RU2538138C2 - Method of studying fluorescent properties and spectral characteristics of nucleotide successions of dna by quantum-bound spectrum of irradiation of dyes with free fluorophoric groups - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and represents method of spectral analysis of fluorescent properties of DNA nucleotide successions. Claimed invention can be applied for genetic diagnostics, research of mitogenetic irradiation of cells, study of coding hereditary and proliferative information. Method includes preparation of water solutions of dyes of basic fluorescence colours. Background fluorescence of dye is measured in respective detection channels by means of fluorescent detector FDG-001. DNA sample is added to dye solution in quantity 150-200 ng. Fluorescence of dye solutions is measured. Results of analysis are registered in form of presentation of values in conventional units of positive or negative increase of fluorescence of dyes relative to their initial background before addition of DNA sample in form of building columnar diagrams or curves of signal growth dynamics in time. Results of dye fluorescence growth are interpreted.

EFFECT: claimed invention makes it possible to determine nucleotide rebuildings of telomeric DNA ends, point mutations, polymorphisms of gens, chromosome rebuildings, and change of karyotype or cell genome.

15 cl, 16 dwg, 1 tbl, 6 ex

Description

Technical field

The invention relates to the field of molecular genetics and quantum cell biophysics and is intended to detect the fluorescence properties of DNA sequences in a wide range of light spectra, including ultraviolet, visible and infrared. The invention can find application in basic research on the spectral nature of mitogenetic radiation and the role of changes in nucleotide rearrangements of the terminal regions of telomeric DNA in the process of activation of cell division. In this regard, the claimed method allows to study the mechanisms of spectral coding of proliferative information in the cell. Its application for the study of gene sequences allows us to understand the mechanisms of quantum saturation of gene structures as a way of laser-optical recording and spectral coding of hereditary information.

The claimed method is the basis of DNA spectral fluorescence analysis - a new area of research in biology and medicine. It can be used in diagnostics and therapeutic purposes to obtain information on the effect of changes in the length and nucleotide endings of telomeric overhangs on the intensity and spectral characteristics of the light energy that regulates cell division. The method can be used to compile spectral maps and color markers of the resulting fluorescence of gene regions, their regulatory elements and entire gene sequences (gene mapping), chromosome sections, entire chromosomes and the whole genome as a whole (chromosomal and genomic mapping). In this sense, the invention allows spectral diagnostics of point mutations of genes, chromosomal rearrangements and any changes in the karyotype and genome of the cell. At the same time, penetration into the mechanisms of spectral coding of genetic information provides unique opportunities for exposure to it using physical light sources or fluorescent molecules.

State of the art

The generally accepted information about the fluorescence of DNA is based on the idea that it is weakly intense and is located in the ultraviolet region of the spectrum. The absorbing properties of DNA are mainly determined by the maximum absorption of nitrogen bases in the near ultraviolet (260 nm). The radiative properties of DNA are also determined by the properties of their constituent bases. Purines make the main contribution to the fluorescence of DNA. In an aqueous solution, the maximum fluorescence of DNA falls at the peak of guanine emission (358 nm). The fluorescence of adenine and thymine in an aqueous solution is much weaker and corresponds to 380 nm. Thus, according to the basic concepts in science, DNA fluorescence is in the ultraviolet region of the spectrum. This is the so-called generally accepted fluorescence of DNA, which is readily available for registration by direct spectrophotometric methods.

Controversial to this day is the existence of DNA fluorescence in the visible range of the spectrum, the study of which is difficult by classical spectrophotometric methods. However, in the works of the research group F.A. Poppa (Germany) provides information on registering DNA and chromosome radiation using a photomultiplier technique in a wide range of light waves from 300 to 800 nm in the form of very weak fields (Porr FA Electromagnetic Bioinformation. Munchen-Baltimore. Urban und Schwarzenberg, 1979; Popp FA, Nagl W., Li KH, Scholz W., Weingartner O., Wolf R. Biophoton emission. New evidence for coherence and DNA as source. Cell Biophys. 1984; 6 (1): 33-52).

Registration of such ultra-weak DNA radiation in the visible wavelength range is very difficult for direct analysis and is based on the use of highly sensitive signal amplifying photomultiplier detectors (Wijk E.R., Wijk RV Multi-site recording and spectral analysis of spontaneous photon emission from human body. Forsch Komplementarmed Klass Naturheilkd. 2005; 12 (2): 96-106) or high-sensitivity photon counters (Inaba N. Super-high sensitivity systems for detection and spectral analysis of ultraweak photon emission from biological cells and tissues. Experientia. 1988; 44 (7) : 550-559).

At present, there are no widespread methods for detecting DNA fluorescence in the visible spectrum by direct spectrophotometric methods with the necessary sensitivity in order to undeniably recognize its existence. Moreover, the sensitivity deficiencies of direct methods, even using the photomultiplier technique, have not allowed to date to establish a relationship between a specific nucleotide sequence and radiation in various regions of the visible spectrum. There are also no methods to link the main types of nitrogenous bases with radiation in a specific region of the visible spectrum.

The difficulty in studying the fluorescence properties of DNA has led to the creation of methods for indirect analysis through the study of fluorescence associated with dye molecules. However, it should be noted that all known indirect methods relate to the study of DNA fluorescence only in the ultraviolet region without considering the waves of the visible spectrum. They are based on the fact that some molecules of fluorescent dyes spontaneously bind to DNA, exhibiting even more intense fluorescence in a bound state. This is due to the fact that the excitation spectrum of these dyes corresponds to the fluorescence spectrum of DNA in the UV range. Thus, dyes play the role of peculiar witness molecules, which, due to an increase in the intrinsic fluorescence of the visible range in a state structurally associated with DNA, indicate a change in its fluorescence properties in the UV range. In this case, until now, the possible contribution of DNA sequences to an increase in the fluorescence of dyes in the visible range due to intrinsic fluorescence of DNA in the visible spectrum of the same wavelength has not been revealed.

The following substances are most widely used for the manifestation of the UV-fluorescent properties of DNA: ethidium bromide (EtBr), acridine orange, and DAPI. Many dyes, including the widely used ethidium bromide and acridine orange, bind to DNA through intercalation. In this case, the aromatic ring of the fluorophore molecule wedges between the bases of the two helices, that is, a structural interaction occurs. A significant drawback of the use of these dyes is a violation of the integrity of DNA. Moreover, local extension and lengthening of the double helix change its structure and properties, including fluorescence characteristics (Neville DM and Davies DR The interaction of acridine dyes with DNA: AnX-ray diffraction and optical investigation. J. Mol. Biol. 1966; 17: 57-74).

Another type of fluorophores, for example 4,6-diamidino-2-phenylindole (DAPI), binds to the minor groove of DNA and is called externally binding ligands. They have advantages over intercalating compounds, since during the interaction they do not violate the visible integrity of the biopolymer. However, the combination of such dyes with DNA, without changing the visible structure of the double helix, leads to a change in the weight and moments of inertia for the bases, which can facilitate the propagation of conformational excitations of a nonlinear nature such as solitons. Such excitations can affect the dynamics of the scattering of radiation by DNA bases and thus change its native fluorescence (Fedyanin V.K. and Yakushevich L.V. Scattering of neutrons and light by DNA solitons. Stud. Biophys. 1984; 103: 171-178). In addition, DAPI-type fluorophores have clear binding selectivity for the nucleotide composition of DNA and are suitable for studying only AT-rich regions. This fact significantly limits the universality of the use of such dyes for the analysis of the fluorescent properties of heteronucleotide sequences.

Thus, the main drawback of existing indirect methods for studying the fluorescent properties of DNA using fluorescent dyes is a change in the structure and physical parameters of DNA. The last remark cannot but affect its fluorescent characteristics. In this regard, all existing methods using binding ligand, and especially intercalating dyes, have an error of results associated with a change in the native fluorescence of DNA. Therefore, the development of a method for studying DNA fluorescence using fluorescent molecules with free fluorophore groups, which do not enter into direct physical contact with DNA and do not change its structure and parameters, is undoubtedly relevant.

The main methodological error of the researchers before the development of the claimed method was to consider the fluorescent properties of DNA in the visible range of light separately without their relationship with molecules fluorescing in the same spectrum of visible light. The result of such studies was the controversial registration with the help of the photomultiplier technique of superweak fields in the form of single photons (work of the research group F.A. Popp, Germany). Thus, in the literature there is no analogue of an indirect method for studying the fluorescence of DNA in the visible range of light using fluorescent dyes. The development of such a method based on the use of fluorescent dyes with free fluorophore groups that are not in contact with the internal structure of DNA was the aim of this invention. It should be noted that the inventive method for the first time allowed to establish the formation of a quantum-bound spectrum of DNA and similar fluorescent molecules in the visible range of light. In this case, the quantum yield of the spectrum of the fluorophore-bound fluorescence of DNA significantly exceeds that for a single fluorophore, and even more so for a single DNA. Moreover, recording the results does not require the use of photomultiplier technology and it is difficult to challenge it, as in the case of recording single photons. In these properties for the proposed method at the moment there are no closest analogues and prototypes.

An important question for the study is the dependence of the fluorescent properties of DNA on its nucleotide sequence. In the literature, there is evidence that the luminescence intensity of DAPI increases to the greatest extent when the molecule of this dye binds to double-stranded DNA regions that have many AT nucleotides (Tanious FA, Veal JM, Buczak N., Ratmeyer LS, Wilson WD DAPI ( 4 ', 6-diamidino-2-phenylindole) binds differently to DNA and RNA: minor-groove binding at AT sites and intercalation at AU sites. Biochemistry. 1992; 31 (12): 3103-12). In this regard, the use of DAPI allows us to establish the relationship of its fluorescence only with the AT composition of DNA, but not with a specific nucleotide sequence. In this case, we are talking about the relationship between the dye and DNA fluorescence in the ultraviolet, and not in the visible range of light.

Thus, to date, there are no known methods to trace the relationship between a specific nucleotide sequence and DNA fluorescence in different regions of the spectrum, including the UV, visible and IR ranges. Until now, prior to the claimed invention, no mention was found of the relationship between the main types of nitrogenous bases and absorption or radiation in a specific spectrum of visible light.

Disclosure of invention

The main technical task of the claimed invention is the development of a fundamentally new indirect method for studying the fluorescent properties of DNA in a wide range of light waves, which allows to study the integrative characteristic of its spectrum. The problem is solved using a new approach to the study of the fluorescent properties of DNA without the use of fluorescent molecules that come into direct contact with DNA and change its structure and physical parameters.

In the first embodiment of the method, fluorescent dyes are free molecules that are together in the same solution with the test DNA (variant using a free dye). In the second embodiment, the dye molecule is located at one end of the DNA sequence of the probe (the variant using end-labeled probes) or in the form of modified nucleosides within the sequence (probes with an internal label). In this case, the planes of the fluorophore groups of the dye are located freely with respect to the DNA molecule without intercalation.

In a remote non-contact embodiment of the method, the dye in the form of free molecules or as part of DNA probes is in a separate tube relative to the DNA sequence being studied. The use of fluorescent dyes corresponding to certain emission spectra allows us to establish the ratio of the main color channels of fluorescence of the studied DNA sequences.

The main technical result of the invention is to increase the specificity and sensitivity of the spectral analysis of the fluorescent properties of DNA sequences in comparison with existing methods. An increase in the specificity of the analysis lies in the possibility of simultaneously studying different ranges of light waves corresponding to the spectral characteristics of the fluorescent dyes used for analysis. Previous methods using intercalating fluorescent dyes made it possible to study only the ultraviolet region of the DNA fluorescence spectrum.

Of particular importance for assessing the specificity of the claimed method for analyzing the spectral properties of DNA is the ability to establish the ratio of the intensity of the primary colors of DNA fluorescence in the visible light spectrum in relation to the specificity of its nucleotide sequence. Previous methods using intercalating dyes of the DAPI type made it possible to detect the association of DNA fluorescence in the UV spectrum only with its nucleotide composition, namely, with the location of AT pairs. In this case, sequences having the same nucleotide composition, but differing in the nucleotide sequence, did not reveal differences in fluorescence. In this regard, the main distinguishing feature of the claimed invention is the possibility of studying the spectrally-specific properties of heteronucleotide DNA sequences that are not caused by the presence of AT-rich sites. The increased sensitivity of the proposed method is expressed in the possibility of recording its results without the use of photomultiplier techniques using standard fluorimetric equipment. This greatly simplifies the analysis technique and reduces its cost.

Increasing the specificity and sensitivity of spectral analysis using the claimed method made it possible to establish the interconnected fluorescence of nucleotide sequences of DNA and fluorescent molecules in certain areas of the visible spectrum, revealing the radiation and absorption zones. This type of fluorescence is associated with the establishment of a common quantum-bound fluorescence spectrum of DNA and fluorescence molecules. In this regard, it was called fluorophore-associated fluorescence of DNA. According to the obtained notions, the spectrum of fluorophore-bound fluorescence of DNA functions as a generally accepted RGB-system for coding color information and is represented by the primary colors (red, green and blue) and intermediate colors (yellow, orange, blue, purple, violet) formed as a result of their superposition. In this case, all the colors of the spectrum are interconnected (integrated) and can serve as radiation or absorption channels, depending on the setting of the spectral code of DNA. The spectral code of the fluorophore-associated DNA fluorescence, as a mechanism controlling the vital activity of a cell, undergoes natural minor vibrations (fluctuations). A significant restructuring of the code was registered in the second half of 2012. In this regard, the study in the examples of the invention of the spectral properties of DNA in such a spectrally unstable period is an important point for understanding the mechanisms of quantum-optical regulation of the processes of cell activity. These studies acquire a special role in connection with studies of telomeric DNA, namely, its terminal regions, called G-overhangs. It is in them that the mechanisms of the existence of DNA sequences in a cell differing in nucleotide composition and spectral properties due to a change in the position of nucleotides in the terminal telomeric repeat are laid down. The latter fact is of great importance in light of the discovery of the process of changing terminal DNA nucleotides during activation of cell division. The claimed method for the first time allows you to set the ratio of the main fluorescence channels of telomeric overhangs at any stage of the cell cycle.

Moreover, a significant qualitative difference of the proposed method is that it gives an idea of the ratio of the processes of absorption and radiation of light energy for each color channel in the framework of the formation of the resulting fluorescence flux of the studied sequences. Based on this, for the first time, it becomes possible to study quantum resonance relations between individual DNA sequences within the studied color channels. This is of particular importance in light of the study of the interactions of telomeric overhangs, which in a cell can be represented by different variants of the main telomeric repeat and end in different terminal nucleotides. Thus, the use of the claimed method opens up new possibilities for studying previously unknown fluorescence properties and spectral characteristics of DNA, inaccessible to preexisting research methods.

The essence of the invention lies in a new approach to the study of fluorescence of DNA sequences using a set of fluorescent dyes corresponding to the primary colors of the radiation spectrum of DNA. Moreover, dyes are not ligands or intercalators between base planes that bind to grooves with respect to DNA. The method is based on the unique properties of DNA sequences to affect the fluorescence of dyes differently depending on the intrinsic emitting and absorbing properties in the corresponding light spectrum. In this case, the establishment of quantum-related relations between the nucleotide sequence of DNA and the dyes used allows us to characterize the fluorescence properties of the test sample in a wide range of visible light waves from violet to red, including the UV and IR regions. By selecting dyes with specific spectral characteristics, the researcher is able to selectively study the region of interest that he is interested in.

The main significant difference of the proposed method from previously known is the ability to detect fluorescence properties of DNA in the visible range, while conventional spectrophotometric methods detect fluorescence only in the UV range. Moreover, the distinctive property of this method is the use of free fluorescent dyes, which do not come into direct contact with the DNA sequence and do not affect its properties. The application of the method for the first time allows us to study the mechanism of a previously unknown method of resonant energy migration over distances exceeding the radius of the electron clouds of interacting substances. The remote nature of such processes can be investigated using a non-contact embodiment of the method, in which the fluorescent dye solution is in a separate tube with respect to the DNA sequence being studied. Moreover, an important advantage of the claimed method is the ability to study the ratio of the processes of absorption and radiation of light energy in a certain spectrum.

The detection of the described fluorescence properties of DNA sequences in the visible spectrum was preceded by the observation of an unusual distribution of the background fluorescence of DNA probes, which included variations of the telomeric repeat (Example 1). These fluorescently-labeled probes contained a combination of dye (FAM) and quencher (RTQ1) at opposite ends. It was noted that regardless of the position of the dye at the 5'-end or at the 3'-end, the probe containing the telomeric repeat variant ending in the maximum amount of guanine (TTAGGG) had the maximum background fluorescence (Fig.2). Accordingly, telomere repeat probes GTTAGG, TAGGGT and GGTTAG possessed less fluorescence. It was found that such a gradation in the decrease in fluorescence in the green spectrum is associated with the location of guanine in the nucleotide sequence.

An assumption was made that the fluorescent dye in the composition of DNA probes based on telomeric sequences acquires new properties due to the quantum-bound state of DNA, similar to the widely used intercalating and ligand fluorophores. However, the mechanism of the quantum-bound state is completely different, since the fluorophore groups of carboxyfluorescein do not come into direct contact with DNA (they do not intercalate inward between the bases and do not bind to its groove). Under these conditions, it is supposed to establish a special quantum coupling, which, as will be shown in Example 3, is carried out remotely. A similar relationship was established between the arrangement of nucleotides and the fluorescence of other dyes in other ranges of visible light. It was shown that, when a quantum-bound fluorescence spectrum is established, the dye can be in a free state in solution, being unbound from the 5'- or 3'-ends of the DNA sequence. It should be borne in mind that the spatial arrangement of the fluorophore molecule affects the specifics of the resulting spectrum by establishing the direction of energy migration in the studied nucleotide sequence.

The described observations in general terms can be formulated as the phenomenon of a specific change in the fluorescence of a dye solution with free fluorophore groups when DNA sequences are added to it. In this case, the nature of the change in the fluorescence of the dye in the corresponding emission spectrum depends on the nucleotide sequence of the DNA fragment, namely, the location of the nitrogenous bases. This phenomenon formed the basis of the claimed method of spectral analysis of the fluorescent properties of nucleotide DNA sequences.

General scheme for the spectral analysis of the fluorescent properties of DNA using dye molecules with free fluorophore groups

The first embodiment of DNA spectral fluorescence analysis is the use of a fluorescent dye as part of nucleotide probes in the form of a label freely located at its 5 'or 3' end. In this case, the plane of the heterocycles of the dye molecule itself and its fluorophore groups are located freely in space and do not interact with DNA bases. Thus, the condition of the absence of intercalation and intramolecular interaction remains. The manufacture of such probes is carried out according to generally accepted methods for terminal modification of oligonucleotides during standard phosphoramidite synthesis. As a label, any fluorescent dyes are used depending on the spectral characteristics of the studied DNA spectrum. The use of such probes containing terminal carboxyfluorescein for studying the fluorescent properties of telomeric sequences in the green spectrum of visible light is shown in examples 1-3. An important condition is the quality of inclusion in the probe of the fluorescent label and its quencher, if used. For an adequate comparison of the fluorescent properties of the sequences with each other, the quality of label inclusion in them should be the same. Otherwise, differences in the fluorescence of the probes will be associated with the efficiency of the inclusion of the label or quencher, and not be determined by the fluorescence properties of the studied DNA sequence. In this regard, when using the services of commercial firms involved in the synthesis of modified oligonucleotides, it is necessary to require careful monitoring at all stages of their modification.

Experiments have shown that oligonucleotide DNA sequences labeled with a combination of a fluorophore quencher at opposite ends can be used for spectral analysis along with solutions of free dye molecules. However, there are some differences in their use associated with the proximity of the location of the fluorophore to the 5 'or 3' end, which determines the corresponding direction of energy migration and its magnitude. In this regard, the results of DNA spectral analysis using a free dye or its terminal arrangement in the probe may vary.

A special variant of the implementation of DNA spectral fluorescence analysis is a non-contact option, in which the mutual influence of DNA sequences in the composition of the probes is carried out remotely. In this case, solutions of quantum interacting probes affect each other at a distance of several centimeters, located in different tubes (example 3).

A further embodiment of the method is the use of a fluorescent dye as an aqueous solution of molecules that are completely free with respect to the structure of DNA. At the first stage, initial solutions of fluorescent dyes corresponding to the main DNA fluorescence spectra are prepared: green channel (FITC, FAM, R110, TET and analogues), yellow-green (R6G, JOE, HEX, VIC, YakimaYellow and analogs), yellow (TAMRA, Cy3 and analogs), orange-red channel (ROX, SuperROX, Cy3.5 and analogs), red (Cy5, Cy5.5, TexasRed and analogs), near infrared (Cy7, Cy7.5 and analogs).

The study of the visible violet and blue fluorescence channels is currently difficult due to the lack of suitable dyes. The dyes available in this spectrum include pyrene. However, it does not satisfy the requirements for the free arrangement of fluorophore groups, since it intercalates not only into duplex, but also actively binds to single-stranded DNA. The widely used DAPI dye is also not suitable for spectral analysis, since, firstly, it also interacts with the DNA structure, and secondly, it has selectivity in binding to AT regions, which limits its use for the analysis of GC-containing sequences.

A feature of the proposed method is the ability to study not only the visible fluorescence spectrum, but also the full spectrum of light, including the ultraviolet and infrared regions, which requires the development of suitable dyes. In addition, the study of UV and IR ranges requires a detailed discretization of the spectrum by the wavelengths of excitation and radiation.

A significant advantage of the claimed method is the ability to use any fluorescent dye that meets the requirement of the absence of interaction with the internal structure of DNA. In the future, it is possible to use any fluorophores suitable for the spectrum that are widely available on the market, including previously not used for molecular studies of nucleic acids and proteins. This greatly facilitates the search for suitable dyes for all color channels, and especially for violet and blue. Today there is a wide range of fluorophores that fluoresce with different wavelengths of the visible spectrum under UV irradiation. This can greatly facilitate and cheapen the creation of fluorimeter detectors that operate on only one excitation length in the UV region.

For all variants of the spectral analysis, a condition of a certain degree of dilution of the dye is necessary, which ensures its background fluorescence, convenient for registration with instrumentation. It is selected empirically so that the effect of DNA sequences is easily detected against its background. In this case, the upper and lower limits of dilution should be taken into account, the use of which is determined by the direct dependence of the increase in dye fluorescence under the influence of DNA on its initial concentration. When the same amount of DNA is added to dye solutions with different concentrations, the increase in dye fluorescence changes in proportion to the change in its initial background. In this regard, against the background of too diluted dye fluorescence, one can not notice the influence of the fluorescent properties of DNA. On the other hand, a very high dye concentration will make it difficult to detect results.

The use of a fluorescence quencher in the construction of probes provides the necessary reduction in the level of intrinsic fluorescence of the dye, which simulates diluted solutions of the free dye. The dilution range of each dye or the concentration of labeled probes is selected empirically so as to provide approximately the same quantum fluorescence yield per unit time for all the dyes used to adequately compare the color channel intensities. An important condition is the observance of the same intensity (brightness) of the exciting radiation for all colors of the spectrum corresponding to the peak of fluorescence of the dyes, since it was found that the effect of DNA sequences on their fluorescence is proportionally dependent on this factor. The use of excitation waves that do not correspond to the peak of excitation of the dye leads to a decrease in the increase in fluorescence of the solution under the influence of DNA in proportion to the decrease in the total fluorescence intensity of the dye at this wavelength.

The described regularities indicate that, against the background of the establishment of a common quantum-bound spectrum, DNA has dependent fluorescence properties with respect to the amount of dye and the intensity of the exciting radiation. DNA adds or absorbs fluorescence in the spectrum under investigation according to its quantity and in proportion to the excitation intensity and the initial level of fluorescence of the dye solution.

Thus, at the first stage of DNA spectral fluorescence analysis using free dye molecules, the background fluorescence of its solution is measured. Measurement is carried out using conventional fluorescence analysis methods using instruments specially designed for this purpose (fluorimeters, fluorimetric photometers, fluorescence detectors and the like). The action of these devices is based on the excitation of fluorescence using a light source corresponding to the maximum absorption of the dye used and registration of emission using filters corresponding to the maximum of its fluorescence.

At the second stage of the analysis, after obtaining the background fluorescence value of the dye solution, a sample of the studied DNA is added to it and thoroughly mixed. If we are talking about synthetic sequences of an oligonucleotide nature, it is convenient to add the solution directly in very small volumes (not more than 1/10), for example, 1-2 μl per 20 μl of the initial dye solution. In this case, an increase in the volume of the solution does not affect the change in the initial background fluorescence.

If a solution of native DNA is exposed to the study, for example, a sample of telomeric overhangs, then it is concentrated to the required volume. In another embodiment of the method, the background fluorescence of a solution of a given dye concentration in a test volume of an overhang solution is predetermined. It is assumed that all solutions in the indicated volume have approximately the same fluorescence, which requires the use of dyes with a stable quantum yield.

The change in the fluorescence of the dye solution is recorded immediately after the addition of the DNA sample and the values are fixed for the first ten minutes to obtain an average value. It should be noted that DNA is a quantum-dynamic system, in contrast to fluorescent dye molecules, whose quantum yield changes insignificantly over time. Therefore, during the first minutes after adding a DNA sample to the dye solution, the fluorescence values may change. This is due to the establishment of complex quantum resonance relations of energy migration over time, arising both between nitrogenous bases inside the DNA sequence itself, and between them and the dye molecule.

In this regard, it is recommended to take the averaged value for the time intervals corresponding to the first three, five, and ten minutes, since in most cases this time is sufficient to establish a stable quantum yield of the bound DNA dye spectrum. However, in some cases, a study of the dynamics of the fluorescence of a solution for a longer time may give a more detailed idea of the dynamic component of the DNA spectrum. In this regard, it is recommended to use longer measurement intervals at the request of the researcher. The stability of the results in this case indicates the establishment of an energy balance between the coupled processes of absorption and emission of light quanta in the spectrum under study. If this does not occur and the change in fluorescence continues, then this indicates a special mode of saturation of DNA sequences with light energy. Such a special saturation mode was observed in the second half of 2012 for mononucleotide and telomeric DNA sequences (Figs. 7 and 10).

It should be noted that a significant advantage of the proposed method is the use of standard fluorimetric devices, without the use of photomultiplier technology. Moreover, the recorded increase in fluorescence is easily detected and can reach 100% or more of the initial level of background fluorescence of the solution. When observing the effect of superfluorescence of telomeric repeat TTAGGG, which occurred on September 21, 2012, the increase in fluorescence was 260% for 48 hours (Fig.7). When observing a similar effect for the cytosine-containing sequence on June 19, 2012, the increase in fluorescence was 124% for the first hour (Fig. 10). In this case, the increase in the fluorescence of pure dye in the control sample was several orders of magnitude lower than in samples containing DNA. This clearly indicates the unique properties of DNA sequences to increase the quantum-associated fluorescence of the dye.

The registration of such a significant increase in fluorescence, in contrast to the fixation of single photons using a photomultiplier, is undeniable and is a reliable result. The recorded increase in dye fluorescence indicates a large quantum contribution of DNA to the total fluorescence of their associated spectrum, which is easily detected and visible to the naked eye (Fig. 1). Thus, the quantum yield of DNA fluorescence in the total quantum-bound spectrum is comparable to that for the fluorescent dye itself. This indicates the outstanding potential of DNA itself as a source of photons in the visible spectrum.

The fluorescence detector FDG-001 (a joint development of the author and the Institute of Theoretical and Experimental Biophysics, Pushchino) was used as a device that records fluorescence in examples of the use of the invention. The detector is built according to the generally accepted principles of fluorimetry using multicolor LED illumination and a set of optical filters that allow the detection of the following dyes (FAM, FITC, R6G, JOE, HEX, TAMRA, ROX) with a sensitivity not inferior to commercial devices. The fluorescence intensity was detected using an appropriate filter on the matrix of a monochrome highly sensitive camera and saved as a graphic file. Graphic files were processed using a specialized image processing program LabWorks 4.6. (UVP, England), which made it possible to convert the results to a numerical format and obtain the value of significant fluorescence in arbitrary units. The results were presented in the form of bar charts or curves showing the change in fluorescence of the dye solution after adding a DNA sample in arbitrary units. One of the forms of presenting the results of DNA spectral fluorescence analysis was the preparation of spectral maps in the studied wavelength range, as well as color markers of the resulting fluorescence of the studied nucleotide sequences.

Brief Description of the Drawings

Figure 1. Image of the fluorescence of FAM and ROX dyes before and after adding a DNA sample to them. Images were obtained using a highly sensitive FDG-001 detector video camera using green (520 nm) and red (605 nm) detection channels. Fluorescence values are based on LabWorks 4.6 software. (UVP, England).

A — FAM dye, to which the oligo d (C) 12 mononucleotide sequence was added under the conditions of the spectral code of DNA fluorescence as of June 19, 2012; the image shows the phenomenon of prolonged hyper-saturation of the studied sequence with green fluorescence for 20 minutes;

B - ROX dye, to which was added the sequence CAGATGGCTGCTCCCACACTTC of the human cyclin D2 gene under the conditions of the spectral code of DNA fluorescence as of the end of June 2012.

Figure 2. Fluorescence of DNA probes based on variations of the telomeric repeat of human DNA, labeled with a combination of FAM dye and quencher RTQ1.

A is an image of the fluorescence of the probes obtained using a FDG-001 detector video camera using a green (520 nm) light filter. The upper row corresponds to the FAM-RTQ1 probes, the lower one corresponds to the RTQ1-FAM probes. The fluorescence values for each probe are given according to the LabWorks 4.6 software. (UVP, England).

B and C are the fluorescence values for probes containing telomeric repeat variations presented in the form of bar charts.

Figure 3. The dynamics of the green fluorescence channel of telomeric repeats of human DNA using FAM-RTQ1 labeled probes as an example (the characteristic corresponds to the spectral code of DNA fluorescence as of March 2012). It displays fluctuation changes in the levels of telomeric DNA saturation with green fluorescence energy over time within the framework of the spectral code of DNA that existed at the time of the study.

Figure 4. The graph of changes in the FAM-associated fluorescence of the telomeric repeat TTAGGG under the influence of remote exposure to sequences of other variants of the telomeric repeat of human DNA. Demonstrates the nature of the quantum resonance energy migration relationships arising between different variants of the telomeric repeat sequence. The experiment was conducted during the period of stable existence of the DNA spectral code at the time of the study (first half of April 2012).

Figure 5. Fluorescence growth diagram of FAM, TAMRA and ROX dyes in the corresponding colors of the visible spectrum under the influence of possible variants of telomeric repeat of human DNA. Demonstrates spectral characteristics of telomeric overhang endings corresponding to the spectral DNA code at the end of April 2012.

Figure 6. Graph of the increase in fluorescence of the FAM dye under the influence of telomeric repeat variations. Displays the dynamics of the slow saturation of telomeric sequences with green fluorescence under the conditions of the modified spectral DNA code at the end of September 2012.

Figure 7. Graph of the increase in fluorescence of the FAM dye in time under the influence of telomeric repeat variations. Displays the dynamics of periodic hypersaturation of telomeric sequences based on TTAGGG repeat with green fluorescence under conditions of an altered spectral DNA code (September 21, 2012).

Figure 8. Fluorescence growth diagram of TAMRA and ROX dyes in the corresponding colors of the visible spectrum under the influence of possible variants of telomeric repeat of human DNA. Demonstrates the spectral characteristics of telomeric overhang endings in the yellow and red fluorescence spectra under the conditions of the modified spectral DNA code at the end of June 2012.

Figure 9. Fluorescence growth diagram of FAM, TAMRA and ROX dyes in the corresponding colors of the visible spectrum under the influence of various variants of mononucleotide DNA sequences. Demonstrates the spectral characteristics of nitrogen bases corresponding to the spectral code of DNA at the end of April 2012.

Figure 10. The graph of the increase in fluorescence of the FAM dye over time under the influence of mononucleotide sequences. It displays the dynamics of periodic hypersaturation with green fluorescence of a sequence containing cytosine under the conditions of an altered spectral DNA code (June 19, 2012).

Figure 11. Fluorescence growth chart of TAMRA and ROX dyes in the corresponding colors of the visible spectrum under the influence of mononucleotide sequences. Demonstrates the spectral characteristics of nitrogen bases in the yellow and red fluorescence spectra under the conditions of an altered spectral DNA code at the end of June 2012.

Figure 12. The graph of the increase in fluorescence of the FAM dye over time under the influence of mononucleotide sequences. It displays the dynamics of slow saturation of green bases with nitrogen fluorescence under conditions of an altered spectral code of DNA (end of October 2012).

Figure 13. Fluorescence growth diagram of FAM, TAMRA and ROX dyes in the corresponding colors of the visible spectrum under the influence of fragments of the minus and plus chains of the DNA of the human cyclin B1 and D2 genes. Demonstrates the spectral characteristics of fluorescence of the indicated gene sequences under the conditions of the spectral code of DNA fluorescence at the end of April 2012.

Figure 14. The graph of the increase in fluorescence of the FAM dye over time under the influence of the sequences of negative and positive chains of human cyclins B1 and D2. Displays the dynamics of green fluorescence saturation of sequences in a modified spectral DNA code (mid-October 2012).

Figure 15. Fluorescence growth diagram of TAMRA and ROX dyes in the corresponding colors of the visible spectrum under the influence of the sequences of negative and positive chains of human cyclins B1 and D2. Demonstrates the spectral characteristics of gene sequences in the yellow and red fluorescence spectra under conditions of an altered spectral DNA code at the end of June 2012.

Figure 16. An example of compiling spectral maps and color markers of the resulting fluorescence sequences of the telomeric repeat of human DNA in the wavelength range of 520-605 nm. Compiled according to the fluorescence data of the dyes FAM, R6G, TAMRA and ROX as of April-May of the month of 2012.

The implementation of the invention

The claimed method is illustrated by several examples demonstrating its universal capabilities as a method of analyzing the spectral properties of the cell genome (spectral genomic analysis). The main characteristic of the spectral properties of the genome is the ratio of the fluorescence levels of the main color channels of the nucleotide sequences, which vary in time. The study of the spectral properties of mononucleotide sequences makes it possible to reveal the intrinsic contribution of each type of nitrogenous base to the fluorescence of the DNA sequence without the influence of other types of nitrogenous bases included in its composition, as in the case of a heteronucleotide sequence (example 5).

The study of heteronucleotide sequences of various lengths reflects the general spectrum of their fluorescence, which occurs during the interaction of the nitrogenous bases that make up them. It consists of the balance of the processes of emission and absorption of fluorescence in different colors of the spectrum.

Of particular importance for the regulation of cell division is the study of the fluorescent properties of telomeric overhang sequences, which are determined by the nucleotide composition of their endings, represented by variants of the terminal telomeric repeat (examples 1-4).

The study of various gene sequences allows us to study the mechanisms of spectral color coding of genetic information and quantum saturation of genostructures in order to create a control laser-active medium of the genome (example 6).

Example 1. DNA spectral analysis of fluorescence of telomeric repeats of human DNA in the green range of visible light using terminal labeling of probes with a combination of carboxyfluorescein and an RTQ1 quencher.

The experiment used aqueous solutions of the following oligonucleotide probes containing possible telomeric repeat variants (underlined):

A second set of probes, of the same nucleotide sequence, contained a combination of a label and a quencher at opposite ends, namely 5'-RTQ1 and 3'-FAM.

Each probe contained one of the variants of the full-sized telomeric repeat and the same sequence of 4 cytosine residues for all, which allowed the probe to be extended to the optimal length. It should be noted that for similar experiments it is possible to use probe sequences entirely consisting of a telomeric sequence without the influence of cytosine, which is not part of the native human telomeric DNA. The used probe design, containing in all its variants the same poly (dC) sequence, is consistent with the objectives of this study, since it allows us to maintain unambiguous discrimination of the influence of the telomeric repeat sequence. Moreover, the presence of a short poly (dC) sequence helps to establish a more pronounced gradation of the fluorescence potential of telomeric repeat species depending on the nucleotide sequence. This is due to the influence of the fluorescent properties of cytosine, which has the maximum energy potential in the green spectrum.

The probes were synthesized at Syntol (Russia) under the unchanged spectral code of DNA fluorescence (FAM-RTQ1 - April 2009 and RTQ1-FAM - January 2012). The sequences were obtained by the standard phosphoramidite method with a high degree of inclusion of dye and quencher, the same for all probes. In this regard, differences in the fluorescence of the probes were determined by the features of the fluorophore-linked fluorescence of the DNA sequences of the probes in the green spectrum at the time of synthesis, and not by the quality of the inclusion of labels.

To measure the fluorescence of the probes, the same 10 μM aqueous solutions were prepared in a volume of 20 μl. In order to eliminate the influence of intra- and inter-probe interactions of the sequences with the formation of the GGG / CCC duplex, the solutions were briefly heated to a temperature of 70 ° C with a subsequent gradient of decrease to 37 ° C. The fluorescence was measured using a FDG-001 fluorescence detector under the same conditions of the intensity of the exciting radiation and the signal exposure of the detection chamber.

The results are presented in figure 2, where under the graphic image of each probe (A) is the magnitude of the significant fluorescence in arbitrary units according to the image analysis program LabWorks 4.6 (UVP, England). The ratio of the signal levels of each probe for the convenience of comparing the fluorescence potentials of telomeric repeats is illustrated in the form of a bar graph (Fig.2B and C).

From the analysis of the obtained data, it can be seen that, with both labeling variants, a characteristic gradation of the fluorescence value of the probes was preserved, depending on the position of guanine in the telomeric repeat. The highest fluorescence in both labeling variants is possessed by the third probe containing the telomeric repeat TTAGGG ending in the maximum amount of guanine. The fluorescence probe had a lower telomere repeat GTTAGG ending in two guanines. Further, with decreasing energy potential, the probes with telomeric repeats TAGGGT and GGTTAG were located. The smallest fluorescence values were possessed by telomeric repeats GGGTTA and AGGGTT.

Thus, the use of terminal carboxyfluorescein labeling for studying the nucleotide sequences of a human telomeric repeat revealed their specific spectral characteristics. It was found that telomeric repeat variants differ sharply in their fluorescence potential in the green spectrum of visible light. In the indicated fluorescence spectrum, the following gradation of the energy potential of telomeric repeat variants is observed in the direction from maximum to minimum: 1. TTAGGG; 2. GTTAGG; 3. TAGGGT; 4. GGTTAG; 5. AGGGTT and 6. GGGTTA.

The magnitude of the energy potential of the repeats depended on the location of the fluorophore molecule. The greatest differences between the repeats were observed at the 5'-terminal arrangement of carboxyfluorescein (Fig.2B). Thus, the use of a different end position of the label in the probe during the implementation of the proposed method revealed the role of the position of the fluorophore in the formation of a quantum-coupled spectrum.

In a cell, telomeric overhangs ending in different telomeric repeats when the fluorophore is located closer to the 5'-end may have maximum differences in fluorescence. The sources of fluorescence (fluorophores) can be amino acids of the proteins that make up the compound with telomeric DNA. For example, the POT1 protein, which is related to the telomeric sequence of overhangs, has a number of amino acid residues of tyrosine and phenylalanine, the aromatic heterocycles of which come into close contact with the planes of nitrogen bases. In this regard, telomeric repeats located behind the POT1 protein binding site towards the 3'-end of DNA have greater fluorescence than those facing it. In this case, unique conditions are created for the maximum difference in the fluorescence of the green spectrum for various variants of terminal telomeric repeats. This mechanism ensures the existence in the cell of various photo modes characteristic of non-dividing and cell division states activated by division. Their occurrence is directly related to changes in the nucleotide endings of telomeric overhangs and the existence of balanced equilibrium and nonequilibrium profiles of their terminal nucleotides.

In connection with the features of probe fluorescence established above, it was shown that the green fluorescence channel is spectrally specific for human DNA telomere repeat sequences. It provides the main trigger mechanism for switching the intensity of color channels during activation of cell division associated with rearrangements of the ends of telomeric overhangs in the cycle of ponucleotide displacements. The balanced profile of terminal nucleotides, characteristic of the non-fissile state of the cell and the phases of activated cell division after the trigger moment of the start of division in the early G1 phase, has a high content of AGG and TAG terminal triplets. It is these triplets in the composition of terminal repeats of telomeric overhangs that determine their high level of fluorescence in the green spectrum. The trigger transition to the fission-activated state is accompanied by rearrangements of the telomere overhang endings and the development of an unbalanced nonequilibrium profile of their terminal nucleotides with a predominance of TTA terminal triplets. As can be seen from the obtained data, the GGGTTA triplet in the composition of the studied probes has the lowest fluorescence in the green spectrum, several times lower than that for the GTTAGG repeat, which is characteristic of the equilibrium state of the profile. Thus, activation of cell division is accompanied by a sharp drop in the intensity of the green fluorescence channel of terminal telomeric repeats of human DNA.

In this regard, the study of the dynamics of changes in the green fluorescence channel of telomeric DNA repeats as a form of spectral genomic monitoring is an example of the study of quantum-optical processes of activation of cell division.

The next aspect of the use of terminal labeling of DNA probes in DNA spectral analysis of visible fluorescence is the study of the dynamics of their background fluorescence over time. An example of such a study is the study of the dynamics of the green fluorescence channel of telomeric DNA repeats in DNA probes during the period of March 2012. For the study, we used the concentrations of synthetic probes described above containing varieties of telomeric repeat and labeled with a combination of FAM dye at the 5'-end and an RTQ1 quencher at the 3'-end. The monitoring results are presented in the form of graphs showing the fluorescence levels in the green spectrum for various variants of the telomeric repeat of a person on the indicated dates of the analysis (Fig. 3).

The monitoring performed using the inventive method demonstrates the dynamic component of the genome within the current spectral code, which preserves the general view of the ratio of the energy contribution of each type of telomeric repeat in the green spectrum, which grows in the direction: 6th, 5th, 1st, 4th, 2nd and 3rd options for repetition. Moreover, the energy levels themselves vary and reveal periods of rise (03/13/2012) and recession (03/05/2012 and 03/27/2012). The graph shows a further upward trend in fluorescence after the last measurement point (03/28/2012), which apparently indicates the presence of the next rise period. During this monitoring period, the maximum limit of variation of the fluorescence values in the green spectrum for some telomeric repeat variants reached more than 50%. This demonstrates the active dynamic component of the green spectrum of fluorophore-bound fluorescence of telomeric DNA.

The concept of the trigger mechanism for switching color channels during cell division activation, formulated by the author of the proposed method, suggests that the adequacy of its functioning directly depends on the balance of the intensity of fluorescence colors. First of all, this concerns the energy level of the color channel, the most spectrally discriminating basic nucleotide transitions of the ends of telomeric overhangs. Based on this, a significant change in the level of fluorescence of the green channel is a vulnerable moment for the cell genome. This is due to the fact that under these conditions, the adequacy of the trigger mechanisms of channel switching and related processes for modifying the ends of telomeric DNA should be maintained.

In this regard, various violations occurring at such spectrally unstable moments may be a possible cause of malignant degeneration of the cell and various genomic breakdowns. Therefore, the identification of the time of a critical change in the level of the main spectrally-specific fluorescence channel of telomeric overhangs, namely green, is an important preventive task in spectral genomic monitoring, which can be carried out using the claimed method.

Example 2. Description of the processes of emission and absorption of fluorescent energy in the green spectrum of visible light by telomeric DNA sequences on the example of mixtures of telomeric repeat variants labeled with carboxyfluorescein and RTQ1 quencher.

The experiment was conducted on the days of the stable existence of the spectral code of the fluorophore-associated DNA fluorescence (second half of March 2012).

The data obtained that the nucleotide composition of the probes affects their fluorescence and spectral characteristics suggested that probes carrying different telomeric repeat variants will affect each other's fluorescence. This statement is of great importance for understanding the role of a set of telomeric G-overhangs ending in different telomeric repeats, as systems whose various components (individual G-overhangs) affect each other and the final result of their general interaction. The role of the criterion for this interaction can be played by the resulting fluorescence of overhangs in the green FAM-bound spectrum.

In this example of the invention, the mutual influence of FAM-RTQ1 probes on each other was studied as a model of antagonistic interaction of telomeric repeat variants in the green fluorescence spectrum. The experiment was to study the effect on the background fluorescence of the FAM-TTAGGGCCCC-RTQ1 probe with other telomeric repeats. The studies were carried out on days of March 2012 with different spectral stability. For these days, the characteristic dependence of the level of green fluorescence of telomeric repeats on the amount of guanine in the terminal triplet was manifested to varying degrees. The variant with maximum background fluorescence containing a telomeric repeat ending in three guanine residues was taken as the test probe.

The study period corresponded to the interval between the first maximum of fluorescence (03/13/12) and the next minimum (03/27/12), which corresponds to the dynamics of the fluctuation change in fluorescence in the green spectrum for telomeric repeats for March 2012 in the previous example (Fig. 3).

For the study, the same number of probes (20 picomoles) were taken in a final volume of the mixture of 20 μl. The theoretically expected fluorescence of the mixture was calculated as the sum of two averaged values of the background fluorescence for each probe in this mixture: F _theory = F1 + F2. The average background value for each probe was calculated separately for five independent solutions. As can be seen from table 1, the actual fluorescence of the probe mixture turned out to be different from the theoretically expected one and determined the difference ΔF (ΔF = F _fact -F _theory ).

The experiment showed that telomeric repeat variants enter quantum resonance relations with each other. As part of the green fluorescence channel, it was shown that each of the telomeric repeat variants, having a certain ratio of emitting and absorbing properties, affects the properties of other repeats that are in mixture with it. The GGGTTA telomeric repeat variant, which has the maximum absorption properties in the green emission spectrum mixed with TTAGGG repeat, showed the largest underestimation of fluorescence in comparison with other mixtures. At the same time, the probes were clearly divided into two groups. The first group consisted of probes with repeats TTAGGG, GTTAGG, and TAGGGT, for which, during the period of maximum, emissive properties prevail over absorbing properties (positive ΔF). When the total fluorescence intensity in the green spectrum decreases in the intermediate period and the minimum period, a positive ΔF value was retained only for the TTAGGG repeat. This indicates its special properties as the main donor of green fluorescent energy under the conditions of the main spectral code of DNA. During the period of the minimum green fluorescence intensity, all other probe variants showed an increased negative ΔF value, which indicates its critical role in the saturation of the genome with green fluorescence, see table.

Fluorescence of telomeric FAM-RTQ1 probes in two-component mixtures using the example of a TTAGGGCCCC probe at different periods of intensity The combination of probe numbers in the mixture Telomeric repeat combinations (terminal triplet underlined) ΔF 03/13/12 maximum period ΔF
03/21/12 intermediate ΔF 03/27/12 minimum period 3-1 TTAGGG + GGTTAG -0.4 -1.83 -2.15 3-2 TTAGGG + GTTAGG +1.62 -1.26 -1.58 3-3 TTAGGG + TTAGGG +5.67 +3.75 +1.16 3-4 TTAGGG + TAGGGT +0.46 -2.1 -2.37 3-5 TTAGGG + AGGGTT -1.56 -2.34 -2.48 3-6 TTAGGG + GGGTTA -1.79 -2.98 -4.49

For probes of the second group (GGGTTA, AGGGTT, GGTTAG), especially for the telomeric repeat GGGTTA, the absorption of green light energy always prevailed over radiation (negative AF). In this case, a characteristic tendency was observed for an increase in absorption during periods of minima compared with periods of maxima, which reflects the general tendency for a decrease in the fluorescence intensity in the green spectrum.

In conclusion, it should be noted that regardless of the dynamic component of the spectral properties of telomeric repeats, consisting in alternating periods of fluorescence maxima and minima, the following gradation of the increase in their energy potential in the green spectrum is preserved, depending on the relative position of the nucleotides in their composition: 1. GGGTTA; 2. AGGGTT; 3. GGTTAG; 4. TAGGGT; 5. GTTAGG; 6. TTAGGG.

To study the relationship between the properties of radiation and absorption of light energy by DNA sequences, a remote contactless embodiment of the method plays a special role, which is represented by the following embodiment of the invention.

Example 3. A non-contact remote method for studying the processes of emission and absorption of fluorescence energy in the green spectrum of visible light by telomeric DNA sequences using telomeric repeat variants labeled with carboxyfluorescein and an RTQ1 quencher as an example. The experiment was conducted on the days of the stable existence of the spectral code of fluorophore-bound DNA fluorescence (first half of April 2012).

The experiment used the same oligonucleotide probes as in examples 1 and 2. Initially, a control 1 μM aqueous solution of the FAM-TTAGGGCCCC-RTQ1 probe was prepared, against which the effect of telomeric repeats of other probes was evaluated. After dilution from the effluent with a high concentration, the solution was isolated from the remote action of any sequences for 2 hours. During this time, the initially high fluorescence of a control solution saturated with quanta from the initial runoff naturally decreased to a certain starting level. This state of the control solution is called quantum-unsaturated and characterizes its own energy potential, in contrast to the initially quantum-saturated solution obtained immediately after dilution from the effluent with a high concentration.

The starting value of fluorescence in the experiment was 28.79 units. (point 1 in the graph of figure 4). Before the experiment, the scatter of the measurement error was studied by five-fold measurement of the starting fluorescence value after shaking the solution on a vortex. Vortex shaking made it possible to reorient the fluorophore dipoles and redistribute the quantum saturation of the overall system. In this regard, during the course of the experiment, before each fluorescence measurement, we shook and briefly centrifuged the solution.

The spread in the values of the starting fluorescence level of the probe was not more than 0.05 units. Such a small error value associated with the reorientation of the fluorophore dipoles in space turned out to be an order of magnitude smaller than the values of the change in fluorescence of the control probe that we obtained under the influence of sequences of other probes. In this regard, the results obtained are reliable and adequately demonstrate the mutual influence of telomeric repeat variants on each other.

The probe solutions whose influence was studied were prepared in advance. They were 10 μm solutions with a volume of 20 μl. The probes were stored frozen in another room. The solution immediately before the study was taken out of the freezer, thawed by heating to 37 ° C for 1 minute. After shaking, the control and test samples were placed in a tripod in close proximity to each other at a distance of 1.5 cm for 5 minutes. Then, the control sample was again shaken and subjected to measurement of the fluorescence level, while the tube with the acting probe was at a distance of no more than 5 cm, i.e., the condition of quantum coupling between the probe solutions was maintained. The fluorescence values of the probes correspond to points 2, 4, 6, 8, 10 and 12 in the graph of figure 4. After measuring the fluorescence of the control solution, the test probe was taken to another room and placed in a freezer. Next, the control sample was shaken, after which it was isolated for 5 minutes without the influence of any sequences. After isolation, the control solution was again shaken and fluorescence measured (white dots on the graphs 3, 5, 7, 9, 11 and 13). The described sequence of actions was repeated for all tested probes in the sequence indicated on the graph from right to left (Fig. 4).

The non-contact remote variant of the proposed method allowed us to establish that the telomeric DNA sequences represented by various telomeric repeat variants have a unique ratio of radiation and absorption processes. It was shown that, relative to the green fluorescence channel, two groups are clearly distinguished within six possible telomeric repeat sequences.

The first group consists of repeats TTAGGG, GTTAGG and TAGGGT. They have the properties of emitting green fluorescence, predominant over absorption. A special role is played by the TTAGGG variant of the telomeric repeat, since it has the maximum properties of fluorescence radiation in this range, while it does not have visible absorption. It is the maximum donor of green light energy in the telomeric DNA of a cell under the conditions of its fluorophore-associated fluorescence functioning. Other telomeric repeat variants from this group have this property to a lesser extent depending on the nucleotide sequence. The GTTAGG and TAGGGT repeats can be both donors and energy absorbers, depending on the quantum saturation of the system. Additional experiments, such as example 6, made it possible to establish that if the GTTAGG and TAGGGT repeats precede the TTAGGG probe with the maximum emissivity, then they will also be emitters. After exposure to the TTAGGG repeat, other repeats of this group become absorbers and restrain the quantum saturation of the system, as can be seen in the example of the TAGGGT repeat (point 8 of the graph in FIG. 4). However, after removing the TAGGGT repeat, the system returned to its quantum saturation due to the TTAGGG repeat, which clearly demonstrates the rise of the dashed line connecting points 7 and 9 on the graph.

The second group includes repetitions GGGTTA, AGGGTT and GGTTAG, in which the property of resonant absorption of green light energy predominates over radiation, which was demonstrated in the contact version of the method in example 4. A special place among them is occupied by GGGTTA repeat, which is a pronounced antagonist of TTAGGG repetition in the green fluorescence spectrum, since it has, on the contrary, the most pronounced absorbing properties of the prolonged action. The fall in fluorescence continued even after the control solution was in seclusion (point 13 of the graph of figure 4). The outstanding absorption properties of the GGGTTA repeat demonstrates a downward movement of the dashed line that represents the quantum saturation of the system after exposure to the probe and connecting the bright points 11 and 13 of the graph. Similar results were obtained in contact experiments, which also showed the maximum predominance of absorbing fluorescence properties over radiative ones for the GGGTTA repeat. In second place in the absorption property of green fluorescence are AGGGTT and GGTTAG repeats.

In the case of using primarily quantum-saturated solutions of a control sample with a high degree of energy saturation obtained from the initial sink with a high concentration, all telomeric repeats led to a decrease in fluorescence to different degrees depending on their energy potential determined by the nucleotide sequence.

Thus, the ratio of the absorbing and radiative properties of telomeric repeats of both the first and second groups obeys a general rule, namely, depends on the ratio of their energy potential and the saturation level of the general quantum system of the dye solution. If the saturation level of the overall quantum system is greater, as, for example, in the case of a initially quantum-saturated solution or after exposure to a preceding energetically richer repetition, then a visible absorption of energy is observed in the form of a decrease in the fluorescence of the solution. Conversely, if the level of quantum saturation of the system is less than the energy potential of the repetition, for example, after exposure to the previous repetition with a lower potential, then the fluorescence of the solution increases and the total quantum saturation of the system increases.

An important advantage of the non-contact method is that it allows you to evaluate the effect of several telomeric sequences in the form of a continuous sequence of one variant after another, which imitates the natural change of telomeric overhang endings in the process of cell division activation. In this case, the study of the processes of emission and absorption of light energy is possible in any of the color channels due to the use of dyes of the corresponding fluorescence spectrum.

Thus, the use of various embodiments of the method (both contact and non-contact) made it possible to establish that telomeric overhangs are elements of a single quantum resonance system and affect each other not only in the same solution, but also in different tubes (remotely ) Drawing an analogy between closed volumes of microtubes and individual cells, the use of the claimed method is of tremendous importance for understanding the mechanism of distance interaction of cells and the existence of a single light field of the cell and the organism as a whole.

The result of the quantum resonance interaction of telomeric overhangs, differing in their length and nucleotide endings, is to maintain a luminous flux of a certain intensity and spectral characteristic, which is the basis of mitogenetic radiation in the visible range that controls cell division. In this regard, the claimed method is a unique, unparalleled tool for its research, which can be widely used in medicine and fundamental biology.

Example 4. DNA spectral analysis of fluorescence of the visible range of synthetic sequences of the G-chain of human telomeric DNA, represented by different variants of telomeric repeat (an embodiment of the method using a fluorescent dye in the form of an aqueous solution of free molecules).

In the experiment, a group of sequences of synthetic oligonucleotides 12 n.o. long was used, which consisted of possible variants of telomeric G-overhang endings, represented by six variants of terminal telomeric repeat. Each oligonucleotide consisted of two full-length telomeric repeats that differ from the previous version by a shift of one nucleotide.

All sequences were synthesized by the standard phosphoramidite method in the Eurogen company (Russia):

1. GGTTAG GGTTAG;

2. GTTAGG GTTAGG;

3. TTAGGG TTAGGG;

4. TAGGGT TAGGGT;

5. AGGGTT AGGGTT;

6. GGGTTA GGGTTA.

In the experiment, we prepared initial aqueous solutions of dyes (FAM, TAMRA, ROX) with a volume of 20 μl at a final concentration of 0.25-0.5 μg / ml depending on their quantum yield so that the resulting dilutions provided approximately the same background fluorescence in each color detection channels in order to adequately compare them.

As dyes, commercial preparations of N-hydroxysuccinimide esters manufactured by Syntol (Russia) were used, which, in the absence of amino groups under the experimental conditions, met the requirements of a chemically free dye and did not interact with the studied DNA sequences. The background fluorescence of these solutions was measured in triplicate to calculate the average background value and to establish the maximum variation in the natural fluctuation of the fluorescence of the dye solution. Then, the same amount of the studied oligonucleotide (40 pmol in 1 μl of an aqueous solution) was added to the solution, the sample was thoroughly mixed, and the fluorescence was measured in triplicate to calculate the average value for the first ten minutes after mixing. The values of fluorescence levels corresponding to three, five, and ten minutes after mixing were averaged and were a criterion for achieving the quantum equilibrium of the solution. In the absence of equilibrium and continued growth of fluorescence, measurements continued at set intervals.

All measurements were performed using a FDG-001 fluorescence detector using appropriate detection channels, namely a green filter (520 nm) for FAM detection, a yellow-green filter (550 nm) for R6G dye, a yellow filter (580 nm) for TAMRA and orange -red filter (605 nm) for dye ROX. All measurements were carried out at the same intensity of the exciting radiation of the corresponding spectrum and equal exposure times of the signal on the matrix of the detecting chamber, which provided comparable conditions for the accumulation of the light signal and the estimation of fluorescence changes.

According to the measurement results, it was calculated by how many arbitrary units the fluorescence of the initial dye solution increased or decreased after the addition of the corresponding oligonucleotide sample. The results were presented in the form of charts and graphs showing the levels of fluorescence of the dyes. The ratio of the obtained values of the fluorescence gain demonstrates the spectral characteristics of the fluorescence properties of the studied telomeric repeat sequences in the studied spectra of visible light.

The studies were carried out from April to September 2012, the result of which was the establishment of different spectral characteristics of telomeric DNA (Figs. 5-8), demonstrating the unique process of changing the saturation mode of telomeric DNA with green light energy, recorded during this period.

Establishing the polymorphism of the terminal nucleotides of telomeric overhangs and the associated cycle of ponucleotide shifts of their 3'-terminus revealed the presence of a specific balance of variants of the endings of telomeric overhangs, which is characteristic of the basic non-fissile and cell division activated state. In this regard, the study of the spectral properties of possible variants of terminal repeats that terminate the telomeric overhangs, namely, the balance of the ratio of the primary colors of the fluorescence spectrum at different stages of the cell cycle, is an urgent task. It allows one to determine the specific spectral markers of activated cell division arising during the main transitions of the nucleotide endings of the telomeric overhangs GTTAGG → GGTTAG → GGGTTA.

When studying all three colors of the visible fluorescence spectrum during a continuous change of one sample after another, the effect of the so-called “residual DNA field” was noticed. It consists in the fact that the place of scanning the sample in the detector continued to carry information about its fluorescence in the form of a weak field even after its removal. In this regard, the previous DNA sequences influenced the fluorescent properties of the samples. Therefore, the sequence of scanning samples was of particular importance.

Taking into account the discovered effects of the influence of previous samples on subsequent ones, we adhered to the same pattern of alternating samples when analyzing all studied sequences, both telomeric, and gene or mononucleotide. Figure 5 shows the spectral characteristics of telomeric repeats in the indicated sequence from left to right, from the first to the sixth options. The indicated fluorescence values corresponded to the state of the DNA spectral code existing at the time of the study (end of April 2012).

The detection of the “residual DNA field” effect in relation to telomere overhang sequences is of great importance in light of understanding the speed and sequence of changes in their terminal nucleotides during activation of cell division. In this regard, we studied the sequence of samples corresponding to the main transitions of terminal triplets in the cell that occur when cell division is activated: 1.TAG → 6.TTA → 5.GTT → 4.GGT → 3.GGG → 2.AGG.

For the red spectrum, such a change in the sequence of samples significantly affected only the fluorescence of the telomeric repeat with the GTT terminal triplet. All other variants of the overhang telomeric repeat had similar values to the first sequence of samples. The fluorescence of the telomeric repeat AGGGTT in the second variant of the sequence of samples was +43.12, which is significantly higher compared to the original sequence of samples (+28.13 in diagram 5). Based on this, it can be concluded that the increase in near-red fluorescence for the GTT-terminal triplet depends on whether it precedes the Guanine-rich triplets (AGG, GGG and GGT) in time, and then experiences their overwhelming influence. This fact reveals the energy feasibility of the existing cycle of transitions of terminal triplets of telomeric overhangs during activation of cell division. It consists in maintaining a high level of the red fluorescence channel against the background of a drop in green during the transition of most endings to the TTA terminal triplet. In addition, the level of red fluorescence upon activation of cell division is maintained by switching the telomere repeat with the GTT terminal triplet to a state of increased fluorescence in the absence of the inhibitory effect of AGG repeat (Fig.16D, activated state of the cell *). In contrast, the high GTT content of the terminal triplet (25-27%) under the non-dividing state of the cell is characterized by its reduced fluorescence variant, since it is influenced by the guanine-containing triplet AGG simultaneously present in equal amounts.

Thus, the application of the claimed method in this study shows that each version of the telomeric repeat, which can end telomeric overhangs, has specific spectral properties and, above all, a unique ratio of red and green fluorescence. The spectral map compiled for the studied wavelength range 520-605 nm using the dyes FAM (520 nm), R6G (550 nm), TAMRA (580 nm) and ROX (605 nm) (Fig. 16) most clearly demonstrates these properties. The conversion of the obtained spectral data into an RGB color coding system of information is presented as a marker of the resulting fluorescence for each telomeric repeat option. All the studied colors of the spectrum in the studied wavelength range are presented as the resulting ratio of the red and green color channels. In particular, the yellow-green fluorescence channel (550 nm) was considered as the result of the predominance of green over red in the ratio 2: 1, the orange-red channel (605 nm) as the result of the prevalence of red over green in the ratio of 1.8: 1. The yellow fluorescence channel (580 nm) was presented as the ratio of red and green in a ratio of 1: 0.9. The result of the interaction of these colors is presented in the form of a color marker, as the resulting R / G ratio of red and green color channels in the studied range of the light spectrum.

As can be seen from the consideration of Fig.16, the markers of the resulting fluorescence differ not only in color tone, but also in its intensity (brightness) on the HSL (HSB) scale. It follows that the various variants of terminal repeats of telomeric overhangs add up to the overall picture of the resulting fluorescence of a certain intensity, which makes up a color marker of specific brightness characteristic of a cell at a certain stage of its cell cycle.

It should be noted that the main differences in the spectral properties of telomeric repeats are associated with the green fluorescence channel corresponding to the FAM dye with an emission maximum of 520 nm. Similar data indicating the greatest spectral specificity of the green spectrum for telomeric repeat sequences were also obtained using their terminal FAM labeling (example 1).

For the near red spectrum with an emission maximum of 605 nm, corresponding to the ROX dye, the differences for telomeric repeat variants are not so pronounced compared to the green spectrum. It is possible that the use of other dyes of the Cy5, Cy7 type and their analogues within the framework of the claimed method, the fluorescence spectrum of which is shifted to the farther red region, including the infrared, will allow better detection of spectral differences in telomeric repeats.

Changes affecting the fluorescence levels of the main color channels can have more global consequences than the established fluctuations in the energy potential of fluorescently-labeled DNA probes in Example 1.

The use of solutions of dyes in the form of free molecules for the implementation of the claimed method made it possible to establish significant changes in the spectral properties of DNA that occurred between April and September 2012. The nature of these changes is mainly associated with a change in the saturation of telomeric DNA with green fluorescence, which plays the role of the main trigger switch during activation of cell division.

The result of studying the green fluorescence spectrum of telomeric repeat sequences at the end of September 2012 is shown in Fig.6. The graph shows the dynamics of the accumulation of the fluorescence signal of carboxyfluorescein in time, which displays their slow prolonged saturation with green light energy under the influence of various telomeric repeat variants. A characteristic feature of the analysis at this stage was the lack of energy balance in the quantum-coupled DNA-dye system, that is, fluorescence continued to grow slowly throughout the study period.

From a comparison of the data of the diagram of FIG. 5 and the graph of FIG. 6, it is seen that a change in the spectral code of telomeric DNA is associated with a sharp drop in fluorescence in the green spectrum. For April 2012, the results of the analysis of the green fluorescence spectrum of telomeric repeats using solutions of free dye molecules were similar to the results of the analysis carried out using labeled probes in Example 1, which can be seen from a comparison of the diagrams of FIG. 2B and FIG. 5. In the month of September 2012, the results obtained using these two analysis options are different. Most likely, this is due to the influence of different spatial arrangement of fluorophore molecules with respect to the telomeric DNA sequence, which imitates various variants of their natural photon saturation in the cell.

Thus, the main changes in the spectral properties of telomeric DNA are associated with the regime of its saturation with the light energy of the green spectrum. It is determined by the quantum-bound fluorescence spectrum of free fluorescent molecules in a cell that do not come into close contact with it. In this case, the saturation mode of telomeric DNA, determined by DNA-binding proteins, has changed slightly. This is evidenced by the preservation in September 2012 of the fluorescent properties of end-labeled probes based on telomeric repeat variations. It is possible that the preservation of the fluorescent properties of the probes is associated with a special type of quantum memory, which retained their fluorescent properties characteristic of the unchanged spectral code of DNA at the time of the synthesis of the probes.

The main feature of the altered light energy saturation mode of telomeric DNA in the green spectrum was not only very slow saturation, but also the existence of periods of its almost complete absence, as well as periods of telomeric DNA hyperfluorescence. An example of the detection of periodic hyperfluorescence of telomeric repeat TTAGGG is the saturation dynamics of September 21, 2012 (Fig.7). As can be seen from the analysis of the graphs, the TTAGGG telomeric repeat possessed the maximum potential for saturation, while the variation of this repeat ending in the TTA triplet had a much lower potential. The GTTAGG telomeric repeat variant, which differs from the TTAGGG repeat by a shift of only one nucleotide, revealed the least saturation.

When studying the dynamics of saturation of the green fluorescent energy of telomeric sequences, a control sample of a pure FAM dye solution without adding DNA was studied (Fig.6-7). It is important to note that such a study of a control sample, taking into account the effect of the residual DNA field, must be carried out without the influence of samples containing oligonucleotides tested on this day. It is better to carry it out on a specially designated day, while waiting for as much as possible of the time after the DNA studies carried out before that. The observed slight increase in the background fluorescence of the control sample of pure dye is associated with the residual DNA fields in the scanning compartment of the fluorescence detector. Such phantom effects can affect the fluorescence of the control dye for several days after previous DNA studies. Nevertheless, the increase in the fluorescence of a pure dye, many times smaller in comparison with samples containing telomeric DNA, unequivocally testified to the specific properties of the latter in increasing the quantum-bound fluorescence of the spectrum common with the dye.

The data obtained indicate that the saturation mode of telomeric DNA with green fluorescence, carried out by free fluorescent molecules in the cell, has changed in the direction of a general decrease in saturation with its prolongation and the simultaneous existence of periods of hypersaturation.

It was shown that changes in the green fluorescence spectrum that began at the end of June 2012 are associated with a slight decrease in absorption in the yellow spectrum for some telomeric repeats and a simultaneous increase in red fluorescence (Fig. 8). These observations support the assertion of the interconnectedness of fluorescence channels and the integration of the multicolor spectrum of DNA radiation. The observed data correlate with a change in the properties of mononucleotide sequences in Example 5, which indicates the general nature of changes in the properties of nitrogen bases with a change in the spectral code of DNA. The decrease in absorption in the yellow spectrum for thymine, which was observed during the study of mononucleotide sequences, correlated with a decrease in absorption in this spectrum for the telomeric repeat variants TAGGGT and AGGGTT ending with this nitrogenous base.

In conclusion, consideration of the use of the proposed method for the study of telomeric sequences should be noted that the spectral properties of DNA are dynamic, especially in the second half of 2012. First of all, this concerns the establishment of a quantum-bound emission spectrum of DNA with free fluorescent molecules. This is due to the formation of multidirectional energy migration in the DNA sequence, non-oriented to the 5 'or 3' ends, as is the case with the use of labeled at the ends of the probes.

Example 5. DNA spectral analysis of the fluorescence of the visible range of mononucleotide DNA sequences using free fluorescence dye molecules.

In the experiment, synthetic mononucleotide sequences of 12 n.o. were used. manufactured by Eurogen (Russia), obtained by the standard phosphoramidite synthesis method.

DNA spectral analysis was carried out similarly to the described method in example 4.

According to the measurement results, it was calculated by how many arbitrary units the fluorescence of the initial dye solution increased or decreased after the addition of the corresponding mononucleotide sample. The results of the study under the conditions of an unchanged DNA code in April 2012 are presented in the form of a diagram showing the levels of dye fluorescence associated with the types of nitrogenous DNA bases (Fig. 9). The ratio of the obtained values of the increase in their fluorescence demonstrates the spectral characteristics of the fluorescence properties of the studied mononucleotide sequences in the studied spectra of visible light. Based on the obtained data, one can get an idea of the spectral properties of each of the four types of nitrogen bases in the absence of their mutual influence on each other, as in the case of a heteronucleotide sequence.

It is the spectral properties of nitrogenous bases that form the basis of the spectral code of DNA as a universal characteristic of its spectral properties, which determines the unique ratio of the processes of absorption and emission of fluorescence within the spectrum of visible light. The basis of the spectral code of DNA is the ratio of the fluorescence levels of the main color channels, which is a dynamic component and is expressed in alternating peaks of maxima and minima of their intensity.

The studies were conducted from April to October 2012. The result was the construction of different dynamic fluorescence spectra of the nitrogenous bases of DNA (Figs. 9-12), demonstrating the unique process of changing the spectral code of DNA fluorescence recorded during the study period.

Using the inventive method, it was found that in April 2012 the spectral code of DNA was characterized by a pronounced gradation of the quantum yield of fluorescence of nitrogenous bases in the green spectrum corresponding to the FAM dye. At the same time, thymine, guanine and cytosine showed an increasing positive increase, and adenine showed a negative increase in fluorescence of this dye (Fig. 9).

A comparison of the spectra obtained for telomeric repeats of the spectra with the fluorescence spectra of mononucleotide sequences under the conditions of an unchanged spectral code in April 2012 (Figs. 5 and 9) shows that the occurrence of green fluorescence is largely associated with the establishment of quantum resonance interactions between different nitrogen bases within the DNA sequences. So, mononucleotide sequences consisting of one type of nitrogenous bases showed a much smaller increase in fluorescence energy in the green spectrum compared to heteronucleotide sequences, which include telomeric and gene DNA. This indicates the special quantum resonance nature of the green fluorescence of DNA sequences, which showed their greatest spectral specificity compared to the yellow and red spectra.

The yellow fluorescence spectrum of mononucleotide sequences, as well as telomeric and gene sequences, was characterized by absorption for all types of nitrogen bases, and the near red emission. Thus, the main distinguishing feature of the spectral code of fluorophore-bound DNA fluorescence is the presence of pronounced fluorescence emission channels in the red and green spectra with simultaneous absorption in the intermediate yellow spectrum. Moreover, the red fluorescence channel is more powerful than green, but less spectrally specific for nucleotide sequences. In this regard, it is the green fluorescence channel that forms the basis of the spectral coding of genetic information, since it makes it possible to distinguish nucleotide sequences of DNA. The ratio of the color channels of fluorescence forms the basis of spectral-optical regulation of the functioning of the genome.

The detection of the effect of the “residual DNA field” in relation to mononucleotide sequences is of great importance in light of the understanding of the mechanisms of recording genetic information in the form of alternation of nitrogen bases along the polynucleotide chain of DNA. Examination of samples in the order oligo (dA) ₁₂ → (dT) ₁₂ → (dG) ₁₂ → (dC) ₁₂ describes the possible interactions of nitrogenous species along the energy migration along the ATGC nucleotide sequence in DNA. In this order of alternating samples, as can be seen from the diagram in Fig. 9, for the yellow channel of the TAMRA dye, the poly (dA) and poly (dT) samples, which were studied first, had the maximum absorption. Studies of the effect of changes in the sequence of samples were carried out under unchanged spectral code of DNA fluorescence (April-May 2012). Changing the sequence of samples, in which the poly (dC) sample was studied first, and then followed by poly (dG) -, poly (dA) - and poly (dT) samples, showed TAMRA dye fluorescence values: -10.53; -3.81; -5.69; -9.03, respectively. It follows that for the yellow fluorescence spectrum, the first in order nucleotide in the DNA sequence has a higher absorption than subsequent nucleotides of the same name (primary position effect). This property is especially pronounced for cytosine, since a change in the position of the poly (dC) oligonucleotide in the sequence of analysis of samples from the first to the fourth led to a decrease in absorption by more than three times. For the remaining samples in the yellow spectrum, the change in order was less pronounced.

In the red spectrum, a change in the sequence of samples to the inverse sequence oligo (dC) ₁₂ → (dG) ₁₂ → (dT) ₁₂ → (dA) ₁₂ showed the following values of the increase in fluorescence of the dye ROX: +22.48; +34.03; +25.99 and +37.64, respectively. In this spectrum, the position effect mainly affected the properties of the poly (dT) sequence and is related to its position relative to the poly (dG) sample in the series of samples. If the poly (dT) sequence preceded the poly (dG) sample, then the increase in dye fluorescence increased one and a half times. The primary position effect was less pronounced for poly (dA) and poly (dC) samples. Their primary position, compared with the last in the series of samples, slightly increased the fluorescence gain of the ROX dye.

In the green spectrum, the reverse sequence of sample analysis showed the following FAM dye fluorescence values: dC ₁₂ (+15.31); dG ₁₂ (+9.96); dT ₁₂ (+5.12); dA ₁₂ (-2.52). It revealed the effect of the primary position for the poly (dA) sample. Its absorbing properties were most clearly revealed at the initial position in the series of samples, similar to how the radiative properties of the poly (dC) sample increased at its primary position (+15.31). Thus, the absorption properties of the primary poly (dA) sample somewhat underestimated the increase in fluorescence for subsequent samples in the initial order. When the order was reversed, the high energy potential of the primary poly (dC) sequence affected all subsequent samples and caused a decrease in the absorption properties of the latter in the series of poly (dA) samples (-2.52).

The main changes in the spectral code that began in June 2012 were associated with a change in the spectral properties of thymine, guanine, and cytosine in the green spectrum. The first stage of such changes is displayed on a combined graph of the dynamics of saturation of mononucleotide sequences with green fluorescence energy from June 19, 2012 (Fig. 10). A comparison of the obtained graph with the diagram of Fig. 9 shows that the changes are due to the fact that in the first ten minutes after adding samples of poly (dT) and poly (dG) sequences to the FAM dye solution, a decrease in the fluorescence of the solution was observed. Only the poly (dC) sequence retained positive growth. At the same time, the mode of saturation with fluorescent energy itself changed, which stretched over time. Over the entire period of time the measurements were taken, energy equilibrium did not occur and fluorescent energy constantly increased. The observed hyperfluorescence of the poly (dC) sequence was similar to the hyperfluorescence of the telomeric repeat TTAGGG observed in the previous example (FIG. 7). It is also periodic. The hyperfluorescence of the poly (dC) sample was significantly superior to that for telomeric repeat. The increase in fluorescence of the FAM dye for the first hour of measurements was 124%. This indicated a more significant fluorescence potential of cytosine in the green spectrum compared to other nitrogenous bases. The recorded phenomenon was the first stage in the change in the spectral properties of nitrogen bases that occurred in the second half of 2012. Thus, it was found that a change in the saturation mode of telomeric sequences was associated primarily with changes in the general spectral properties of nitrogen bases.

At the first stage of changes in the spectral code of DNA fluorescence in June 2012, adenine showed spectrally stable properties in the studied spectra and did not reveal any significant changes. Against the background of a decrease in the thymine energy potential in the green spectrum, the absorption in the yellow spectrum for the poly (dT) sequence significantly decreased (Fig. 11). For the remaining sequences, no significant changes in the yellow spectrum were observed. Changes in the red spectrum mainly resulted in an increase in fluorescence for guanine and cytosine with a general tendency to equalize energy potentials for all types of nitrogenous bases in this spectrum.

It should be noted that the change in the spectral code of DNA described in June was not completed in 2012. They represent only the stages of restructuring, for the study of which the claimed method represents a unique, unparalleled tool. Studies were continued that indicated further spectral changes in DNA in the following months of June 2012. The subsequent trend of changes was associated with a further decrease in the saturation of DNA sequences with green fluorescence due to the altered properties of guanine and cytosine with a simultaneous increase in fluorescence associated with adenine (Fig. 12). If in the month of April guanine and cytosine showed maximum fluorescence in the green spectrum, and adenine showed maximum absorption, then in the months after June, guanine and cytosine began to absorb with a slow positive increase (saturation) of fluorescence energy. In this case, the poly (dA) sequence immediately after adding the FAM dye to the solution changed the absorption to an increase in radiation with the same slow saturation. The consequence of this process was the observed ratio of the energy potentials of telomeric repeats in the green fluorescence spectrum in the month of September 2012 (Fig.6). Moreover, the obtained results demonstrate the general tendency of changes in the green fluorescence channel for mononucleotide sequences, which is associated with the provision of spectral differences between nitrogenous bases. This difference lays the foundation for spectral coding of nucleotide sequences under conditions of an altered state of the DNA spectral code. Moreover, the differences between adenine and guanine are of particular importance, both under conditions of an altered and unchanged spectral DNA code. This is due to the fact that it is these nitrogenous bases that determine the specificity of the fluorescence of the ends of telomeric overhangs in the main non-fissile and cell-activated states of division.

Example 6. DNA spectral analysis of fluorescence of the visible range of fragments of gene sequences of human cyclin B1 and D2 using free fluorescent dye molecules.

In the experiment, synthetic oligonucleotide sequences produced by Eurogen (Russia) for human cyclin genes were used:

1. TGCCAGTGCCAGTGTCTGAGCC (gene CNB1, minus chain of DNA chromosome 5);

2. GGTCTGACTGCTTGCTCTTCCTC (gene CNB1, plus chain of DNA chromosome 5);

3. GTGCTGTCTGCATGTTCCTGGC (CND2 gene, minus DNA strand of chromosome 12);

4. CAGATGGCTGCTCCCACACTTC (CND2 gene, plus DNA strand of chromosome 12).

DNA spectral analysis was carried out similarly to studies of oligonucleotide sequences in the previous examples. The results are presented in the form of bar charts and graphs of figures 13-15.

The diagram of Fig. 13 shows the ratio of fluorescence channels in the three primary colors of the visible spectrum in April 2012. Thus, the conditions of the unchanged spectral code of DNA fluorescence during this period demonstrate pronounced spectral differences not only in mononucleotide and telomere sequences, but also in gene sequences.

The results obtained showed that changes in the spectral code of DNA that occurred at the end of June 2012 also affected the spectral properties of gene sequences. Moreover, the nature of these changes significantly differed from those for telomeric sequences.

The restructuring of the spectral code of DNA in the second half of 2012, associated with changes in the properties of nitrogen bases, affected the properties of polynucleotide DNA sequences in different ways. These differences are related to their nucleotide composition, namely, the amount of nitrogen bases of guanine and adenine. It is these nitrogenous bases that have most changed their spectral properties when establishing a quantum-bound fluorescence spectrum with free dye molecules under conditions of an altered DNA spectral code. For the G chain sequence of telomeric DNA containing a regularly repeating sequence of three guanines, changes in the properties of this nitrogenous base led to a sharp drop in green fluorescence. Gene sequences that are more variable in nucleotide composition not only did not decrease, but also increased their fluorescence in this spectrum. This proves the importance of green fluorescence saturation for the functioning of the cell genome. It was in the green fluorescence spectrum that the largest differences were obtained between the nucleotide sequences of DNA, especially in conditions of the unchanged spectral code of DNA that existed until June 2012.

Under the conditions of the modified spectral code, prolonged saturation with green fluorescence, characteristic of telomeric sequences, was practically not observed for gene sequences (Fig. 14). This fact indicates the fundamental differences of telomeric sequences from gene sequences. It is telomeric sequences that possess a unique mechanism of genome replenishment with green fluorescence, which performs the basic functions of spectral coding of hereditary information.

Changes in other spectra for the studied gene sequences, as well as for mononucleotide and gene sequences, were associated with a slight decrease in the fluorescence level in the yellow spectrum and an increase in red. At the end of June 2012, a slight decrease in the absorption in the yellow spectrum was observed only for the sequences of the plus chains of both genes, which is possibly associated with the end position of thymine in them (Fig. 15). In the red spectrum, all studied sequences revealed an increase in fluorescence, with the exception of the minus chain of cyclin B1. Perhaps this is due to a change in absorption to emission in the green spectrum.

Thus, the most spectrally unstable position was occupied by the sequence of the minus chain of cyclin B1, which changed the absorption to emission in the green spectrum. In this regard, the discovery using the claimed method of such spectrally unstable regions of genes, along with spectrally stable, plays an important role in understanding the functioning of the genome.

Using the claimed method makes it possible to obtain ideas about the significant differences of gene sequences from telomeric ones. The use of DNA spectral fluorescence analysis using free dyes made it possible to establish that a change in the spectral code in the second half of 2012 mainly affected the properties of telomeric sequences. It was telomeric DNA that was characterized by the greatest decrease in saturation with green fluorescent energy. At the same time, the mode of its saturation changed, which, unlike the gene sequences, became slow and stretched over time, showing periodic bursts of fast hyper-saturation (Figs. 6 and 7). Almost all telomeric repeats turned out to be extremely spectrally unstable. This was especially true of the GGGTTA, GGTTAG, and TTAGGG repeats, which regulate the existence of the basic quantum states of telomeric overhangs characteristic of non-dividing and activated cell division cells. Perhaps this is due to the lack of a nitrous base of cytosine in the composition of human telomeric DNA, which has the maximum, and therefore the most stable fluorescence in the green spectrum. The latter fact indicates the enormous importance of the process of changing the spectral properties of DNA and its monitoring using the inventive method for regulating cell division and identifying a risk factor for malignancy of cells.

A comparison of the spectra obtained in examples 4-6 showed that telomeric repeat variants revealed no less pronounced differences in the ratio of green and red fluorescence channels than gene or mononucleotide sequences. This confirms the idea that, within the framework of the nucleotide code of telomeric DNA, the necessary existence in the genome of terminal nucleotide sequences is ensured, which are particularly different in their spectral and fluorescent properties. It is due to them that the resulting fluorescence is regulated as part of mitogenetic radiation, which is a necessary condition for starting and implementing the process of cell division.

In this regard, the proposed method is a universal mechanism by which it is possible to evaluate changes in the level of fluorescence in the cell, which occurs due to rearrangements of the ends of telomeric overhangs, as the basis of mitogenetic radiation in the visible range that controls cell division. Thus, the concept of mitogenetic radiation itself is expanding, which, in contrast to the classical understanding laid down by A.G. Gurwich in the first half of the XX century, includes not only the UV region, but also the entire visible fluorescence spectrum.

The molecules of the fluorescent dyes used are a universal model by which the effect of telomeric DNA sequences on cell fluorescence is studied. The cell can contain many similar fluorescent molecules, which can be sources of mitogenetic radiation in the UV and visible light ranges. The sources of UV fluorescence can be the amino acids tryptophan, tyrosine, phenylalanine, cysteine, and cystine, which are part of proteins whose fluorescence maximum corresponds to 300-350 nm. In the green region of the spectrum, oxidized flavoproteins (510-540 nm) fluoresce. Sources of red fluorescence may be some derivatives of porphyrins. Sources of blue fluorescence are reduced pyridine nucleotides NADH and NADPH (440-480 nm), as well as compounds of the thiochrome type (vitamin B1 derivative). With food, a person can also consume fluorescent substances. For example, plant chlorophyll is a powerful source of red fluorescence, and derivatives of certain alkaloids (plant quinine) have strong blue fluorescence. Thus, many metabolites of the human body possess fluorescence properties in the visible range of light and can form an associated multicolor spectrum with DNA, which forms the basis of quantum-optical regulation of the genome.

According to the generally accepted opinion, the intrinsic fluorescence of DNA is very weak and belongs to the UV spectrum. However, it was shown that DNA itself emits light in a wide range of the visible spectrum in the form of very weak fields (works by Popp, Germany). In this regard, the described properties of DNA to form a quantum-bound spectrum and increase the fluorescence of some dyes can also extend to various fluorescent molecules in the cell, which as a result can become a light source of greater power. This is a new understanding of the role of DNA in generating a single light field of a cell, sufficient for the formation of the laser-active medium of the genome. Theoretical and experimental developments regarding the existence of coherent radiation of photons of the visible spectrum forming a laser-active medium in DNA are presented in studies of the Poppa group (Porr FA, Li KH, Cu G. Recent Advances in Biophoton Reseach and its Application (Kaiserslantern, Word Scientific, 1992) and Garyaeva P. P. (Wave genome. Moscow, 1994; Wave genetic code. Moscow, 1997). Despite this, the existence of ultra-weak laser radiation of DNA in the visible wavelength range is still controversial.

Until today, researchers have not stopped searching for sources of suitable power for the existence of a laser DNA field as the basis of quantum-optical recording of hereditary information. The development of the idea of recording genetic information through a laser was facilitated by the progress in optical electronics associated with the creation of a fluorescence dye laser. It was shown that fluorophores with a high quantum yield can be used as components of the active media of lasers. At the same time, one of the main directions of using such a laser was the transfer of a large amount of information. In this regard, the idea of recording in this way a huge amount of genetic information on DNA suggests itself. In addition, the use of ultrashort light pulses created on the basis of fluorescent laser dyes was the main characteristic. This brings us closer to the idea of DNA as a similar medium, the coherent photons of which correspond to ultrashort picosecond and femtosecond pulses. The unresolved issue of the necessary radiation power of DNA.

Controversial evidence of ultra-weak DNA emission has hindered progress in this area. The main methodological error of the researchers was to consider the fluorescence of DNA separately without its quantum connection with other fluorescent molecules. The discovery of fluorophore-bound DNA fluorescence explains the existence of a more powerful source of DNA radiation than was previously accepted, sufficient for the formation of a laser-active medium. Using the inventive method, it was found that the formation of a quantum-bound spectrum between a dye (fluorophore) and DNA in a common solution can lead to a powerful increase in the initial fluorescence of the dye solution, which in some cases reaches 100% or more. A unique fact discovered using the proposed method is the detected periodic hyperfluorescence of DNA sequences. It describes the mechanisms of saturation of the cell genome with light energy due to a source unknown to science. Moreover, the increase in dye fluorescence in the presence of DNA depends on its nucleotide sequence and can reach more than 260%, depending on the duration of monitoring.

This demonstrates the unique fluorescence potential of DNA, which directly depends on the fluorescence potential of the fluorophore with which it forms an associated spectrum. It was found that the quantum yield of fluorophore-bound DNA fluorescence is directly proportional to the intensity and spectral characteristics of light excitation and is comparable to that for a specialized dye. This suggests the possibility of the existence in the cell of a laser medium based on a quantum-bound spectrum of DNA and fluorescent molecules. Moreover, for the formation of exciting radiation, the photo mode of the cell itself is essential, the intensity and spectral characteristics of which are also determined by the number and composition of the fluorescent molecules included in it. On the one hand, the fluorophore-bound spectrum of DNA is determined by fluorescent molecules that form a common spectrum with DNA; on the other hand, these molecules themselves use other spectrum-suitable molecules for their excitation. Thus, monitoring the composition of body fluorescent molecules and their emission spectrum is a unique tool for controlling DNA fluorescence as the basis of the laser-optical mechanism of genome functioning. For these purposes, the use of various embodiments of the proposed method provides ample opportunities.

Naturally, the substances present in the body in their fluorescence potential are significantly inferior to specialized dyes. However, the power of photon saturation (light field) of DNA in each specific radiation spectrum is enhanced by the fluorescent properties of fluorescent molecules, not only in a given cell, but also due to the totality of such molecules in the body. Together, this can amount to sufficient photon pumping, which is necessary for the formation of the laser-active medium of the genome. Given ultrashort radiation pulses, it will provide a sufficient level of power to create a laser field of DNA.

The possibility of remote hyper-saturation of DNA with photons is evidenced by the detected remote action of some fluorescently-labeled DNA sequences on others located in a separate tube at a distance of several centimeters (example 3). In this regard, the possibilities of explaining the remote photo-saturation of the genome of the body are opened not only from their own fluorescent molecules, but also from surrounding objects of animate and inanimate nature. The use of the claimed method in the form of a non-contact embodiment opens up prospects for the use of remote corrective action on biosystems. Physical light sources or DNA sequences possessing their own fluorescence, including those enhanced by a fluorophore, as well as pure solutions of fluorophores without DNA sequences, can be used to affect the body’s photoprocesses. This aspect of the application of the proposed method is highlighted in the last claim.

All embodiments of the invention, with the exception of the third, relate to the contact embodiment of the method in which the molecules of the studied DNA sequence and dye (fluorophore) are in the same solution in a common tube. Example 4 clearly demonstrated that the nucleotide sequence of telomeric DNA, namely the sequence of its telomeric repeat, determines its own fluorescent properties. They are reflected in the change in fluorescence of the initial solution of the fluorescent dye, to which the studied fragments of telomeric DNA were added. Thus, the contact method is the option that most closely mimics the natural water conditions for the existence of telomeric DNA in cells. In this case, the resulting fluorescence of the dye is determined by the influence of the fluorescence properties of the telomeric sequence in the form of the ratio of radiation and absorption of light energy in the studied spectrum.

In the study of the latter qualities, the variant of the contact method, in which more than one DNA sequence is added to the dye solution, but uses a mixture of DNA fragments, has an indisputable advantage. For example, the study of mixtures of synthetic oligonucleotide probes imitating various variants of telomeric repeats in Example 2. In this case, the use of the claimed method provides unique opportunities for describing the spectral characteristics of telomeric repeat variations that can end telomeric overhangs in a cell.

Of particular relevance is the prospect of studying native fractions of telomeric overhangs using the claimed method to identify their spectral characteristics, which may be color markers of activation of cell division and the passage of phases of the cell cycle.

Using the inventive method, it was shown that telomeric DNA has unique fluorescence properties and spectral characteristics. Recent data on nucleotide polymorphism of telomeric DNA endings have led to a new understanding of the canonical hexanucleotide repeat as six variants of the possible sequence (GGTTAG, GTTAGG, TTAGGG, TAGGGT, AGGGTT and GGGTTA), each of which has unique fluorescent properties and spectral characteristics. Therefore, the detected phenomenon of rearrangements of the terminal nucleotide terminations of telomeric DNA is directly related to the phenomenon of fluorophore-associated fluorescence of DNA in the visible range of light discovered using the claimed method.

Depending on the variation in the nucleotide termination of the 3 'and 5' ends of telomeric DNA, the totality of its G-overhangs is a heteromorphic population that differs in the nucleotide composition of telomeric repeats. Depending on the 5'-end of the C-chain of telomeric DNA, the sequence of each single-stranded overhang of the G-chain is the nth number of one of six full-size repeat variants. At the same time, overhangs may not end in a full-sized repetition. In this regard, the role of their terminal triplets in determining the resulting fluorescence becomes clear.

It was found that activation of cell division in the first hours of stimulus exposure is associated with rearrangements of the telomere overhang terminal nucleotides. It was shown that the cell is most sensitive to a change in the sequence of the last telomeric repeat at the 3'-end of DNA. The result of this process can be a change in the spectral characteristics of the resulting fluorescence, determined by the 3'-ends of the telomeric overhangs of the cell.

According to the obtained ideas, the channels of integrated fluorescence of DNA form the basis of the trigger mechanism for the activation of cell division by switching two primary colors of the spectrum. One of the colors is red, and the second, the antagonistic color, can be represented by green or blue. Such a scheme provides clear spectral discrimination of the optical signal that the cell perceives to begin preparation for division.

It was shown that in accordance with the spectral code of the fluorophore-associated fluorescence of human DNA, a green-red coding of proliferative information is used to regulate cell division processes. Changes in the spectral code that occurred in June 2012 are associated with a significant change in the saturation mode of human telomeric DNA with green fluorescence. Using the proposed method presents unique opportunities for studying the mechanism of quantum saturation of telomeric DNA and allowed to establish a new mode of its functioning in the green spectrum (example 4).

A study of the terminal nucleotides of the G-chain of human telomeric DNA has established the existence of balanced and unbalanced profiles of the terminal nucleotides of telomeric overhangs. Using the proposed method allowed them to be associated with the existence of different quantum states of the cell associated with the ends of telomeric overhangs. These states are characterized by a different balance of the green and red radiation channels depending on the change in their nucleotide endings. For the first time, it was found that the main non-fissile state of the cell is accompanied by the predominant end of telomeric overhangs to guanine. Activation of cell division in the first hours of stimulus exposure is accompanied by a sharp increase in the content of telomeric overhang endings on adenine. The difference in the spectral properties of nitrogenous bases, established using the proposed method, allows us to associate these nucleotide rearrangements with a change in the fluorescence of telomeric overhangs. The non-fissile state of the cell is characterized by the predominance of the emission of fluorescence of telomeric overhangs in the spectrum corresponding to their termination by guanine. For conditions for the stable existence of the spectral code of human telomeric DNA, this spectrum is green. It was the green spectrum that turned out to be the most spectrally specific for various variants of the endings of telomeric G-overhangs.

It was found that the activation of fission is accompanied by an increase in the content of telomeric endings on adenine, which is directly related to the preservation of the red spectrum of their radiation and a sharp drop in green. Under these conditions, especially in the first hours of fission activation, the nucleus of an activated cell “turns red” due to changes in the resulting fluorescence of the ends of telomeric overhangs. This is evidenced by the compilation of the spectral map and color marker of the resulting fluorescence of the telomeric repeat GGGTTA in the wavelength range of 520-605 nm (Fig.16E). The indicated trait can be used as a diagnostic color marker of cell division activated. In the following hours, a further progression of the cycle of rearrangements of terminal nucleotides leads to a gradual decrease in the red signal. Against the background of its decrease, the green fluorescence channel again increases up to the ratio characteristic of non-dividing cells. In this case, the color marker of the resulting fluorescence of the ends of the telomeric overhangs again acquires a pronounced green component. The main contribution to this process is made by the telomere repeat of GTTAGG, which is demonstrated by its spectral map and color marker of the resulting fluorescence (Fig.16B).

The conditions of the modified spectral code that arose in the second half of 2012 are apparently associated with a significant transformation of the fission activation scheme described above. It is mainly associated with a delayed saturation of the green fluorescent energy of telomeric repeats, which ensures their spectral differentiation. In the green spectrum, the predominance of fluorescence of GTTAGG repeat (the main for the non-dividing state of the cell) over the GGGTTA repeat (the main for the activated cell division) began to be observed after two hours of studying the dynamics of their saturation (Fig.6).

Thus, by the ratio of the main coding channels of proliferative information represented by fluorescent radiation of telomeric overhangs, one can judge the stages of activation of cell division. This can form the basis of the latest DNA spectral analysis, which can be widely used in medicine. Any changes at the stages of rearrangement of terminal nucleotides can be diagnosed not only directly, but also using the proposed method by establishing the ratio of green and red fluorescence channels of telomeric overhangs.

In conclusion, it should be noted that telomeric overhangs are the only variable genetic substrate of the cell capable of rapid reflex changes in response to changes in environmental conditions. This is due to the fact that genomic DNA is conservative in structure and is supported by strict mechanisms of replication and repair. The existence in the cell of mechanisms of exonuclease action on the 5'- and mainly 3'-ends of telomeric DNA is the basis for a quick reflex response of the cell to the effect of the division stimulus. The changes in the spectral characteristics of the fluorescence of telomeric overhangs that occur in this case can serve as an important criterion for evaluating the proliferative properties of a cell. In this regard, the claimed method can form the basis of a new direction in molecular diagnostics - DNA spectral analysis of the fluorescence of telomeric overhangs, which consists in establishing the ratio of the main fluorescence channels of telomeric overhangs during activation of cell division and the passage of the main stages of the cell cycle.

Another area of application of the proposed method is DNA spectral analysis of fluorescence of gene sequences. In this case, synthetic sequences of genes, native fragments of genomic DNA, chromosome regions, etc., are used as test samples. DNA spectral analysis is a powerful tool for studying the genome of a cell, especially in connection with the consideration of the concept of quantum optical coding of hereditary information. This concept assumes that each nucleotide has specific spectral characteristics and contributes to the resulting fluorescence of the DNA sequence. Moreover, each sequence, regardless of length, can be represented by a characteristic fluorescence spectrum as a result of the interaction of the main color channels. An example of studying the role of the main types of nitrogen bases in the visible spectrum of DNA fluorescence is the study of mononucleotide sequences in example 5.

A study of the role of each type of nitrogenous base and their combinations in a specific nucleotide sequence allows us to rethink the importance of single nucleotide polymorphisms and point mutations in the cell genome. Further development of DNA technologies in this direction may lead to the preparation of spectral color maps of gene regions, full-sized gene sequences, or their regulatory elements, which will help to understand the mechanisms of their functioning. Example 6 shows that the different regions represented by the plus and minus DNA chains within the sequence of one gene differ in their spectral characteristics, especially in conditions of a stable spectral DNA code (April 2012).

Spectral mapping of chromosomes and their fragments will make it possible to explain in a new way their contribution to the formation of the general light field of a cell and to understand the significance of chromosome rearrangements in its genome.

These new areas of study of the genome of the cell, which are possible using the proposed method, speak of its indisputable practical significance and advantage over existing methods for studying the fluorescence of DNA. Until now, there were no ways to illuminate the question of the ratio of the processes of absorption and emission of light quanta in the visible spectrum, depending on the specific nucleotide sequence of DNA. The claimed method made it possible to establish that for the spectral code of the fluorophore-associated fluorescence of human DNA, the main fluorescent channels in the visible range of light are red and green, and the yellow spectrum is absorbed. Changes in the spectral code of DNA fluorescence observed after mid-June 2012 mainly affected the properties of telomeric sequences, for which the saturation mode of green fluorescence changed.

For the first time, the proposed method for studying DNA fluorescence made it possible to evaluate the contribution of each nucleotide of the studied sequence to the formation of the resulting radiation flux as the balance of the primary colors of the visible spectrum. It has become possible to study the quantum resonance relationships between individual sequences based on the effects of energy migration between nucleotides within the studied color channels. Moreover, the use of various embodiments of the method allows one to study the influence of a specific direction of energy migration, namely, the 5'-terminal or 3'-terminal direction, depending on the location of the dye in the studied sequence of the DNA probe. The conditions for the absence of a preferred direction of energy migration are studied using a dye in the form of molecules freely surrounding the studied DNA sequence in solution. The use of free dye molecules plays a special role for the purpose of studying the saturation of nucleotide sequences with the fluorescence energy of a certain spectrum.

This is of great importance in the framework of a comprehensive study of the telomeric overhang population as a molecular substrate controlling the light flux regulating cell division. Using the patented method allows you to explore the quantum resonance relationships between individual telomeric overhangs, which are the balance of the processes of radiation and absorption of quanta of a certain spectrum depending on their nucleotide sequence.

Using the inventive method, a universal remote mechanism of quantum interactions was established that occurs between nucleotides both within the sequences themselves and between different sequences. The remote influence of solutions of synthetic analogs of overhangs on the fluorescence of each other, located at a distance of several centimeters in different tubes, was discovered. This mechanism differs from the mechanisms of inductive-resonance and exchange-resonance energy migration described in the literature, in which close contact or overlapping of electron clouds between the donor and acceptor molecules is required. Thus, it was found that telomeric overhangs can affect each other, not only being in the same cell, but also affect the fluorescence of the overhangs of surrounding cells and tissues. The latter fact is especially relevant in order to study the mechanisms of formation of a single field of the cell, organ and organism as a whole, as well as for the development of systems for remote diagnostics and correction of processes occurring in them.

Claims (15)

1. The method of spectral analysis of the fluorescent properties of nucleotide DNA sequences, used for the purpose of genetic diagnosis, research of mitogenetic radiation of cells, coding of hereditary and proliferative information, which consists in studying the emission spectrum of solutions of fluorescent dyes, quantum-associated with the studied sequence, and carried out in the following steps:
a) preparation of aqueous solutions of dyes of primary fluorescence colors of the FAM type in the green spectrum, R6G in the yellow-green spectrum, TAMRA in the yellow spectrum, ROX in the orange-red spectrum and the like, having fluorophore groups freely located in space and which are relative to the internal the DNA structure with non-intercalating and non-grooved molecules, at a concentration of 0.25-0.5 μg / ml, providing the same fluorescence intensity in each of the color channels of detection;
b) measurement of the background fluorescence of dye solutions in the respective detection channels using a FDG-001 fluorescence detector;
c) adding to the dye solution a DNA sample in an amount of 150-200 ng, which allows you to record changes in the fluorescence of dyes under the influence of DNA with reliable sensitivity;
d) measurement of fluorescence of dye solutions, which selectively responds to the addition of a DNA sample depending on the fluorescence and spectral characteristics of the studied nucleotide sequence in the recorded wavelength ranges due to the establishment of a common quantum-bound emission spectrum of DNA-dye;
e) recording the results of the analysis in the form of a representation of the values in arbitrary units of the positive or negative increase in the fluorescence of the dyes in relation to their initial background before adding a DNA sample in the form of building bar charts or curves of the dynamics of signal growth over time;
f) interpretation of the results of the increase in the fluorescence of dyes, which indicates changes in the intrinsic fluorescence properties of the studied DNA sequences in the corresponding spectral range resulting from nucleotide rearrangements of telomeric DNA ends, point mutations and polymorphisms of genes, chromosomal rearrangements, changes in the karyotype or cell genome. 2. The method according to claim 1, characterized in that the dye solutions are represented by probes, in which the planes of the fluorophore groups retain freedom with respect to the internal structure of DNA and are attached to its free 5 ′ or 3 ′ end, or are embedded inside as modified nucleosides , including using a combination with quenchers that provide the necessary level of underestimation of the dye fluorescence; in this case, the effect of the intrinsic sequence of a fluorescently-labeled probe or other DNA on the fluorescence of dyes in the composition of the probe is studied. 3. The method according to claim 1, characterized in that the sample of the studied DNA sequence, including as fluorescently-labeled probes, is used as a separate solution without adding dyes to the solutions; in this case, the remote non-contact effect of the DNA sequence on the fluorescence of solutions of pure dyes or dyes in the composition of the probes is studied. 4. The method according to claim 1, characterized in that the DNA samples for spectral analysis are: a) synthetic oligonucleotides of various lengths, as well as their double-stranded duplexes, which are mononucleotide, telomeric or gene sequences, including regulatory elements and non-coding regions; b) extended gene sequences, including cloned in a vector; c) fractions of double-stranded telomeric DNA or single-stranded telomeric overhangs; d) total genomic DNA or DNA of individual chromosomes and their fragments. 5. The method according to claim 1, characterized in that the fluorescence spectrum of the dye solutions is represented by waves of visible light in the range from violet to red, the specification of which is determined by the spectral characteristics of the used fluorophores and the peculiarities of recording their fluorescence at specific wavelengths using detecting devices. 6. The method according to claim 1, characterized in that the fluorescence spectrum of the dye solutions is represented by waves of the UV and IR ranges, the specification of which is determined by the spectral characteristics of the used fluorophores and the peculiarities of recording their fluorescence at specific wavelengths using detecting devices. 7. The method according to claim 1, characterized in that for carrying out spectral analysis a set of fluorescent dyes with different spectral characteristics is used, which allows to study the effect of the nucleotide sequence in different fluorescence spectra both mono-channel, when each dye is represented by a separate solution, and multichannel, when used a mixture of several dyes in one solution; the intensity of the exciting radiation corresponding to the fluorescence peak of each of the dyes is the same for all colors of the spectrum. 8. The method according to claim 1, characterized in that the fluorescence measurement of the dye solutions is carried out using fluorimeters, fluorimetric spectrophotometers, fluorescence scanners and detectors according to the conventional fluorimetry and spectrometry techniques using the appropriate color filters or light separators that allow studies of a wide transmission spectrum for primary fluorescence colors, as well as discretization by individual wavelengths within the individual colors of the spectrum. 9. The method according to claim 1, characterized in that at the stage of recording the results of spectral analysis, the intensity of the fluorescence color channels is estimated according to RGB and HSB, HSL color information coding scales in the form of spectral maps or color markers of the resulting fluorescence of the DNA under study in the wavelength range corresponding to the dyes used. 10. The method according to claim 1, characterized in that the spectral analysis is used to study gene sequences represented by individual plus and minus chains, as well as their duplexes, including regulatory gene elements and non-coding regions, in order to obtain spectral maps and color markers of the resulting fluorescence including for the spectral diagnosis of point mutations and polymorphisms of genes and the study of photon saturation of genostructures as a mechanism of quantum optical recording and spectral coding asledstvennoy information. 11. The method according to claim 1, characterized in that the spectral analysis is used to study the DNA fractions of individual chromosomes and their fragments in order to obtain spectral maps and color markers of the resulting fluorescence, as well as to study the role of their changes during chromosome rearrangements and violations of normal cell karyotype . 12. The method according to claim 1, characterized in that the spectral analysis is used to study synthetic telomeric sequences represented by various variations of telomeric DNA repeats and their ends, as well as their double-stranded duplexes, in order to obtain spectral maps and color markers of the resulting fluorescence and study them photon saturation as a mechanism of quantum optical recording and spectral coding of proliferative information. 13. The method according to claim 1, characterized in that the spectral analysis is used to study native fractions of telomeric DNA and telomeric overhangs with the aim of studying changes in their spectral characteristics, in particular determining the ratio of the main fluorescence channels and color markers during activation of cell division and passage of the main stages of the cell cycle. 14. The method according to claim 1, characterized in that for remote spectral diagnostics, living biosystems are used as samples for research as DNA sources in the form of cultures of cells and tissues, organs and parts of a living organism, the organism as a whole; in this case, solutions of dyes or labeled probes are used as biosensors and are located in close proximity to the object under study and allow one to obtain a general spectral picture, by changing which one can judge the functional state of the object under study. 15. The method according to claim 1, characterized in that the use of contact or non-contact options for its implementation is used to compile and use corrective action schemes on biosystems based on: a) physical photon sources, including laser and LED arrays; b) fluorescent molecules, including in combination with DNA; c) individual DNA sequences as sources of biofluorescence; wherein corrective action is characterized by a certain intensity, spectral characteristic and duration of radiation, including a certain mode of switching color channels in the case of using a multi-color spectrum.

Images