WO2007100833A2 - Gpat4 encodes a mammalian, microsomal acyl-coa:glycerol 3-phosphate acyltransferase - Google Patents

Abstract

The present invention provides isolated and purified polynucleotides and polypeptides related to mouse and human microsomal acyl-CoA: glycerol 3-phosphate acyltransferase 4 (GP AT4) and their uses in modulating triacylglycerol (TAG) levels in a cell or sample of interest. The invention also provides GPAT4 agonists and antagonists, e.g., GPAT4 polynucleotides and polypeptides, antibodies to GPAT4 (agonistic and antagonistic antibodies), GPAT4 inhibitory polypeptides, and GPAT4 inhibitory polynucleotides. The present invention is also directed to novel methods for diagnosing, prognosing, monitoring, treating, ameliorating and/or preventing conditions related to GPAT4, TAG synthesis (or accumulation), or the synthesis (or accumulation) of TAG precursors (e.g., MAG, LPA, PA, and/or G3P). These GPAT4-associated conditions include, but are not limited to, dyslipidemia (e.g., hyperlipidemia, hypertriglyceridemia, Type III hyperlipidemia), obesity, hypercholesterolemia, hepatic steatosis, cancer, skin disorders associated with altered lipid metabolism (e.g., acne vulgaris, dry skin), adiposity, type 2 diabetes (and complications associated therewith, such as dermopathy, retinopathy, neuropathy, and nephropathy), insulin resistance, hyperinsulinemia, hypertension, cardiovascular disease, atherosclerosis, stroke, thrombosis, lipodystrophy, lipopenia, Reye's syndrome, Cushing's syndrome, metabolic syndrome (e.g., syndrome X), eating disorders (e.g., anorexia, bulimia), skin homeostasis, disorders related to energy storage, nutrient absorption, and lipid metabolism, reduced or absent lactation, and low preterm birth weight (and complications thereof, such as defects in neural development).

Description

TITLE

GPAT4 ENCODES A MAMMALIAN, MICROSOMAL ACYL-COArGLYCEROL 3-PHOSPHATE ACYLTRANSFERASE

Related applications

[0001] This application claims the benefit of priority from U.S. Provisional Patent Application Nos 60/776,759, filed February 24, 2006, 60/852,366, filed October 17, 2006, and 60/872,747, filed December 4, 2006, the contents of which are hereby incorporated by reference herein in their entireties.

BACKGROUND OF THE INVENTION

Field of the Invention

[0002] The invention relates to a previously uncharacterized triacyl glycerol biosynthetic enzyme, designated GPAT4 (e.g., mouse and human GPAT4), and active fragments thereof, as Well as GPAT4 antagonists (e.g., inhibitory GPAT4 polynucleotides and polypeptides, antagonistic anti-GPAT4 antibodies, and inhibitory small molecules) that interfere with GPAT4 activity, and GPAT4 agonists (e.g., GPAT4 polynucleotides and polypeptides, agonistic anti-GPAT4 antibodies, and stimulatory small molecules) that enhance GPAT4 activity. In particular, the invention relates to mouse and human GPAT4 and related regulatory molecules, and their uses in regulating GPAT4-associated activities. The GPAT4 polynucleotides and polypeptides, and GPAT4 agonists and antagonists, disclosed herein are useful in modulating triacylglycerol (TAG) synthesis and TAG accumulation, as well as in screening for compounds capable of modulating TAG synthesis and/or TAG accumulation. As such, the GPAT4 polynucleotides and polypeptides (including fragments and fusions thereof), and GPAT4 agonists and antagonists are predicted to be useful in diagnosing, prognosing, monitoring, preventing, and/or treating GPAT4- associated conditions, disorders associated with TAG metabolism (e.g., TAG synthesis, depletion, or accumulation), and/or disorders associated with TAG precursor metabolism (e.g., TAG precursor synthesis, depletion, or accumulation).

Related Background Art

[0003] Synthesis of triacylglycerols (TAGs) is a fundamental metabolic pathway critically important for energy storage, nutrient absorption, lactation, skin homeostasis, and transport and metabolism of free fatty acids (Coleman and Lee (2004) Prog. Lipid Res. 43:134-76; Lehner and Kuksis (1996) Prog. Lipid. Res. 35:169-201; Smith et al. (2000) Nat. Genet. 25:87-90; Stone et al. (2004) J. Biol Chem. 279:11767-76). In animals, there are two main biochemical pathways for TAG biosynthesis: the monoacyl glycerol (MAG) pathway and the glycerol 3-phosphate (G3P) pathway. The MAG pathway begins with the acylation of 1- or 2-MAG to TAG by acyl- CoA:monoacylglycerol acyltransferase (MGAT); this pathway plays a dominant role in intestinal TAG synthesis for fat absorption. The G3P pathway is a de novo triacylglycerol biosynthetic pathway found in most tissues. GPAT (acyl- CoA:glycerol 3-phosphate acyltransferase) catalyzes the first step in triacylglycerol synthesis by the G3P pathway, producing 1-acyl-glycerol 3-phosphate (acyl-G3P) or lysophosphatidic acid (LPA). Subsequently, LPA is acylated at the sn-2 position to form phosphatidic acid (PA) by acyl-CoA:l- acyl-glycerol 3-phosphate acyltransferase (AGPAT), followed by a phosphohydrolyzation catalyzed by phosphatidic acid phosphatase (PTP) to form diacylglycerol (DAG). Both the MAG and G3P pathways share the final step of converting DAG to TAG, which is catalyzed by acyl-CoA:DAG acyltransferase (DGAT).

[0004] Enzymes in the triacylglycerol biosynthetic pathway are of considerable interest in the pathophysiology and treatment of disorders such as obesity, type 2 diabetes, dyslipidemia and atherosclerosis. For example, deletion of DGATl decreases body weight and improves insulin sensitivity in mouse models of obesity (Smith et al., supra; Chen and Farese (2005) Arterioscler. Thromb. Vase. Biol. 25:482-86); modulation of DGAT2 in mice by antisense oligonucleotides improves hepatic steatosis and hyperlipidemia (Yu et al, (2005) Hepatology 42:362-71). Ablation of mitochondrial GPAT (GPATl) in mice also leads to reduced fat pad mass, lower body weight, and lower hepatic VLDL secretion, as well as improved hepatic steatosis and insulin resistance (Hammond et al. (2002) MoI. Cell. Biol. 22:8204-14; Neschen et al. (2005) Cell Metab. 2:55-65). Since disorders such as obesity, type 2 diabetes, dyslipidemia, and atherosclerosis are closely associated with alterations in triacylglycerol and fatty acid synthesis, inhibition of enzymes in triacylglycerol synthesis is considered to be a means of treating these disorders (Chen and Farese (2005), supra; Chen and Farese (2000), supra; Subauste and Burant (2003) Curr. Drug Targets Immune Endocr. Metabol. Disord. 3:263-70; Shi and Bum (2004) Nat. Rev. DrugDiscov. 3:695-710; Lewin et al. (2004) J. Biol. Chem. 279:13488-95).

[0005] GPAT catalyzes the initial and committed step of triacylglycerol de novo synthesis. In mammals, GPAT activity exists in multiple isoforms, which can be distinguished by subcellular localization (mitochondria vs. microsomes), sensitivity to N-ethylmaleimide (NEM), and substrate preference (Coleman and Lee, supra; Lehner and Kuksis, supra; Lewin et al., supra). The gene encoding mammalian mitochondrial NEM-resistant GPATl (mtGPATl) was identified a decade ago, and found to play a key role in liver triacylglycerol synthesis (Hammond et al., supra; Neschen et al., supra; Yet et al. (1993) Biochemistry 32:9486-91). Early reports suggested that GPATl -deficient mice have decreased adipose tissue mass (Hammond et al.₅ supra); more recent studies have shown little effect of GPATl deficiency on the development of obesity (Neschen et al., supra). It is therefore likely that GPAT isoforms other than GPATl contribute to lipogenesis in adipose tissue.

[0006] Previously, the mammalian NEM-sensitive microsomal GPAT activity was demonstrated to account for 80% to 90% of total GPAT activity in most tissues, and 50% to 80% of total activity in liver (Coleman and Lee, supra). In contrast to a relatively modest increase in mitochondrial GPAT activity, the microsomal GPAT activity is dramatically induced during adipocyte differentiation (Yet et al., supra; Coleman et al. (1978) J. Biol. Chern. 253:7256-61), and is decreased in adipose tissue of rodent models of type 1 diabetes (Saggerson and Carpenter (1987) Biochem. J. 243:289-92).

[0007] Although a considerable number of attempts have been made to purify microsomal GPAT from various species (Kluytmans and Raju (1974) Prep. Biochem. 4:141-63; Yamashita and Numa, supra; Eccleston and Harwood (1995) Biochim Biophys. Acta 1257:1-10; Mishra and Kamisaka (2001) Biochem. J. 355:315-22), these attempts have not yielded the molecular makeup of the enzyme. Recently, identification of lipid biosynthetic enzymes has been facilitated by the availability of sequence information and identification of homologues or orthologues across different enzymes and species (Cao et al. (2004) J. Biol. Chem. 279:31727-34; Cao et al. (2003) J. Biol Chem. 278:13860-66; Cases et al. (1998) Proc. Natl. Acad. Set U.S.A. 95:13018-23; Cases et al. (2001) J. Biol. Chem. 276:38870-76; Yang et al. (2004) J. Biol Chem. 279:55866-74; Yen and Farese (2003) J. Biol. Chem. 278:18532-37). A gene encoding an NEM-sensitive enzyme exhibiting both GPAT and dihydroxyacetone phosphate acyltransferase (DHAP-AT) activity was recently identified in yeast (Zheng and Zou (2001) J. Biol. Chem. 276:41710-16). This enzyme belongs to the same superfamily as GPATl (mtGPAT), making it likely that mammalian microsomal GPAT is also a member of this family. However, to date, no close mammalian homologs of this yeast gene have been identified. SUMMARY OF THE INVENTION

[0008] The present invention provides various methods and compositions related to a previously uncharacterized triacylglycerol biosynthetic enzyme, designated GPAT4. Thus in at least one embodiment, the invention provides a method for treating, ameliorating, or preventing a GPAT4-associated condition in a mammal comprising administering to the mammal a therapeutically effective amount of an agent that modulates the level of expression or activity of GPAT4 in the mammal, i.e., a GPAT4 antagonist or a GPAT4 agonist. In another embodiment, the agent is a GPAT4 antagonist selected from the group consisting of GPAT4 inhibitory polynucleotides or fragments thereof, GPAT4 inhibitory polypeptides or fragments thereof, antagonistic anti-GPAT4 antibodies, antagonistic anti-GPAT4 antibody fragments, and small molecules. In another embodiment, the agent is a GPAT4 agonist selected from the group consisting of GPAT4 polynucleotides or fragments thereof, polynucleotides that hybridize under high stringency conditions to a nucleic acid sequence or a fragment of a nucleic acid as sequence set forth in SEQ ID NO:1 or SEQ ID NO:3, GPAT4 polypeptides or fragments thereof, polypeptides encoded by a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO:3, polypeptides encoded by a nucleic acid that hybridizes under high stringency conditions to a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, agonistic anti-GPAT4 antibodies, agonistic anti-GPAT4 antibody fragments, and small molecules. In a further embodiment, the GPAT4 associated condition is selected from the group consisting of dyslipidemia, obesity, hypercholesterolemia, hepatic steatosis, cancer, acne vulgaris, adiposity, type 2 diabetes, insulin resistance, hyperinsulinemia, hypertension, cardiovascular disease, atherosclerosis, stroke, thrombosis, lipodystrophy, lipopenia, Reye's syndrome, Cushing's syndrome, metabolic syndrome, anorexia, bulimia, reduced or absent lactation, and low preterm birth weight.

[0009] In another embodiment, the invention provides a pharmaceutical composition comprising a GPAT4 antagonist and a pharmaceutically acceptable carrier. In another embodiment, the GPAT4 antagonist is selected from the group consisting of GPAT4 inhibitory polynucleotides or fragments thereof, GPAT4 inhibitory polypeptides or fragments thereof, antagonistic anti-GPAT4 antibodies, antagonistic anti-GPAT4 antibody fragments, and small molecules. In another embodiment, the invention provides a pharmaceutical composition comprising a GPAT4 agonist and a pharmaceutically acceptable carrier. In another embodiment, the GPAT4 agonist is selected from the group consisting of GPAT4 polynucleotides or fragments thereof, polynucleotides that hybridize under high stringency conditions to a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, GPAT4 polypeptides or fragments thereof, polypeptides encoded by a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, polypeptides encoded by a nucleic acid that hybridizes under high stringency conditions to a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, agonistic anti- GPAT4 antibodies, agonistic anti-GPAT4 antibody fragments, and small molecules.

[0010] In another embodiment, the invention provides an antibody or antibody fragment that specifically binds a GPAT4 polypeptide or a fragment of a GPAT4 polypeptide. In another embodiment, the GPAT4 polypeptide is a mouse GPAT4 polypeptide or a human GPAT4 polypeptide. In another embodiment, the GPAT4 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:4. In other embodiments, the antibody antagonizes at least one GPAT4 activity. In other embodiments, the antibody agonizes at least one GPAT4 activity.

[0011] In another embodiment, the invention provides a method for decreasing TAG synthesis in a cell or cell population, comprising contacting a cell or cell population with a GPAT4 antagonist in an amount sufficient to decrease the level of expression or activity of GPAT4 in the cell or cell population, wherein the GP AT4 antagonist is selected from the group consisting of GPAT4 inhibitory polynucleotides or fragments thereof, GPAT4 inhibitory polypeptides or fragments thereof, antagonistic anti-GPAT4 antibodies, antagonistic anti- GPAT4 antibody fragments, and small molecules. In another embodiment, the invention provides a. method for increasing TAG synthesis in a cell or cell population, comprising contacting a cell or cell population with a GPAT4 agonist in an amount sufficient to increase the level of expression or activity of GPAT4 in the cell or cell population, wherein the GPAT4 agonist is selected from the group consisting of GPAT4 polynucleotides or fragments thereof, polynucleotides that hybridize under high stringency conditions to a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, GPAT4 polypeptides or fragments thereof, polypeptides encoded by a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO:3, polypeptides encoded by a nucleic acid that hybridizes under high stringency conditions to a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ. ID NO:1 or SEQ ID NO.3, agonistic anti^GPAT4 antibodies, agonistic anti-GPAT4 antibody fragments, and small molecules.

(0012] In another embodiment, the invention provides a method for decreasing PA, LPA and/or DAG synthesis and/or accumulation in a cell or cell population, comprising contacting a cell or cell population with a GPAT4 antagonist in an amount sufficient to decrease the level of expression or activity of GPAT4 in the ceil or cell population, wherein the antagonist is selected from the group consisting of GPAT4 inhibitory polynucleotides or fragments. thereof, GPAT4 inhibitory polypeptides or fragments thereof, antagonistic anti-GPAT4 antibodies, antagonistic anti-GPAT4 antibody fragments, and small molecules. In another embodiment, the invention provides a method for increasing PA, LPA and/or DAG synthesis and/or accumulation in a cell or cell population, comprising contacting a cell or cell population with a GPAT4 agonist in an amount sufficient to increase the level of expression or activity of GPAT4 in the cell or cell population, wherein the agonist is selected from the group consisting of GPAT4 polynucleotides or fragments thereof, polynucleotides that hybridize under high stringency conditions to a nucleic acid sequence or a fragment of a nucleic. acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, GPAT4 polypeptides or fragments thereof, polypeptides encoded- by a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, polypeptides encoded by a nucleic acid that hybridizes under high stringency conditions to a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, agonistic anti- GPAT4 antibodies, agonistic anti-GPAT4 antibody fragments, and small molecules.

[0013] In another embodiment; the invention provides a method for monitoring the course of a treatment of a GPAT4-associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient; (b) administering a GPAT4 antagonist to the patient; and (c) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from, the patient following administration of the GP AT4 antagonist, wherein a lower level of expression or activity of GPAT4 in the cell or sample of interest from the patient following administration of the GPAT4 antagonist, in comparison to the level of expression or activity of GP AT4 in the cell or sample of interest from the patient prior to administration of the GPAT4 antagonist, provides a positive indication of the treatment of the GPAT4-associated condition in the patient. In another embodiment, the invention provides a method for monitoring the course of a treatment of a GPAT4-associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient; (b) administering a GPAT4 agonist to the patient; and (c) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient following administration of the GPAT4 agonist, wherein a greater level of expression or activity of GPAT4 in the cell or sample of interest from the patient following administration of the GPAT4 agonist, in comparison to the level of expression or activity of GPAT4 in the cell or sample of interest from the patient prior to administration of the GPAT4 agonist, provides a positive indication of the treatment of the GPAT4-associated condition in the patient.

[0014] In another embodiment, the invention provides a method for prognosing a GPAT4-associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a first time point; and (b) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a second time point, wherein a lower level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the second time point, in comparison to the level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the first time point, indicates a decreased likelihood that the patient will develop a more severe form of the GPAT4-associated condition. In another embodiment, the invention provides a method for prognosing a GPAT4- associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient; and (b) comparing the level of expression or activity of GPAT4 in the cell or sample of interest to the level of expression or activity o'f GPAT4 in a reference cell or sample of interest, wherein a lower level of expression or activity of GP AT4 in the cell or sample of interest from the patient, in comparison to the level of expression or activity of GPAT4 in the reference cell or sample, indicates a decreased likelihood that the patient will develop a more severe form of the GP AT4-associated condition.

[0015] In another embodiment, the invention provides a method for prognosing a GPAT4-associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a first time point; and (b) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a second time point, wherein a greater level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the second time point, in comparison to the level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the first time point, indicates a decreased likelihood that the patient will develop a more severe form of the GPAT4-associated condition. In another embodiment, the invention provides a method for prognosing a GPAT4- associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient; and (b) comparing the level of expression or activity of GPAT4 in the cell or sample of interest to the level of expression or activity of GPAT4 in a reference cell or sample of interest, wherein a greater level of expression or activity of GPAT4 in the cell or sample of interest from the patient, in comparison to the level of expression or activity of GPAT4 in the reference cell or sample, indicates a decreased- likelihood that the patient will develop a more severe form of the GPAT4-associated condition.

[0016] In another embodiment, the invention provides a method for monitoring a GP AT4-associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a first time point; and (b) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a second time point, wherein a lower level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the second time point, iri comparison to the level of expression of activity of GPAT4 in the cell or sample of interest from the patient at the first time point, provides an indication that the GPAT4-associated condition has decreased in severity. In another embodiment, the invention provides a method for monitoring a GPAT4-associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient; and (b) comparing the level of expression or activity of GPAT4 in the cell or sample of interest from the patient to the level of expression or activity of GPAT4 in a reference cell or sample of interest, wherein a lower level of expression or activity of GPAT4 in the cell or sample of interest from the patient, in comparison to the level of expression or activity of GPAT4 in the reference cell or sample, provides an indication that the GPAT4-associated condition has decreased in severity.

[0017] In another embodiment, the invention provides a method for monitoring a GPAT4-associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a first time point; and (b) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a second time point, wherein a greater level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the second time point, in comparison to the level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the first time point, provides an indication that the GPAT4-associated condition has decreased in severity. In another embodiment, the invention provides a method for monitoring a GPAT4-associated condition in a patient, comprising (a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient; and (b) comparing the level of expression or activity of GPAT4 in the cell or sample of interest from the patient to the level of expression or activity of GPAT4 in a reference cell or sample of interest, wherein a greater level of expression or activity of GPAT4 in the cell or sample of interest from the patient, in comparison to the level of expression or activity of GPAT4 in the reference cell or sample, provides an indication that the GPAT4-associated condition has decreased in severity.

[0018] In another embodiment, the invention provides a method of screening for a compound capable of antagonizing GPAT4 activity comprising the steps of: (a) contacting a sample containing GPAT4 with a compound of interest; and (b) determining whether the level of activity of GPAT4 in the contacted sample is decreased relative to the level of activity of GPAT4 in a sample not contacted with the compound, wherein a decrease in the level of activity of GPAT4 in the contacted sample identifies the compound as a compound that is capable of antagonizing GPAT4 activity. In another embodiment, a method of screening based on determining the levels of expression of GPAT4 is provided. In other embodiments, the invention provides methods of screening for compounds capable of agonizing GPAT4 activity based on determining levels of activity or expression of GPAT4.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG. IA shows a sequence alignment and analysis of full-length human GPAT3 (hGPAT3) and human GPAT4 (hGPAT4); the predicted acyltransferase domain is boxed. Grey highlighting indicates homologous residues; black highlighting indicates identical residues. Once incorporated into the endoplasmic reticulum (ER) membrane, the stretch of amino acids between the TM domains is believed to be located on the lumenal side of the ER, while the acyltransferase domains are predicted to be located on the cytosolic side of the ER membrane. FIG. IB shows a transmembrane region prediction of human GPAT4 using hidden Markov modeling, suggesting that hGPAT4 contains three possible transmembrane regions located at approximately amino acids 20-42, 156-175, ahd 180-202 (indicated by the bars labeled "TMl," TM2" and "TM3").

[0020] Expression of GP AT4 in both mammalian HEK 293 cells (FIG.2A) and Sf9 cells (FIG. 2B) results in increased GPAT activity. Assays were conducted using cell lysates prepared from mammalian HEK 293 cells transfected with empty vector (Wild type) or vectors containing human DGATl, human GPAT4 (hGPAT4), human GPAT3 (hGPAT3), or human mitochondrial GPATl (hmtGPATl) cDNA, or from Sf9 cells infected with wild type virus without exogenous cDNA (Wild type) or virus containing DGATl, human GPAT4 (hGPAT4), or human.GPAT3 (hGPAT3) cDNA. In the absence of exogenously added lauroyl-CoA, formation of LPA is also absent, indicating the dependence on acyl-CoA of detected GPAT activity (FIG. 2B, last lane).

[0021] FIG. 3 shows that GPAT activity conferred by GPAT4-overexpression in Sf9 cells is NEM-sensitive. Cell lysates from Sf9 cells infected with wild type virus without exogenous cDNA.(Wild type) or virus containing human GPAT4 cDNA (hGPAT4) were preincubated with or without 0.4 mM N-ethylmaleimide (NEM) on ice for 15 min prior to GPAT assay.

[0022] FIGs. 4A and 4B show that GPAT activity in hGPAT4-infected Sf9 cells differs relative to different acyl-CoA species. FIG. 4A is a TLC image showing the formation of LPA; FIG. 4B is a quantitative analysis of the LPA bands from the TLC- image. GPAT activity in cell lysates prepared from Sf9 cells infected with wild type virus or virus containing human GPAT4 (hGPAT4) cDNA was examined with 15O mM of [¹⁴C]GSP and 50 mM of lauroyl-CoA (C12:0), pamlitoyl-CoA (C16:0), oleoyl-CoA (Cl 8:1), linoleoyl-CoA (Cl 8:2), arachidoyl-CoA (C20:0), or arachidonoyl-CoA ^"(C20:4).

[0023] FIG. 5A shows tissue distribution of mouse GPAT4 mRNA, and FIG. SB shows tissue distribution of human GPAT4 mRNA, both detected by Q-PCR. Data are expressed as mean ± SD (n=4). BAT, brown adipose tissue. [0024] FIG. 6A shows regulation of GPAT4 mRNA during 3T3-L1 differentiation (Preadi, preadipocytes; Adi, adipocytes). Regulation of GPAT4 mRNA in white adipose tissue (Fat) (FIG. 6B) and liver (FIG. 6C) is shown in control and in ob/ob (OB) mice. Regulation of GPAT4 mRNA upon PPARγ activation by rosiglitazone (Rosi) is shown in fat (FIG. 6D) and in liver (FIG. 6E). Data are expressed as mean ± SEM (n=4). *, P<0.05.

[0025] FIGs. 7A and 7B show that GPAT4 activity was diminished with a truncated GPAT4 protein (amino acids 1-207; GPAT4-T207). FIG. 7A shows a representative TLC analysis showing formation of LPA in a GPAT activity assay. FIG. 7B shows the quantitative GPAT activity analysis from three independent experiments; GPAT activity, as a percentage of activity from untransfected / wild type- cells, is expressed as mean ± SE.

[0026] FIG. 8 shows that differentiated 3T3-L1 adipocytes contain similar amounts of GPAT3 and GPAT4 mRNA. Levels of mRNA were measured by Taqman Q-PCR; standard curves were generated using recombinant plasmids containing GPAT3 or GPAT4, and were used to calculate cDNA copy number per ng of RNA. Data represent average values from three independent measurements.

DETAILED DESCRIPTION OF THE INVENTION [0027] In addition to the previously identified ER-associated GPAT, i.e., GPAT3, as disclosed in U.S. Provisional Application Nos. 60/776,759 (referred to as "GPAT2" therein) and 60/872,747 (the contents of both of which are incorporated by reference herein), the inventors herein disclose the molecular characterization of an additional ER-associated GPAT, GPAT4. The designation of GPAT4 as an ER-associated GPAT is supported by: 1) recombinant GPAT4 ectopically expressed in both mammalian HEK293 cells and Sf9 insect cells exhibits an acyl-CoA-dependent, NEM-sensitive GPAT activity, which recognizes a variety of acyl-CoA species as acyl donors; 2) GPAT4 is the closest homologue to GPAT3 and shares approximately 67% amino acid identity with GPAT3 across the entire molecule; and 3) GPAT4 exhibits a distinct and complementary tissue distribution pattern to GPAT3, especially in those tissues where active metabolism of triacylglycerols takes place (e;g., adipose tissue, liver, small intestine, kidney, and heart).

[0028] The discoveries and disclosure provided herein, in conjunction with the discovery and characterization of GPAT3, indicate that mammalian ER- associated GPAT, the crucial triacylglycerol biosynthetic enzyme, is encoded by multiple enzymes and/or isoforms. These isoforms may play overlapping, distinct, and complementary roles in controlling the formation of LPA in different tissues. The present disclosure facilitates' research into the basic biology of lipid metabolic enzymes, including the identification of additional protein(s) or cofactor(s) critical for triacylglycerol biosynthesis, which may themselves become therapeutic targets for disorders involving lipid metabolism. The present disclosure also facilitates research related to understanding the basic cellular processes such as energy storage,- fatty acid metabolism, signal transduction, lipids trafficking, and the interaction of different lipid synthetic enzymes in the ER membrane.

[0029] Two recent reports have disclosed inai me mouse gene αesignated AGP AT6 (termed "GPAT4" herein) displays approximately 66% identity to mouse GPAT3 (Beigneux et al. (2006) J. Lipid Res. 47:734-44); Vergnes et al. (2006) J. Lipid Res. 47:745-54). It has been previously reported that GPAT4/AGPAT6 is localized to ER (Beigneux et al., supra), consistent with GPAT4 being- a microsomal GPAT isoform. The instant identification of GPAT4/AGPAT6 as an enzyme with GPAT activity explains the phenotype of GPAT4/AGPAT6^'7" mice. Mice lacking GP AT4/AGPAT6. display a reduced body weight and fat content, lack of subdermal fat, and defective lactation (Beigneux et al., supra; Vergnes et al., supra). This phenotype is similar to the DGATl knockout mouse (Smith et al., supra; Chen and Farese (2005) Arterioscler. Thfomb. Vase: Biol. 25:482-86), and, in view of the data presented herein, is now explained as a defect iri triacylglycerol biosynthesis due to lack of a microsomal GPAT.

[0030] The inventors have identified GPAT4 as a new triacylglycerol biosynthetic enzyme.- Accordingly, similar to other lipogeriic enzymes, GPAT4 is believed to be useful as a target for the treatment of disorders related to alterations in triacylglycerol metabolism including, but not limited to, dyslipidemia, obesity, adiposity, type 2 diabetes (and complications associated therewith, such as dermopathy, retinopathy, neuropathy, and nephropathy), insulin resistance, hyperinsulinemia, hypertension, cardiovascular disease, atherosclerosis, stroke, lipodystrophy, Cushing's syndrome, metabolic syndrome (e.g., syndrome X), eating disorders (e.g., anorexia, bulimia), skin homeostasis, and disorders related to energy storage, nutrient absorption, lactation, and low preterm birth weight (and complications thereof, such as defects in neural development).

[0031] As such, the present invention provides GPAT4 antagonists, e.g., mouse and human GPAT4 inhibitory polynucleotides (i.e., polynucleotides that decrease GPAT4 levels and/or activity either directly or indirectly, e.g., antisense molecules, siKNAs, aptamers); GPAT4 inhibitory polypeptides (i.e., polypeptides that decrease GPAT4 levels and/or activity either directly or indirectly, e.g., fragments of GPAT4, such as soluble fragments containing the G3P or acyl-CoA interaction domains, and fusion proteins thereof); antagonistic anti-GPAT4 antibodies or antibody fragments (i.e., antibodies or antibody fragments that decrease GPAT4 activity and/or expression either directly or indirectly, including antagonistic antibodies and antibody fragments that bind full-length GPAT4 and/or GPAT4 fragments); and antagonistic small molecules (e.g., siRNAs, aptamers, and small inorganic and/or organic molecules or compounds), which may be used to suppress GPAT4-mediated acylation of G3P, and/or accumulation of TAG and/or TAG precursors (e.g., LPA, PA, and/or DAG), and consequently, which may be used in the diagnosis, prognosis, monitoring, treating, ameliorating and/or preventing disorders related to increased GPAT4 activity and/or disorders related to increased TAG levels and/or disorders treatable' by decreasing GPAT4 activity or expression and/or TAG levels, i.e., GPAT4-associated conditions and/or conditions associated with TAG de novo synthesis. The present invention further provides GPAT4 agonists, e.g., GPAT4 polynucleotides and GPAT4 polypeptides (including full- length and/or fragments of GPAT4, such as a GPAT4 catalytic domain, and fusions thereof), agonistic anti-GPAT4 antibodies or antibody fragments (i.e., antibodies or antibody fragments that enhance GPAT4 activity and/or expression either directly or indirectly, including agonistic antibodies and antibody fragments that bind GPAT4 fragments), and agonist small molecules, which may be used to enhance GPAT4-mediated acylation of G3P, and/or accumulation of TAG and/or TAG precursors (e.g., LPA, PA, and/or DAG), and consequently, which may be used in the diagnosis, prognosis, monitoring, treating, ameliorating and/or preventing disorders related^' to decreased GPAT4 activity and/or disorders related to decreased TAG levels and/or disorders treatable by increasing GPAT4 activity or expression and/or TAG levels.

[0032] Disorders related to increased and decreased GPAT4 activities are described herein as "GPAT4-associated conditions" or "GPAT-2-associated disorders," and include, without limitation, dyslipidemia (e.g., hyperlipidemia, hypertriglyceridemia, Type III hyperlipidemia), obesity, hypercholesterolemia, hepatic steatosis; cancer, skin disorders associated with altered lipid metabolism (e.g., acne vulgaris:,- dry skin), adiposity, type 2 diabetes (and complications associated therewith, such as dermopathy, retinopathy, neuropathy, and nephropathy), insulin resistance, hyperinsulinemia, hypertension, cardiovascular disease, atherosclerosis, arteriosclerosis, stroke, thrombosis, lipodystrophy (including congenital generalized lipodystrophy (Berardinelli-Seip syndrome), familial partial lipodystrophy (Dunnigan type, Kobberling type, and the mandibuloacral dysplasia type), and acquired forms of lipodystrophy such as acquired generalized lipodystrophy (Lawrence syndrome), acquired partial lipodystrophy (Barraquer-Simons syndrome), and lipodystrophy induced by antiviral treatments, e.g., treatment with HIV protease inhibitors), lipopenia, Reye's syndrome, Cushing's syndrome, metabolic syndrome (e.g., syndrome X), eating disorders (e.g., anorexia, bulimia), disorders and conditions related to skin homeostasis, disorders related to energy storage, nutrient absorption, and lipid metabolism, reduced or absent lactation, and low preterm birth weight (and complications thereof, such as defects in neural development).

[0033] The present invention further provides methods of screening for: 1) GPAT4 antagonists, e.g., mouse and human GPAT4 inhibitory polynucleotides (e.g., antisense, siRNA, aptamers); GPAT4 inhibitory polypeptides (e.g., G3P or acyl-CoA interacting fragments of GPAT4); antagonistic anti-GPAT4 antibodies and antibody fragments (including antibodies and antibody fragments that bind GPAT4 fragments); and antagonistic small molecules (e.g., siRNAs, aptamers, and small organic molecules or compounds); and 2) GPAT4 agonists, e.g., GPAT4 polynucleotides and polypeptides (including fragments of GP AT4, such as a GPAT4 catalytic-domains) and fusions thereof; agonistic anti-GPAT4 antibodies and antibody fragments (including antibodies and antibody fragments that bind GPAT4 fragments); and agonistic small molecules. Such screening methods may be undertaken by, e.g., measuring changes in the level of expression of GPAT4 (e.g., levels of GPAT4 mRNA, cDN A,^' protein and/or protein fragments), or by measuring changes in the level of activity of GPAT4 (e.g., changes in. levels .of acylated GPAT4 product (e.g., LPA), changes in levels of nonacylated GPAT4 acceptor molecules (e.g., G3P), changes in levels of TAG and/of TAG precursors (e.g., LPA, PA, DAG), changes in the levels of CoA-SH byproducts, and/or ^"changes in levels of acyl donors (e.g., lauroyl-CoA, oleoyl-CoAJ).

[0034] The term "GPAT4" as used herein, where appropriate, refers to mammalian GPAT4, e.g., primate and/or rodent GPAT4, e.g., human and/or mouse GPAT4, and includes both GPAT4 polynucleotides (e.g., RNAs and DNAs, including the sequences disclosed herein, variants (e.g., analogs and homologs) and polymorphs thereof, and alleles of GPAT4) and GPAT4 polypeptides.

[0035] Accordingly, the present application provides GPAT4-related polynucleotides and polypeptides. The present invention- also provides antibodies, i.e.j intact antibodies and antigen-binding fragments thereof that bind to GPAT4, in particular, human and/or mouse GPAT4. In one embodiment, an anti-GPAT4 antibody inhibits or antagonizes at least one GPAT4-associated activity. For example, an anti-GPAT4 antibody may bind GPAT4 and interfere with (e.g., block, inhibit, neutralize) the interaction between GPAT4 and an acyl-CoA or the interaction between GPAT4 and G3P. An anti-GPAT4 antibody may also bind GPAT4 and interfere with GPAT4 enzymatic activity (e.g., acylation activity) by inducing, for example, a conformational change in GPAT4 amino acid tertiary and/or secondary structure. Alternatively, anti-GPAT4 antibodies may comprise agonistic antibodies that bind GPAT4 and enhance the interaction between GPAT4 and an acyl-CoA or the interaction between GPAT4 and G3P. An agonistic anti- GPAT4 antibody may also bind GPAT4 and stimulate GPAT4 enzymatic activity (e.g., acylation activity) by inducing, for example, a conformational change in GPAT4 amino acid tertiary and/or secondary structure. Thus, the antibodies of the invention may be used detect, and optionally inhibit (e.g., decrease, limit, block or otherwise reduce) or enhance (e.g., stimulate, increase, facilitate), a GPAT4 activity (e.g., interaction of GPAT4 with an acyl donor, interaction of GPAT4 with an acyl acceptor, GPAT4 catalytic activity, and/or modulation of TAG, MAG, LPA, PA, and/or G3P levels (e.g., accumulation or reduction in cell or tissue levels of TAG, MAG, LPA, PA, and/or G3P)). Thus, the anti-GPAT4 of the invention may be used to diagnose, prognose, monitor and/or treat or prevent disorders and conditions related to GPAT4 activity and/or disorders and conditions associated with synthesis (and/or accumulation) of TAG and/or TAG precursors.

GPAT4 Polynucleotides and Polypeptides

[0036] The present invention provides characterization of GPAT4, i.e., substrate affinity, cellular localization, enzymatic activity, and expression profiles. As such, the present invention relates to GPAT4 polynucleotides and polypeptides (e.g., full length and fragments of GPAT4 polynucleotides and polypeptides) and inhibitory GPAT4 polynucleotides and polypeptides (e.g., inhibitory full length and fragments of GPAT4 polynucleotides and polypeptides). The human GPAT4 (hGPAT4) nucleic acid sequence, which corresponds to GenBank Accession No. NM_178819, is set forth in SEQ ID NO:1. The human GPAT4 amino acid sequence is set forth in SEQ ID NO:2. The mouse GPAT4 (mGPAT4) nucleic acid sequence, which corresponds to GenBank Accession No. NM_018743, is set forth in SEQ ID NO:3. The mouse GPAT4 amino acid sequence is set forth in SEQ ID NO:4. GPAT4 polypeptide refers to mammalian (e.g., human and mouse) GPAT4 proteins (including allelic variants) and fragments thereof, such as the amino acid sequences set forth in SEQ ID NO:2 and SEQ ID NO:4. GPAT4 polynucleotide refers to mammalian (e.g., Human and mouse) GPAT4 nucleic acids (e.g., RNAs and DNAs (e.g., genomic DNA and cDNA), including the sequences disclosed herein, variants (e.g., analogs and homologs) and polymorphs thereof, and alleles of GPAT4) and fragments thereof, such as the nucleic acid sequences set forth in SEQ ID NO: l and SEQ ID NO:3.

[0037] The nucleic, acids related to the present invention may comprise DNA or RNA and may be wholly or partially synthetic. Reference to a.nucleotide sequence as set forth herein encompasses a DNA molecule with the specified sequence (or a complement thereof), and encompasses an RNA molecule with the specified sequence in which U is substituted for T, unless context requires otherwise.

[0038] The isolated polynucleotides related to the present invention may be used as hybridization probes and primers to identify and isolate nucleic acids having sequences identical to or similar to those encoding the disclosed polynucleotides. Hybridization methods for identifying and isolating nucleic acids include polymerase chain reaction (PCR), Southern hybridization, in situ hybridization and Northern hybridization, and are well known to those skilled in the art.

[0039] Hybridization reactions may be performed under conditions of different stringency.- The stringency of a hybridization reaction includes the difficulty with which any two nucleic acid molecules will hybridize to one another. Preferably, each hybridizing polynucleotide hybridizes to its corresponding polynucleotide under reduced stringency conditions, more preferably stringent conditions,. and most preferably highly stringent conditions. Examples of stringency conditions are shown in Table 1 below: highly stringent conditions are those that are at least as. stringent as, for example, conditions A-F; stringent conditions are at least as stringent as, for example, conditions G-L; and reduced stringency conditions are at least as stringent as, for example, conditions M-R. Table 1. Stringency Conditions

1 : The hybrid length is that anticipated for the hybridized rcgion(s) of the hybridizing polynucleotides. When hybridizing a polynucleotide lo a target polynucleotide of unknown sequence, the hybrid length is assumed to be that of the hybridizing polynucleotide. When polynucleotides of known sequence are hybridized, the hybrid length can be determined by aligning the sequences of the polynucleotides and identifying the region or regions of optimal sequence complementarity.

2r SSPE (IxSSPE is 0.15M NaCl, 1OmM NaH₂PO₄, and 1.25mM EDTΛ, pH 7.4) can be substituted for SSC ( 1 xSSC is 0.15M NaCl and 15mM sodium citrate) in the hybridization and wash buffers; washes arc performed for 15 minutes after hybridization is complete. TB* - T_R*: The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10⁰C less than the melting temperature (T_n,) of the hybrid, where T_n, is determined according to the following equations. For hybrids less than 18 base pairs in length, T_m(^oC) = 2(# of A + T bases) + 4(# of G + C bases). For hybrids between 18 and 49 base pairs in length, T_m(°C) = 81.5 + 16.6(1Og₁₀Na⁺) + 0.41 (%G+C) - (600/N), where N is the number of bases in the hybridj and Na⁺ is the concentration of sodium ions in the hybridization buffer (Na⁺ for IxSSC = 0.165M).

Additional examples of string^'ency conditions for polynucleotide hybridization are provided in Sambrook, J., E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F.M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, incorporated herein by reference.

[0040] The isolated polynucleotides related to the present invention may be used as hybridization probes and primers to identify and isolate DNAs having sequences encoding allelic variants of the disclosed polynucleotides. Allelic variants are naturally occurring alternative forms of the disclosed polynucleotides that encode polypeptides that are identical to or have significant similarity to the polypeptides encoded by the disclosed polynucleotides. Preferably, allelic variants have at least 90% sequence identity (more preferably, at least 95% identity; most preferably, at least 99% identity) with the disclosed polynucleotides. Alternatively, significant similarity exists when the nucleic acid segments will hybridize under selective hybridization conditions (e.g., highly stringent hybridization conditions) to the disclosed polynucleotides.

[0041] The isolated polynucleotides related to the present invention may also be used as hybridization probes and primers to identify and isolate DNAs having sequences encoding polypeptides homologous to the disclosed polynucleotides. These homologs are polynucleotides and polypeptides isolated from a different species than that of the disclosed polypeptides and polynucleotides, or within the same species, but with significant sequence similarity to the disclosed polynucleotides and polypeptides. Preferably, polynucleotide homologs have at least 50% sequence identity (more preferably, at least 75% identity; most preferably, at least 90% identity) with the disclosed polynucleotides, whereas polypeptide homologs have at -least 30% sequence identity (more preferably, at least 45% identity; most preferably, at least 60% identity) with the disclosed polypeptides. .Preferably, homologs of the disclosed polynucleotides and polypeptides are those isolated from mammalian species.

[0042] Calculations of "homology" or "sequence identity" between two sequences may be performed by comparison methods well known in the art. For example, regarding identity, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment, and nonhomologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

[0043] The comparison of sequences and determination of percent sequence identity between two sequences may be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. MoI. Biol. 48:444-53) algorithm, which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine whether a molecule is within a sequence identity or homology limitation of the invention) is a Blossum 62 scoring matrix with a gap penalty of 12, a gap- extend penalty of 4, and a frameshi^'ft gap penalty of 5. ^' The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of Meyers and Miller ((1989) CABIOS 4:11-17), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.

[0044] The isolated polynucleotides related to the present invention may also be used as hybridization probes and primers to identify cells and tissues that express the polypeptides related to the present invention and the conditions under which they are expressed.

[0045] Additionally,' the function of the polypeptides related to the present invention may be directly examined by using the polynucleotides encoding the polypeptides to alter (i.e.,- enhance, reduce, or modify) the expression of the genes corresponding to the polynucleotides related to the present invention in a cell or organism. These "corresponding genes" are the genomic DNA sequences related to the present invention that are transcribed to produce the mRNAs from which the polynucleotides related to the present invention are derived.

[0046] Altered expression of the genes related to the present invention may be achieved in a cell or organism through the use of various inhibitory polynucleotides, such as antisense polynucleotides, siRNAs, and ribozymes that bind and/or cleave the mRNA transcribed from the genes related to the invention (see, e.g., Galderisϊ et al. (1999) J. Cell Physiol.181 :251-57; Sioud (2001) Curr. MoI. Med. 1:575-88). Inhibitory polynucleotides to GPAT4 may be useful as TAG, MAG, LPA and/or PA antagonists and, as such, may also be useful in preventing of treating disorders related to TAG, MAG, LPA and/or PA synthesis and/or accumulation. Inhibitory polynucleotides may- also consist of aptamers, i.e., polynucleotides that bind to and regulate protein activity, e.g., the activity of human GPAT4. Aptamers are described in the literature, see, e.g., Nimjee et al. (2005) Annu. Rev. Med 56:555-83; Patel (1997) Curr. Opin. Chem. Biol 1 :32-46.

[0047] The inhibitory polynucleotides of the present invention also include triplex-forming oligonucleotides (TFOs) that bind in the major groove of duplex DNA with high specificity and affinity (Knauert and Glazer (2001) Hum. MoI. Genet. 10:2243-51). Expression of the genes related to the present invention can be inhibited by targeting TFOs complementary to the regulatory regions of the genes (i.e., the promoter and/or enhancer sequences) to form triple helical structures that prevent transcription of the genes.

[0048] In one embodiment of the invention, the inhibitory polynucleotides of the present invention are short interfering RNA (siRNA) molecules (preferably 19-25 nucleotides; most preferably 19 or 21 nucleotides) useful for RNA interference (RNAi) (e.g., Bass (2001) Nature 411 :428-29). The siRNA molecules of the present invention may be generated by a variety of methods that are well known in the art (Fire et al., U.S. Patent No. 6,506,559; Yu et al. (2002) Proc. Natl. Acad. Sci. USA 99:6047-52; Elbashir et al. (2001) Nature 411 :494-98; Yu et al., supra; Sui et al. (2002) Proc. Natl. Acad. Sci. USA 99:5515-20; Paddison et al. (2002) Proc. Natl. Acad. Sci. USA 99:1443-48; Arts et al. (2003) Genome Res. 13:2325-32). The siRNA molecules targeted to the polynucleotides related to the present invention can be designed based on criteria well known in the art (e.g., Elbashir et al. (2001) EMBO J. 20:6877-88; Reynolds et al. (2004) Nature Biotechnol. 22:326-30).

[0049] In some embodiments of the invention, the inhibitory polynucleotide, e.g. /siRNA molecule or antisense molecule, targets exon 2 of GPAT4 (e.g., the nucleic acid sequence encoding about amino acids 56-78 of mouse GPAT4) or exon 13 of GPAT4 (e.g., the nucleic acid sequence encoding about the last 36 amino acids of the C-terminus of mouse GPAT4).

[0050] Altered expression of the genes related to the present invention in an organism may also be achieved through the creation of nonhuman transgenic animals into whose genomes polynucleotides related to the present invention have been introduced. Such transgenic animals include animals that have multiple copies of a gene (i.e., the transgene) of the present invention. A tissue- specific regulatory sequence(s) may be operably linked to the transgene to direct expression of a polypeptide related to the present invention to particular cells or a particular developmental stage. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional and are well known in the art (e.g., Bockamp et al. (2002) Physiol. Genomics 11:115-32).

[0051] Altered expression of the genes related to the present invention in an organism may also be achieved through the creation of animals whose endogenous genes corresponding to the polynucleotides related to the present invention have been disrupted through insertion of extraneous polynucleotide sequences (i.e., a knockout animal). The coding region of the endogenous gene may be disrupted, thereby generating a nonfunctional protein. Alternatively, the upstream regulatory region of the endogenous gene may be disrupted or replaced with different regulatory elements, resulting in the altered expression of the still-functional protein. Methods for generating knockout animals include homologous recombination and are well known in the art (e.g., Wolfer et al. (2002) Trends Neurosci. 25:336-40).

[0052] The isolated polynucleotides of the present invention also may be operably linked to an expression control sequence and/or ligated into an expression vector for recombinant production of the polypeptides (including active fragments and/or fusion polypeptides thereof) related to the present invention. An expression vector, as used herein, is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked and includes plasmids, yeast artificial chromosomes, viral vectors, etc. In the present specification, plasmid and vector may be used interchangeably, as the plasmid is the most commonly used form of vector. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. [0053] Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, selectable marker genes and other sequences, e.g., sequences that regulate replication of the vector in the host cells (e.g., origins of replication), as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd ed., Sambrook et al., Cold Spring Harbor Laboratory Press, 1989 and Current Protocols in Molecular Biology, 2nd ed., Ausubel et al. (eds.) John Wiley & Sons. 1992.

[0054] In one embodiment, the polynucleotides related to the present invention are used to create recombinant GPAT4 agonists and antagonists. Exemplary GPAT4 agonists include, but are not limited to, wild type GPAT4 (polypeptide or polynucleotide) and active (e.g., enzymatically active) fragments thereof. Such agonists may be useful in regulating TAG biosynthesis, and consequently, in the treatment of lipodystrophy and other disorders in which it is desirable to enhance TAG synthesis and/or levels of PA, LPA and/or DAG. In another embodiment, the polynucleotides related to the present invention are used to create GPAT4 antagonists, e.g., GPAT4 inhibitory polynucleotides; soluble GPAT4 polypeptides (including fragments (e.g., acyl-CoA- and/or G3P- interacting fragments) and/or fusion proteins thereof); antagonistic anti-GPAT4 antibodies; and/or antagonistic small molecules; etc. Such antagonists may be useful in regulating TAG biosynthesis, and consequently, in the treatment of obesity, type 2 diabetes, and other disorders where it is desirable to decrease TAG synthesis and/or levels of PA, LPA and/or DAG, or to increase cellular stores of G3P.

[0055] Methods of creating fusion polypeptides, i.e., a first polypeptide moiety linked with a second polypeptide moiety, are well known in the art. For example, a GPAT4 polypeptide may be fused directly or indirectly through a "linker" sequence (e.g., a peptide linker of about 2 to 20, more preferably less than 10, amino acids in length) to a second polypeptide moiety, e.g., an immunoglobulin or a fragment thereof (e.g., an Fc binding fragment thereof), a heterologous sequence (e.g., sequences encoding glutathione-S-transferase (GST), Lex A, thioredoxin (TRX) or maltose-binding protein (MBP); signal sequences; and tag sequences), or a homologous sequence (e.g., a domain from another GPAT4 polynucleotide). The second polypeptide moiety is preferably soluble. In some embodiments, the second polypeptide moiety enhances the half-life, (e.g., the serum half-life) of the linked polypeptide. In preferred embodiments, the second polypeptide includes at least a region of an immunoglobulin polypeptide. Immunoglobulin fusion polypeptides are known in the art and are described in, e.g., U.S. Patent Nos. 5,516,964;^"5,225,538; 5,428,130; 5,514,582; 5,714,147; and 5,455,165, all of which are hereby incorporated by reference in their entireties.

[0056] A fusion protein of the invention may be produced by standard recombinant DNA techniques such as cloning and subcloning, chemical synthesis, and PCR (see, for example, Current Protocols in Molecular Biology, Ausubel et al. (eds.), John Wiley & Sons, 1992). Moreover, many expression vectors are commercially available that encode a fusion moiety (e.g., an Fc region of an immunoglobulin heavy chain). A GPAT4-encoding nucleic acid may be cloned into such an expression vector such that the fusion moiety is linked in-frame to the immunoglobulin protein.

[0057] A further aspect of the present invention provides a host cell comprising a nucleic acid as disclosed herein. A still further aspect provides a method comprising introducing such a nucleic acid into a host cell. The introduction may employ any available technique, including calcium phosphate transfection, DEAE-Dextran, electroporation, gene-gun transfer, liposome-mediated transfection, transduction using retrovirus or other viruses, baculovirus infection, calcium chloride transfection or transformation, and transfection using bacteriophage. The introduction may be followed by causing or allowing expression from the nucleic acid, e.g., by culturing^:host celis under conditions for expression of the gene. Such techniques are well known in the art.

[0058] A number of cell lines and primary cells may act as suitable host cells for recombinant expression of the polypeptides related to the present invention. Host cells include-mammalian cells (e.g., COS cells, CHO cells, 293 cells, primary explants, etc.), lower eukaryotic cells (e.g.-, yeast cells), insect cells (e.g., using baculovirus / Sf9 expression systems), and prokaryotic cells (e.g., E. colt). If the polypeptides related to the present invention are made in yeast or bacteria, it may be necessary to modify them by, for example, phosphorylation or glycosylation of appropriate sites, or by refolding the recombinant protein in order to obtain functionality. Such covalent modifications may be accomplished using .well-known chemical or enzymatic methods, and general methods of refolding are disclosed in, e.g., Kohno (1990) Meth. Enzymol, 185:187-95. Other appropriate methods are disclosed in, e.g., EP 0433225 and U.S. Patent No. 5,39.9,677.

[0059] Following recombinant expression in the appropriate host cells, the recombinant polypeptides of the present invention may be purified from cell extracts using known purification processes, such as immunoprecipitation, gel filtration, affinity chromatography, and ion exchange (anion or cation as appropriate) chromatography. Preferably, the isolated recombinant protein is purified so that it. is substantially free of other mammalian proteins. j Additionally, various purification processes may also be used to purify the polypeptides of the present invention from other sources, including natural sources (e.g., from the milk of transgenic animals). Alternatively, the polypeptides may also be recombinantly expressed in a form that facilitates purification (e.g., fusions containing GST or MPB, or fusions containing epitope tags, e.g., myc or FLAG tags). Kits for expression and purification of such fusion proteins are commercially available from, e.g., New England BioLabs (Beverly, MA), Pharmacia (Piscataway, NJ), and Invitrogen.

[0060] The polypeptides related to the present invention, including GPAT4 agonists and antagonists, may also be produced by known conventional chemical synthesis. Methods for chemically synthesizing such polypeptides are well known to those skilled in the art. Such chemically synthetic polypeptides may possess biological properties in common with the natural, purified polypeptides, and thus may be employed as biologically active or immunological substitutes for the natural polypeptides. [0061] The polypeptides related to the present invention, including GPAT4 agonists and antagonists, also encompass molecules that are structurally different from the disclosed polypeptides (e.g., which have a slightly altered sequence), but have substantially the same biochemical properties as the disclosed polypeptides (e.g., are changed only in functionally nonessential amino acid residues). Such molecules include naturally occurring allelic variants and deliberately engineered variants containing alterations, substitutions, replacements, insertions, or deletions. Techniques for such alterations, substitutions, replacements, insertions, or deletions are well known to those skilled in the art. In some embodiments, the polypeptide moiety is provided as a variant polypeptide having mutations in the naturally occurring sequence (wild type) that results in a sequence more resistant to proteolysis (relative to the nonmutated sequence).

[0062] GPAT4 polypeptides, fragments and/or fusion polypeptides thereof, and recombinant and/or natural forms thereof, may be used to screen for agents (e.g., other GPAT4 agonists or antagonists, e.g., anti-GPAT4 antibodies) that are capable of binding GPAT4 and/or regulating GPAT4 activity, as described further herein. Binding assays utilizing a desired binding protein, immobilized or not, are well known in the art and may be used for this purpose with the polypeptides related to the present invention, including the GPAT4 antagonists and agonists of the invention, e.g., GPAT4 polynucleotides and polypeptides. Purified cell-based or protein-based (cell-free) screening assays may be used to identify such agents. For example, GPAT4 polypeptides may be immobilized in purified form on a carrier and binding of potential ligands to purified GPAT4 may be measured.

Antibodies

[0063] In other embodiments, the invention provides GPAT4 agonists and antagonists as antibodies, i.e., intact antibodies and antigen binding fragments thereof, that specifically bind to GP AT4 and/or fragments of GPAT4, preferably mammalian (e.g., human or mouse) GPAT4. In one embodiment, the antibodies are inhibitory antibodies, i.e., they inhibit at least one GPAT4 activity (e.g., accumulation of TAG) and may be useful in diagnosing, prognosing, monitoring and/or treating disorders related to TAG dysregulation. Additionally, the invention provides agonistic antibodies, i.e., antibodies that enhance at least one GPAT4 activity (e.g., accumulation of TAG) and may be useful in diagnosing, prognosing, monitoring and/or treating disorders related to TAG dysregulation. Additionally, the invention provides anti-GPAT4 antibodies that specifically bind to GPAT4, but do not inhibit or increase GPAT4 activity (i.e., detecting antibodies);- such antibodies may be used to detect the presence of, e.g., GPAT4 protein, e.g., as part of a kit for diagnosing, prognosing, and/or monitoring a disorder(s) related to GPAT4 activity. In one embodiment, the antibody is directed to GPAT4, preferably mammalian GPAT4, more preferably human GPAT4. In another embodiment, the antibody is a monoclonal or single specificity antibody. The antibodies may also be human, humanized, chimeric, or in vjYrø-generated antibodies against human or mouse GPAT4.

[0064] One of skill in the art will recognize that, as used herein, the term "antibody" refers to a protein comprising at least one, and preferably two, heavy (H) chain variable regions (abbreviated herein as VH), and at least one and preferably two light (L) chain variable regions (abbreviated herein as VL). The antibody may further include a heavy and light chain constant region to thereby form a heavy and light immunoglobulin chain, respectively. In one embodiment, the antibody is a tetramer of two heavy immunoglobulin chains and two light immunoglobulin chains, wherein the heavy and light immunoglobulin chains are interconnected, e.g., by disulfide bonds.

[0065] The antigen binding fragment of an antibody (or simply "antibody portion," or "fragment"), as used herein, refers to one or more fragments of a full-length antibody that retain the ability to specifically bind to an antigen (e.g., CD3). Examples of binding fragments encompassed within the term "antigen binding fragment" of an antibody include, but are not limited to: (i) an Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHl domains; (ii) an F(ab')₂ fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) an Fd fragment consisting of the VH and CHl domains; (iv) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody; (v) a dAb fragment, which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they may be joined, using recombinant methods, by a synthetic linker that enables their production as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv)). Such single chain antibodies are also encompassed within the term "antigen binding fragment" of an antibody. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are screened for utility in the same manner as are intact antibodies.

[0066] Antibody molecules to the polypeptides of the present invention, e.g., antibodies to GPAT4, may be produced by methods well known to those skilled in the art. GPAT4 proteins of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies that react with the GPAT4 protein and which may inhibit or enhance the interaction of acyl-CoA and/or G3P with GPAT4, or which may inhibit or enhance GPAT4 catalytic activity. A full-length polypeptide of the present invention may be used as the immunogen, or, alternatively, antigenic peptide fragments of the polypeptides may be used. An antigenic peptide of a polypeptide of the present invention comprises at least seven continuous amino acid residues and encompasses an epitope such that an antibody raised against the peptide forms a specific immune complex with the polypeptide. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues.

[0067] In a further improvement to this procedure, a method for identifying a clinically relevant epitope on an immunogen, and a correlative method for selecting an antibody that binds immunospecifically to the relevant epitope with high affinity, are disclosed in, e.g., PCT international patent publication WO 99/53049, which is hereby incorporated by reference herein in its entirety. Exemplary epitopes generally useful for targeting lipid acyltransferases, e.g., G3P interaction domains and catalytic domains, are discussed in, e.g., Coleman and Lee (2004), supra.

[0068] Monoclonal antibodies may be produced by generation of hybridomas in accordance with known methods, or by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with a polypeptide related to the present invention (e.g., mouse and human GPAT4 and fragments thereof) to thereby isolate immunoglobulin library members that bind to the polypeptides related to the present invention. The "combinatorial antibody display" method is well known and was developed to identify and isolate antibody fragments having a particular antigen specificity, and may be utilized to produce monoclonal antibodies.

[0069] Polyclonal sera and antibodies may be produced by immunizing a suitable subject with a polypeptide of the present invention. The antibody titer in the immunized subject may be monitored over time, and the antibody molecules directed against a polypeptide of the present invention may be isolated from the subject or culture media and further purified by well-known techniques.

[0070] Fragments of antibodies to the polypeptides of the present invention may be produced by cleavage of the antibodies in accordance with methods well known in the art. For example, immunologically active Fab and F(ab')₂ fragments may be generated by treating the antibodies with an enzyme such as pepsin.

[0071] Additionally, chimeric, humanized, and single-chain antibodies to the polypeptides of the present invention, comprising both human and nonhuman portions, may be produced using standard recombinant DNA techniques and/or a recombinant combinatorial immunoglobulin library. The production of chimeric, humanized, and single-chain antibodies is well known in the art (see, e.g., Morrison (1985) Science 229:1202-07; Oi et al. (1986) BioTechniques 4:214-21 ; Queen et al., U.S. Patent Nos. 5,585,089; 5,693,761; 5,693,762, the contents of all of which are hereby incorporated by reference herein). Humanized or CDR-grafted antibody molecules or immunoglobulins may be produced by standard procedures (see, e.g., U.S. Patent No. 5,225,539; Jones et al. (1986) Nature 321:552-25; Verhoeyan et al. (1988) Science 239:1534; Beidler et al. (1988) J. Immunol. 141 :4053-60; Winter, U.S. Patent No. 5,225,539, the contents of all of which are hereby incorporated by reference herein). Human antibodies may be produced using transgenic nonhuman animals that are modified so as to produce fully human antibodies rather than the animal's endogenous antibodies in response to challenge by an antigen (see PCT international patent publication WO 94/02602, WO 96/33735 and WO 96/34096). Monoclonal, chimeric, human and humanized antibodies that have been modified by, e^g., deleting, adding, or substituting other portions of the antibody, e.g., the constant region, are also within the scope of the invention. As nonlimiting examples,. an antibody can be modified by deleting the constant region, by replacing the constant region with another constant region, e.g., a constant region meant to increase half-life, stability, or affinity of the antibody, or a constant region from another species or antibody class, and by modifying one or more amino acids in the constant region to alter, for example, the number of glycosylation sites, effector cell function, Fc receptor (FcR) binding, complement fixation, etc.

[0072] Antibodies with altered function, e.g., altered affinity for an effector ligand, such as FcR on a cell, or the Cl component of complement, can be produced by replacing at least one amino acid residue in the constant portion of the antibody with a different residue (see, e.g., EP 388,15.1, U.S. Patent Nos. 5,624,821 and 5_;648,260, the contents of which are hereby incorporated by reference herein in their entireties).

[0073] In addition to antibodies for use in the instant invention, other molecules may also be employed to modulate the activity of GPAT4. Such molecules include small modular imrnunopharmaceutical (SMIP™) drugs (Trubion Pharmaceuticals,- Seattle, WA). SMIPs are single-chain polypeptides composed of a binding domain for a cognate structure such as an antigen, a- counter receptor or the like, a hinge-region polypeptide having either one or no cysteine residues, and immunoglobulin CH2 and CH3 domains (see also www.trubion.com). SMIPs .and their uses and applications are disclosed in, e.g., U.S. Published Patent Appln. Nos. 2003/0118592, 2003/0133939, 2004/0058445, 2005/0136049, 2005/0175614, 2005/0180970, 2005/0186216, 2005/0202012, 2005/0202023, 2005/0202028, 2005/0202534, and 2005/0238646, and related patent family members thereof, all of which are hereby incorporated by reference herein in their entireties.

[0074] Anti-GPAT4 antibodies of the invention may be useful for isolating, purifying, and/or detecting GPAT4 polypeptides and GPAT4 polypeptide fragments (or fusions thereof), in supernatants, cellular lysates, or on the cell surface. Antibodies disclosed in the invention may be also used diagnostically to monitor, e.g., GPAT4 polypeptide levels, as part of a clinical testing procedure, or clinically to target a therapeutic modulator to a cell or tissue comprising the antigen of the antibody. For example, a therapeutic, such as a small molecule or other therapeutic of the invention, may be linked to an anti- GPAT4 antibody in order to target the therapeutic to the cell or tissue expressing GPAT4. Antagonistic and agonistic antibodies (preferably monoclonal antibodies) that bind to GPAT4 polypeptides may also be useful in the treatment of a disease(s) related to GPAT4 activity, and/or a GPAT4- associated conditions. Thus, the present invention further provides compositions comprising an inhibitory (antagonistic) antibody that specifically binds to GPAT4 and decreases, limits, blocks, or otherwise reduces GPAT4 activity. The present invention further provides compositions comprising a stimulatory (agonistic) antibody that specifically binds to GPAT4 and increases or otherwise enhances GPAT4 activity. Similarly, anti-GPAT4 antibodies may be useful in isolating, purifying, detecting, and/or diagnostically monitoring GPAT4, and/or clinically targeting a therapeutic modulator to a cell or tissue comprising GPAT4.

Screening Assays

[0075] The GPAT4 polynucleotides and polypeptides may be used in screening assays to identify pharmacological agents or lead compounds for agents that are capable of modulating the activity of GPAT4 in a cell or organism and are thereby potential regulators of TAG synthesis and disorders associated with TAG dysregulation. For example, samples containing GPAT4 may be contacted with one of a plurality of test compounds (either biological agents or small organic molecules), and the activity of GPAT4 in each of the treated samples can be compared with the activity of GPAT4 in untreated samples or in samples contacted with- different test compounds. Such comparisons will determine whether any of the test compounds results in: 1) a substantially decreased level of expression or activity of GPAT4, thereby indicating an antagonist of GPAT4, or 2) a substantially increased level of expression or activity of GPAT4, thereby indicating an agonist of GPAT4. In one embodiment, the identification of test compounds capable of modulating GPAT4 activity is performed using high-throughput screening assays, such as BIACORE^® (Biacore International AB, Uppsala, Sweden), BRET (bioluminescence resonance energy transfer), and/or FRET (fluorescence resonance energy transfer) assays, as well as ELISA and/or cell-based assays.

|0076] As^' GPATs increases levels of TAG, screens for agonists or antagonists of GPAT4 activity may employ well-established methods for analyzing lipid biosynthesis, or may follow the protocols described in the Examples. Thus, one may contact a cell or sample containing GPAT4 with a test compound, and determine if the test compound- modulates GPAT4 expression by, e.g., Western or Northern Analysis, PCR, immunohistochemistry, in situ hybridization, differential display, etc. Alternatively, one may contact a cell of sample containing GPAT4 with a test compound and determine if the test compound modulates GPAT4 activity. GPAT4 activity may be measured by a variety of methods, including measuring changes in levels of acylated product (e.g., LPA), changes in levels of nonacylated acceptor molecules (e.g., G3P), changes in levels of TAG and/or TAG precursors (e.g., LPA, PA, DAG), changes in levels of CoA-SH byproduct, and changes in levels of acyl donors (e.g., lauroyl-CoA, oleoyl-CoA). As shown in the Examples, using, e.g., thin layer chromatography or butanol extraction, one may employ a [¹⁴C]-labeled acceptor (G3P) or various donor molecules (e.g., lauroyl-CoA, palmitoyl-CoA, oleoyl-CoA) in a method of measuring GPAT4 activity. Other acyl-CoA doribrs and useful labels (e.g., ³H) are well known in the art, and additional methods for acyltransferase activity are disclosed throughout the literature (see, e.g., Coleman and Lee, supra; Chen and Farese (2000), supra; Chen and Farese (2005), supra; Yamazaki et al. (2005) J. Biol. Chem. 280:21506-14; Coleman (1992) Meth. Enzymol. 209:98-104; and U.S Patent Appln. 2002/0127627 Al).

Small Molecules

[0077] Decreasing GPAT4 activity in an organism (or subject) afflicted with (or at risk for) a disorder related to enhanced GPAT4 expression and/or activity or a disorder related to increased TAG levels or TAG accumulation, e.g., obesity, type 2 diabetes, etc., or in a cell from such an organism or subject, may also be achieved through the use of small molecules (usually organic small molecules) that antagonize, i.e., inhibit the activity of, GPAT4. Novel antagonistic small molecules may be identified by the screening methods described herein and may be used in the treatment, amelioration and/or prevention methods of the present invention described herein.

[0078] Conversely, increasing GPAT4 activity in an organism (or subject) afflicted with (or at risk for) a disorder related to decreased GPAT4 expression and/or activity or a disorder related to decreased TAG levels, e.g., lipodystrophy, may also be achieved through the use of small molecules (usually organic small molecules) that agonize, i.e., enhance the activity of, GPAT4. Novel agonistic small molecules may be identified by the screening methods described herein and may be used in the treatment, amelioration and/or prevention methods of the present invention described herein.

[0079] The term small molecule refers to compounds that are not macromolecules (see, e.g., Karp (2000) Bioinformatics Ontology 16:269-85; Verkman (2004) AJP-CeIl Physiol. 286:465-74). Thus, small molecules are often considered those compounds that are, e.g., less than one thousand daltons (e.g., Voet and Voet, Biochemistry, 2^nd ed., ed. N. Rose, Wiley and Sons, New York, 14 (1995)). For example, Davis et al. ((2005) Proc. Natl. Acad. ScL USA 102:5981-86) use the phrase small molecule to indicate folates, methotrexate, and neuropeptides, whereas Halpin and Harbury ((2004) PLos Biology 2:1022-30) use the phrase to indicate small molecule gene products, e.g., DNAs, RNAs and peptides. Examples of natural small molecules include, but are not limited to, cholesterols, neurotransmitters, aptamers, and siRNAs; synthesized small molecules include, but are not limited to, various chemicals listed in numerous commercially available small molecule databases, e.g., FCD (Fine Chemicals Database), SMID (Small Molecule Interaction Database), ChEBI (Chemical Entities of Biological Interest), and CSD (Cambridge Structural Database) (see, e.g., Alfarano et al. (2005) Nuc. Acids Res. Database Issue 33:D416-24).

Methods for Diagnosing, Prognosing, and Monitoring the Progress of Disorders and Conditions Related to GPAT4 Activity

[0080] The present invention provides methods for diagnosing, prognosing, and monitoring the progress of disorders and conditions related to GPAT4 in a subject (e.g., conditions that directly or indirectly involve increases or decreases in the activity of GPAT4) by detecting, e.g., an upregulation or a downregulation of GPAT4 activity, e.g., by detecting the upregulation of human GP AT4, including but not limited to the use of such methods in human subjects. These methods may be performed by utilizing prepackaged diagnostic kits comprising at least one of the group comprising a GPAT4 polynucleotide or fragments thereof, a GPAT4 polypeptide or fragments thereof (including fusion proteins thereof), antibodies to a GPAT4 polypeptide or derivatives thereof, or modulators of GPAT4 polynucleotides and/or polypeptides as described herein, which may be conveniently used, for example, in a clinical setting. A skilled artisan will recognize that other indirect methods may be used to confirm, e.g., the upregulation of GPAT4, e.g., human GPAT4, such as measuring changes in the mass of adipose tissue.

[0081] "Diagnostic" or "diagnosing" means identifying the presence or absence of a pathologic condition. Diagnostic methods include detecting regulation of the level of expression of GPAT4 and/or the level of activity GPAT4 by determining a test amount of the level of expression of GPAT4 (e.g., level of mRNA, cDNA, and/or polypeptide, including fragments thereof) and/or level of activity of GPAT4 (e.g., level of acyl transferase activity, level of conversion of G3P to LPA, accumulation of LPA, PA₅ DAG and/or TAG, reduction in G3P levels, reduction in acyl-CoA levels,'etc.) in a biological sample from a subject (human or nonhuman mammal), and comparing the test amount with a normal amount or range (e.g., a reference amount, such an amount or range from an individual(s) known not to suffer from disorders related to GPAT4 activity). Although a particular diagnostic method may not provide a definitive diagnosis of disorders related GPAT4 activity, it suffices if the method provides a positive or negative indication that aids in diagnosis.

[0082] The present invention also provides methods for prognosing such disorders by detecting changes in the level (increases or decreases) of GPAT4 expression or activity. "Prognostic" or "prognosing" means predicting the probable development and/or severity of a pathologic condition. Prognostic methods include determining the test amount of a gene-product of GPAT4 and/or the level of activity of GPAT4 contained in a biological sample from a subject, and comparing the test amount or activity level to a prognostic amount or range (i.e., an amount or range from individuals with varying severities of disorders related to GPAT4 activity and/or disorders associated with TAG dysregulation) of the gene product and/or level of activity of GPAT4. Various amounts of the GPAT4 gene product or level of activity of GPAT4 in a test sample are consistent with certain prognoses for disorders related to GPAT4 activity and/or disorders associated with TAG dysregulation. The detection of an amount of GPAT4 gene product or GPAT4 level of activity, e.g., at a particular prognostic level, provides a prognosis for the subject.

[0083J The present invention also provides methods for monitoring the progress or course of such disorders or the course of treatment of disorders related to GPA T4 activity (and/or disorders associated with TAG dysregulation) by detecting, e.g., the upregulation or downregulation of GPAT4 activity or expression. Monitoring methods include determining the test amounts of a gene product of GPAT4 and/or level of activity of GPAT4 in biological samples taken from a subject at a first and second time, and comparing the amounts. A change in amount of a GPAT4 gene product between the first and second times indicates a change in the course of GPAT4-related conditions or disorders. Such monitoring assays are also useful for evaluating the efficacy of a particular therapeutic intervention in patients being treated for GPAT4-associated conditions and/or conditions resulting in TAG dysregulation, e.g., measuring and comparing the levels of GPAT4 activity or expression before and after administration of a therapeutic treatment.'

[0084] Increased GPAT4 activity in the methods outlined above may be detected in a variety of biological samples, including bodily fluids (e.g., whole blood, plasma, and urine), cells (e.g., whole cells, cell fractions, and cell extracts), and other tissues. Biological samples also include sections of tissue, such as biopsies and frozen sections taken for histological purposes. Preferred biological samples include^" adipose, heart, liver, kidney, muscle, thyroid, testis, and intestine. It will be appreciated that analysis of a biological sample need not necessarily require removal of cells or tissue from the subject. For example, appropriately labeled agents that bind GPAT4 gene products (e.g., antibodies, nucleic acids) can be administered to a subject and visualized (when bound to the target) using standard imaging technology (e.g., CAT, NMR (MRI), and PET).

[0085] In the diagnostic arid prognostic assays of the present invention, the GPAT4 gene product is detected and quantified to yield a test amount. The test amount is then compared with a normal amount or range. Particular methods of detection and quantitation of GPAT4 gene products are described below.

[0086] Normal amounts or baseline levels of GPAT4 gene products may be determined for any particular sample type and population. Generally, baseline (normal) levels of GPAT4 protein or mRNA are determined by measuring respective amounts of GP AT4 protein or mRNA in a biological sample from normal (i.e., healthy) subjects. Alternatively, normal values of GPAT4 gene product(s) may be determined by measuring the amount in healthy cells or tissues taken from the same subject from which the diseased (or possibly diseased) test cells or tissues were taken. The amount of GPAT4 gene product(s) (either the normal amount or the test amount) may be determined or expressed on a per cell, per total protein, or per volume basis. To determine the baseline amount of a sample, one can measure the level of a constitutively expressed gene product or other gene product expressed at known levels in cells of the type from which the biological sample was taken.

[0087] It will be appreciated that the assay methods of the present invention do not necessarily require measurement of absolute values of GPAT4 gene products because relative values are sufficient for many applications of these methods. It will also be appreciated that in addition to the quantity or abundance of GPAT4 gene products, variant or abnormal GPAT4 gene products or their expression patterns (e.g., mutated transcripts, truncated polypeptides) may be identified by comparison to normal gene products and expression patterns.

[0088] Whether the expression of a particular gene in two samples is significantly similar or significantly different, e.g., significantly above or significantly below a given level, depends on the gene itself and, inter alia, its variability in expression between different individuals or different samples. It is within the skill of those in the art to determine whether expression levels are significantly, similar or different. Factors such as genetic variation, e.g., in GPAT4 expression levels,.between individuals, species, organs, tissues, or cells may be taken into consideration (if necessary) when determining whether the level of expression, e.g., of human GPAT4, between two samples is significantly similar or significantly different, e.g., significantly above or below a given level. As a result of the natural heterogeneity in gene expression between individuals, species, organs, tissues, or cells, phrases such as "significantly similar," "significantly greater," "significantly lower," "significantly above" and the like cannot be defined as a precise percentage or value, but rather can be ascertained by one skilled in the art upon practicing the invention.

Uses of Molecules Related to GPAT4 Activity in Therapy [0089] The inventors have demonstrated, inter alia, the following: 1) recombinant AGPAT6/GPAT4 ectopically expressed in both mammalian HEK293- cells and Sf9 insect cells exhibits an acyl-CoA-dependent, NEM- sensitive GPAT activity, which recognizes a variety of acyl-CoA species as its acyl donors; 2) GPAT4 is the closest homologue to GPAT3, sharing approximately 67% identity with GPAT3 at the amino acid level across the entire molecule; and 3) GPAT4- exhibits a distinct and complementary tissue distribution pattern to GPAT3, especially in those tissues where active metabolism of triacylglycerols takes place, such as adipose tissue, liver, small intestine, kidney, and heart. The above results indicate that the disclosed methods for using molecules related to GPAT4 activity; e.g., agonists and antagonists of GPAT4, to treat GPAT4-associated conditions and disorders, will be particularly useful for treating such disorders in humans.

[0090] The GPAT4-related molecules disclosed herein, including modulators of mammalian, e.g., mouse arid human GPAT4 polynucleotide and/or polypeptide activity identified using the methods described herein, may be used in vitro, ex vivo, or incorporated into pharmaceutical compositions and administered to individuals (e.g., human subjects) in vivo to treat, ameliorate, or prevent, e.g., disorders related to GPAT4 activity and disorders related to TAG synthesis and/or accumulation, by administration of a GPAT4 antagonist (e.g., GPAT4 inhibitory polynucleotides (i.e., polynucleotides that decrease GPAT4 levels and/or activity either directly or indirectly, e.g., antisense, siRNA, aptamers); GPAT4 inhibitory polypeptides (i.e., polypeptides that decrease GPAT4 levels and/or activity either directly or indirectly, e.g., fragments of GPAT4, such as soluble fragments containing the G3P or acyl-CoA interaction domains, and fusion proteins thereof); antagonist anti-GPAT4 antibodies or antibody fragments (i.e., antibodies or antibody fragments that decrease GPAT4 activity and/or expression either directly or indirectly, including antibodies and antibody fragments that bind GPAT4 fragments); and antagonistic small molecules (e.g., siRNAs, aptamers, and small organic molecules or compounds)), or a GPAT4 agonist (e.g., GPAT4 polynucleotides and GPAT4 polypeptides (including full- length and/or fragments of GPAT4, such as a GPAT4 catalytic domain, and fusions thereof); agonistic anti-GPAT4 antibodies or antibody fragments (i.e., antibodies or antibody fragments that enhance GPAT4 activity and/or expression either directly or indirectly, including antibodies and antibody fragments that bind GPAT4 fragments); and agonist small molecules). Several pharmacogenomic approaches to consider in determining whether to administer a GP AT4 agonist or antagonist are well known to one of skill in the art and include genome-wide association, candidate gene approach, and gene expression profiling. A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration (e.g., oral compositions generally include an inert diluent or an edible carrier). Other nonlimiting examples of routes of administration include parenteral (e.g., intravenous), intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. The pharmaceutical compositions compatible with each intended route are well known in the art.

[0091] A GPAT4 antagonist(s) or agonist(s) may be used as a pharmaceutical composition when combined with a pharmaceutically acceptable carrier. Such a composition may contain, in addition to a GPAT4 antagonist(s) or agonist(s) (e.g., a human GPAT4 antagonist or agonist), carriers, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. The term "pharmaceutically acceptable" means a nontoxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.

[0092] The pharmaceutical composition of the invention may also contain additional therapeutic agents for treatment of the particular targeted disorder. For example, a pharmaceutical composition for treatment of type 2 diabetes may also include an antidiabetic drug. The pharmaceutical composition may contain thrombolytic or antithrombotic factors such as plasminogen activator and Factor VIII. The pharmaceutical composition may further contain anti-inflammatory agents. Such additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with GPAT4 antagonist(s) or agonist(s), or to minimize side effects caused by the GPAT4 antagonist(s) or agonist(s).

[0093] The pharmaceutical composition of the invention may be in the form of a liposome in which a GPAT4 antagonist(s) or agonist(s) is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids that exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution. Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, etc.

[0094] As used herein, the term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.

[0095] In practicing the method of treatment or use of the present invention, a therapeutically effective amount of a GPAT4 antagonists) or agonist(s) is administered to a subject, e.g., a mammal (e.g., a human). A GPAT4 antagonist(s) or agonist(s) may be administered in accordance with the method of the invention either alone or in combination with other therapies, such as, e.g., in combination with additional therapies for, e.g., obesity, type 2 diabetes, or lipodystrophy. When coadministered with one or more agents, a GPAT4 antagonists) or agonist(s) may be administered either simultaneously with the other agent, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering the GPAT4 antagonist(s) or agonist(s) in combination with other agents.

[0096] When a therapeutically effective amount of a GPAT4 antagonist(s) or agonist(s) is administered orally, the binding agent will be in the form of a tablet, capsule, powder, solution or elixir. When administered in tablet form, the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant. When administered in liquid form, a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil (exercising caution in relation to peanut allergies), mineral oil, soybean oil, or sesame oil, or synthetic oils may be added. The liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol, or polyethylene glycol.

[0097] When a therapeutically effective amount of a GPAT4 antagonist(s) or agonist(s) is administered by intravenous, cutaneous or subcutaneous injection, the GPAT4 antagonist(s).or agonist(s) will be in the form of a pyrogen-free, parenterally acceptable aqueous solution. A preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to the GPAT4 antagonist(s) or agonist(s), an isotonic vehicle such as sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection, or other vehicle, as known in the art.

[0098] The amount of a GPAT4 antagonist(s) or agonist(s) in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments that the patient has undergone. Ultimately, the attending physician will decide the amount of GPAT4 antagonist(s) or agoriist(s) with which to treat each individual patient. Initially, the attending physician will administer low doses of GPAT4 antagonist(s) or agonist(s) and observe the patient's response. Larger doses of GPAT4 antagonist(s) or agonist(s) may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not generally increased further.

[0099] The duration of intravenous (i.v.) therapy using a pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated. and the condition and potential idiosyncratic response of each individual patient. Also contemplated is subcutaneous (s.c.) therapy using a pharmaceutical composition bf the present invention. The attending physician will decide on the appropriate duration of i.v. or s.c. therapy, or therapy with a small molecule, and^'the timing of administration of the therapy, using the pharmaceutical composition of the present invention. . [0100] The polynucleotides and proteins of the present invention are expected to exhibit one or more of the uses or biological activities (including those associated with assays cited herein) identified below. Uses" or activities described for proteins of the present invention may be provided by administration or use of such proteins or by administration .or use of polynucleotides encoding such proteins (such as, for example, in gene therapies or vectors suitable for introduction of DNA).

Uses of GPAT4 Agonists and Antagonists

[0101] In one aspect, the invention-features a method of regulating TAG levels in a cell or sample of interest (e.g., in a tissue such as heart or blood). One such method comprises contacting a cell or population of cells with a GPAT4 antagonist(s) or.agonist(s) in an amount sufficient to modulate the level of TAG in the cell or sample of interest. In one embodiment of the invention, a GPAT4 agonist is used, such that the level of TAG is increased in the cell or sample of interest. In another embodiment of the invention, a GPAT4 antagonist is used, such that the level of TAG is decreased in the cell or sample of interest. Modulation of TAG levels is expected to be beneficial for individuals suffering from GPAT4-associated conditions and/or conditions accompanied by TAG dysregulation.

[0102] In other embodiments of the invention, a GPAT4 agonist or antagonist is used to modulate levels of TAG precursors, i.e., PA, LPA, DAG, and/or G3P. Modulating levels of such TAG precursors is expected to be beneficial in several respects. For example, LPA influences the developing and adult cardiovascular system, reproductive system, immune system, and nervous system (Anliker and Chun (2004) J. Biol. Chem. 279:20555-58), and contributes to wound healing (Mazereeuw-Hautier et al. (2005) J. Invest. Dermatol. 125(3):421-27). PA is the precursor of phosphatidylinositol, phosphatidylglycerol and cardiolipin, phospholipids that are autoantibody targets in antiphospholipid syndrome (Ulcova-Gallova (2005) Chem. Immunol. Allergy. 88:139-49) and systemic lupus erythematosus (Rhaman (2004) Rheumatology (Oxford) 43(11): 1326-36), while cardiolipin appears to play a role in X-linked cardioskeletal myopathy and neutropenia (Barth syndrome) (Barth et al. (2004) Am. J. Med. Genet. A. V26(4):349-54). PA is also an important messenger in a common signaling pathway activated by proinflammatory mediators such as IL-I₅ TNFα, platelet activating factor, and lipid A (Bursten et al. (1992) Am. J. Physiol. 262:C328; Bursten et al. (1991) J. Biol. Chem. 255:20732; Kester (1993) J. Cell Physiol. 156:317). PA has been implicated in mitogenesis of several cell lines, and is increased in either ras- or fps-transformed cell lines compared to the parental Rat2 fibroblast cell line (Martin et al. (1997) Oncogene 14:1571). Activation of Raf-1, which is initiated by association of the molecule with the intracellular membrane, is an essential component of the MAPK signaling cascade. More importantly, recruitment of Raf-1 to membranes is reported to be mediated by direct association with phosphatidic acid (Rizzo et al. (2000) J. Biol. Chem. 275 :23911-18). Thus, regulators of cellular levels of PA may play a role in cancer, and/or mediate inflammatory responses to various proinflammatory agents.

[0103] Further, it is known that DAG, in addition to being a second messenger in a number of cellular events requiring protein kinase C (PKC) activity, is the precursor of the major phospholipids phosphatidylcholine (PC), phosphatidylethanolamine (PE), and phosphatidylserine (PS), which have roles in membrane biosynthesis and integrity, phospholipase activation, and apoptosis and cancer (Wright et al. (2004) Biochem. Cell Biol. 82: 18-26; Jenkins and Froham (2005) Cell. MoI Life ScI 62:2305-16; Hanshaw and Smith (2005) Bioorg. Med. Chem. 13:5035-42). DAG/PKC activity is implicated in numerous pathological events, including hyperglycemia and endothelial cell dysfunction (see, e.g., Hink et al. (2003) Treat Endocrinol. 2:293-304), Alzheimer's disease (e.g., Rossner (2004) Int. J. Dev. Neurosci. 22:467-74), cancer (e.g., Geiger et al. (2003) Curr. Opin. MoI. Ther. 5:631-41), and other disorders (e.g., Kawakami et al. (2002) J. Biochem. (Tokyo) 132:677-82).

[0104] Agonists or antagonists of GPAT4 may also be administered to subjects for whom regulation of GPAT4 activity is desired. These subjects may be afflicted with a condition such as dyslipidemia (e.g., hyperlipidemia, hypertriglyceridemia, Type III hyperlipidemia), obesity, hypercholesterolemia, hepatic steatosis, cancer, skin disorders associated with altered lipid metabolism (e.g., acne vulgaris, dry skin), adiposity, type 2. diabetes (and complications associated therewith, such as dermopathy, retinopathy, neuropathy, and nephropathy), insulin resistance, hyperinsulinemia, hypertension, cardiovascular disease, atherosclerosis, stroke, thrombosis, lipodystrophy (including congenital generalized lipodystrophy (Berardinelli-Seip syndrome), familial partial lipodystrophy (Dunnigan type, Kδbberl ing type, and the mandibύloacral dysplasia type), and acquired forms of lipodystrophy such as acquired generalized lipodystrophy (Lawrence syndrome), acquired partial lipodystrophy (Barraquer-Simons syndrome),, and lipodystrophy induced by antiviral treatments, e.g., treatment with HIV protease inhibitors), lipopenia, Reye's syndrome, Cushing's syndrome, metabolic syndrome (e.g., syndrome X), eating disorders (e.g., anorexia, bulimia), skin homeostasis, disorders related to energy storage, nutrient absorption, and lipid metabolism, reduced or absent lactation, and low preterm birth weight (and complications thereof, such as defects in neural development).

[0105] These methods are based, at least in part, on the finding that GPAT4 expression results in increased production of TAG via G3P acylatibn. Accordingly, GPAT4 antagonists, i.e., molecules that inhibit GPAT4 activity (e.g., antagonist anti-GPAT4 antibodies) may be used to decrease TAG levels in vivo, e.g., for treating or preventing disorders related to increased TAG synthesis or accumulation, such as obesity. Further, GPAT4 agonists, i.e., molecules- that enhance GPAT4 activity (e.g., agonist anti-GPAT4 antibodies) may be used to increase TAG levels in vivo, e.g., for treating or preventing disorders related to decreased TAG synthesis or accumulation, such as lipodystrophy.

[0106] By using a GPAT4 agonist(s) and antagonist(s), it is possible to modulate TAG synthesis and accumulation in a number of ways. For example, decreasing TAG synthesis and/or accumulation (and/or accumulation of TAG precursors, i.e., DAG, LPA, PA, or G3P) may be in the form of inhibiting or blocking an established GPAT4-associated condition or disorder, or may involve preventing the induction of a GPAT4-associated conditions or disorders.

[0107] In one embodiment, a GPAT agonist(s) or antagonists), including pharmaceutical compositions thereof, is administered in combination therapy, i.e., combined with other agents, e.g.,- therapeutic agents, that are useful for treating pathological conditions or disorders, such as disorders of lipid metabolism or the cardiovascular system. The term "in combination" in this context means that the agents are given substantially contemporaneously, either simultaneously or sequentially. If given sequentially, at the' onset of administration of the second compound, the first of the two compounds is preferably still detectable at effective concentrations at the site of treatment.

[0108] Preferred therapeutic agents used in combination with a GPAT4 agonist(s) or antagonist(s) are those agents that modulate different stages of TAG synthesis, e.g., agents that interfere with the activity of AGPAT, PTP, or DGAT, as well as agents that increase fatty acid utilization, such as PP ARa and δ modulators. Thus, agents useful in combination with a GPAT4 antagonist(s) or agonist(s) include, without limitation, PPARγ modulators (e.g., glitazones, fatty acids (including polyunsaturated fatty acids)), PP ARa modulators (e.g., fibrates (such as clofibrate, gemfibrozol, and Wy- 14,643)), PPARδ modulators,.eicosapentaenoic acid, xanthohumols, roselipins, prenylflavonoids, polyacetylenes, tanshinones and derivatives thereof (see Coleman and Lee (2004), supra; Chen and Farse (2005), supra; Rustan et al. (1988) J. Lipid Res. 29:1417-26; Tabata et al. (1997) Phytochemistry 46:683-87; Tomoda (1999) J. Antibot. 52:689-94; Chung et al. (2004) Planta Med. 70:258- 60; Lee et al. (2004) Planta Med. 70: 197-200; Ko et al. (2002) Arch. Pharm. Res. 25:446-48); inhibitors of cholesterol acyltransferase enzymes (see Krause et al. (1995) Inflammation Mediators and Pathways, pp. 173-98 CRC Press, Boca Raton, FL); agents for the treatment of diabetes (e.g., insulin, insulin sensitizers such as metformin; GIp- 1 mimetics, such as exenatide (B YETT A^®); insulin secretagogues, such as sulfonylureas (e.g., tolazamide, glyburide and others) and metiglinϊdes (e.g., nateglinide (STARLIX®)); modulators of sterol regulatory element-binding protein (SREBP), such as atorvastatin and simvastatin (e.g., LIPITOR® and CADUET®); modulators of liver X receptors (LXR) (e.g., oxysterols) and farnesoid X receptor (FXR) (e.g., bile acids); and other modulators of tissue lipid and cholesterol levels.

[0109] Another aspect of the present invention accordingly relates to kits for carrying out the administration of a GPAT4 agonist(s) or antagonist(s) with other therapeutic compounds. In one embodiment, the kit comprises one or more GPAT4 agonists or antagonists (e.g., one or more GPAT4 antagonists) formulated with one or more binding agents in a pharmaceutical carrier, and at least one other agent, e.g., another therapeutic agent, formulated as appropriate, in one or more separate pharmaceutical preparations. Kits related to diagnostic methods, prognostic methods, monitoring methods, etc., are also contemplated.

[0110] The entire contents of all references, patents, and patent applications cited throughout this application are hereby incorporated by reference herein.

EXAMPLES

[0111] The following Examples provide illustrative embodiments of the invention and do not in any way limit the invention. One of ordinary skill in the art will recognize that numerous other embodiments are encompassed within the scope of the invention.

[0112] The Examples do not include detailed descriptions of conventional methods, such methods employed in the construction of vectors, the insertion of genes encoding polypeptides into such vectors and plasmids, the introduction of such vectors and plasmids into host cells, and the expression of polypeptides from such vectors and plasmids in host cells. Such methods are well known to those of ordinary skill in the art.

Example 1 : Identification of GPAT4 as a Candidate for Microsomal GPAT

[0113] To search for genes related to GPAT3 that could be candidates for additional GPAT enzymes, the acyltransferase domains of human and mouse GPAT3, and full-length GPAT3 amino acid sequences, were used as queries to search comprehensive protein databases such as GenPept, GeneSeqP, Ensembl transcripts, etc. Several closely related candidate genes were identified, and phylogenetic analysis identified a close homolog. (previously termed "AGPAT6"or "LPAAT zeta") in the database (mouse accession number NM_018743 ; human accession number NM_178819). Human GPAT4 is approximately 67% identical to human GPAT3 at the amino acid level (FIG. IA). The high degree of homology spans the entire molecule, especially in the C-terminus, which includes the database-predicted acyltransferase domain, where the two molecules share approximately 87% identity (FIG. IA, boxed portion). As analyzed by a TMHMM program (TrarisMembrane prediction using Hidden Markov Models), which predicts transmembrane helices in proteins (Krogh.et al. (2001) J. MoI. Biol 305:567-80), human GPAT4 contains at least three transmembrane domains (FIG. IB; bars labeled "TMl," "TM2" and "TM3").

Example 2: GPAT4 Expressed in Sf9 Cells Possesses GPAT Activity

[0114] Human GPAT4 cDNA was isolated from cDNA libraries prepared from human leucocytes using PCR amplification and the following primers: forward, 5'-gtgctggcctggcctggatctt-3' (SEQ ID NO:5); and reverse, 5'-ccccagccagctggaggcaggc-3' (SEQ ID NO:6).

An N-terminal FLAG-tagged GPAT4 cDNA was also amplified using the forward primer 5'-ccaccatggactacaaagacgatgacgacttcctgttgctgccttttgat-3' (SEQ ID NO:7) and the same reverse primer as used in the untagged version. PCR products were cloned into the pPCRscript Amp SK(+) vector (Stratagene, La Jolla, CA) and sequenced. The cDNA fragment of FLAG-tagged GPAT4 was subcloned into the pcDNA3.1(+/-) /hygro mammalian expression vector (Invitrogen, Carlsbad, CA) for mammalian expression. To express these cDNAs in Sf9 cells, the human FLAG-tagged GPAT4 cDNA was subcloned into a pFastBac vector (Invitrogen), which was subsequently transformed into DHlOBacTM Escherichia coli cells (Invitrogen) to generate a recombinant bacmid that carries the FLAG-hGPAT4. High titer recombinant baculovirus was generated by transfecting the bacmid DNA into Sf9 insect cells followed by several rounds of amplification to increase viral titer.

10115] Full-length human GPAT3 (hGPAT3) was cloned by PCR amplification from cDNA libraries from human leukocytes (BD Biosciences, San Diego, CA) using the following' primers (5' to 3'): hGPAT3 forward ctcctgagtgggtgcgccgagt (SEQ ID NO:8); and hGPAT3 reverse tgtcatccgtcctcttagctga (SEQ ID NO:9).

DGATl and GPATl cDNAs were cloned as previously described (Cao et al. (2004), supra; Cases et al., supra).

[0116] Mammalian expression vectors containing DGATl, FLAG-hGPAT4 (flag-tagged human GPAT4), hGPAT3 (human GPAT3), or hmtGPATl (human mitochondrial GPATl) were transiently transfected into HEK293 cells with FUGENE^® 6 according to the manufacturer's instruction (Roche Diagnostics, Nutley, NJ). Cells were collected for enzyme assay after 48 hours. FLAG- hGPAT4 was also overexpressed in Spodoptera frugiperda 9 (Sf9) insect cells as mentioned above. After infection with various recombinant baculoviruses for 65 h, Sf9 cells were harvested, lysed in PBS by sonication and subjected to in vitro GPAT assay. GPAT activity was assayed by measuring the incorporation of the acyl moiety from lauroyl-CoA into [¹⁴C]-glycerol 3-phosphate (G3P) to form [¹⁴C] 1-acyl-sn-glycerol 3-phosphate or LPA, detected by a thin layer chromatography (TLC) separation. The assay was conducted for 30 min at RT in a volume of 50 μl containing 25 μg of total protein, 75 mM Tris HCl, pH 7.5, 4 mM MgCl₂, lmg/ml fatty acid free BSA with 200 μM [¹⁴C]G3P (55 mCi/mmol) and 50 μM acyl-CoA as substrates. Lipids were extracted using chloroform:methanol (2:1, v/v), dried, and separated by TLC with chloroform:methanol: water (65:25:4, v/v) followed by exposure to a phosphorimager screen to visualize the radiolabeled products with a Bio-Rad scanner (Hercules, CA). Where indicated, cell lysates were incubated with or without 0.4 mM NEM for 15 min on ice prior to the initiation of reaction. [0117] Overexpression of hGPAT4, hGPAT3, and hmtGPATl in mammalian HEK293 cells led to increase in GPAT activity by 80%, 40%, and 160%, respectively, as compared with wild type control (empty vector) or cells transfected with a DGATl -containing vector (FIG.2A). Expression of hGPAT4 and hGPAT3 in Sf9 cells resulted in more profound increase in GPAT activity. As shown in FIG. 2B, the formation of LPA was enhanced 4.3- and 5.6-fold, respectively, in Sf9 cells overexpressing hGPAT4 and hGPAT3, as compared to wild type cells. The formation of LPA by hGPAT4 is dependent on the exogenously added acyl-Co A (note the absence of LPA in the last lane on right panel), indicating a substrate specificity of GPAT activity. These data demonstrate that GPAT4 encodes a protein with GPAT activity.

[0118] Similar to GPAT3, the GPAT activity conferred by overexpression of hGPAT4 was also sensitive to NEM treatment. As shown in FIG. 3, the increased GPAT activity in hGPAT4-overexpressing Sf9 cells was completely abolished by treatment with NEM (lane 4 vs. lane 2). Such an inactivation by NEM is consistent with the known NEM-scnsitivity of microsomal GPAT activity.

Example 3: Ectopic Expression of GPAT4 Activity Towards Lauroyl-CoA, Oleoyl-CoA, Linoleoyl-CoA, and Arachidonoyl-CoA

[0119] GPAT activities in Sf9 cells infected with wild type virus (Wild Type) and in cells infected with hGPAT4-virus (H.GPAT4) were examined regarding different acyl-CoA species. Assay conditions are the same as described for FIGs. 2 A and 2B. As shown in FIGs. 4 A and 4B, overexpression of hGPAT4 in Sf9 cells leads to increased GPAT activity relative to lauroyl-CoA, oleoyl- CoA, linoleoyl-CoA, and arachidonoyl-CoA. When palmitoyl-CoA is used as acyl donor, no increase in GPAT activity in cell lysates containing recombinant hGPAT4 is found compared with that from wild type virus-infected cells (virus does not carry an exogenous cDNA) (FΪG. 4B). The results additionally show that the long chain saturated arachidoyl-CoA (C20:0) is a poor acyl donor for hGPAT4 CFIG. 4BV Example 4: Tissue Distribution of GPAT4 mRNA in Mouse and Human

[0120] TAQMAN® real-time RT-PCR was used to study the expression of GPAT4 mRNA in normal human and mouse tissues obtained from Clontech (Mountain View, CA). Specific primer pairs for mouse and human GPAT4 and primers for 18S were obtained from PE Applied Biosystems (Foster City, CA). TAQMAN® real-time quantitative PCR (Q-PCR) was performed using an ABI PRISM ™ 7900 sequence detector (PE Applied Biosystems) with 18S as an internal control. Relative expression was determined by the Ct method (corrected by 18S, Applied Biosystems).

[0121] Mouse GPAT4 transcripts were expressed in a variety of tissues with the most abundant level in adipose tissue and liver (FIG. 5A)₅ which are involved in active lipid metabolism. In human, GPAT4 mRNA was also found to be widely expressed in many tissues. Among them, GPAT4 is abundantly expressed in brain, testis, adipose tissue, kidney, heart, skeletal muscle, lung, prostate, adrenal gland, and liver (FIG. 5B).

[0122] Undifferentiated and differentiated 3T3-L1 adipocytes, .tissues from normal, 8-12 week old male C57B1/6J mice, as well as tissues from 10-week old male ob/ob and age-matched wild type control mice were obtained as previously described (Lake et al. (2005) J. Lipid Res. 46:2477 '-87). For PPARγ agonist treatment, 10-week old male ob/ob mice were gavaged once a day with 15 mg/kg rosiglitazone or vehicle control for 21 days. TAQMAN® real-time PCR analysis was performed as described herein.

[0123] Unlike GPAT3, whose mRNA was increased 60-fold after differentiation of 3T3-L1 preadipocytes to adipocytes, GPAT4 mRNA was only moderately upregulated during this process (approximately 2-fold, FIG. 6A). In addition, no significant difference in GPAT4 mRNA expression level was observed in liver and adipose tissue between wild type and ob/ob mice (FIGs. 6B and 6C). GPAT4 mRNA expression in liver and adipose tissues did not show a response to treatment with rosiglitazone (Rosi), a potent PPARγ agonist (FIGs. 6D and 6E). Example.5: GPAT Activity Decreased with Deletion of Predicted Acyltransferase Domain

[0124] A truncated form of GPAT4 was detected in expression studies; this form (amino acids 1-207; "GPAT4-T207") was studied for GPAT activity by measuring formation of LPA. GP AT4-T207 does not include the predicted acyltransferase domain (see FIG. IA, boxed portion). FIGs. 7A and 7B show that GPAT4 activity was diminished with this truncated GPAT4 protein.

Example 6: Comparison of GPAT3 and GPAT4 mRNA in 3T3-L1 Adipocytes

[0125] GPAT3 and GPAT4 mRNA levels in differentiated 3T3-L1 adipocytes were measured by Taqman Q-PCR. Standard curves were generated using recombinant plasmids containing GPAT3 or GPAT4, and were used to calculate cDNA copy number per ng of RNA. Differentiated 3T3-L1 adipocytes contain similar amounts of GPAT3 and GPAT4 mRNA (FIG. 8).

Claims

WHAT IS CLAIMED IS:

1. A method for treating, ameliorating, or preventing a GPAT4-associated condition in a mammal comprising administering to the mammal a therapeutically effective amount of an agent that modulates the level of expression or activity of GPAT4 in the mammal.

2. The method as set forth in claim 1 , wherein the agent is selected from the group consisting of GPAT4 inhibitory polynucleotides or fragments thereof, GPAT4 inhibitory polypeptides or fragments thereof, antagonistic anti-GPAT4 antibodies, antagonistic anti-OPAT4 antibody fragments, and small molecules.

3. The method as set forth in claim 1 , wherein the agent is selected from the group consisting of GPAT4 polynucleotides or fragments thereof; polynucleotides that hybridize under high stringency conditions to a complement of the nucleic acid sequence or a fragment of the nucleic acid sequence as set forth in SEQ ID NO.l or SEQ ID NO.3, GPAT4 polypeptides or fragments thereof, polypeptides encoded by a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO:3, polypeptides encoded by a nucleic acid that hybridizes under high stringency conditions to a complement of the nucleic acid sequence or a fragment of the nucleic acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO:3, agonistic anti-GPAT4 antibodies, agonistic anti-GPAT4 antibody fragments, and small molecules.

4. A method for decreasing TAG synthesis and/or PA, LPA and/or DAG synthesis and/or accumulation in a cell or cell population, comprising contacting the cell or cell population with a GPAT4 antagonist in an amount sufficient to decrease the level of expression or activity of GPAT4 in the cell or cell population, wherein the GPAT4 antagonist is selected from the group consisting of GPAT4 inhibitory polynucleotides or fragments thereof, GPAT4 inhibitory polypeptides or fragments thereof, antagonistic anti-GPAT4 antibodies, antagonistic anti-GPAT4 antibody fragments, and small molecules.

5. A method for increasing TAG synthesis and/or PA, LPA and/or DAG synthesis and/or accumulation in a cell or cell population, comprising contacting the cell or cell population with a GPAT4 agonist in an amount sufficient to increase the level of expression or activity of GPAT4 in the cell or cell population, wherein the GP AT4 agonist is selected from the group consisting of GPAT4 polynucleotides or fragments thereof, polynucleotides that hybridize under high stringency conditions to a complement of the nucleic acid sequence or a fragment of the nucleic acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO:3, GPAT4 polypeptides or fragments thereof, polypeptides encoded by a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID N0:3, polypeptides encoded by a nucleic acid that hybridizes under high stringency conditions to a complement of the nucleic acid sequence or a fragment of the nucleic acid sequence as .set forth in SEQ ID NO:1 or SEQ ID NO:3, agonistic anti-GPAT4 antibodies, agonistic anti-GPAT4 antibody fragments, and small molecules.

6. A method for monitoring the course of a treatment of a GPAT4-associated condition in a patient, comprising:

(a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient;

(b) administering a GPAT4 antagonist to the patient; and

(c) measuring the- level of expression or activity of GPAT4 in a cell or sample of interest from the patient following administration of the GPAT4 antagonist, wherein a lower level of expression or activity of GPAT4 in the cell or sample of interest from the patient following administration of the.GPAT4 antagonist, in comparison to the level of expression or activity of GPAT4 in the cell or sample of interest from the patient prior to administration of the GPAT4 antagonist, provides a positive indication of the treatment of the GPAT4- associated condition in the patient.

7. A method for monitoring the course of a treatment of a GPAT4-associated condition in a patient, comprising:

(a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient;

(b) administering a GP AT4 agonist to the patient; and

(c) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient following administration of the GPAT4 agonist, wherein a greater level of expression or activity of GPAT4 in the cell or sample of interest from the patient following administration of the GPAT4 agonist, in comparison to the level of expression or activity of GPAT4 in the cell or sample of interest from the patient prior to administration of the GPAT4 agonist, provides a positive indication of the treatment of the GPAT4-associated condition in the patient.

8. A method for prognosing a GPAT4-associated condition in a patient, comprising:

(a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a first time point; and

(b) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient at a second time point, wherein a different level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the second time point, in comparison to the level of expression or activity of GPAT4 in the cell or sample of interest from the patient at the first time point, indicates a decreased likelihood that the patient will develop a more severe form of the GPAT4-associated condition.

9. A method for prognosing a GPAT4-associated condition in a patient, comprising:

(a) measuring the level of expression or activity of GPAT4 in a cell or sample of interest from the patient; and (b) comparing the level of expression or activity of GPAT4 in the cell or sample of interest to the level of expression or activity of GPAT4 in a reference cell or sample of interest, wherein a different level of expression or activity of GPAT4 in the cell or sample of interest from the patient, in comparison to the level of expression or activity of GPAT4 in the reference cell or sample, indicates a decreased likelihood that the patient will develop a more severe form of the GPAT4- associated condition.

10. A method of screening for a compound capable of modulating GPAT4 activity comprising the steps of:

(a) contacting a sample containing GPAT4 with a compound of interest; and

(b) determining whether the level of expression or activity of GPAT4 in the contacted sample is modulated relative to the level of expression or activity of GPAT4 in a sample not contacted with the compound, wherein a change in the level of expression or activity of GPAT4 in the contacted sample identifies the compound as a compound that is capable of modulating GPAT4 activity.

11. A pharmaceutical composition comprising a GPAT4 antagonist and a pharmaceutically acceptable carrier.

12. The pharmaceutical composition of claim 11, wherein the GPAT4 antagonist is selected from the group consisting of GPAT4 inhibitory polynucleotides or fragments thereof, GPAT4 inhibitory polypeptides or fragments thereof, antagonistic anti-GPAT4 antibodies, antagonistic anti-GPAT4 antibody fragments, and small molecules.

13. A pharmaceutical composition comprising a GPAT4 agonist and a pharmaceutically acceptable carrier.

14. The pharmaceutical composition of claim 13, wherein the GPAT4 agonist is selected from the group consisting of GPAT4 polynucleotides or fragments thereof, polynucleotides that hybridize under high stringency conditions to a complement of the nucleic acid sequence or a fragment of the nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, GPAT4 polypeptides or fragments thereof, polypeptides encoded by a nucleic acid sequence or a fragment of a nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, polypeptides encoded by a nucleic acid that hybridizes under high stringency conditions to a complement of the nucleic acid sequence or a fragment of the nucleic acid sequence as set forth in SEQ ID NO:1 or SEQ ID NO:3, agonistic anti-GPAT4 antibodies, agonistic anti-GPAT4 antibody fragments, and small molecules.

15. An antibody or antibody fragment that specifically binds a GPAT4 polypeptide or a fragment of a GPAT4 polypeptide.

16. The antibody or antibody fragment as set forth in claim 15; wherein the GPAT4 polypeptide is a mouse GPAT4 polypeptide or a human GPAT4 polypeptide.

17. The antibody or antibody fragment as set forth in claim 16, wherein the GPAT4 polypeptide comprises the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:4.

18. The antibody or antibody fragment as set forth in any one of claims 15-17, wherein the antibody antagonizes at least one GPAT4 activity.

19. The antibody or antibody fragment as set forth in any one of claims 15-17, wherein the antibody agonizes at least one GPAT4 activity.