nucleotide bases. As noted above, an exemplary BIS pattern is reproduced in FIG. 1 hereto and a plot of the BIS values is presented in FIG. 2. (ii) Discrete Fourier Transform (DFT) on BISs. The frequency spectrum of each base is obtained by computing the DFT of its corresponding BIS using Equation (1) ( reproduced below):
N-I 2π
Ux[k] = ∑ux[n]e , k = 0, 1, ..., [N/lj + l X = A, T, C or G (1)
B=O
As illustrated in FIG. 3, the sequence Uf kj provides a measure of the frequency content at frequency k, which is equivalent to an underlying period of N/k samples.
(iii) Mapping of DTF values to RGB colors. The four DFT sequences are reduced to three sequences in the RGB space by a set of linear equations which are reproduced below:
Xr[k] = arUA[k] + trUT[k] + crUc[k] + grUG[k]
Xg[k] = agUA[k] + tgUT[k] + cgUc[k] + ggUG[k] (2)
Xb[k] = abUA[k] + tbUT[k] + cbUc[k] + gbUG [k]
where (ar, ag, ab), (tr, tg, tb), (cr, cg, cb) and (gr, gg, gb) are the color mapping vectors for the nucleotide bases A, T, C and G, respectively. The resultant pixel color ((Xr[k], Xg\k\, Xέ[k]) is thus a superposition of the color mapping vectors weighted by the magnitude of the frequency component of their respective nucleotide base (see FIG. 4). Mapping of DFT values to colors is illustrated in FIGS. 5 and 6
(iv) Normalizing the pixel values. Before rendering the color spectrograms, the RGB values of each pixel are generally normalized so as to fall between 0 and 1. FIG. 7 presents exemplary normalized plots of the combined DFT values of FIG. 6.
(v) Short-time Fourier Transform (STFT). A DNA spectrogram is formed by a concatenation of individual DNA sequence strips, where each strip generally depicts the frequency spectrum of a local DNA segment (see FIGS. 8 and 9). According to the present disclosure, CpG islands may be advantageously extracted from the DNA spectral images generated hereby. CpG islands are important biological markers for the promoter regions of genes in organisms containing 5- methylcytosine in their genomes, and CpG islands play important roles in cell differentiation and in the regulation of gene expression in vertebrates. CpG islands have been defined by Gardiner-Garden and Frommer as regions with at least 200 base pairs (bp), a C+G content greater than 50% and an observed/expected CpG ratio larger than 0.6. CpG islands have also been defined by Takai and Jones as regions longer than 500 bp, with a C+G nucleotide content of at least 55% and an observed/expected CpG ratio of 0.65. It is noted that the Takai and Jones definition is targeted at returning CpG islands more likely to be associated with the 5 ' regions of genes and at excluding most AIu- repetitive elements. In both definitions, the observed/expected CpG ratio is given by
(number of C x number of G / length of the segment). With reference to FIG. 10, two exemplary spectrograms are providing showing a CpG island at the center. The size of the STFT window is chosen to be 120 base pairs (bp), with an overlap of 119 bp between adjacent windows. It is noted that in the extraction of a CpG from a spectral image, it is generally not necessary to differentiate A from T, and C from G. Therefore, instead of using four color vectors respectively for the four nucleotide bases, two color vectors may be used, e.g., red (1, 0, 0) for A and T and green (0, 1, 0) for C and G. The corresponding spectrograms are shown in FIG. 11 and, in both images, the CpG islands contrast the background better. This choice of color vectors also permits consideration of only the red and green color components, while the blue component may be ignored. Thus, the disclosed color selection technique permits and/or facilitates generation of images wherein features are more distinguishable, i.e., enhanced extraction performance is achieved by adopting optimal color scheme(s).
Generally, image feature detection methods may involve three steps: (i) image denoising, (ii) extraction of classification features, and (iii) decision-making by evaluating the classification features. For purposes of the disclosed systems and methods, denoising of the spectral images is not required, although enhanced results may generally be achieved by including an appropriate denoising step. IMAGE DENOISING
A raw spectrogram image contains noise, the removal of which can improve or enhance detection reliability, efficiency and/or performance. Denoising of a spectrogram image can be achieved using one or more morphological operations. For example, by performing morphological opening followed by morphological closing, small regions of weak pixels can be removed. Thereafter, regions containing strong pixels that are close together can be merged. Denoising is generally undertaken separately in the green and red color spaces. The shape and size of the structural elements for the morphological operations are carefully chosen so that noise is filtered out, while useful details are retained in the spectrogram. Rectangular structuring elements with a height of one and a length of fifty pixels have been found to provide effective parameters for denoising operations in connection with the detection of CpG islands. Exemplary denoised spectrograms are presented in FIG. 12 hereto, wherein the left-hand images include the green and red channel images only, and the corresponding right-hand images after morphological "close" followed by "open" filter. EXTRACTION OF CLASSIFICATION FEATURES
It has been noted through visual inspection that in CpG islands, the intensity of the green color is generally stronger (presence of C and G) than the red (presence of A and T). In addition, the intensity of the red color is typically evenly low - i.e., substantially uniform - in the region, whereas there is a larger fluctuation in intensity in the green space, which is evident from one or more clusters of bright spots. To address the foregoing issues of uniformity/non-uniformity, systems and methods of the present disclosure advantageously facilitate enhanced extraction of classification features. Thus, according to exemplary embodiments of the present disclosure, 'Sobel' edge detection is performed on the denoised spectrogram in the green and red spaces respectively. As is generally known in the art, the Sobel operator is a discrete differentiation operator that computes an approximation of the gradient of the image intensity function. At each point in the image, the result of the Sobel operator is either the corresponding gradient vector or the norm of this vector. Alternative edge detection techniques may be employed, e.g., Canny edge detector, without departing from the spirit or scope of the present disclosure.
Application of Sobel edge detection to a denoised spectrogram yields binary images of edges, which correspond to pixels having larger intensity differences from their neighbors. It has generally been found that there are more edge pixels for CpG islands in the green space than in the red space. The binary images generated through edge detection are further processed by counting the number of edge pixels along the x-axis (STFT window position) and the y-axis (spectral frequency), respectively. Four histograms are obtained as a result: x- and y-histograms for the green and red spaces. Finally, the foregoing histograms are smoothed by computing moving averages for each.
Exemplary spectral images reflecting edge readings for green- and red-based spectrograms are set forth in FIG. 13. The left column of FIG. 13 shows the original image, while the right column shows the corresponding image after applying Sobel edge detection with a square 2x2 mask. The images on the right show horizontal and vertical edge histograms.
Thus, the extraction of classification features is influenced by a series of parameters that may be addressed according to the systems and methods of the present disclosure. Among the parameters that affect the extraction of classification features and that are controlled according to the present disclosure are: (i) the method of edge detection, (ii) the threshold for edge detection, and (iii) the size of the moving-average window. DECISION-MAKING THROUGH EVALUATION OF CLASSIFICATION FEATURES
Once the classification features of a spectral image have been identified, it is contemplated according to disclosed systems/methods that a classifier for CpG islands may be provided. Two exemplary approaches for generating a classifier are (i) a fixed- threshold approach, and (ii) a genetic algorithm/support vector machine (GA-SVM) approach.
In the disclosed fixed-threshold approach, CpG islands are advantageously extracted in the following way:
(i) (x histogram green - x histogram red) > threshold (= 2 in this example) (ii) Regions satisfying (1) of length < 200 bp are rejected.
(iii) Regions satisfying both (1) & (2) separated by less than 100 bp are merged.
With reference to FIG. 14, the edges are extracted from a color spectrogram which maps the bases 'A', 'T' to the red color, and 'C, 'G' to the green color. The edge pixels, which may displayed in red and green, are extracted from the corresponding color spaces independently. A further color, e.g., a yellow color, may be used to display results associated with coexistence of both red and green edges. As is apparent from exemplary FIG. 13, the count of the green pixels in the histograms along the x-axis clearly exceeds that of the red pixels for the CpG island. Based on CpG island identification criteria set froth above, a CpG island is identified as being located from 1102 to 1322 nucleotides of the DNA segment. For comparison purposes, the CpG islands based on Gardiner's and Takai's CpG definitions are also shown in FIG. 14, i.e., Gardiner (855, 1524) and Takai (744, 1243). Of note, the CpG island identification criteria set forth herein is more stringent as compared to Gardiner's and Takai's definition/criteria, at least for purposes of the exemplary spectrogram presented in FIG. 14. As will be readily apparent to persons skilled in the art, the CpG island identification criteria is adjustable through variation of the applicable parameter values.
Thus, in a broader sense, an exemplary histogram comparative system and method according to the present disclosure involves the following steps, a flowchart for which is presented in FIG. 15. Although the order in which the steps are presented herein is representative of the disclosed system/method, it is to be understood that the disclosed system and method are not limited to the order presented herein. Moreover, the disclosed system and method do not exclude the introduction of one or more additional steps that may further enhance or facilitate the identification process, nor are the disclosed system and method limited in scope to implementations entail each and every step disclosed herein, as is readily apparent from the detailed description provided herein. Exemplary Comparative Histogram/Fixed Threshold Processing System and Method
1. Input a DNA sequence of length M to the disclosed system/method: Parameters: N - STFT window size, q - overlap, p - viewing resolution (where M » p > N)
2. Convert the input DNA sequence of size N into a binary indicator sequence;
3. Apply short term Fourier transform (STFM) to the binary indicator sequence and produce a frequency domain vector;
4. Map the frequency domain vectors for A, T, C and G into a color space, e.g., RGB (red-green-blue) or HSV (hue-saturation-value) color space; 5. Apply edge detection to the DNA spectral image using a conventional edge detection method (e.g., a Sobel or Canny edge detector);
6. Compute horizontal and vertical histograms for red, green, blue components from RGB (or HSV components if HSV color space is used) separately by using edge projection. The histograms can also represent combined colors. For example, C and G can be combined and represented by a green component and A and T can be combined to represent a red component;
7. Evaluate histogram data. For example, for CpG islands, the following extraction criteria may be employed: (1) (x histogram green - x histogram red) > threshold (e.g., equal to 2)
(2) Regions satisfying (1) of length < 200 bp are rejected.
(3) Regions satisfying both (1) & (2) separated by less than 100 bp are merged.
8. DNA segments that satisfy the evaluation criteria are marked as repetitive element(s) and the start and end position are noted/recorded (e.g., CpG island). There are other types of DNA sequences that may exhibit repetitive characteristics at the structural level for whole genomes and/or across genomes. Recently, it has been recognized that important functional roles may be performed by and/or associated with non-coding RNAs. The DNA sequences that give rise to hairpin structures represent a class of such non-coding RNAs. For example, MicroRNAs (miRNAs) are small RNAs that regulate gene expression post-transcriptionally. David Bartel, a biology professor at the
Whitehead Institute at the Massachusetts Institute of Technology, predicts that miRNAs could regulate one third of all human genes (Cell, Cell Press, January 14, 2005). The disclosed processing techniques are typically implemented through appropriate software/programming that is run/operated on an appropriate processing unit. The processing system may be free-standing, e.g., a personal computer, or associated with a network (intranet, extranet, distributed network that communicates across the Internet, etc.). The processing unit/system typically communicates with appropriate memory/storage, e.g., for purposes of accessing software/programming, databases that contain parameters and values associated with the disclosed systems/methods, and for storage (both short-term and long-term) of values/data/images generated through the disclosed systems/methods. The disclosed processing unit/system also typically communicates with one or more output systems for displaying and/or recording the values/data/images generated according to the present disclosure, e.g., printer(s), monitor(s), and the like. Thus, in short, the disclosed systems and methods are susceptible to computer and/or processor-based implementations, as are known to persons skilled in the art. Turning to exemplary GA-SVM approaches/techniques according to the present disclosure, a support vector machine with genetic algorithm is utilized to evaluate and rank the quality of a set of features, e.g., a set of image-based features. In exemplary embodiments, the disclosed evaluation/ranking functionality are effective to identify, for example, CpG islands. In addition, recursive feature elimination method(s) and/or principal component analysis may be employed to find prominent features. Of note, existing CpG island definitions, like those by Gardiner and Takai, guide implementation of the disclosed systems and methods, although alternative definitions may be accommodated, as will be readily apparent to persons skilled in the art. A typical goal of the disclosed GA-SVM approach/technique is to find features that are useful for CpG island classification.
The disclosed GA-SVM approach/technique generally involves use of a support vector machine with genetic algorithm to evaluate and rank the quality of a set of features, e.g., for identifying CpG islands. Thus, for example, the disclosed GA-SVM approach/technique may be employed to extract a predetermined number of features, e.g., 127 features, from each DNA segment having a given length, e.g., a DNA segment that is 200 bases in length. According to exemplary embodiments of the present disclosure, the composition of the feature set is as follows (total features = 127):
• Number of green pixels (1)
• Number of red pixels (1)
• Number of green edge pixels ( 1 )
• Number of red edge pixels (1)
• Number of green edge pixels minus number of red edge pixels (1)
• Red edge histogram count along the frequency axis (61)
• Green edge histogram count along the frequency axis (61)
Various CpG island definitions may be employed, e.g., Gardiner's and/or Takai's CpG island definition. Based on the selected definition, a large number of features is typically generated according to the disclosed GA-SVM approach/technique, e.g., 127 features for each spectrogram image. In total, according to an exemplary embodiment of the present disclosure, 3206 DNA segments were used, such segments being converted to spectrograms. The features sets are extracted from spectrograms representing CpG or non-CpG classes. According to the present disclosure, a predetermined percentage of the input data is used to "train" the support vector machine, e.g., two-thirds of the input data may be used for training the SVM (see table below). The remaining data (e.g., one third of the total) are used for testing purposes according to the disclosed GA-SVM approach/technique. Preliminary results have shown that out of the 127 features noted above, the best feature set consists of 57 elements, and an optimum accuracy of 67% has been achieved.
An exemplary GA-SVM approach/technique according to the present disclosure involved the following operational parameters:
• Total number of sequences:
Figure imgf000027_0001
• Number of trials: 100,000
As described herein, the exemplary implementations are based on a color- mapping scheme that groups the bases 'A', 'T' and 'C, 'G' into the red and green colors, respectively. In such implementations, it is only necessary to consider the red and green color components in the extraction algorithms for identification of CpG islands. However, other color mapping schemes may be employed according to the present disclosure, in which case it may be necessary to consider all three layers of color R, G, and B (or HSV). The set of features and selection criteria may be adjusted, as appropriate, to address alternative color mapping schemes, as will be apparent to persons skilled in the art based on the detailed description provided herein. With reference to FIGS. 16 and 17, CpG island detection results are presented, wherein edge histograms are employed n spectrograms derived using color mapping.
Exemplary GA-SVM System and Method for Feature Selection and Classification 1. Input: DNA sequence of length M to the disclosed system/method:
Parameters: N - STFT window size, q - overlap, p - viewing resolution (where M » p > N)
2. Convert the input DNA sequence of size N into a binary indicator sequence; 3. Apply short term Fourier transform (STFM) to the binary indicator sequence and produce a frequency domain vector
4. Map the frequency domain vectors for A, T, C and G into a color space, e.g., RGB or HSV;
5. Apply edge detection to DNA spectral image using a conventional edge detection method (e.g., Sobel or Canny edge detector);
6. Compute horizontal and vertical histograms for red, green, blue components (or HSV components) separately by using edge projection. The histograms can also represent combined colors. For example, C and G can be combined and represented by a green component and A and T can be combined to represent a red component; 7. Evaluate and rank a set of prominent spectral features using a feature selection method using a support vector machine with genetic algorithm. Alternatively, a recursive feature elimination method and/or principal component analysis may be employed to find prominent features. For example, the following features can be used: 127 features (extracted from a DNA segment which is N bases long, where N can vary; in an exemplary embodiment, N is 200 bp long)
- Number of green pixels ( 1 )
- Number of red pixels (1) - Number of green edge pixels (1)
- Number of red edge pixels (1)
- Number of green edge pixels minus number of red edge pixels ( 1 )
- Red edge histogram count along the frequency axis (61)
- Green edge histogram count along the frequency axis (61) 8. Design/implement a classifier using a subset of the top ranking features from the previous step. In an exemplary embodiment of the present disclosure, a support vector machine classifier is employed; however, alternative classifiers may be employed without departing from the spirit or scope of the present disclosure, e.g., neural network(s), self-organizing map (SOM) techniques/systems and other classifiers known in the machine learning literature may be employed. The classifier detects and classifies unknown input DNA sequences into sub-segments that have repetitive DNA structure(s) (e.g., CpG islands);
9. DNA segments that satisfy the evaluation criteria are marked as repetitive element(s) and the start and end positions are noted/recorded (e.g., CpG island). A flowchart for the exemplary GA-SVM system/method for feature selection and classification, as described herein above, is presented in FIG. 18. As with the comparative histogram/fixed threshold processing systems and methods described above, the disclosed GA-SVM systems/methods are typically implemented through appropriate software/programming that is run/operated on an appropriate processing unit. The processing system may be free-standing, e.g., a personal computer, or associated with a network (intranet, extranet, distributed network that communicates across the Internet, etc.). The processing unit/system typically communicates with appropriate memory/storage, e.g., for purposes of accessing software/programming, databases that contain parameters and values associated with the disclosed systems/methods, and for storage (both short-term and long-term) of values/data/images generated through the disclosed systems/methods. The disclosed processing unit/system also typically communicates with one or more output systems for displaying and/or recording the values/data/images generated according to the present disclosure, e.g., printer(s), monitor(s), and the like. Thus, the disclosed systems and methods are susceptible to computer and/or processor-based implementations, as are known to persons skilled in the art.
The disclosed comparative histogram/fixed threshold and GA-SVM systems/methods have wide ranging applicability and utility. For example, repetitive DNA spectral analysis can be used for fast whole genome analysis and for identifying/finding significant patterns for long DNA sequences. Indeed, the identification of such patterns can be used for epigenomic analysis of DNA sequences, which is important and/or useful for studying and diagnosing cancer, aging and developmental disorders.
It is important to note that both supervised and unsupervised classifications can be performed without mapping the FFT result into a color space. Features can be extracted directly from the 4-transformed binary indicator sequences. In this case, instead of an RGB spectrogram image, the input is the FFT transformed binary indicator sequences. Normalization can be an optional step. The rest of the analysis is performed on a feature vectors consisting of the 4 transformed indicator sequences combined to represent a full vector - representing each DNA segment. SYSTEMS/METHODS FOR CREATING SPECTRO VIDEO FROM SPECTROGRAMS
According to a further aspect of the present disclosure, systems and methods for creating spectrovideo from a spectrograms associated with a DNA sequence are disclosed. The frequency spectrum of a very long DNA sequence (e.g., a chromosome which might be 150 million bases long) cannot be fit into a single spectrogram frame at any desired resolution. Instead of looking at individual images, exemplary systems and methods of the present disclosure facilitate the creation of a continuous video from spectrograms. The disclosed spectrovideo essentially corresponds to "panning" across a genome or other DNA sequence of interest. With spectrovideo, visualization of the genome in a short amount of time and at a desired resolution is enabled. In addition, analysis of the spectrovideo provides full genome analysis and permits detection of changes in full length DNA patterns. In contrast to a spectrogram of the same sequence, the disclosed spectrovideo provides more resolution of the same sequence.
As disclosed herein, the creation and use of spectrovideos offers numerous advantages and/or functionalities, including:
• Continuous viewing of the entire genome, as opposed to saving and displaying individual spectrograms; • Time savings: spectral video is produced by stitching the DNA spectrograms together, whereas viewing of spectrograms one at a time is very time consuming;
• Analysis of the continuous linear genomic patterns. At a low resolution, these patterns might extend beyond a single spectrogram.
• Visualizing long sequences at a desired resolution and fine level of detail.
• The ability to change the resolution as viewing of a spectrovideo progresses. For example, when an interesting pattern appears, the disclosed system/method facilitates an immediate "dive" into more detail for a particular subsequence.
The disclosed system/method for translating spectrograms into a spectrovideo may be implemented through software/computer programming. According to an exemplary embodiment of the present disclosure, software/programming is provided for operation on a processing unit/computer, such software being adapted to display the frequency spectrum of an entire DNA sequence (or desired portion thereof) by gradually panning the spectrogram window across the DNA sequence, e.g., from the 5' to the 3' end. An exemplary program/algorithm for effectuating the disclosed spectrovideo is described herein. Reference is also made to the flowchart set forth in FIG. 19 hereto. EXEMPLARY ALGORITHM/PROGRAM FOR CREATING SPECTROVIDEO (1) Input: DNA sequence of length M to disclosed system/method
Parameters: N - STFT window size, q - window interval (N - window overlap), p - viewing resolution (the width of the video image), and v - speed of viewing, i.e., number of spectral image columns shifted per video frame (where M » p > N).
(2) Initialize: s=l; r=l.
(3) Starting at position s, for a p-long segment or sub-sequence of the full DNA sequence;
(4) Starting at position r, convert an input DNA sequence of size N into a binary indicator sequence;
(5) Apply short term Fourier transform to a binary indicator sequence and produce a frequency domain vector; (6) Map the frequency domain vectors for A, T, C and G into a color space, e.g., RGB or HSV color space;
(7) If (r - s + 1) < p, visualize the result and move forward q nucleotides: r = r + q. Go to step 4.
(8) If no DNA spectral image previously shown, display the spectral image, r = r + q. Go to step 4.
(9) If (r - s + 1) < p + vq, remove the first column from the spectral image and add the latest generated column at the end. r = r + q. Go to step 4.
(10) If (r - s + 1) >= p + vq , display spectral image, s = s + vq. r = r + q.
(11) If (r + N - 1) <= M, go to step 4. (12) Adjust the speed of viewing v as per user request. Normal speed is one column shift per video frame.
With reference to FIG. 20, an exemplary image from a spectrovideo is set forth. As is readily apparent from the image of FIG. 20 (which suffers from being stagnant - not a moving image), the disclosed spectrovideo-related system and method offers significant advantages for the review and analysis of DNA sequences, e.g., both for known and unknown biomarker detection. Moreover, scene change detection methods may be employed with respect to a spectrovideo to find breaks in linear visual features. For each scene in a spectrovideo, statistical features may be extracted from the spectral domain. Furthermore, individual scenes from a full (or substantially complete) spectrovideo may be clustered using unsupervised clustering methods. Indeed, unsupervised video feature detection methods, as discussed in greater detail below, may be employed to identify and/or reveal genome-wide similarities at the spectral DNA level. Such analytic techniques can thus be employed for automatic DNA analysis, e.g., to find gene networks, important motifs, spectrally and structurally repetitive DNA elements, and other prominent DNA patterns. UNSUPERVISED SPECTROGRAM AND SPECTROVIDEO ANALYSIS
According to exemplary embodiments of the present disclosure, spectrograms may be employed for unsupervised exploration of gene regulatory elements and networks. Indeed, large scale spectrogram analysis to find important regulatory elements is contemplated according to the present disclosure. Unsupervised methods, such as hierarchical clustering, may be employed in order to determine the groups of most prevalent patterns. The most frequent patterns throughout a genome can generally be identified/located without relying on linear dependency of nucleotide occurrence (i.e., simple statistical measures). Traditional methods in bioinformatics use multiple sequence alignment in order to find ultra-conserved segments. However, with spectral analysis, the systems and methods of the present disclosure may be employed to identify evolutionary and/or slowly varying changes, and not ultra- but mostly conserved elements, that have occurred in the genome.
Using large scale spectrogram analysis techniques, the systems and methods of the present disclosure facilitate scanning of the genome and focus on spectrally- conserved sequences - from the point of view of similar frequencies of occurring patterns. Rather than looking at linear nucleotide order, the disclosed systems/methods advantageously examine structural characteristics that may only be apparent from the spectral representation - and hardly discernible with sequence alignment. An advantage of the disclosed technique/approach is that the distribution of each repetitive spectral pattern within a single chromosome may be visualized, e.g., across entire chromosomes and genomes. Indeed, the disclosed analytic techniques may be applied across genomes to identify both known and novel patterns. Long repetitive elements, e.g., starting with a few hundred base pairs to a few hundred thousand base pairs, such as AIu, short hairpin structures (e.g., microRNAs), SINEs, LINEs, and CpG islands, can be effectively characterized in this manner. In addition, patterns at different resolutions can be shown: within 200bp windows and within lOOKbp long windows. This facilitates detection of new classes of repetitive elements. Before applying applicable algorithm(s), certain repeat elements may be masked, e.g., elements that are of no interest to the user. An exemplary method/algorithm is described herein below:
Step 1. For input DNA sequence (e.g., a chromosome), generate spectrogram S 1 of length L (L is the number of nucleotides), with a STFT window W (where W < L), and the window overlap is V, where V< W. Step 2. Move R nucleotides to the right and generate spectrogram S1 until the end of the DNA sequence is reached.
Step 3. With all the spectrograms generated in steps 1 and 2, perform unsupervised image based clustering (.e.g., k-means clustering, hierarchical clustering). Exemplary similarity metrics for use according to the disclosed method/algorithm include any image-based similarity metric, e.g., the Ll metric that generates C clusters. The features for clustering can include: color, texture, specific objects that appear in the images: lines, squares, diagonals, etc.
Step 4. Find the largest cluster, take the cluster center, and perform search against a known genome resource to see the label class of the elements of this cluster. This can reveal the most repetitive elements on a particular chromosome. Step 5. Select one of (a) or (b):
(a) Randomly choose P spectrograms that are farthest from the cluster center and perform a class label search. Verify that they also belong to the same class. (b) Visualize for the user the spectrograms and the types of class labels of all elements in spectrogram set. If a spectrogram is in a cluster, where the center is known but the spectrogram that is further away from the cluster center is unknown, then designate novel element as the class label of cluster center and visualize the difference. Step 6. Continue with the second largest cluster, and perform/repeat steps (5) and
(6). Proceed with the next largest cluster until the cluster center - class label is unknown. Denote that K clusters have known labels and U clusters have unknown labels. Step 7. For all the U clusters with unknown labels, with substantial cluster size (typically, at least half of the maximum number of elements in the largest cluster): find the prevalence of the pattern, statistical distribution within the same chromosome. Find statistical distribution across chromosomes. Step 8. Increase V and go to step (1) with a given step size (e.g., step size =1), until V reaches half of W, then go to step (9).
Step 9. Increase W and go to step (1), with a given step size, until W reaches half of L, then go to step (10).
Step 10. Increase L and go to step (1). Step 11. Summarize results at each level of V, W, and L.
As will be readily apparent to persons skilled in the art, the disclosed method/algorithm may be adapted for computer-based operation/implementation, thereby facilitating automated operation thereof. Indeed, the disclosed method/algorithm may be advantageously performed in an unsupervised manner, thereby generating V, W and L values for DNA sequences without user supervision and/or intervention.
According to the present disclosure, novel elements by association may be identified using step 5, i.e., the disclosed method/algorithm facilitates identification of sequences having a potential significant similarity that had previously been unrecognized and/or unappreciated. Indeed, sequences from a first species can be efficiently and effectively compared against sequenced genomes from different species to determine and/or identify potentially novel elements within the DNA sequence for such species. In addition, novel classes of elements may be identified from DNA sequences by the techniques identified in step 7 of the foregoing method/algorithm. These classes can be efficiently and effectively explored against other genomes according to the present disclosure. Further applications of the disclosed method/algorithm include:
• Intragenome comparison: An algorithm for large scale analysis can be applied to each chromosome of a studied genome. Then, all the cluster centers can be used to perform overall clustering to see functionally important elements (across chromosomes) for that genome.
• Comparative genomics: An algorithm for large scale analysis can be applied to each genome of the known 200+ sequenced genomes. Then, all the cluster centers can be used to perform overall clustering to see functionally conserved elements during the evolution.
SPECTROVIDEO ANALYSIS TO FIND GENOME-WIDE PATTERNS
In further exemplary embodiments and implementations of the present disclosure, scene change detection methods may be applied to a spectrovideo generated according tot the techniques described above to find breaks in important linear visual features. For each scene, statistical features from the spectral domain can be extracted. Furthermore, individual scenes of the full spectrovideo can be clustered using unsupervised clustering methods. Unsupervised video feature detection methods can then be employed to reveal genome-wide similarities at the spectral DNA level. The results of such unsupervised detection methods can then be used for automatic DNA analysis in order to find gene networks, important motifs, repetitive DNA elements and other prominent DNA patterns. An exemplary methodology/algorithm for undertaking such unsupervised detection is described herein below: Step 1. Generate spectrovideo for a given DNA sequence (e.g., a part or full chromosome);
Step 2. Extract features, e.g., horizontal and vertical edge histograms for a given window, color, length of edges, number of same colors on a particular column, etc. Step 3. Find spectro-cuts, e.g., find continuous patterns using the extracted features - this technique is similar to finding "cuts" in film.
Step 4. Cluster scenes, e.g., store the features for each spectro-cut. Indeed, spectro-cuts may be clustered using these features, as if clustering scenes in a video.
Step 5. Find clusters with longest elements, e.g., sort order and visualize "scenes" with particular length.
Step 6. Query spectral elements of the same length, e.g., the ones that belong to a single scene. Each segment corresponding to a spectro-cut may be advantageously checked against a known genomic resource (e.g., NCBI) to determine any known functional importance. Thus, the systems, methods and techniques disclosed herein provide a series of valuable tools in assessing, determining and/or identifying repetitive patterns in DNA sequences, and for associating biologic and/or clinical significance to such patterns. Although the systems, methods and techniques have been described with reference to exemplary embodiments thereof, it is to be understood that the present disclosure is not limited to such exemplary embodiments. Rather, as will be readily apparent to persons skilled in the art, the disclosed systems, methods and techniques are susceptible to wide ranging variations, modifications and/or enhancements, without departing from either the spirit or scope of the present disclosure. The present disclosure expressly encompasses such variations, modifications and/or enhancements within the scope hereof.

Claims

1. A method for assessing the presence of a notable region in a DNA sequence, comprising: a. providing a DNA sequence; b. creating a plurality of spectrograms based on the DNA sequence; c. performing at least one of the following functions with respect to the plurality of spectrograms: (i) creation of a spectrovideo, (ii) comparative histogram analysis, (iii) large scale feature selection and classification (e.g., of known DNA functional elements), and (iv) unsupervised classification and discovery of structurally novel DNA elements.
2. A method according to claim 1, wherein the DNA sequence represents a genome, a chromosome or a portion thereof
3. A method according to any of the preceding claims, wherein creation of the plurality of spectrograms includes one or more of the following steps: (i) input of a DNA sequence, (ii) conversion of a DNA sequence into a binary indicator sequence, (iii) application of short term Fourier transform to a binary indicator sequence to produce a frequency domain vector, (iv) map frequency domain vectors into color space, (v) application of edge detection to a DNA spectral image; and (vi) computation of horizontal and vertical histograms.
4. A method according to any of the preceding claims, wherein creation of the spectrovideo involves an algorithm that is adapted to run on a processing unit.
5. A method according to claim 4, wherein the algorithm includes: (a) Input: DNA sequence of length M; Parameters: N - STFT window size, q - window interval (N - window overlap), p - viewing resolution (the width of the video image), and v - speed of viewing, i.e., number of spectral image columns shifted per video frame (where M » p > N); (b) Initialize : s= 1 ; r= 1.
(c) Starting at position s, for a p-long segment or sub-sequence of the full DNA sequence;
(d) Starting at position r, convert an input DNA sequence of size N into a binary indicator sequence; (e) Apply short term Fourier transform to a binary indicator sequence and produce a frequency domain vector;
(f) Map the frequency domain vectors for A, T, C and G into a color space, e.g., RGB or HSV color space;
(g) If (r - s + 1) < p, visualize the result and move forward q nucleotides: r = r + q. Go to step (d).
(h) If no DNA spectral image previously shown, display the spectral image, r = r + q. Go to step (d).
(i) If (r - s + 1) < p + vq, remove the first column from the spectral image and add the latest generated column at the end. r = r + q. Go to step (d). (j) If (r - s + 1) >= p + vq , display spectral image, s = s + vq. r = r + q.
(k) If (r + N - 1) <= M, go to step (d).
(1) Adjust the speed of viewing v as per user request. Normal speed is one column shift per video frame.
6. A method according to any of the preceding claims, wherein comparative histogram analysis includes:
(a). Input a DNA sequence of length M; Parameters: N - STFT window size, q - overlap, p - viewing resolution (where M » p > N); (b) Convert the input DNA sequence of size N into a binary indicator sequence;
(c) Apply short term Fourier transform (STFM) to the binary indicator sequence and produce a frequency domain vector;
(d) Map the frequency domain vectors for A, T, C and G into a color space, e.g., RGB (red-green-blue) or HSV (hue-saturation- value) color space;
(e) Apply edge detection to the DNA spectral image using a conventional edge detection method (e.g., a Sobel or Canny edge detector);
(f) Compute horizontal and vertical histograms for red, green, blue components (or HSV components) separately by using edge projection. The histograms can also represent combined colors. For example, C and G can be combined and represented by a green component and A and T can be combined to represent a red component;
(g) Evaluate histogram data. For example, for CpG islands, the following extraction criteria may be employed: (i) (x histogram green - x histogram red) > threshold (e.g., equal to 2)
(ii) Regions satisfying (1) of length < 200 bp are rejected, (iii) Regions satisfying both (1) & (2) separated by less than 100 bp are merged. (h) DNA segments that satisfy the evaluation criteria are marked as repetitive element(s) and the start and end position are noted/recorded (e.g., CpG island).
7. A method according to claim any of the preceding claims, wherein feature selection and classification includes: (a). Input: DNA sequence of length M; Parameters: N - STFT window size, q - overlap, p - viewing resolution (where M » p > N)
(b) Convert the input DNA sequence of size N into a binary indicator sequence;
(c) Apply short term Fourier transform (STFM) to the binary indicator sequence and produce a frequency domain vector
(d) Map the frequency domain vectors for A, T, C and G into a color space, e.g., RGB or HSV;
(e) Apply edge detection to DNA spectral image using a conventional edge detection method (e.g., Sobel or Canny edge detector); (f) Compute horizontal and vertical histograms for red, green, blue components (or HSV components) separately by using edge projection. The histograms can also represent combined colors. For example, C and G can be combined and represented by a green component and A and T can be combined to represent a red component; (g). Evaluate and rank a set of prominent spectral features using a feature selection method using a support vector machine with genetic algorithm. Alternatively, a recursive feature elimination method and/or principal component analysis may be employed to find prominent features. For example, the following features can be used: 127 features (extracted from a DNA segment which is N bases long, where N can vary; in an exemplary embodiment, N is 200 bp long)
- Number of green pixels ( 1 )
- Number of red pixels (1) - Number of green edge pixels (1)
- Number of red edge pixels (1)
- Number of green edge pixels minus number of red edge pixels ( 1 )
- Red edge histogram count along the frequency axis (61)
- Green edge histogram count along the frequency axis (61) (h) Design/implement a classifier using a subset of the top ranking features from the previous step. In an exemplary embodiment of the present disclosure, a support vector machine classifier is employed; however, alternative classifiers may be employed without departing from the spirit or scope of the present disclosure, e.g., neural network(s), self-organizing map (SOM) techniques/systems and other classifiers known in the machine learning literature may be employed. The classifier detects and classifies unknown input DNA sequences into sub-segments that have repetitive DNA structure(s) (e.g., CpG islands);
(i) DNA segments that satisfy the evaluation criteria are marked as repetitive element(s) and the start and end positions are noted/recorded (e.g., CpG island).
8. A method according to any of the preceding claims, further comprising unsupervised exploration of the DNA sequence.
9. A method according to claim 8, wherein the unsupervised exploration includes a clustering technique.
10. A method according to claims 8 or 9, wherein the unsupervised exploration includes:
Step 1. For input DNA sequence (e.g., a chromosome), generate spectrogram S 1 of length L (L is the number of nucleotides), with a STFT window W (where W < L), and the window overlap is V, where V< W.
Step 2. Move R nucleotides to the right and generate spectrogram S1 until the end of the DNA sequence is reached.
Step 3. With all the spectrograms generated in steps 1 and 2, perform unsupervised image based clustering (.e.g., k-means clustering, hierarchical clustering). Exemplary similarity metrics for use according to the disclosed method/algorithm include any image-based similarity metric, e.g., the Ll metric that generates C clusters. The features for clustering can include: color, texture, specific objects that appear in the images: lines, squares, diagonals, etc.
Step 4. Find the largest cluster, take the cluster center, and perform search against a known genome resource to see the label class of the elements of this cluster. For example, this can reveal that AIu is the most repetitive element on this chromosome.
Step 5. Select one of (a) or (b):
(a) Randomly choose P spectrograms that are farthest from the cluster center and perform a class label search. Verify that they also belong to the same class.
(b) Visualize for the user the spectrograms and the types of class labels of all elements in spectrogram set. If a spectrogram is in a cluster, where the center is known but the spectrogram that is further away from the cluster center is unknown, then designate novel element as the class label of cluster center and visualize the difference.
Step 6. Continue the second largest cluster, and perform/repeat steps (5) and (6). Proceed with the next largest cluster until the cluster center - class label is unknown. Denote that K clusters have known labels and U clusters have unknown labels.
Step 7. For all the U clusters with unknown labels, with substantial cluster size: find the prevalence of the pattern, statistical distribution within the same chromosome. Find statistical distribution across chromosomes. Step 8. Increase V and go to step (1) with a given step size (e.g., step size =1), until V reaches half of W, then go to step (9).
Step 9. Increase W and go to step (1), with a given step size, until W reaches half of L, then go to step (10).
Step 10. Increase L and go to step (1). Step 11. Summarize results at each level of V, W, and L.
11. A method according to any of the preceding claims, wherein one or more DNA patterns are identified.
12. A method according to claim 11, wherein the one or more DNA patterns includes at least one of a CpG island, one or more AIu repeats, one or more non-coding RNAs, one or more tandem repeats, and one or more satellite repeats.
13. A system that is adapted to operate and/or perform any of the preceding methods.
14. A system according to claim 13, comprising at least one processor and programming that is adapted to implement, in whole or in part, the method steps recited in one or more of the preceding claims.
15. A system or method according to any of the preceding claims, wherein supervised and/or unsupervised classifications.
16. A system or method according to claim 15, wherein the supervised and/or unsupervised classifications are performed without mapping the Fourier transform result into a color space.
17. A system or method according to claim 16, wherein one or more features is extracted directly from the Fourier-transformed binary indicator sequences.
18. A system or method according to claim 17, wherein the recited analysis is performed on feature vectors consisting of the indicator sequences combined that are combined to represent a full vector.
19. A system or method according to claim 18, wherein a full vector represents each DNA segment.
20. A system or method according to any of the preceding claims, wherein normalization is an optional step.
PCT/IB2007/050762 2006-03-10 2007-03-07 Methods and systems for identification of dna patterns through spectral analysis WO2007105150A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US12/282,435 US8189892B2 (en) 2006-03-10 2007-03-07 Methods and systems for identification of DNA patterns through spectral analysis
EP07713221A EP1999663A2 (en) 2006-03-10 2007-03-07 Methods and systems for identification of dna patterns through spectral analysis
CN200780008687.1A CN101401101B (en) 2006-03-10 2007-03-07 Methods and systems for identification of DNA patterns through spectral analysis
JP2008557880A JP5297207B2 (en) 2006-03-10 2007-03-07 DNA pattern identification method and system through spectral analysis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US78156806P 2006-03-10 2006-03-10
US60/781,568 2006-03-10

Publications (2)

Publication Number Publication Date
WO2007105150A2 true WO2007105150A2 (en) 2007-09-20
WO2007105150A3 WO2007105150A3 (en) 2008-04-24

Family

ID=38509861

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2007/050762 WO2007105150A2 (en) 2006-03-10 2007-03-07 Methods and systems for identification of dna patterns through spectral analysis

Country Status (7)

Country Link
US (1) US8189892B2 (en)
EP (1) EP1999663A2 (en)
JP (1) JP5297207B2 (en)
CN (1) CN101401101B (en)
RU (1) RU2466458C2 (en)
TW (1) TW200741192A (en)
WO (1) WO2007105150A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2187328A1 (en) 2008-11-18 2010-05-19 Koninklijke Philips Electronics N.V. Method and device for efficient searching of DNA sequence based on energy bands of DNA spectrogram
EP2228742A1 (en) 2009-03-10 2010-09-15 Koninklijke Philips Electronics N.V. Efficient distribution method for frequency sorting in spectral video analysis of DNA sequences
US9844255B2 (en) 2008-05-30 2017-12-19 Che-Wen Lin Cover-type containing structure for flexible enclosures
CN109800337A (en) * 2018-12-06 2019-05-24 成都网安科技发展有限公司 A kind of multi-mode canonical matching algorithm suitable for big alphabet
CN109818623A (en) * 2019-01-16 2019-05-28 上海上塔软件开发有限公司 A kind of living electric apparatus power curve line compression algorithm based on feature templates

Families Citing this family (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2466458C2 (en) * 2006-03-10 2012-11-10 Конинклейке Филипс Электроникс, Н.В. Methods and systems for identifying dna patterns through spectral analysis
EP2425240A4 (en) 2009-04-30 2012-12-12 Good Start Genetics Inc Methods and compositions for evaluating genetic markers
TWI399661B (en) * 2009-08-21 2013-06-21 A system for analyzing and screening disease related genes using microarray database
US9163281B2 (en) 2010-12-23 2015-10-20 Good Start Genetics, Inc. Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction
US20120191356A1 (en) * 2011-01-21 2012-07-26 International Business Machines Corporation Assembly Error Detection
WO2012177792A2 (en) 2011-06-24 2012-12-27 Sequenom, Inc. Methods and processes for non-invasive assessment of a genetic variation
US9984198B2 (en) 2011-10-06 2018-05-29 Sequenom, Inc. Reducing sequence read count error in assessment of complex genetic variations
US9367663B2 (en) 2011-10-06 2016-06-14 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
WO2013052907A2 (en) 2011-10-06 2013-04-11 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10424394B2 (en) 2011-10-06 2019-09-24 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10196681B2 (en) 2011-10-06 2019-02-05 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US8688388B2 (en) 2011-10-11 2014-04-01 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
EP2768983A4 (en) 2011-10-17 2015-06-03 Good Start Genetics Inc Analysis methods
LT2805280T (en) 2012-01-20 2022-12-27 Sequenom, Inc. Diagnostic processes that factor experimental conditions
US8209130B1 (en) 2012-04-04 2012-06-26 Good Start Genetics, Inc. Sequence assembly
US8812422B2 (en) 2012-04-09 2014-08-19 Good Start Genetics, Inc. Variant database
US10227635B2 (en) 2012-04-16 2019-03-12 Molecular Loop Biosolutions, Llc Capture reactions
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US10504613B2 (en) 2012-12-20 2019-12-10 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US8787626B2 (en) * 2012-05-21 2014-07-22 Roger G. Marshall OMNIGENE software system
US20130324417A1 (en) * 2012-06-04 2013-12-05 Good Start Genetics, Inc. Determining the clinical significance of variant sequences
US10497461B2 (en) 2012-06-22 2019-12-03 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US10482994B2 (en) 2012-10-04 2019-11-19 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
CN113160896B (en) * 2012-11-07 2024-08-16 生命技术公司 Video tool for digital PCR data
RU2538138C2 (en) * 2012-11-09 2015-01-10 Елена Андреевна Чирясова Method of studying fluorescent properties and spectral characteristics of nucleotide successions of dna by quantum-bound spectrum of irradiation of dyes with free fluorophoric groups
US20130309666A1 (en) 2013-01-25 2013-11-21 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
WO2014152421A1 (en) 2013-03-14 2014-09-25 Good Start Genetics, Inc. Methods for analyzing nucleic acids
LT2981921T (en) 2013-04-03 2023-02-27 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
IL309903A (en) 2013-05-24 2024-03-01 Sequenom Inc Methods and processes for non-invasive assessment of genetic variations
EP3005200A2 (en) 2013-06-03 2016-04-13 Good Start Genetics, Inc. Methods and systems for storing sequence read data
KR102299305B1 (en) 2013-06-21 2021-09-06 시쿼넘, 인코포레이티드 Methods and processes for non-invasive assessment of genetic variations
BR112016007401B1 (en) 2013-10-04 2023-04-11 Sequenom, Inc. METHOD FOR DETERMINING THE PRESENCE OR ABSENCE OF A CHROMOSOMAL ANEUPLOIDY IN A SAMPLE
CA2925111C (en) 2013-10-07 2024-01-16 Sequenom, Inc. Methods and processes for non-invasive assessment of chromosome alterations
US10851414B2 (en) 2013-10-18 2020-12-01 Good Start Genetics, Inc. Methods for determining carrier status
WO2015057565A1 (en) 2013-10-18 2015-04-23 Good Start Genetics, Inc. Methods for assessing a genomic region of a subject
EP3105695B1 (en) * 2014-02-13 2022-06-01 Illumina, Inc. Integrated consumer genomic services
WO2015175530A1 (en) 2014-05-12 2015-11-19 Gore Athurva Methods for detecting aneuploidy
EP3760739A1 (en) 2014-07-30 2021-01-06 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
WO2016040446A1 (en) 2014-09-10 2016-03-17 Good Start Genetics, Inc. Methods for selectively suppressing non-target sequences
CA2999708A1 (en) 2014-09-24 2016-03-31 Good Start Genetics, Inc. Process control for increased robustness of genetic assays
EP3023884A1 (en) * 2014-11-21 2016-05-25 Thomson Licensing Method and apparatus for generating fingerprint of an audio signal
WO2016112073A1 (en) 2015-01-06 2016-07-14 Good Start Genetics, Inc. Screening for structural variants
US20180089368A1 (en) * 2015-06-02 2018-03-29 Koninklijke Philips N.V. Methods, systems and apparatus for subpopulation detection from biological data
US20180305757A1 (en) * 2015-10-16 2018-10-25 The Regents Of The University Of California Repetitive Element (RE)-based Genome Analysis and Dynamic Genetics Surveillance Systems
EP3491560A1 (en) 2016-07-27 2019-06-05 Sequenom, Inc. Genetic copy number alteration classifications
CN109952382B (en) 2016-08-08 2023-11-14 豪夫迈·罗氏有限公司 Base recognition by random sequencing methods
US9943505B2 (en) 2016-09-09 2018-04-17 Corcept Therapeutics, Inc. Glucocorticoid receptor modulators to treat pancreatic cancer
US10216899B2 (en) 2016-10-20 2019-02-26 Hewlett Packard Enterprise Development Lp Sentence construction for DNA classification
US11694768B2 (en) 2017-01-24 2023-07-04 Sequenom, Inc. Methods and processes for assessment of genetic variations
JP6240804B1 (en) * 2017-04-13 2017-11-29 大▲連▼大学 Filtered feature selection algorithm based on improved information measurement and GA
CN107437001B (en) * 2017-07-03 2020-03-27 微梦创科网络科技(中国)有限公司 Method and system for converting information sequence into vectorized data
CN108009402A (en) * 2017-07-25 2018-05-08 北京工商大学 A kind of method of the microbial gene sequences disaggregated model based on dynamic convolutional network
US20190114388A1 (en) * 2017-10-16 2019-04-18 Genomic Vision Sa Detection, measurement, and analysis of dna replication signals
US10810408B2 (en) 2018-01-26 2020-10-20 Viavi Solutions Inc. Reduced false positive identification for spectroscopic classification
US11656174B2 (en) 2018-01-26 2023-05-23 Viavi Solutions Inc. Outlier detection for spectroscopic classification
US11009452B2 (en) * 2018-01-26 2021-05-18 Viavi Solutions Inc. Reduced false positive identification for spectroscopic quantification
CN108363905B (en) * 2018-02-07 2019-03-08 南京晓庄学院 A kind of CodonPlant system and its remodeling method for the transformation of plant foreign gene
US11380422B2 (en) * 2018-03-26 2022-07-05 Uchicago Argonne, Llc Identification and assignment of rotational spectra using artificial neural networks
EP3843033B1 (en) * 2018-08-22 2024-05-22 GeneMind Biosciences Company Limited Method for constructing sequencing template based on image, and base recognition method and device
CN112288783B (en) * 2018-08-22 2021-06-29 深圳市真迈生物科技有限公司 Method for constructing sequencing template based on image, base identification method and device
EP4286809A4 (en) * 2021-03-03 2024-01-10 Mitsubishi Electric Corporation Signal processing apparatus, control circuit, storage medium, and signal processing method
JP2023016243A (en) * 2021-07-21 2023-02-02 パナソニックIpマネジメント株式会社 Learning device, learning method, and nondestructive inspection system
CN116230094A (en) * 2023-02-09 2023-06-06 中国科学院深圳先进技术研究院 DNA encoding method, system, equipment and storage medium based on waveform characteristic storage

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5580728A (en) * 1994-06-17 1996-12-03 Perlin; Mark W. Method and system for genotyping
US6142681A (en) * 1999-02-22 2000-11-07 Vialogy Corporation Method and apparatus for interpreting hybridized bioelectronic DNA microarray patterns using self-scaling convergent reverberant dynamics
US6136541A (en) * 1999-02-22 2000-10-24 Vialogy Corporation Method and apparatus for analyzing hybridized biochip patterns using resonance interactions employing quantum expressor functions
US6287773B1 (en) * 1999-05-19 2001-09-11 Hoeschst-Ariad Genomics Center Profile searching in nucleic acid sequences using the fast fourier transformation
US6728642B2 (en) * 2001-03-29 2004-04-27 E. I. Du Pont De Nemours And Company Method of non-linear analysis of biological sequence data
US6950755B2 (en) * 2001-07-02 2005-09-27 City Of Hope Genotype pattern recognition and classification
US20040101873A1 (en) * 2002-02-06 2004-05-27 Went Gregory T. Method and apparatus for validating DNA sequences without sequencing
AU2003256479A1 (en) 2002-07-11 2004-02-02 The Research Foundation Of State University Of New York A method of using g-matrix fourier transformation nuclear magnetic resonance (gft nmr) spectroscopy for rapid chemical shift assignment and secondary structure determination of proteins
RU2466458C2 (en) * 2006-03-10 2012-11-10 Конинклейке Филипс Электроникс, Н.В. Methods and systems for identifying dna patterns through spectral analysis

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FIERS MARK W E J ET AL: "DNAVis: interactive visualization of comparative genome annotations." BIOINFORMATICS (OXFORD, ENGLAND) 1 FEB 2006, vol. 22, no. 3, 1 February 2006 (2006-02-01), pages 354-355, XP002452663 ISSN: 1367-4803 *
HALL R ET AL: "A rapid method for illustrating features in both coding and non-coding regions of a genome" BIOINFORMATICS (OXFORD), vol. 20, no. 6, 12 April 2004 (2004-04-12), pages NIL_0641-NIL_0650, XP002452662 ISSN: 1367-4803 *
SUSSILLO D ET AL: "Spectrogram analysis of genomes" EURASIP JOURNAL ON APPLIED SIGNAL PROCESSING HINDAWI USA, vol. 2004, no. 1, 1 January 2004 (2004-01-01), pages 29-42, XP002452661 ISSN: 1110-8657 cited in the application *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9844255B2 (en) 2008-05-30 2017-12-19 Che-Wen Lin Cover-type containing structure for flexible enclosures
EP2187328A1 (en) 2008-11-18 2010-05-19 Koninklijke Philips Electronics N.V. Method and device for efficient searching of DNA sequence based on energy bands of DNA spectrogram
WO2010058321A1 (en) * 2008-11-18 2010-05-27 Koninklijke Philips Electronics N.V. Method and device for efficient searching of dna sequence based on energy bands of dna spectrogram
JP2012509545A (en) * 2008-11-18 2012-04-19 コーニンクレッカ フィリップス エレクトロニクス エヌ ヴィ Method and apparatus for efficiently searching DNA sequence based on energy band of DNA spectrumgram
EP2228742A1 (en) 2009-03-10 2010-09-15 Koninklijke Philips Electronics N.V. Efficient distribution method for frequency sorting in spectral video analysis of DNA sequences
WO2010103459A1 (en) 2009-03-10 2010-09-16 Koninklijke Philips Electronics N.V. Efficient distribution method for frequency sorting in spectral video analysis of dna sequences
CN109800337A (en) * 2018-12-06 2019-05-24 成都网安科技发展有限公司 A kind of multi-mode canonical matching algorithm suitable for big alphabet
CN109800337B (en) * 2018-12-06 2023-07-11 成都网安科技发展有限公司 Multi-mode regular matching algorithm suitable for large alphabet
CN109818623A (en) * 2019-01-16 2019-05-28 上海上塔软件开发有限公司 A kind of living electric apparatus power curve line compression algorithm based on feature templates
CN109818623B (en) * 2019-01-16 2022-12-13 上海上塔软件开发有限公司 Life electric appliance power curve online compression algorithm based on characteristic template

Also Published As

Publication number Publication date
CN101401101A (en) 2009-04-01
JP5297207B2 (en) 2013-09-25
US20090129647A1 (en) 2009-05-21
US8189892B2 (en) 2012-05-29
RU2466458C2 (en) 2012-11-10
TW200741192A (en) 2007-11-01
WO2007105150A3 (en) 2008-04-24
CN101401101B (en) 2014-06-04
EP1999663A2 (en) 2008-12-10
JP2009529723A (en) 2009-08-20
RU2008140168A (en) 2010-04-20

Similar Documents

Publication Publication Date Title
US8189892B2 (en) Methods and systems for identification of DNA patterns through spectral analysis
CN111276252B (en) Construction method and device of tumor benign and malignant identification model
EP4250143A2 (en) Systems and methods for spectral unmixing of microscopic images using pixel grouping
CA2371718A1 (en) Methods for normalization of experimental data
CN112599199A (en) Analysis method suitable for 10x single cell transcriptome sequencing data
CN116189763A (en) Single sample copy number variation detection method based on second generation sequencing
CN113823356B (en) Methylation site identification method and device
Zintzaras et al. Forest classification trees and forest support vector machines algorithms: Demonstration using microarray data
Khalilabad et al. Fully automatic classification of breast cancer microarray images
US8374798B2 (en) Apparatus, method, and computer program product for determining gene function and functional groups using chromosomal distribution patterns
Dimitrova et al. Analysis and visualization of DNA spectrograms: open possibilities for the genome research
EP2310968B1 (en) A method for spectral dna analysis
US7689365B2 (en) Apparatus, method, and computer program product for determining gene function and functional groups using chromosomal distribution patterns
WO2008129458A1 (en) A method for data mining dna frequency based spectra
Georgoulaki Classification of Pointillist paintings using colour and texture features
US20070288540A1 (en) Sorting points into neighborhoods (spin)
KR102405732B1 (en) Method and appratus for cell clustering
Bucur et al. Frequency sorting method for spectral analysis of DNA sequences
WO2008129459A2 (en) A method for visualizing a dna sequence
Punitha Extraction of Co-Expressed Degs From Parkinson Disease Microarray Dataset Using Partition Based Clustering Techniques
Sheshkal et al. ML-Peaks: Chip-seq peak detection pipeline using machine learning techniques
Bijnens et al. Spectral map-analysis: a method to analyze gene expression data
CN116206680A (en) Method, device, equipment and storage medium for detecting tandem repeat area
Bucur et al. Alignment method for spectrograms of DNA sequences
Symons Analysis and visualization of gene expression data

Legal Events

Date Code Title Description
REEP Request for entry into the european phase

Ref document number: 2007713221

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2007713221

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2008557880

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 12282435

Country of ref document: US

Ref document number: 4809/CHENP/2008

Country of ref document: IN

Ref document number: 200780008687.1

Country of ref document: CN

NENP Non-entry into the national phase

Ref country code: DE